>Feature sequence001 1062 160 gene locus_tag LOCUS_00010 1062 160 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_00010 1239 1994 gene locus_tag LOCUS_00020 1239 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3368 2157 gene locus_tag LOCUS_00030 3368 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3609 3803 gene locus_tag LOCUS_00040 3609 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3860 4060 gene locus_tag LOCUS_00050 3860 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4894 5394 gene locus_tag LOCUS_00060 4894 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5431 6756 gene locus_tag LOCUS_00070 gene pel 5431 6756 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_00070 7457 6864 gene locus_tag LOCUS_00080 7457 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8114 7683 gene locus_tag LOCUS_00090 8114 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9416 8358 gene locus_tag LOCUS_00100 9416 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966221.1 protein_id gnl|my_center|LOCUS_00100 10930 9506 gene locus_tag LOCUS_00110 10930 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14440 11309 gene locus_tag LOCUS_00120 gene czcA 14440 11309 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_00120 15678 14437 gene locus_tag LOCUS_00130 15678 14437 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123111.1 protein_id gnl|my_center|LOCUS_00130 16239 18341 gene locus_tag LOCUS_00140 16239 18341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18491 19063 gene locus_tag LOCUS_00150 18491 19063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19997 19098 gene locus_tag LOCUS_00160 19997 19098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20490 21395 gene locus_tag LOCUS_00170 gene gcvA 20490 21395 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071711.1 protein_id gnl|my_center|LOCUS_00170 21507 22475 gene locus_tag LOCUS_00180 21507 22475 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_00180 23549 22758 gene locus_tag LOCUS_00190 23549 22758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23906 23565 gene locus_tag LOCUS_00200 23906 23565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 24602 24180 gene locus_tag LOCUS_00210 24602 24180 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 protein_id gnl|my_center|LOCUS_00210 26692 24749 gene locus_tag LOCUS_00220 26692 24749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 29009 28293 gene locus_tag LOCUS_00230 29009 28293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30588 29353 gene locus_tag LOCUS_00240 30588 29353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 31188 30811 gene locus_tag LOCUS_00250 31188 30811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 31619 31185 gene locus_tag LOCUS_00260 31619 31185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 32148 31624 gene locus_tag LOCUS_00270 32148 31624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32504 32145 gene locus_tag LOCUS_00280 32504 32145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33478 32501 gene locus_tag LOCUS_00290 33478 32501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 33720 33475 gene locus_tag LOCUS_00300 33720 33475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 34265 33717 gene locus_tag LOCUS_00310 34265 33717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34519 34262 gene locus_tag LOCUS_00320 34519 34262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 35058 34516 gene locus_tag LOCUS_00330 35058 34516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 35750 35055 gene locus_tag LOCUS_00340 35750 35055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35998 35747 gene locus_tag LOCUS_00350 35998 35747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36525 35995 gene locus_tag LOCUS_00360 36525 35995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 36722 36522 gene locus_tag LOCUS_00370 36722 36522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 37171 36719 gene locus_tag LOCUS_00380 37171 36719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 37461 37171 gene locus_tag LOCUS_00390 37461 37171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 38027 37458 gene locus_tag LOCUS_00400 38027 37458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 39058 38024 gene locus_tag LOCUS_00410 39058 38024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 39915 39055 gene locus_tag LOCUS_00420 39915 39055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 41456 39972 gene locus_tag LOCUS_00430 41456 39972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 41716 41453 gene locus_tag LOCUS_00440 41716 41453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 41922 41713 gene locus_tag LOCUS_00450 41922 41713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 42173 41919 gene locus_tag LOCUS_00460 42173 41919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 42385 42170 gene locus_tag LOCUS_00470 42385 42170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 43000 42737 gene locus_tag LOCUS_00480 43000 42737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 43508 43014 gene locus_tag LOCUS_00490 43508 43014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 43697 44041 gene locus_tag LOCUS_00500 43697 44041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 44399 44737 gene locus_tag LOCUS_00510 44399 44737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 45795 44893 gene locus_tag LOCUS_00520 45795 44893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 45951 46955 gene locus_tag LOCUS_00530 45951 46955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 46948 48522 gene locus_tag LOCUS_00540 46948 48522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 48519 49133 gene locus_tag LOCUS_00550 48519 49133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 49130 49384 gene locus_tag LOCUS_00560 49130 49384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 49381 49623 gene locus_tag LOCUS_00570 49381 49623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 49620 49970 gene locus_tag LOCUS_00580 49620 49970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 49967 50245 gene locus_tag LOCUS_00590 49967 50245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 50245 50673 gene locus_tag LOCUS_00600 50245 50673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 50591 50923 gene locus_tag LOCUS_00610 50591 50923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 50920 51321 gene locus_tag LOCUS_00620 50920 51321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 51427 51636 gene locus_tag LOCUS_00630 51427 51636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 51636 51839 gene locus_tag LOCUS_00640 51636 51839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 51836 52090 gene locus_tag LOCUS_00650 51836 52090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 52170 52541 gene locus_tag LOCUS_00660 52170 52541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 52561 53229 gene locus_tag LOCUS_00670 52561 53229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 53226 53612 gene locus_tag LOCUS_00680 53226 53612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 53612 54025 gene locus_tag LOCUS_00690 53612 54025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 54209 54463 gene locus_tag LOCUS_00700 54209 54463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 54480 54740 gene locus_tag LOCUS_00710 54480 54740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 54751 54951 gene locus_tag LOCUS_00720 54751 54951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 54944 55180 gene locus_tag LOCUS_00730 54944 55180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 55167 55505 gene locus_tag LOCUS_00740 55167 55505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 55505 56140 gene locus_tag LOCUS_00750 55505 56140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 56144 57664 gene locus_tag LOCUS_00760 56144 57664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399999.1 protein_id gnl|my_center|LOCUS_00760 57839 59128 gene locus_tag LOCUS_00770 57839 59128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 59128 60129 gene locus_tag LOCUS_00780 59128 60129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 60143 61456 gene locus_tag LOCUS_00790 60143 61456 CDS product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336913.1 protein_id gnl|my_center|LOCUS_00790 61545 61979 gene locus_tag LOCUS_00800 61545 61979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 62040 62375 gene locus_tag LOCUS_00810 62040 62375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 62379 63035 gene locus_tag LOCUS_00820 62379 63035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 63035 63364 gene locus_tag LOCUS_00830 63035 63364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 63357 63773 gene locus_tag LOCUS_00840 63357 63773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 63770 64162 gene locus_tag LOCUS_00850 63770 64162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 64175 64576 gene locus_tag LOCUS_00860 64175 64576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 64633 65301 gene locus_tag LOCUS_00870 64633 65301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 65346 65909 gene locus_tag LOCUS_00880 65346 65909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 65915 66148 gene locus_tag LOCUS_00890 65915 66148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 66221 69247 gene locus_tag LOCUS_00900 66221 69247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 69251 69994 gene locus_tag LOCUS_00910 69251 69994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 69991 71946 gene locus_tag LOCUS_00920 69991 71946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 71957 72277 gene locus_tag LOCUS_00930 71957 72277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 72277 72651 gene locus_tag LOCUS_00940 72277 72651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 72651 73691 gene locus_tag LOCUS_00950 72651 73691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 73691 74077 gene locus_tag LOCUS_00960 73691 74077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 74074 74460 gene locus_tag LOCUS_00970 74074 74460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 74457 74789 gene locus_tag LOCUS_00980 74457 74789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 74786 75655 gene locus_tag LOCUS_00990 74786 75655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 75652 75924 gene locus_tag LOCUS_01000 75652 75924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 75924 76442 gene locus_tag LOCUS_01010 75924 76442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 76439 76834 gene locus_tag LOCUS_01020 76439 76834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 76848 77159 gene locus_tag LOCUS_01030 76848 77159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 77218 77958 gene locus_tag LOCUS_01040 77218 77958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 79251 78148 gene locus_tag LOCUS_01050 79251 78148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 79406 79834 gene locus_tag LOCUS_01060 79406 79834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 80358 80286 gene locus_tag LOCUS_t00010 80358 80286 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 80555 81259 gene locus_tag LOCUS_01070 80555 81259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 81329 83347 gene locus_tag LOCUS_01080 81329 83347 CDS product tyrosine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403601.1 protein_id gnl|my_center|LOCUS_01080 83596 84786 gene locus_tag LOCUS_01090 83596 84786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 84870 86903 gene locus_tag LOCUS_01100 84870 86903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 86996 88192 gene locus_tag LOCUS_01110 86996 88192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525235.1 protein_id gnl|my_center|LOCUS_01110 88748 88212 gene locus_tag LOCUS_01120 88748 88212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 90403 89213 gene locus_tag LOCUS_01130 90403 89213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 90882 90589 gene locus_tag LOCUS_01140 90882 90589 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_01140 92004 91072 gene locus_tag LOCUS_01150 92004 91072 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_01150 92611 92111 gene locus_tag LOCUS_01160 92611 92111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_01160 92992 93825 gene locus_tag LOCUS_01170 92992 93825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 93955 94446 gene locus_tag LOCUS_01180 93955 94446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 95024 96505 gene locus_tag LOCUS_01190 95024 96505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 96742 97467 gene locus_tag LOCUS_01200 96742 97467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 97477 98850 gene locus_tag LOCUS_01210 97477 98850 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_01210 99008 101341 gene locus_tag LOCUS_01220 99008 101341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 102647 101847 gene locus_tag LOCUS_01230 gene smuG1 102647 101847 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_01230 102861 103343 gene locus_tag LOCUS_01240 102861 103343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 103399 104760 gene locus_tag LOCUS_01250 103399 104760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 104845 106284 gene locus_tag LOCUS_01260 104845 106284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 106405 107544 gene locus_tag LOCUS_01270 106405 107544 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977648.1 protein_id gnl|my_center|LOCUS_01270 107736 110609 gene locus_tag LOCUS_01280 107736 110609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 111366 110656 gene locus_tag LOCUS_01290 111366 110656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 111762 114083 gene locus_tag LOCUS_01300 111762 114083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 114943 114182 gene locus_tag LOCUS_01310 114943 114182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 115545 115048 gene locus_tag LOCUS_01320 gene yitI 115545 115048 CDS product putative N-acetyltransferase YitI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06744 protein_id gnl|my_center|LOCUS_01320 115685 116863 gene locus_tag LOCUS_01330 115685 116863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 116972 117805 gene locus_tag LOCUS_01340 116972 117805 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027437.1 protein_id gnl|my_center|LOCUS_01340 117908 118504 gene locus_tag LOCUS_01350 117908 118504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 119349 118498 gene locus_tag LOCUS_01360 gene apaH 119349 118498 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FA03 protein_id gnl|my_center|LOCUS_01360 121471 119393 gene locus_tag LOCUS_01370 121471 119393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 123091 121499 gene locus_tag LOCUS_01380 123091 121499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 124388 123246 gene locus_tag LOCUS_01390 124388 123246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 126865 124535 gene locus_tag LOCUS_01400 126865 124535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 127248 129137 gene locus_tag LOCUS_01410 127248 129137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 129137 132550 gene locus_tag LOCUS_01420 129137 132550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142889.1 protein_id gnl|my_center|LOCUS_01420 132689 134956 gene locus_tag LOCUS_01430 132689 134956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 135093 137633 gene locus_tag LOCUS_01440 135093 137633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 138476 137802 gene locus_tag LOCUS_01450 138476 137802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 139418 138555 gene locus_tag LOCUS_01460 139418 138555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 140932 139562 gene locus_tag LOCUS_01470 140932 139562 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_01470 141212 142213 gene locus_tag LOCUS_01480 gene argF' 141212 142213 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J2 protein_id gnl|my_center|LOCUS_01480 142265 143488 gene locus_tag LOCUS_01490 gene argG 142265 143488 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J4 protein_id gnl|my_center|LOCUS_01490 143493 144614 gene locus_tag LOCUS_01500 gene argE 143493 144614 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037390.1 protein_id gnl|my_center|LOCUS_01500 144617 145936 gene locus_tag LOCUS_01510 gene argB 144617 145936 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J6 protein_id gnl|my_center|LOCUS_01510 146795 146025 gene locus_tag LOCUS_01520 146795 146025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 147929 146952 gene locus_tag LOCUS_01530 gene argC 147929 146952 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J8 protein_id gnl|my_center|LOCUS_01530 150058 147965 gene locus_tag LOCUS_01540 150058 147965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 150306 151556 gene locus_tag LOCUS_01550 gene argH 150306 151556 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J9 protein_id gnl|my_center|LOCUS_01550 151891 154023 gene locus_tag LOCUS_01560 151891 154023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 154131 155525 gene locus_tag LOCUS_01570 154131 155525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 157326 155527 gene locus_tag LOCUS_01580 157326 155527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 158590 157361 gene locus_tag LOCUS_01590 158590 157361 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968429.1 protein_id gnl|my_center|LOCUS_01590 159210 158587 gene locus_tag LOCUS_01600 159210 158587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 160634 159474 gene locus_tag LOCUS_01610 160634 159474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 162748 160688 gene locus_tag LOCUS_01620 162748 160688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 164361 162745 gene locus_tag LOCUS_01630 164361 162745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 165113 164478 gene locus_tag LOCUS_01640 165113 164478 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143855.1 protein_id gnl|my_center|LOCUS_01640 167749 165233 gene locus_tag LOCUS_01650 167749 165233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 168784 167945 gene locus_tag LOCUS_01660 gene menH 168784 167945 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBD4 protein_id gnl|my_center|LOCUS_01660 168843 169745 gene locus_tag LOCUS_01670 168843 169745 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706060.1 protein_id gnl|my_center|LOCUS_01670 169843 170841 gene locus_tag LOCUS_01680 169843 170841 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968518.1 protein_id gnl|my_center|LOCUS_01680 170853 172112 gene locus_tag LOCUS_01690 170853 172112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 173426 172152 gene locus_tag LOCUS_01700 173426 172152 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_01700 173655 174416 gene locus_tag LOCUS_01710 173655 174416 CDS product guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876603.1 protein_id gnl|my_center|LOCUS_01710 174666 178853 gene locus_tag LOCUS_01720 174666 178853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 181372 179006 gene locus_tag LOCUS_01730 181372 179006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 181479 182333 gene locus_tag LOCUS_01740 181479 182333 CDS product inward rectifier potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_01740 182459 184531 gene locus_tag LOCUS_01750 182459 184531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 186064 184616 gene locus_tag LOCUS_01760 186064 184616 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYU1 protein_id gnl|my_center|LOCUS_01760 186277 186351 gene locus_tag LOCUS_t00020 186277 186351 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 186726 188318 gene locus_tag LOCUS_01770 186726 188318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 188441 189238 gene locus_tag LOCUS_01780 188441 189238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 189283 190059 gene locus_tag LOCUS_01790 189283 190059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 190223 192328 gene locus_tag LOCUS_01800 190223 192328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 192723 196208 gene locus_tag LOCUS_01810 192723 196208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 196362 197627 gene locus_tag LOCUS_01820 196362 197627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 197776 198063 gene locus_tag LOCUS_01830 197776 198063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 198413 198676 gene locus_tag LOCUS_01840 198413 198676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 198870 201005 gene locus_tag LOCUS_01850 198870 201005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 202823 201270 gene locus_tag LOCUS_01860 202823 201270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 <207189 202879 gene locus_tag LOCUS_01870 <207189 202879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530879.1:membrane protein >Feature sequence002 1100 159 gene locus_tag LOCUS_01880 1100 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228113.1 protein_id gnl|my_center|LOCUS_01880 2173 1118 gene locus_tag LOCUS_01890 2173 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 2552 2626 gene locus_tag LOCUS_t00030 2552 2626 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3606 2779 gene locus_tag LOCUS_01900 3606 2779 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229113.1 protein_id gnl|my_center|LOCUS_01900 4268 3675 gene locus_tag LOCUS_01910 4268 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 5188 4424 gene locus_tag LOCUS_01920 5188 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 5345 6145 gene locus_tag LOCUS_01930 5345 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 6295 9768 gene locus_tag LOCUS_01940 6295 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 9887 10465 gene locus_tag LOCUS_01950 9887 10465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 11312 10452 gene locus_tag LOCUS_01960 11312 10452 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529052.1 protein_id gnl|my_center|LOCUS_01960 12580 11462 gene locus_tag LOCUS_01970 12580 11462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 13215 14321 gene locus_tag LOCUS_01980 13215 14321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 15942 14332 gene locus_tag LOCUS_01990 gene alkK 15942 14332 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_01990 16193 17782 gene locus_tag LOCUS_02000 16193 17782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 17893 17967 gene locus_tag LOCUS_t00040 17893 17967 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 18397 19173 gene locus_tag LOCUS_02010 18397 19173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 19207 20322 gene locus_tag LOCUS_02020 19207 20322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 20507 21577 gene locus_tag LOCUS_02030 20507 21577 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_02030 21856 25242 gene locus_tag LOCUS_02040 21856 25242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141887.1 protein_id gnl|my_center|LOCUS_02040 26849 25377 gene locus_tag LOCUS_02050 26849 25377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 27728 26868 gene locus_tag LOCUS_02060 27728 26868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 28441 27830 gene locus_tag LOCUS_02070 28441 27830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 29421 28861 gene locus_tag LOCUS_02080 29421 28861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 29698 30516 gene locus_tag LOCUS_02090 29698 30516 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_02090 30524 30964 gene locus_tag LOCUS_02100 30524 30964 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_02100 31119 31814 gene locus_tag LOCUS_02110 31119 31814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 31811 33832 gene locus_tag LOCUS_02120 31811 33832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 33961 35592 gene locus_tag LOCUS_02130 33961 35592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 35672 36619 gene locus_tag LOCUS_02140 35672 36619 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888088.1 protein_id gnl|my_center|LOCUS_02140 36619 37371 gene locus_tag LOCUS_02150 36619 37371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083640.1 protein_id gnl|my_center|LOCUS_02150 37426 38739 gene locus_tag LOCUS_02160 37426 38739 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_02160 39657 38746 gene locus_tag LOCUS_02170 39657 38746 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 protein_id gnl|my_center|LOCUS_02170 39828 41294 gene locus_tag LOCUS_02180 gene crtI 39828 41294 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_02180 41569 42189 gene locus_tag LOCUS_02190 41569 42189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 42238 44667 gene locus_tag LOCUS_02200 42238 44667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 45995 44655 gene locus_tag LOCUS_02210 45995 44655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119646.1 protein_id gnl|my_center|LOCUS_02210 46170 47330 gene locus_tag LOCUS_02220 46170 47330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 47502 48785 gene locus_tag LOCUS_02230 47502 48785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 50026 48950 gene locus_tag LOCUS_02240 50026 48950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 50364 51854 gene locus_tag LOCUS_02250 50364 51854 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_02250 51864 53360 gene locus_tag LOCUS_02260 gene mmsA 51864 53360 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208096.1 protein_id gnl|my_center|LOCUS_02260 53429 54748 gene locus_tag LOCUS_02270 53429 54748 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_02270 54773 56089 gene locus_tag LOCUS_02280 54773 56089 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969941.1 protein_id gnl|my_center|LOCUS_02280 56091 57362 gene locus_tag LOCUS_02290 56091 57362 CDS product dihydropyrimidine dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_02290 57574 58128 gene locus_tag LOCUS_02300 57574 58128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 60534 58261 gene locus_tag LOCUS_02310 60534 58261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 62145 60637 gene locus_tag LOCUS_02320 62145 60637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 62359 63486 gene locus_tag LOCUS_02330 62359 63486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_02330 63483 63926 gene locus_tag LOCUS_02340 63483 63926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 64236 65006 gene locus_tag LOCUS_02350 64236 65006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 65624 65208 gene locus_tag LOCUS_02360 65624 65208 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256880.1 protein_id gnl|my_center|LOCUS_02360 67558 65651 gene locus_tag LOCUS_02370 67558 65651 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530092.1 protein_id gnl|my_center|LOCUS_02370 67816 69336 gene locus_tag LOCUS_02380 67816 69336 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727729.1 protein_id gnl|my_center|LOCUS_02380 69336 69725 gene locus_tag LOCUS_02390 69336 69725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701719.1 protein_id gnl|my_center|LOCUS_02390 70005 71144 gene locus_tag LOCUS_02400 70005 71144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199806.1 protein_id gnl|my_center|LOCUS_02400 71141 73006 gene locus_tag LOCUS_02410 71141 73006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 73003 74187 gene locus_tag LOCUS_02420 73003 74187 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388449.1 protein_id gnl|my_center|LOCUS_02420 74184 75311 gene locus_tag LOCUS_02430 gene cyaA 74184 75311 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123079.1 protein_id gnl|my_center|LOCUS_02430 77486 75378 gene locus_tag LOCUS_02440 77486 75378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 80024 77802 gene locus_tag LOCUS_02450 80024 77802 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_02450 80570 80379 gene locus_tag LOCUS_02460 80570 80379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 80523 82847 gene locus_tag LOCUS_02470 80523 82847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 84836 83019 gene locus_tag LOCUS_02480 84836 83019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 85275 87272 gene locus_tag LOCUS_02490 85275 87272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 87275 88366 gene locus_tag LOCUS_02500 87275 88366 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_02500 89236 88358 gene locus_tag LOCUS_02510 89236 88358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 90368 89229 gene locus_tag LOCUS_02520 90368 89229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 90595 91632 gene locus_tag LOCUS_02530 90595 91632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 91670 92653 gene locus_tag LOCUS_02540 91670 92653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 92819 94000 gene locus_tag LOCUS_02550 gene ivd 92819 94000 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202093.1 protein_id gnl|my_center|LOCUS_02550 94154 95473 gene locus_tag LOCUS_02560 94154 95473 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405421.1 protein_id gnl|my_center|LOCUS_02560 95488 97140 gene locus_tag LOCUS_02570 95488 97140 CDS product type II DNA modification methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_720343.1 protein_id gnl|my_center|LOCUS_02570 97945 97142 gene locus_tag LOCUS_02580 97945 97142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 98041 99060 gene locus_tag LOCUS_02590 98041 99060 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255958.1 protein_id gnl|my_center|LOCUS_02590 104076 99064 gene locus_tag LOCUS_02600 104076 99064 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USG5 protein_id gnl|my_center|LOCUS_02600 104446 104913 gene locus_tag LOCUS_02610 104446 104913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 104922 106085 gene locus_tag LOCUS_02620 104922 106085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 107289 106090 gene locus_tag LOCUS_02630 107289 106090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 108362 107436 gene locus_tag LOCUS_02640 108362 107436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 109694 108366 gene locus_tag LOCUS_02650 109694 108366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119021.1 protein_id gnl|my_center|LOCUS_02650 111370 109694 gene locus_tag LOCUS_02660 111370 109694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 111802 112428 gene locus_tag LOCUS_02670 111802 112428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 113204 112440 gene locus_tag LOCUS_02680 113204 112440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 113309 114202 gene locus_tag LOCUS_02690 gene menB 113309 114202 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8C7 protein_id gnl|my_center|LOCUS_02690 114241 114639 gene locus_tag LOCUS_02700 114241 114639 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071479.1 protein_id gnl|my_center|LOCUS_02700 115179 115925 gene locus_tag LOCUS_02710 115179 115925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 116106 119279 gene locus_tag LOCUS_02720 116106 119279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 119384 120589 gene locus_tag LOCUS_02730 119384 120589 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_02730 120724 122730 gene locus_tag LOCUS_02740 120724 122730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 123811 122717 gene locus_tag LOCUS_02750 gene jmjD5 123811 122717 CDS product aspartate beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207486.1 protein_id gnl|my_center|LOCUS_02750 124434 123862 gene locus_tag LOCUS_02760 124434 123862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 126346 124682 gene locus_tag LOCUS_02770 126346 124682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 126692 126375 gene locus_tag LOCUS_02780 126692 126375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 128092 126875 gene locus_tag LOCUS_02790 128092 126875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 128510 132028 gene locus_tag LOCUS_02800 128510 132028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 132127 133983 gene locus_tag LOCUS_02810 132127 133983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65531 protein_id gnl|my_center|LOCUS_02810 134164 135084 gene locus_tag LOCUS_02820 134164 135084 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939346.1 protein_id gnl|my_center|LOCUS_02820 135406 135089 gene locus_tag LOCUS_02830 135406 135089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 136383 135517 gene locus_tag LOCUS_02840 136383 135517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 137248 136391 gene locus_tag LOCUS_02850 137248 136391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 138029 137334 gene locus_tag LOCUS_02860 138029 137334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 139045 138029 gene locus_tag LOCUS_02870 139045 138029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 139965 139261 gene locus_tag LOCUS_02880 139965 139261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 141039 140095 gene locus_tag LOCUS_02890 141039 140095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 147133 141452 gene locus_tag LOCUS_02900 147133 141452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 149172 147553 gene locus_tag LOCUS_02910 149172 147553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 150717 149176 gene locus_tag LOCUS_02920 150717 149176 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_02920 151047 153308 gene locus_tag LOCUS_02930 151047 153308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 153475 154455 gene locus_tag LOCUS_02940 153475 154455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 155670 154465 gene locus_tag LOCUS_02950 gene cypA 155670 154465 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240954.1 protein_id gnl|my_center|LOCUS_02950 156462 155674 gene locus_tag LOCUS_02960 156462 155674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 158727 156625 gene locus_tag LOCUS_02970 gene fusA 158727 156625 CDS product elongation factor G 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30913 protein_id gnl|my_center|LOCUS_02970 159182 160162 gene locus_tag LOCUS_02980 159182 160162 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_02980 160207 161313 gene locus_tag LOCUS_02990 160207 161313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 161862 161317 gene locus_tag LOCUS_03000 161862 161317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 162064 163050 gene locus_tag LOCUS_03010 162064 163050 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_03010 163096 164649 gene locus_tag LOCUS_03020 163096 164649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 164842 166134 gene locus_tag LOCUS_03030 164842 166134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 166375 168459 gene locus_tag LOCUS_03040 166375 168459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 168456 170021 gene locus_tag LOCUS_03050 168456 170021 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104986.1 protein_id gnl|my_center|LOCUS_03050 170469 173867 gene locus_tag LOCUS_03060 170469 173867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 174076 174528 gene locus_tag LOCUS_03070 174076 174528 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326711.1 protein_id gnl|my_center|LOCUS_03070 174661 176166 gene locus_tag LOCUS_03080 174661 176166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence003 230 1711 gene locus_tag LOCUS_03090 230 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 1786 3120 gene locus_tag LOCUS_03100 1786 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 3472 5577 gene locus_tag LOCUS_03110 3472 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 5577 6905 gene locus_tag LOCUS_03120 5577 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 6902 7819 gene locus_tag LOCUS_03130 6902 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 7816 9483 gene locus_tag LOCUS_03140 7816 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 10481 9924 gene locus_tag LOCUS_03150 10481 9924 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704788.1 protein_id gnl|my_center|LOCUS_03150 10674 10859 gene locus_tag LOCUS_03160 10674 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 10913 11695 gene locus_tag LOCUS_03170 10913 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 12308 11901 gene locus_tag LOCUS_03180 12308 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 12473 13282 gene locus_tag LOCUS_03190 12473 13282 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_03190 13303 13833 gene locus_tag LOCUS_03200 13303 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 15678 13837 gene locus_tag LOCUS_03210 15678 13837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 16479 16829 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaacgtcccagctttggcg 17003 18058 gene locus_tag LOCUS_03220 17003 18058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 18051 19115 gene locus_tag LOCUS_03230 18051 19115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 19265 20020 gene locus_tag LOCUS_03240 19265 20020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 21196 20063 gene locus_tag LOCUS_03250 21196 20063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 21868 21203 gene locus_tag LOCUS_03260 21868 21203 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977395.1 protein_id gnl|my_center|LOCUS_03260 22147 23001 gene locus_tag LOCUS_03270 22147 23001 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028208.1 protein_id gnl|my_center|LOCUS_03270 24144 25175 gene locus_tag LOCUS_03280 24144 25175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 25343 25771 gene locus_tag LOCUS_03290 25343 25771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 26050 27660 gene locus_tag LOCUS_03300 26050 27660 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026866.1 protein_id gnl|my_center|LOCUS_03300 27745 35172 gene locus_tag LOCUS_03310 27745 35172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 35337 44402 gene locus_tag LOCUS_03320 35337 44402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 44497 49467 gene locus_tag LOCUS_03330 44497 49467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 50242 50922 gene locus_tag LOCUS_03340 50242 50922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 51909 50971 gene locus_tag LOCUS_03350 51909 50971 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312781.1 protein_id gnl|my_center|LOCUS_03350 52080 52517 gene locus_tag LOCUS_03360 52080 52517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 52625 53611 gene locus_tag LOCUS_03370 52625 53611 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082510.1 protein_id gnl|my_center|LOCUS_03370 53857 55350 gene locus_tag LOCUS_03380 53857 55350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 55350 56378 gene locus_tag LOCUS_03390 55350 56378 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261387.1 protein_id gnl|my_center|LOCUS_03390 56381 57382 gene locus_tag LOCUS_03400 gene gshB 56381 57382 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CU65 protein_id gnl|my_center|LOCUS_03400 58840 57689 gene locus_tag LOCUS_03410 58840 57689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 59031 59801 gene locus_tag LOCUS_03420 59031 59801 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_03420 62156 59802 gene locus_tag LOCUS_03430 62156 59802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 62524 64512 gene locus_tag LOCUS_03440 62524 64512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 64525 64908 gene locus_tag LOCUS_03450 64525 64908 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_03450 65770 64913 gene locus_tag LOCUS_03460 65770 64913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 65943 66623 gene locus_tag LOCUS_03470 65943 66623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 67634 66627 gene locus_tag LOCUS_03480 67634 66627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 69599 67800 gene locus_tag LOCUS_03490 gene typA 69599 67800 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_03490 69956 70546 gene locus_tag LOCUS_03500 69956 70546 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYU4 protein_id gnl|my_center|LOCUS_03500 70760 71515 gene locus_tag LOCUS_03510 70760 71515 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027142.1 protein_id gnl|my_center|LOCUS_03510 71629 72813 gene locus_tag LOCUS_03520 71629 72813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 73191 72886 gene locus_tag LOCUS_03530 gene rpsN 73191 72886 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6W9 protein_id gnl|my_center|LOCUS_03530 74509 73346 gene locus_tag LOCUS_03540 74509 73346 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776765.1 protein_id gnl|my_center|LOCUS_03540 74760 76250 gene locus_tag LOCUS_03550 74760 76250 CDS product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229439.1 protein_id gnl|my_center|LOCUS_03550 76284 76892 gene locus_tag LOCUS_03560 76284 76892 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031175.1 protein_id gnl|my_center|LOCUS_03560 77595 76906 gene locus_tag LOCUS_03570 77595 76906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 81402 77614 gene locus_tag LOCUS_03580 81402 77614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 83585 81543 gene locus_tag LOCUS_03590 83585 81543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 85456 83693 gene locus_tag LOCUS_03600 85456 83693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 86322 85723 gene locus_tag LOCUS_03610 86322 85723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 86541 87785 gene locus_tag LOCUS_03620 86541 87785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 87931 88293 gene locus_tag LOCUS_03630 87931 88293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 88542 89765 gene locus_tag LOCUS_03640 88542 89765 CDS product perosamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807055.1 protein_id gnl|my_center|LOCUS_03640 89762 91174 gene locus_tag LOCUS_03650 89762 91174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 91342 91881 gene locus_tag LOCUS_03660 91342 91881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 92061 92555 gene locus_tag LOCUS_03670 92061 92555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 92552 93523 gene locus_tag LOCUS_03680 92552 93523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 93559 94452 gene locus_tag LOCUS_03690 93559 94452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 94467 95393 gene locus_tag LOCUS_03700 94467 95393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 95723 95992 gene locus_tag LOCUS_03710 95723 95992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 96767 96943 gene locus_tag LOCUS_03720 96767 96943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 97584 96940 gene locus_tag LOCUS_03730 97584 96940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 100046 97584 gene locus_tag LOCUS_03740 100046 97584 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257049.1 protein_id gnl|my_center|LOCUS_03740 100720 100130 gene locus_tag LOCUS_03750 100720 100130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 102889 101582 gene locus_tag LOCUS_03760 102889 101582 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978098.1 protein_id gnl|my_center|LOCUS_03760 103811 102978 gene locus_tag LOCUS_03770 103811 102978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 104862 103918 gene locus_tag LOCUS_03780 104862 103918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 105428 105054 gene locus_tag LOCUS_03790 105428 105054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 106413 105466 gene locus_tag LOCUS_03800 106413 105466 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546428.1 protein_id gnl|my_center|LOCUS_03800 106783 108759 gene locus_tag LOCUS_03810 106783 108759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 108993 114992 gene locus_tag LOCUS_03820 108993 114992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204835.1 protein_id gnl|my_center|LOCUS_03820 115487 120463 gene locus_tag LOCUS_03830 115487 120463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 120460 121149 gene locus_tag LOCUS_03840 120460 121149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 124111 121910 gene locus_tag LOCUS_03850 124111 121910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 124733 124302 gene locus_tag LOCUS_03860 124733 124302 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_03860 125105 125551 gene locus_tag LOCUS_03870 125105 125551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 126017 126871 gene locus_tag LOCUS_03880 126017 126871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 127029 127580 gene locus_tag LOCUS_03890 127029 127580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 128224 127640 gene locus_tag LOCUS_03900 128224 127640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 128822 128316 gene locus_tag LOCUS_03910 128822 128316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 129171 128935 gene locus_tag LOCUS_03920 129171 128935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 129900 129268 gene locus_tag LOCUS_03930 129900 129268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 131672 129891 gene locus_tag LOCUS_03940 131672 129891 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_03940 131836 132444 gene locus_tag LOCUS_03950 131836 132444 CDS product ribosomal-protein-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481806.1 protein_id gnl|my_center|LOCUS_03950 135538 132437 gene locus_tag LOCUS_03960 gene dnaE2 135538 132437 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3H9 protein_id gnl|my_center|LOCUS_03960 137038 135557 gene locus_tag LOCUS_03970 137038 135557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 137938 137222 gene locus_tag LOCUS_03980 137938 137222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 140341 137972 gene locus_tag LOCUS_03990 140341 137972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 141201 140446 gene locus_tag LOCUS_04000 141201 140446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 142898 141237 gene locus_tag LOCUS_04010 142898 141237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 144195 143125 gene locus_tag LOCUS_04020 gene rsgA 144195 143125 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFS8 protein_id gnl|my_center|LOCUS_04020 144887 146080 gene locus_tag LOCUS_04030 144887 146080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 146093 147094 gene locus_tag LOCUS_04040 146093 147094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 147153 147797 gene locus_tag LOCUS_04050 147153 147797 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_04050 147794 148426 gene locus_tag LOCUS_04060 147794 148426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 148508 148720 gene locus_tag LOCUS_04070 148508 148720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 148788 151562 gene locus_tag LOCUS_04080 148788 151562 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_04080 152306 151623 gene locus_tag LOCUS_04090 152306 151623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 153196 152309 gene locus_tag LOCUS_04100 153196 152309 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_04100 153521 154081 gene locus_tag LOCUS_04110 153521 154081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 155470 154763 gene locus_tag LOCUS_04120 155470 154763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 155694 155491 gene locus_tag LOCUS_04130 155694 155491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 158535 155761 gene locus_tag LOCUS_04140 158535 155761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 158988 160109 gene locus_tag LOCUS_04150 158988 160109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 160271 162529 gene locus_tag LOCUS_04160 160271 162529 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_04160 163414 162671 gene locus_tag LOCUS_04170 163414 162671 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_04170 163761 164642 gene locus_tag LOCUS_04180 gene cysE 163761 164642 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937965.1 protein_id gnl|my_center|LOCUS_04180 164704 165726 gene locus_tag LOCUS_04190 gene cysK 164704 165726 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087225.1 protein_id gnl|my_center|LOCUS_04190 165749 165952 gene locus_tag LOCUS_04200 165749 165952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 >Feature sequence004 206 1456 gene locus_tag LOCUS_04210 206 1456 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268185.1 protein_id gnl|my_center|LOCUS_04210 2634 1492 gene locus_tag LOCUS_04220 2634 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 2829 4298 gene locus_tag LOCUS_04230 2829 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 4316 5113 gene locus_tag LOCUS_04240 4316 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 5156 5953 gene locus_tag LOCUS_04250 5156 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 7540 5957 gene locus_tag LOCUS_04260 7540 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 8714 7659 gene locus_tag LOCUS_04270 8714 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 9549 9043 gene locus_tag LOCUS_04280 9549 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 11068 9689 gene locus_tag LOCUS_04290 11068 9689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 11396 11827 gene locus_tag LOCUS_04300 11396 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 13707 11938 gene locus_tag LOCUS_04310 13707 11938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 13944 14672 gene locus_tag LOCUS_04320 13944 14672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 14706 15650 gene locus_tag LOCUS_04330 14706 15650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 16206 15742 gene locus_tag LOCUS_04340 16206 15742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 16373 17179 gene locus_tag LOCUS_04350 16373 17179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 17207 17686 gene locus_tag LOCUS_04360 17207 17686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 17718 19484 gene locus_tag LOCUS_04370 17718 19484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 20521 19625 gene locus_tag LOCUS_04380 20521 19625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 20682 23903 gene locus_tag LOCUS_04390 20682 23903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 24173 25558 gene locus_tag LOCUS_04400 24173 25558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 25692 26288 gene locus_tag LOCUS_04410 25692 26288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 28775 26325 gene locus_tag LOCUS_04420 28775 26325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 29591 29163 gene locus_tag LOCUS_04430 29591 29163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 29780 30460 gene locus_tag LOCUS_04440 29780 30460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 32728 30464 gene locus_tag LOCUS_04450 32728 30464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 33685 33017 gene locus_tag LOCUS_04460 33685 33017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 33922 35625 gene locus_tag LOCUS_04470 33922 35625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 35780 36445 gene locus_tag LOCUS_04480 35780 36445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696151.1 protein_id gnl|my_center|LOCUS_04480 36445 38055 gene locus_tag LOCUS_04490 36445 38055 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218639.1 protein_id gnl|my_center|LOCUS_04490 39901 38069 gene locus_tag LOCUS_04500 39901 38069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 41039 40194 gene locus_tag LOCUS_04510 41039 40194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 44924 41265 gene locus_tag LOCUS_04520 44924 41265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 45048 46628 gene locus_tag LOCUS_04530 45048 46628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 48599 46728 gene locus_tag LOCUS_04540 48599 46728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 50467 48698 gene locus_tag LOCUS_04550 50467 48698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 50727 50575 gene locus_tag LOCUS_04560 50727 50575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 50680 51270 gene locus_tag LOCUS_04570 50680 51270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 51368 53281 gene locus_tag LOCUS_04580 51368 53281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 53655 54974 gene locus_tag LOCUS_04590 53655 54974 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385652.1 protein_id gnl|my_center|LOCUS_04590 55191 56348 gene locus_tag LOCUS_04600 55191 56348 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974637.1 protein_id gnl|my_center|LOCUS_04600 58252 56354 gene locus_tag LOCUS_04610 58252 56354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 58540 58280 gene locus_tag LOCUS_04620 58540 58280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 58942 58661 gene locus_tag LOCUS_04630 58942 58661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 59823 58939 gene locus_tag LOCUS_04640 59823 58939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 60757 59870 gene locus_tag LOCUS_04650 60757 59870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 61486 60767 gene locus_tag LOCUS_04660 61486 60767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 61987 63810 gene locus_tag LOCUS_04670 61987 63810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 63926 64906 gene locus_tag LOCUS_04680 63926 64906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057104.1 protein_id gnl|my_center|LOCUS_04680 65015 66436 gene locus_tag LOCUS_04690 65015 66436 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228250.1 protein_id gnl|my_center|LOCUS_04690 66681 67085 gene locus_tag LOCUS_04700 66681 67085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 67277 67660 gene locus_tag LOCUS_04710 67277 67660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 67728 69281 gene locus_tag LOCUS_04720 67728 69281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 70445 69420 gene locus_tag LOCUS_04730 70445 69420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 72402 70477 gene locus_tag LOCUS_04740 72402 70477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 72663 76607 gene locus_tag LOCUS_04750 72663 76607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 77309 77878 gene locus_tag LOCUS_04760 77309 77878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 77973 78365 gene locus_tag LOCUS_04770 gene mecI 77973 78365 CDS product methicillin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035303.1 protein_id gnl|my_center|LOCUS_04770 78362 79348 gene locus_tag LOCUS_04780 78362 79348 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228279.1 protein_id gnl|my_center|LOCUS_04780 79505 80668 gene locus_tag LOCUS_04790 79505 80668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 80670 82307 gene locus_tag LOCUS_04800 80670 82307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 82318 85431 gene locus_tag LOCUS_04810 82318 85431 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_04810 85485 85955 gene locus_tag LOCUS_04820 85485 85955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 87641 85959 gene locus_tag LOCUS_04830 87641 85959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 88486 87641 gene locus_tag LOCUS_04840 88486 87641 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_04840 88993 90153 gene locus_tag LOCUS_04850 88993 90153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 91008 90262 gene locus_tag LOCUS_04860 91008 90262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 92165 91005 gene locus_tag LOCUS_04870 92165 91005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 92416 92880 gene locus_tag LOCUS_04880 92416 92880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 93673 92903 gene locus_tag LOCUS_04890 93673 92903 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028999.1 protein_id gnl|my_center|LOCUS_04890 93823 94377 gene locus_tag LOCUS_04900 93823 94377 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_04900 94567 98199 gene locus_tag LOCUS_04910 gene dnaE 94567 98199 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB6 protein_id gnl|my_center|LOCUS_04910 99155 98256 gene locus_tag LOCUS_04920 99155 98256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226431.1 protein_id gnl|my_center|LOCUS_04920 100173 99157 gene locus_tag LOCUS_04930 100173 99157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226432.1 protein_id gnl|my_center|LOCUS_04930 101011 100415 gene locus_tag LOCUS_04940 101011 100415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 101297 101040 gene locus_tag LOCUS_04950 101297 101040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 101379 102404 gene locus_tag LOCUS_04960 gene fabH2 101379 102404 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_04960 102664 104685 gene locus_tag LOCUS_04970 102664 104685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 105446 104835 gene locus_tag LOCUS_04980 gene sodA 105446 104835 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54375 protein_id gnl|my_center|LOCUS_04980 105875 106465 gene locus_tag LOCUS_04990 105875 106465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 107815 106547 gene locus_tag LOCUS_05000 107815 106547 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532138.1 protein_id gnl|my_center|LOCUS_05000 108770 108018 gene locus_tag LOCUS_05010 108770 108018 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_05010 109635 109039 gene locus_tag LOCUS_05020 109635 109039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 109825 111375 gene locus_tag LOCUS_05030 109825 111375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 111913 111386 gene locus_tag LOCUS_05040 111913 111386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 114270 111910 gene locus_tag LOCUS_05050 114270 111910 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765027.1 protein_id gnl|my_center|LOCUS_05050 114758 114345 gene locus_tag LOCUS_05060 114758 114345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 115573 114755 gene locus_tag LOCUS_05070 115573 114755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 116054 117049 gene locus_tag LOCUS_05080 116054 117049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 117198 118241 gene locus_tag LOCUS_05090 117198 118241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 118422 119933 gene locus_tag LOCUS_05100 118422 119933 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKK9 protein_id gnl|my_center|LOCUS_05100 120268 120867 gene locus_tag LOCUS_05110 120268 120867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 120952 122811 gene locus_tag LOCUS_05120 gene uvrC 120952 122811 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747I7 protein_id gnl|my_center|LOCUS_05120 123144 122815 gene locus_tag LOCUS_05130 123144 122815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 123797 123207 gene locus_tag LOCUS_05140 123797 123207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705801.1 protein_id gnl|my_center|LOCUS_05140 125556 124060 gene locus_tag LOCUS_05150 gene dacC 125556 124060 CDS product D-alanyl-D-alanine carboxypeptidase DacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39844 protein_id gnl|my_center|LOCUS_05150 126212 125724 gene locus_tag LOCUS_05160 126212 125724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 126775 126209 gene locus_tag LOCUS_05170 126775 126209 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_05170 127979 126951 gene locus_tag LOCUS_05180 127979 126951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 128273 128911 gene locus_tag LOCUS_05190 128273 128911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 129360 128947 gene locus_tag LOCUS_05200 129360 128947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 129820 132318 gene locus_tag LOCUS_05210 129820 132318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 132451 133842 gene locus_tag LOCUS_05220 132451 133842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 133950 134657 gene locus_tag LOCUS_05230 133950 134657 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_05230 135338 134664 gene locus_tag LOCUS_05240 135338 134664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 135973 136500 gene locus_tag LOCUS_05250 135973 136500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 136724 137710 gene locus_tag LOCUS_05260 136724 137710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 137720 139909 gene locus_tag LOCUS_05270 137720 139909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 140046 141371 gene locus_tag LOCUS_05280 140046 141371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 141617 142975 gene locus_tag LOCUS_05290 141617 142975 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805147.1 protein_id gnl|my_center|LOCUS_05290 142994 144010 gene locus_tag LOCUS_05300 142994 144010 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259366.1 protein_id gnl|my_center|LOCUS_05300 144065 144976 gene locus_tag LOCUS_05310 gene oleB 144065 144976 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_05310 146185 145040 gene locus_tag LOCUS_05320 146185 145040 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_05320 148575 146890 gene locus_tag LOCUS_05330 148575 146890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889608.1 protein_id gnl|my_center|LOCUS_05330 148944 150794 gene locus_tag LOCUS_05340 gene glmS 148944 150794 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GH6 protein_id gnl|my_center|LOCUS_05340 151093 151911 gene locus_tag LOCUS_05350 151093 151911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 151908 152339 gene locus_tag LOCUS_05360 151908 152339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 152343 152600 gene locus_tag LOCUS_05370 152343 152600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 153273 152653 gene locus_tag LOCUS_05380 gene thiE 153273 152653 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A8 protein_id gnl|my_center|LOCUS_05380 >Feature sequence005 594 4265 gene locus_tag LOCUS_05390 594 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 6248 4359 gene locus_tag LOCUS_05400 6248 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 6759 7484 gene locus_tag LOCUS_05410 6759 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 7791 9158 gene locus_tag LOCUS_05420 7791 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 9443 10195 gene locus_tag LOCUS_05430 9443 10195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 11219 10242 gene locus_tag LOCUS_05440 11219 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 13369 11216 gene locus_tag LOCUS_05450 13369 11216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 17398 13724 gene locus_tag LOCUS_05460 gene mfd 17398 13724 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H75 protein_id gnl|my_center|LOCUS_05460 19564 18512 gene locus_tag LOCUS_05470 19564 18512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 20079 19672 gene locus_tag LOCUS_05480 20079 19672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 20272 21462 gene locus_tag LOCUS_05490 20272 21462 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414924.1 protein_id gnl|my_center|LOCUS_05490 21564 22799 gene locus_tag LOCUS_05500 21564 22799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 22887 24623 gene locus_tag LOCUS_05510 22887 24623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 24675 25022 gene locus_tag LOCUS_05520 24675 25022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 25427 26032 gene locus_tag LOCUS_05530 gene infC 25427 26032 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D03 protein_id gnl|my_center|LOCUS_05530 26476 26673 gene locus_tag LOCUS_05540 26476 26673 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_05540 26928 27233 gene locus_tag LOCUS_05550 gene rplT 26928 27233 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKP6 protein_id gnl|my_center|LOCUS_05550 27545 28582 gene locus_tag LOCUS_05560 gene pheS 27545 28582 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D00 protein_id gnl|my_center|LOCUS_05560 28703 31177 gene locus_tag LOCUS_05570 gene pheT 28703 31177 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ9 protein_id gnl|my_center|LOCUS_05570 31648 31941 gene locus_tag LOCUS_05580 gene ihfA-2 31648 31941 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BC1 protein_id gnl|my_center|LOCUS_05580 32130 32939 gene locus_tag LOCUS_05590 32130 32939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 33563 35164 gene locus_tag LOCUS_05600 gene rpoD 33563 35164 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B8 protein_id gnl|my_center|LOCUS_05600 35414 35848 gene locus_tag LOCUS_05610 35414 35848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 36212 39637 gene locus_tag LOCUS_05620 36212 39637 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_05620 39651 41111 gene locus_tag LOCUS_05630 39651 41111 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_05630 41177 42319 gene locus_tag LOCUS_05640 41177 42319 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_05640 43261 42527 gene locus_tag LOCUS_05650 43261 42527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 45349 43388 gene locus_tag LOCUS_05660 45349 43388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 46073 45507 gene locus_tag LOCUS_05670 46073 45507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 46165 45968 gene locus_tag LOCUS_05680 46165 45968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 46354 46172 gene locus_tag LOCUS_05690 46354 46172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 49442 47427 gene locus_tag LOCUS_05700 49442 47427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 49612 50742 gene locus_tag LOCUS_05710 49612 50742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 51159 52898 gene locus_tag LOCUS_05720 51159 52898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 53146 55260 gene locus_tag LOCUS_05730 gene lcrD 53146 55260 CDS product low calcium response locus protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69955 protein_id gnl|my_center|LOCUS_05730 56402 55347 gene locus_tag LOCUS_05740 56402 55347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 56656 57708 gene locus_tag LOCUS_05750 56656 57708 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_05750 57888 58547 gene locus_tag LOCUS_05760 57888 58547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 59550 58681 gene locus_tag LOCUS_05770 gene bioH 59550 58681 CDS product O-methylpimelyl-ACP methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943266.1 protein_id gnl|my_center|LOCUS_05770 60126 59557 gene locus_tag LOCUS_05780 gene pyrE 60126 59557 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727B2 protein_id gnl|my_center|LOCUS_05780 61024 60260 gene locus_tag LOCUS_05790 61024 60260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 61345 61028 gene locus_tag LOCUS_05800 61345 61028 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278842.1 protein_id gnl|my_center|LOCUS_05800 61753 61421 gene locus_tag LOCUS_05810 61753 61421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 62196 65564 gene locus_tag LOCUS_05820 62196 65564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 65588 66868 gene locus_tag LOCUS_05830 65588 66868 CDS product aromatic hydrocarbon degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_05830 67729 66956 gene locus_tag LOCUS_05840 67729 66956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 68925 67984 gene locus_tag LOCUS_05850 68925 67984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 69596 68922 gene locus_tag LOCUS_05860 69596 68922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 69931 69593 gene locus_tag LOCUS_05870 69931 69593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 71597 70068 gene locus_tag LOCUS_05880 gene mpl 71597 70068 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_05880 72366 71671 gene locus_tag LOCUS_05890 72366 71671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 73972 72458 gene locus_tag LOCUS_05900 73972 72458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 75689 74103 gene locus_tag LOCUS_05910 75689 74103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 79010 76002 gene locus_tag LOCUS_05920 79010 76002 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_05920 79336 80712 gene locus_tag LOCUS_05930 79336 80712 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_05930 80893 81492 gene locus_tag LOCUS_05940 80893 81492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 81547 82446 gene locus_tag LOCUS_05950 81547 82446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 82552 82752 gene locus_tag LOCUS_05960 82552 82752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 82745 83803 gene locus_tag LOCUS_05970 82745 83803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 83812 84363 gene locus_tag LOCUS_05980 83812 84363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 84543 85661 gene locus_tag LOCUS_05990 84543 85661 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5S2 protein_id gnl|my_center|LOCUS_05990 86315 86971 gene locus_tag LOCUS_06000 86315 86971 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_06000 87577 88377 gene locus_tag LOCUS_06010 87577 88377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 88592 89479 gene locus_tag LOCUS_06020 88592 89479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 89608 90681 gene locus_tag LOCUS_06030 89608 90681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 90843 92204 gene locus_tag LOCUS_06040 90843 92204 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QU9 protein_id gnl|my_center|LOCUS_06040 92213 94300 gene locus_tag LOCUS_06050 gene hyuA 92213 94300 CDS product N-methylhydantoinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_06050 94297 95847 gene locus_tag LOCUS_06060 gene hyuB 94297 95847 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_06060 96651 95851 gene locus_tag LOCUS_06070 96651 95851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 96935 98701 gene locus_tag LOCUS_06080 96935 98701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 99371 98796 gene locus_tag LOCUS_06090 99371 98796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 99718 101079 gene locus_tag LOCUS_06100 gene rlmD 99718 101079 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LP5 protein_id gnl|my_center|LOCUS_06100 101495 101178 gene locus_tag LOCUS_06110 101495 101178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 102033 101542 gene locus_tag LOCUS_06120 102033 101542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 102316 104898 gene locus_tag LOCUS_06130 102316 104898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 105413 106696 gene locus_tag LOCUS_06140 gene gltA 105413 106696 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW5 protein_id gnl|my_center|LOCUS_06140 107780 106788 gene locus_tag LOCUS_06150 107780 106788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 108081 107770 gene locus_tag LOCUS_06160 108081 107770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44034 protein_id gnl|my_center|LOCUS_06160 108335 108111 gene locus_tag LOCUS_06170 108335 108111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 108666 109970 gene locus_tag LOCUS_06180 108666 109970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 111171 109984 gene locus_tag LOCUS_06190 111171 109984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 111437 114079 gene locus_tag LOCUS_06200 111437 114079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 114177 115616 gene locus_tag LOCUS_06210 114177 115616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 117263 115719 gene locus_tag LOCUS_06220 117263 115719 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_06220 118934 117369 gene locus_tag LOCUS_06230 gene glgA2 118934 117369 CDS product glycogen synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747K8 protein_id gnl|my_center|LOCUS_06230 119319 119137 gene locus_tag LOCUS_06240 119319 119137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 119874 119422 gene locus_tag LOCUS_06250 119874 119422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 121066 120368 gene locus_tag LOCUS_06260 121066 120368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 125862 121252 gene locus_tag LOCUS_06270 125862 121252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 128452 126095 gene locus_tag LOCUS_06280 128452 126095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 129295 128504 gene locus_tag LOCUS_06290 129295 128504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 131448 129391 gene locus_tag LOCUS_06300 gene rep 131448 129391 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7FK74 protein_id gnl|my_center|LOCUS_06300 132254 131526 gene locus_tag LOCUS_06310 132254 131526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 132370 132609 gene locus_tag LOCUS_06320 132370 132609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 132803 134320 gene locus_tag LOCUS_06330 132803 134320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_06330 135300 134386 gene locus_tag LOCUS_06340 135300 134386 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707778.1 protein_id gnl|my_center|LOCUS_06340 135630 137759 gene locus_tag LOCUS_06350 135630 137759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 139746 137857 gene locus_tag LOCUS_06360 gene mnmG 139746 137857 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Q4 protein_id gnl|my_center|LOCUS_06360 140837 139962 gene locus_tag LOCUS_06370 140837 139962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 141741 141133 gene locus_tag LOCUS_06380 141741 141133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 146045 142281 gene locus_tag LOCUS_06390 146045 142281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 147105 146200 gene locus_tag LOCUS_06400 147105 146200 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112416.1 protein_id gnl|my_center|LOCUS_06400 147603 147172 gene locus_tag LOCUS_06410 147603 147172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 147938 149347 gene locus_tag LOCUS_06420 147938 149347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence006 129 1085 gene locus_tag LOCUS_06430 129 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144242.1 protein_id gnl|my_center|LOCUS_06430 1167 1880 gene locus_tag LOCUS_06440 1167 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 2236 3405 gene locus_tag LOCUS_06450 gene add 2236 3405 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403444.1 protein_id gnl|my_center|LOCUS_06450 3464 4858 gene locus_tag LOCUS_06460 gene glmU 3464 4858 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181B4 protein_id gnl|my_center|LOCUS_06460 6394 4865 gene locus_tag LOCUS_06470 6394 4865 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887940.1 protein_id gnl|my_center|LOCUS_06470 6732 6457 gene locus_tag LOCUS_06480 6732 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 8064 7117 gene locus_tag LOCUS_06490 8064 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 9238 8069 gene locus_tag LOCUS_06500 9238 8069 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_06500 10410 9235 gene locus_tag LOCUS_06510 10410 9235 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_06510 11078 12181 gene locus_tag LOCUS_06520 11078 12181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 13139 12210 gene locus_tag LOCUS_06530 13139 12210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_06530 14437 13331 gene locus_tag LOCUS_06540 14437 13331 CDS product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404913.1 protein_id gnl|my_center|LOCUS_06540 15730 14462 gene locus_tag LOCUS_06550 15730 14462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 17916 15862 gene locus_tag LOCUS_06560 17916 15862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 18815 17994 gene locus_tag LOCUS_06570 18815 17994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084260.1 protein_id gnl|my_center|LOCUS_06570 18998 19750 gene locus_tag LOCUS_06580 18998 19750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 20223 19966 gene locus_tag LOCUS_06590 20223 19966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 20132 22531 gene locus_tag LOCUS_06600 20132 22531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 22644 23555 gene locus_tag LOCUS_06610 22644 23555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 23734 24726 gene locus_tag LOCUS_06620 23734 24726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 24846 24920 gene locus_tag LOCUS_t00050 24846 24920 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27063 24988 gene locus_tag LOCUS_06630 27063 24988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 27327 29711 gene locus_tag LOCUS_06640 27327 29711 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H4 protein_id gnl|my_center|LOCUS_06640 33002 29736 gene locus_tag LOCUS_06650 33002 29736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 36229 32999 gene locus_tag LOCUS_06660 36229 32999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 36599 36877 gene locus_tag LOCUS_06670 36599 36877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 37234 38577 gene locus_tag LOCUS_06680 37234 38577 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC96 protein_id gnl|my_center|LOCUS_06680 39248 38679 gene locus_tag LOCUS_06690 39248 38679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 40882 39515 gene locus_tag LOCUS_06700 40882 39515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 41571 40879 gene locus_tag LOCUS_06710 41571 40879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 41732 41968 gene locus_tag LOCUS_06720 41732 41968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 42096 43394 gene locus_tag LOCUS_06730 42096 43394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 43400 43804 gene locus_tag LOCUS_06740 43400 43804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 43832 45898 gene locus_tag LOCUS_06750 43832 45898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 45947 46300 gene locus_tag LOCUS_06760 45947 46300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 46419 47450 gene locus_tag LOCUS_06770 46419 47450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 48812 47661 gene locus_tag LOCUS_06780 48812 47661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 50048 48903 gene locus_tag LOCUS_06790 50048 48903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 51547 50342 gene locus_tag LOCUS_06800 51547 50342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 51888 54146 gene locus_tag LOCUS_06810 51888 54146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 54288 55478 gene locus_tag LOCUS_06820 54288 55478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 55621 55818 gene locus_tag LOCUS_06830 55621 55818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 56587 55820 gene locus_tag LOCUS_06840 gene ttcA 56587 55820 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Z7 protein_id gnl|my_center|LOCUS_06840 58297 56597 gene locus_tag LOCUS_06850 58297 56597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 58507 59160 gene locus_tag LOCUS_06860 58507 59160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110585.1 protein_id gnl|my_center|LOCUS_06860 59526 61868 gene locus_tag LOCUS_06870 59526 61868 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466031.1 protein_id gnl|my_center|LOCUS_06870 62002 63783 gene locus_tag LOCUS_06880 62002 63783 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_06880 66044 63786 gene locus_tag LOCUS_06890 66044 63786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 66957 66223 gene locus_tag LOCUS_06900 66957 66223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 67212 67817 gene locus_tag LOCUS_06910 67212 67817 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903437.1 protein_id gnl|my_center|LOCUS_06910 68115 69491 gene locus_tag LOCUS_06920 68115 69491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 70759 69599 gene locus_tag LOCUS_06930 70759 69599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 73237 71003 gene locus_tag LOCUS_06940 73237 71003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 74790 73645 gene locus_tag LOCUS_06950 74790 73645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 76067 74856 gene locus_tag LOCUS_06960 76067 74856 CDS product pheromone autoinducer 2 transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118268.1 protein_id gnl|my_center|LOCUS_06960 76217 77023 gene locus_tag LOCUS_06970 gene cobB2 76217 77023 CDS product NAD-dependent protein deacylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E1 protein_id gnl|my_center|LOCUS_06970 77062 78309 gene locus_tag LOCUS_06980 77062 78309 CDS product putative trans-acting enoyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O53176 protein_id gnl|my_center|LOCUS_06980 78306 79271 gene locus_tag LOCUS_06990 78306 79271 CDS product putative lipase/esterase LipN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704000.1 protein_id gnl|my_center|LOCUS_06990 79514 80272 gene locus_tag LOCUS_07000 79514 80272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 83923 80279 gene locus_tag LOCUS_07010 83923 80279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 84131 84550 gene locus_tag LOCUS_07020 84131 84550 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_07020 84640 85275 gene locus_tag LOCUS_07030 84640 85275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 85548 86132 gene locus_tag LOCUS_07040 85548 86132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 86180 88087 gene locus_tag LOCUS_07050 86180 88087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 89009 88089 gene locus_tag LOCUS_07060 89009 88089 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_07060 91672 89183 gene locus_tag LOCUS_07070 91672 89183 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS5 protein_id gnl|my_center|LOCUS_07070 92928 91894 gene locus_tag LOCUS_07080 92928 91894 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095359.1 protein_id gnl|my_center|LOCUS_07080 93412 95910 gene locus_tag LOCUS_07090 93412 95910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 95910 96899 gene locus_tag LOCUS_07100 gene kka 95910 96899 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972041.1 protein_id gnl|my_center|LOCUS_07100 97072 97713 gene locus_tag LOCUS_07110 97072 97713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 97755 98063 gene locus_tag LOCUS_07120 97755 98063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 98975 98181 gene locus_tag LOCUS_07130 98975 98181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 100616 99159 gene locus_tag LOCUS_07140 100616 99159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_07140 102138 100708 gene locus_tag LOCUS_07150 102138 100708 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708650.1 protein_id gnl|my_center|LOCUS_07150 102978 102172 gene locus_tag LOCUS_07160 102978 102172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 103237 105090 gene locus_tag LOCUS_07170 103237 105090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 105087 105521 gene locus_tag LOCUS_07180 105087 105521 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 protein_id gnl|my_center|LOCUS_07180 105676 105512 gene locus_tag LOCUS_07190 105676 105512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 108192 105673 gene locus_tag LOCUS_07200 108192 105673 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120873.1 protein_id gnl|my_center|LOCUS_07200 108756 108268 gene locus_tag LOCUS_07210 108756 108268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 110244 108781 gene locus_tag LOCUS_07220 110244 108781 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_07220 110882 110256 gene locus_tag LOCUS_07230 110882 110256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 111090 110899 gene locus_tag LOCUS_07240 111090 110899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 113327 111087 gene locus_tag LOCUS_07250 113327 111087 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120869.1 protein_id gnl|my_center|LOCUS_07250 113708 114499 gene locus_tag LOCUS_07260 113708 114499 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 protein_id gnl|my_center|LOCUS_07260 114510 115883 gene locus_tag LOCUS_07270 gene hemN 114510 115883 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67886 protein_id gnl|my_center|LOCUS_07270 117391 116018 gene locus_tag LOCUS_07280 117391 116018 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368806.1 protein_id gnl|my_center|LOCUS_07280 118593 117388 gene locus_tag LOCUS_07290 118593 117388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 120312 119419 gene locus_tag LOCUS_07300 120312 119419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 120435 121364 gene locus_tag LOCUS_07310 120435 121364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 122209 121355 gene locus_tag LOCUS_07320 122209 121355 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207225.1 protein_id gnl|my_center|LOCUS_07320 122551 124032 gene locus_tag LOCUS_07330 122551 124032 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_07330 124029 125060 gene locus_tag LOCUS_07340 124029 125060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 125576 125064 gene locus_tag LOCUS_07350 125576 125064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895908.1 protein_id gnl|my_center|LOCUS_07350 126684 125689 gene locus_tag LOCUS_07360 126684 125689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 126970 127740 gene locus_tag LOCUS_07370 126970 127740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836738.1 protein_id gnl|my_center|LOCUS_07370 129008 127749 gene locus_tag LOCUS_07380 129008 127749 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973190.1 protein_id gnl|my_center|LOCUS_07380 129186 130319 gene locus_tag LOCUS_07390 129186 130319 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921469.1 protein_id gnl|my_center|LOCUS_07390 132960 130348 gene locus_tag LOCUS_07400 132960 130348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 134159 133065 gene locus_tag LOCUS_07410 134159 133065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 134375 135136 gene locus_tag LOCUS_07420 134375 135136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence007 3616 2813 gene locus_tag LOCUS_07430 3616 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 4334 3621 gene locus_tag LOCUS_07440 4334 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 4864 5589 gene locus_tag LOCUS_07450 4864 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 6515 5601 gene locus_tag LOCUS_07460 6515 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 7545 6505 gene locus_tag LOCUS_07470 7545 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 7786 8628 gene locus_tag LOCUS_07480 7786 8628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 8625 11048 gene locus_tag LOCUS_07490 8625 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 12413 11067 gene locus_tag LOCUS_07500 12413 11067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 12971 13306 gene locus_tag LOCUS_07510 12971 13306 CDS product (Fe-S)-cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951096.1 protein_id gnl|my_center|LOCUS_07510 13422 13826 gene locus_tag LOCUS_07520 13422 13826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 14920 13847 gene locus_tag LOCUS_07530 14920 13847 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM54 protein_id gnl|my_center|LOCUS_07530 15208 15804 gene locus_tag LOCUS_07540 15208 15804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 16476 15820 gene locus_tag LOCUS_07550 16476 15820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_07550 16931 16473 gene locus_tag LOCUS_07560 16931 16473 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038959.1 protein_id gnl|my_center|LOCUS_07560 19321 16928 gene locus_tag LOCUS_07570 19321 16928 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064553.1 protein_id gnl|my_center|LOCUS_07570 19930 20946 gene locus_tag LOCUS_07580 gene trpS 19930 20946 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_07580 20960 22441 gene locus_tag LOCUS_07590 20960 22441 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639261.2 protein_id gnl|my_center|LOCUS_07590 22585 23100 gene locus_tag LOCUS_07600 22585 23100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 23248 23997 gene locus_tag LOCUS_07610 23248 23997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 24100 25566 gene locus_tag LOCUS_07620 gene nhaA 24100 25566 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AP9 protein_id gnl|my_center|LOCUS_07620 25571 26230 gene locus_tag LOCUS_07630 25571 26230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 26400 28430 gene locus_tag LOCUS_07640 gene yoaA 26400 28430 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262264.1 protein_id gnl|my_center|LOCUS_07640 28940 28446 gene locus_tag LOCUS_07650 28940 28446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 protein_id gnl|my_center|LOCUS_07650 29825 28944 gene locus_tag LOCUS_07660 29825 28944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 31339 29822 gene locus_tag LOCUS_07670 gene malQ 31339 29822 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4T3 protein_id gnl|my_center|LOCUS_07670 31469 32611 gene locus_tag LOCUS_07680 31469 32611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 32627 35182 gene locus_tag LOCUS_07690 32627 35182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 37224 35491 gene locus_tag LOCUS_07700 37224 35491 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_07700 37494 38453 gene locus_tag LOCUS_07710 37494 38453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 38578 40950 gene locus_tag LOCUS_07720 38578 40950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 41032 44721 gene locus_tag LOCUS_07730 41032 44721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 44718 46166 gene locus_tag LOCUS_07740 44718 46166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 46234 46512 gene locus_tag LOCUS_07750 46234 46512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 46878 47522 gene locus_tag LOCUS_07760 46878 47522 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_07760 47930 48625 gene locus_tag LOCUS_07770 47930 48625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 48842 49408 gene locus_tag LOCUS_07780 48842 49408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 49749 51191 gene locus_tag LOCUS_07790 49749 51191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 51479 52108 gene locus_tag LOCUS_07800 51479 52108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 52238 53545 gene locus_tag LOCUS_07810 52238 53545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 53593 54204 gene locus_tag LOCUS_07820 53593 54204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_07820 55348 54410 gene locus_tag LOCUS_07830 55348 54410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 60383 55368 gene locus_tag LOCUS_07840 60383 55368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 61783 60383 gene locus_tag LOCUS_07850 61783 60383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 62271 64004 gene locus_tag LOCUS_07860 62271 64004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889385.1 protein_id gnl|my_center|LOCUS_07860 64709 64110 gene locus_tag LOCUS_07870 64709 64110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 66624 64714 gene locus_tag LOCUS_07880 66624 64714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 67717 66809 gene locus_tag LOCUS_07890 67717 66809 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815215.1 protein_id gnl|my_center|LOCUS_07890 68966 68019 gene locus_tag LOCUS_07900 gene ribF 68966 68019 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAC6 protein_id gnl|my_center|LOCUS_07900 69201 70538 gene locus_tag LOCUS_07910 gene ugd 69201 70538 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_07910 70601 72001 gene locus_tag LOCUS_07920 70601 72001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 72014 74491 gene locus_tag LOCUS_07930 72014 74491 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937936.1 protein_id gnl|my_center|LOCUS_07930 75841 74594 gene locus_tag LOCUS_07940 75841 74594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 77213 76158 gene locus_tag LOCUS_07950 77213 76158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 77702 77782 gene locus_tag LOCUS_t00060 77702 77782 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 77890 77972 gene locus_tag LOCUS_t00070 77890 77972 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 78055 78136 gene locus_tag LOCUS_t00080 78055 78136 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 78229 78310 gene locus_tag LOCUS_t00090 78229 78310 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 78357 78440 gene locus_tag LOCUS_t00100 78357 78440 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 78546 78625 gene locus_tag LOCUS_t00110 78546 78625 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 79249 78659 gene locus_tag LOCUS_07960 79249 78659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 79687 79490 gene locus_tag LOCUS_07970 79687 79490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 79704 81653 gene locus_tag LOCUS_07980 79704 81653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 82414 81740 gene locus_tag LOCUS_07990 82414 81740 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_07990 83023 82592 gene locus_tag LOCUS_08000 gene infC 83023 82592 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_08000 85184 83502 gene locus_tag LOCUS_08010 85184 83502 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_08010 85445 86398 gene locus_tag LOCUS_08020 85445 86398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 86885 87352 gene locus_tag LOCUS_08030 86885 87352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 88594 87353 gene locus_tag LOCUS_08040 88594 87353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 88850 89089 gene locus_tag LOCUS_08050 88850 89089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 89133 89771 gene locus_tag LOCUS_08060 89133 89771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 90125 91132 gene locus_tag LOCUS_08070 90125 91132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 93107 91215 gene locus_tag LOCUS_08080 93107 91215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 94841 93225 gene locus_tag LOCUS_08090 94841 93225 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056336.1 protein_id gnl|my_center|LOCUS_08090 95356 106956 gene locus_tag LOCUS_08100 95356 106956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 106975 107580 gene locus_tag LOCUS_08110 106975 107580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 107577 109145 gene locus_tag LOCUS_08120 107577 109145 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_08120 110163 109138 gene locus_tag LOCUS_08130 110163 109138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 111384 110296 gene locus_tag LOCUS_08140 111384 110296 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729119.1 protein_id gnl|my_center|LOCUS_08140 111923 111372 gene locus_tag LOCUS_08150 111923 111372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 115296 112159 gene locus_tag LOCUS_08160 115296 112159 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103123.1 protein_id gnl|my_center|LOCUS_08160 116515 115280 gene locus_tag LOCUS_08170 116515 115280 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_08170 117780 116512 gene locus_tag LOCUS_08180 gene czcC 117780 116512 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119960.1 protein_id gnl|my_center|LOCUS_08180 118932 117883 gene locus_tag LOCUS_08190 118932 117883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 119360 118929 gene locus_tag LOCUS_08200 119360 118929 CDS product penicillinase repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257725.1 protein_id gnl|my_center|LOCUS_08200 119581 120345 gene locus_tag LOCUS_08210 119581 120345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 120383 121132 gene locus_tag LOCUS_08220 120383 121132 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707810.1 protein_id gnl|my_center|LOCUS_08220 121384 122175 gene locus_tag LOCUS_08230 121384 122175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 122334 123575 gene locus_tag LOCUS_08240 122334 123575 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_08240 123785 124399 gene locus_tag LOCUS_08250 123785 124399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 124470 126056 gene locus_tag LOCUS_08260 124470 126056 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727550.1 protein_id gnl|my_center|LOCUS_08260 127917 126025 gene locus_tag LOCUS_08270 127917 126025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 128876 128034 gene locus_tag LOCUS_08280 128876 128034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 129140 129643 gene locus_tag LOCUS_08290 129140 129643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 129800 131326 gene locus_tag LOCUS_08300 129800 131326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence008 202 468 gene locus_tag LOCUS_08310 202 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 516 815 gene locus_tag LOCUS_08320 516 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 979 3309 gene locus_tag LOCUS_08330 979 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 3396 4205 gene locus_tag LOCUS_08340 3396 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 4511 4810 gene locus_tag LOCUS_08350 4511 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 4910 5926 gene locus_tag LOCUS_08360 4910 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 6041 6904 gene locus_tag LOCUS_08370 6041 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 7150 8322 gene locus_tag LOCUS_08380 7150 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 8566 9435 gene locus_tag LOCUS_08390 8566 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 9768 22313 gene locus_tag LOCUS_08400 9768 22313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 23539 22964 gene locus_tag LOCUS_08410 23539 22964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 23433 23702 gene locus_tag LOCUS_08420 23433 23702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 23762 26296 gene locus_tag LOCUS_08430 23762 26296 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_08430 27179 26337 gene locus_tag LOCUS_08440 27179 26337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 29346 27181 gene locus_tag LOCUS_08450 29346 27181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 29588 30499 gene locus_tag LOCUS_08460 29588 30499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 30642 32141 gene locus_tag LOCUS_08470 30642 32141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 32746 32177 gene locus_tag LOCUS_08480 32746 32177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 32922 34376 gene locus_tag LOCUS_08490 32922 34376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 34521 35306 gene locus_tag LOCUS_08500 34521 35306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 35313 35846 gene locus_tag LOCUS_08510 35313 35846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 35843 36199 gene locus_tag LOCUS_08520 35843 36199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 36294 38081 gene locus_tag LOCUS_08530 gene aspS 36294 38081 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F323 protein_id gnl|my_center|LOCUS_08530 39178 38078 gene locus_tag LOCUS_08540 39178 38078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 39254 40189 gene locus_tag LOCUS_08550 39254 40189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 41284 40361 gene locus_tag LOCUS_08560 41284 40361 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404448.1 protein_id gnl|my_center|LOCUS_08560 41470 42114 gene locus_tag LOCUS_08570 41470 42114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 42308 42844 gene locus_tag LOCUS_08580 42308 42844 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227885.1 protein_id gnl|my_center|LOCUS_08580 43341 42886 gene locus_tag LOCUS_08590 43341 42886 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX32 protein_id gnl|my_center|LOCUS_08590 43459 45798 gene locus_tag LOCUS_08600 43459 45798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 45860 46681 gene locus_tag LOCUS_08610 45860 46681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140126.1 protein_id gnl|my_center|LOCUS_08610 47622 46648 gene locus_tag LOCUS_08620 47622 46648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 49747 47915 gene locus_tag LOCUS_08630 49747 47915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 50525 49989 gene locus_tag LOCUS_08640 50525 49989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 50783 51748 gene locus_tag LOCUS_08650 50783 51748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 51938 53659 gene locus_tag LOCUS_08660 51938 53659 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RR71 protein_id gnl|my_center|LOCUS_08660 54172 54501 gene locus_tag LOCUS_08670 54172 54501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 56227 54653 gene locus_tag LOCUS_08680 56227 54653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 57269 56448 gene locus_tag LOCUS_08690 57269 56448 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_08690 57764 57381 gene locus_tag LOCUS_08700 57764 57381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 58789 57848 gene locus_tag LOCUS_08710 58789 57848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 59852 58734 gene locus_tag LOCUS_08720 59852 58734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 60023 61525 gene locus_tag LOCUS_08730 gene cyaA4 60023 61525 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946864.1 protein_id gnl|my_center|LOCUS_08730 65965 61589 gene locus_tag LOCUS_08740 65965 61589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 65904 66188 gene locus_tag LOCUS_08750 65904 66188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 66333 67076 gene locus_tag LOCUS_08760 66333 67076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 67776 67273 gene locus_tag LOCUS_08770 67776 67273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 68037 68963 gene locus_tag LOCUS_08780 68037 68963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 68960 71587 gene locus_tag LOCUS_08790 68960 71587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 72806 71604 gene locus_tag LOCUS_08800 72806 71604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 73891 72896 gene locus_tag LOCUS_08810 73891 72896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 78400 73907 gene locus_tag LOCUS_08820 78400 73907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 79372 78800 gene locus_tag LOCUS_08830 79372 78800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 79296 79601 gene locus_tag LOCUS_08840 79296 79601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 79630 80331 gene locus_tag LOCUS_08850 79630 80331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 82305 80365 gene locus_tag LOCUS_08860 82305 80365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 85359 82696 gene locus_tag LOCUS_08870 85359 82696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 85523 86032 gene locus_tag LOCUS_08880 85523 86032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 88417 86057 gene locus_tag LOCUS_08890 gene glnS 88417 86057 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1L9 protein_id gnl|my_center|LOCUS_08890 88945 88538 gene locus_tag LOCUS_08900 88945 88538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 88856 90472 gene locus_tag LOCUS_08910 88856 90472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 91988 90636 gene locus_tag LOCUS_08920 91988 90636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 92635 91985 gene locus_tag LOCUS_08930 92635 91985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 92845 94602 gene locus_tag LOCUS_08940 92845 94602 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804193.1 protein_id gnl|my_center|LOCUS_08940 95638 94616 gene locus_tag LOCUS_08950 95638 94616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 96496 95852 gene locus_tag LOCUS_08960 96496 95852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 97291 97073 gene locus_tag LOCUS_08970 97291 97073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 97193 97759 gene locus_tag LOCUS_08980 97193 97759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 99284 97773 gene locus_tag LOCUS_08990 99284 97773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 99524 101893 gene locus_tag LOCUS_09000 99524 101893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402856.1 protein_id gnl|my_center|LOCUS_09000 102817 101993 gene locus_tag LOCUS_09010 102817 101993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 103294 104583 gene locus_tag LOCUS_09020 103294 104583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67918 protein_id gnl|my_center|LOCUS_09020 104627 105568 gene locus_tag LOCUS_09030 104627 105568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 105595 106398 gene locus_tag LOCUS_09040 105595 106398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 106583 107161 gene locus_tag LOCUS_09050 106583 107161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 107171 108118 gene locus_tag LOCUS_09060 107171 108118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 108118 109221 gene locus_tag LOCUS_09070 108118 109221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 112157 109230 gene locus_tag LOCUS_09080 112157 109230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 113048 112260 gene locus_tag LOCUS_09090 113048 112260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 113824 113168 gene locus_tag LOCUS_09100 113824 113168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846138.1 protein_id gnl|my_center|LOCUS_09100 114187 114633 gene locus_tag LOCUS_09110 114187 114633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 115441 114617 gene locus_tag LOCUS_09120 115441 114617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 116159 115470 gene locus_tag LOCUS_09130 116159 115470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 116630 116268 gene locus_tag LOCUS_09140 116630 116268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 116829 117824 gene locus_tag LOCUS_09150 116829 117824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 120172 117830 gene locus_tag LOCUS_09160 120172 117830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112509.1 protein_id gnl|my_center|LOCUS_09160 122008 120200 gene locus_tag LOCUS_09170 122008 120200 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895539.1 protein_id gnl|my_center|LOCUS_09170 124077 122116 gene locus_tag LOCUS_09180 124077 122116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 124749 124132 gene locus_tag LOCUS_09190 124749 124132 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886754.1 protein_id gnl|my_center|LOCUS_09190 124900 125784 gene locus_tag LOCUS_09200 gene lyrS 124900 125784 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139967.1 protein_id gnl|my_center|LOCUS_09200 125809 126201 gene locus_tag LOCUS_09210 125809 126201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 127226 126393 gene locus_tag LOCUS_09220 127226 126393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 protein_id gnl|my_center|LOCUS_09220 129334 127367 gene locus_tag LOCUS_09230 129334 127367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence009 206 2302 gene locus_tag LOCUS_09240 206 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 4074 2401 gene locus_tag LOCUS_09250 4074 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 6001 4331 gene locus_tag LOCUS_09260 6001 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 5885 6211 gene locus_tag LOCUS_09270 5885 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 6195 7208 gene locus_tag LOCUS_09280 6195 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 7386 8423 gene locus_tag LOCUS_09290 7386 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 8562 10610 gene locus_tag LOCUS_09300 8562 10610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 10889 12991 gene locus_tag LOCUS_09310 10889 12991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 13953 13222 gene locus_tag LOCUS_09320 13953 13222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 15425 13977 gene locus_tag LOCUS_09330 15425 13977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 16683 16177 gene locus_tag LOCUS_09340 16683 16177 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259518.1 protein_id gnl|my_center|LOCUS_09340 17643 16765 gene locus_tag LOCUS_09350 17643 16765 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289749.1 protein_id gnl|my_center|LOCUS_09350 17819 18466 gene locus_tag LOCUS_09360 17819 18466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 18495 22010 gene locus_tag LOCUS_09370 18495 22010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 22299 22772 gene locus_tag LOCUS_09380 22299 22772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 26720 22839 gene locus_tag LOCUS_09390 26720 22839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 27001 27216 gene locus_tag LOCUS_09400 27001 27216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 27379 31269 gene locus_tag LOCUS_09410 27379 31269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 31609 33450 gene locus_tag LOCUS_09420 31609 33450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 34761 33481 gene locus_tag LOCUS_09430 34761 33481 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884033.1 protein_id gnl|my_center|LOCUS_09430 35397 34765 gene locus_tag LOCUS_09440 35397 34765 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884034.1 protein_id gnl|my_center|LOCUS_09440 35847 35452 gene locus_tag LOCUS_09450 gene nudG 35847 35452 CDS product CTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77788 protein_id gnl|my_center|LOCUS_09450 37192 35840 gene locus_tag LOCUS_09460 37192 35840 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919839.1 protein_id gnl|my_center|LOCUS_09460 38682 37189 gene locus_tag LOCUS_09470 38682 37189 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038469.1 protein_id gnl|my_center|LOCUS_09470 39545 38829 gene locus_tag LOCUS_09480 39545 38829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 41597 39606 gene locus_tag LOCUS_09490 41597 39606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 42860 41835 gene locus_tag LOCUS_09500 42860 41835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 46951 43118 gene locus_tag LOCUS_09510 46951 43118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 47584 47075 gene locus_tag LOCUS_09520 47584 47075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 47845 48759 gene locus_tag LOCUS_09530 47845 48759 CDS product ribonucleotide-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259170.1 protein_id gnl|my_center|LOCUS_09530 48808 49716 gene locus_tag LOCUS_09540 48808 49716 CDS product ribonucleotide-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259170.1 protein_id gnl|my_center|LOCUS_09540 49945 52059 gene locus_tag LOCUS_09550 49945 52059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 52181 53167 gene locus_tag LOCUS_09560 52181 53167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 53167 53931 gene locus_tag LOCUS_09570 53167 53931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 55743 54058 gene locus_tag LOCUS_09580 gene glpA 55743 54058 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D6F1 protein_id gnl|my_center|LOCUS_09580 57811 55877 gene locus_tag LOCUS_09590 57811 55877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 58848 57847 gene locus_tag LOCUS_09600 58848 57847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 61545 58891 gene locus_tag LOCUS_09610 61545 58891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 61817 62827 gene locus_tag LOCUS_09620 61817 62827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 64163 62847 gene locus_tag LOCUS_09630 64163 62847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 64394 65515 gene locus_tag LOCUS_09640 64394 65515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 68086 65546 gene locus_tag LOCUS_09650 68086 65546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 68856 68245 gene locus_tag LOCUS_09660 68856 68245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 69020 70600 gene locus_tag LOCUS_09670 69020 70600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 71707 71285 gene locus_tag LOCUS_09680 71707 71285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 73301 71820 gene locus_tag LOCUS_09690 73301 71820 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943658.1 protein_id gnl|my_center|LOCUS_09690 73502 78457 gene locus_tag LOCUS_09700 73502 78457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 79040 78582 gene locus_tag LOCUS_09710 79040 78582 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887201.1 protein_id gnl|my_center|LOCUS_09710 79076 80500 gene locus_tag LOCUS_09720 79076 80500 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF6 protein_id gnl|my_center|LOCUS_09720 80666 83923 gene locus_tag LOCUS_09730 80666 83923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 84549 83959 gene locus_tag LOCUS_09740 84549 83959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 85544 84552 gene locus_tag LOCUS_09750 85544 84552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 86257 89529 gene locus_tag LOCUS_09760 86257 89529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 89637 96071 gene locus_tag LOCUS_09770 89637 96071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 96068 97978 gene locus_tag LOCUS_09780 96068 97978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 98072 99367 gene locus_tag LOCUS_09790 98072 99367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 99416 101938 gene locus_tag LOCUS_09800 gene topB 99416 101938 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97DB3 protein_id gnl|my_center|LOCUS_09800 102081 102893 gene locus_tag LOCUS_09810 102081 102893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 102977 103990 gene locus_tag LOCUS_09820 102977 103990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 105249 104101 gene locus_tag LOCUS_09830 105249 104101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 105879 105367 gene locus_tag LOCUS_09840 105879 105367 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S183 protein_id gnl|my_center|LOCUS_09840 106510 105896 gene locus_tag LOCUS_09850 106510 105896 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_09850 106653 112166 gene locus_tag LOCUS_09860 106653 112166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 113179 112388 gene locus_tag LOCUS_09870 113179 112388 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140144.1 protein_id gnl|my_center|LOCUS_09870 115642 113207 gene locus_tag LOCUS_09880 115642 113207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 116756 115911 gene locus_tag LOCUS_09890 gene deoD 116756 115911 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE80 protein_id gnl|my_center|LOCUS_09890 117985 116876 gene locus_tag LOCUS_09900 117985 116876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence010 639 73 gene locus_tag LOCUS_09910 639 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2077 752 gene locus_tag LOCUS_09920 2077 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3552 2065 gene locus_tag LOCUS_09930 3552 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3726 4517 gene locus_tag LOCUS_09940 3726 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 5846 4521 gene locus_tag LOCUS_09950 5846 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 6854 5853 gene locus_tag LOCUS_09960 gene mhpE 6854 5853 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y6H7 protein_id gnl|my_center|LOCUS_09960 7771 6851 gene locus_tag LOCUS_09970 gene mhpF 7771 6851 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK04 protein_id gnl|my_center|LOCUS_09970 8067 7789 gene locus_tag LOCUS_09980 8067 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 9614 8199 gene locus_tag LOCUS_09990 9614 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 9899 11032 gene locus_tag LOCUS_10000 9899 11032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 11301 12101 gene locus_tag LOCUS_10010 11301 12101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 13054 12281 gene locus_tag LOCUS_10020 13054 12281 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_10020 13445 13074 gene locus_tag LOCUS_10030 13445 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 15037 13490 gene locus_tag LOCUS_10040 15037 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 16791 15160 gene locus_tag LOCUS_10050 16791 15160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 17557 18372 gene locus_tag LOCUS_10060 17557 18372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 18512 19210 gene locus_tag LOCUS_10070 18512 19210 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918095.1 protein_id gnl|my_center|LOCUS_10070 19298 19939 gene locus_tag LOCUS_10080 gene lpsJ 19298 19939 CDS product succinyl-CoA:3-ketoacid coenzyme A transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7I8 protein_id gnl|my_center|LOCUS_10080 20054 21670 gene locus_tag LOCUS_10090 20054 21670 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141615.1 protein_id gnl|my_center|LOCUS_10090 24011 21741 gene locus_tag LOCUS_10100 24011 21741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 25321 24092 gene locus_tag LOCUS_10110 25321 24092 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 protein_id gnl|my_center|LOCUS_10110 25651 26367 gene locus_tag LOCUS_10120 25651 26367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 26558 27469 gene locus_tag LOCUS_10130 26558 27469 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947874.1 protein_id gnl|my_center|LOCUS_10130 29247 27757 gene locus_tag LOCUS_10140 29247 27757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 30075 29269 gene locus_tag LOCUS_10150 30075 29269 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_10150 32288 30225 gene locus_tag LOCUS_10160 32288 30225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 32768 33964 gene locus_tag LOCUS_10170 gene queG 32768 33964 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL4 protein_id gnl|my_center|LOCUS_10170 33968 34822 gene locus_tag LOCUS_10180 33968 34822 CDS product formiminoglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918629.1 protein_id gnl|my_center|LOCUS_10180 36461 34827 gene locus_tag LOCUS_10190 36461 34827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 37450 36467 gene locus_tag LOCUS_10200 37450 36467 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404568.1 protein_id gnl|my_center|LOCUS_10200 39115 37565 gene locus_tag LOCUS_10210 39115 37565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 39650 40261 gene locus_tag LOCUS_10220 39650 40261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 40258 41334 gene locus_tag LOCUS_10230 40258 41334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 41907 41344 gene locus_tag LOCUS_10240 41907 41344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 42854 41907 gene locus_tag LOCUS_10250 42854 41907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 47661 43519 gene locus_tag LOCUS_10260 47661 43519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 48771 47815 gene locus_tag LOCUS_10270 48771 47815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 50105 49107 gene locus_tag LOCUS_10280 gene gluQ 50105 49107 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_10280 50919 50143 gene locus_tag LOCUS_10290 50919 50143 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403082.1 protein_id gnl|my_center|LOCUS_10290 51153 52301 gene locus_tag LOCUS_10300 51153 52301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 52315 52764 gene locus_tag LOCUS_10310 52315 52764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 52761 53612 gene locus_tag LOCUS_10320 52761 53612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 54660 53617 gene locus_tag LOCUS_10330 54660 53617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 55823 54717 gene locus_tag LOCUS_10340 55823 54717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 56499 57395 gene locus_tag LOCUS_10350 56499 57395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 57568 58770 gene locus_tag LOCUS_10360 57568 58770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 59567 58773 gene locus_tag LOCUS_10370 59567 58773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 59753 62485 gene locus_tag LOCUS_10380 59753 62485 CDS product proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144124.1 protein_id gnl|my_center|LOCUS_10380 62755 63474 gene locus_tag LOCUS_10390 62755 63474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 64316 64894 gene locus_tag LOCUS_10400 64316 64894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 67738 65462 gene locus_tag LOCUS_10410 67738 65462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 69399 67816 gene locus_tag LOCUS_10420 69399 67816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 70532 69399 gene locus_tag LOCUS_10430 70532 69399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 71296 70532 gene locus_tag LOCUS_10440 gene dck 71296 70532 CDS product deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403716.1 protein_id gnl|my_center|LOCUS_10440 71378 72763 gene locus_tag LOCUS_10450 71378 72763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 73365 72787 gene locus_tag LOCUS_10460 73365 72787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 76654 74108 gene locus_tag LOCUS_10470 76654 74108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 78913 76982 gene locus_tag LOCUS_10480 gene htpG 78913 76982 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P880 protein_id gnl|my_center|LOCUS_10480 80256 78910 gene locus_tag LOCUS_10490 80256 78910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 81864 80395 gene locus_tag LOCUS_10500 gene cls-2 81864 80395 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_10500 82980 81970 gene locus_tag LOCUS_10510 gene gpsA 82980 81970 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZB6 protein_id gnl|my_center|LOCUS_10510 84266 83754 gene locus_tag LOCUS_10520 84266 83754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 84986 84303 gene locus_tag LOCUS_10530 84986 84303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 88932 85252 gene locus_tag LOCUS_10540 88932 85252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 91965 89140 gene locus_tag LOCUS_10550 91965 89140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 92613 92239 gene locus_tag LOCUS_10560 92613 92239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 92987 94141 gene locus_tag LOCUS_10570 92987 94141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 94397 95383 gene locus_tag LOCUS_10580 94397 95383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 95396 96370 gene locus_tag LOCUS_10590 95396 96370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 96408 96893 gene locus_tag LOCUS_10600 96408 96893 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974891.1 protein_id gnl|my_center|LOCUS_10600 98559 97039 gene locus_tag LOCUS_10610 98559 97039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 98916 99884 gene locus_tag LOCUS_10620 98916 99884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 101194 99968 gene locus_tag LOCUS_10630 101194 99968 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729321.1 protein_id gnl|my_center|LOCUS_10630 102740 101361 gene locus_tag LOCUS_10640 gene hisS 102740 101361 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QS2 protein_id gnl|my_center|LOCUS_10640 103153 104298 gene locus_tag LOCUS_10650 103153 104298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 105183 104344 gene locus_tag LOCUS_10660 105183 104344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703681.1 protein_id gnl|my_center|LOCUS_10660 106418 105186 gene locus_tag LOCUS_10670 106418 105186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 106771 106421 gene locus_tag LOCUS_10680 106771 106421 CDS product putative HIT-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66536 protein_id gnl|my_center|LOCUS_10680 106977 108497 gene locus_tag LOCUS_10690 106977 108497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence011 17 1147 gene locus_tag LOCUS_10700 17 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1349 2800 gene locus_tag LOCUS_10710 gene radA 1349 2800 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG1 protein_id gnl|my_center|LOCUS_10710 2896 3366 gene locus_tag LOCUS_10720 2896 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3363 3827 gene locus_tag LOCUS_10730 3363 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3843 4172 gene locus_tag LOCUS_10740 3843 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 4169 4822 gene locus_tag LOCUS_10750 4169 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 6250 5450 gene locus_tag LOCUS_10760 6250 5450 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KLP5 protein_id gnl|my_center|LOCUS_10760 6415 6254 gene locus_tag LOCUS_10770 6415 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 7014 6412 gene locus_tag LOCUS_10780 gene ctaG 7014 6412 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_10780 8071 7067 gene locus_tag LOCUS_10790 gene ctaB 8071 7067 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIL7 protein_id gnl|my_center|LOCUS_10790 8657 8331 gene locus_tag LOCUS_10800 8657 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 9383 8754 gene locus_tag LOCUS_10810 gene coxP 9383 8754 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709069.1 protein_id gnl|my_center|LOCUS_10810 11365 9581 gene locus_tag LOCUS_10820 gene ctaD 11365 9581 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31833 protein_id gnl|my_center|LOCUS_10820 13172 11526 gene locus_tag LOCUS_10830 13172 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 14990 13368 gene locus_tag LOCUS_10840 14990 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 16399 15098 gene locus_tag LOCUS_10850 16399 15098 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453372.1 protein_id gnl|my_center|LOCUS_10850 17186 16551 gene locus_tag LOCUS_10860 17186 16551 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872574.1 protein_id gnl|my_center|LOCUS_10860 18373 17246 gene locus_tag LOCUS_10870 18373 17246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 19805 18366 gene locus_tag LOCUS_10880 19805 18366 CDS product Fe-S-cluster-containing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_10880 23406 19969 gene locus_tag LOCUS_10890 23406 19969 CDS product Fe-S-cluster-containing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_10890 23956 23447 gene locus_tag LOCUS_10900 23956 23447 CDS product class III cytochrome C domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_10900 25905 24655 gene locus_tag LOCUS_10910 25905 24655 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932672.1 protein_id gnl|my_center|LOCUS_10910 26415 27584 gene locus_tag LOCUS_10920 26415 27584 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017189.1 protein_id gnl|my_center|LOCUS_10920 27870 28598 gene locus_tag LOCUS_10930 27870 28598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 28655 29518 gene locus_tag LOCUS_10940 28655 29518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 29845 29982 gene locus_tag LOCUS_10950 29845 29982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 30445 29984 gene locus_tag LOCUS_10960 30445 29984 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_10960 31251 30451 gene locus_tag LOCUS_10970 31251 30451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 31470 32519 gene locus_tag LOCUS_10980 31470 32519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 33977 32523 gene locus_tag LOCUS_10990 33977 32523 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_10990 35333 33990 gene locus_tag LOCUS_11000 35333 33990 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_11000 35546 36682 gene locus_tag LOCUS_11010 35546 36682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 38040 36727 gene locus_tag LOCUS_11020 38040 36727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 39590 38037 gene locus_tag LOCUS_11030 gene nnr 39590 38037 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI2 protein_id gnl|my_center|LOCUS_11030 41024 39657 gene locus_tag LOCUS_11040 gene glmM 41024 39657 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C70 protein_id gnl|my_center|LOCUS_11040 42164 41205 gene locus_tag LOCUS_11050 42164 41205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 43063 42161 gene locus_tag LOCUS_11060 43063 42161 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_11060 44103 43237 gene locus_tag LOCUS_11070 gene folP 44103 43237 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942453.1 protein_id gnl|my_center|LOCUS_11070 46094 44106 gene locus_tag LOCUS_11080 gene ftsH-2 46094 44106 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C66 protein_id gnl|my_center|LOCUS_11080 47822 46329 gene locus_tag LOCUS_11090 47822 46329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 48814 47819 gene locus_tag LOCUS_11100 48814 47819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 49333 50709 gene locus_tag LOCUS_11110 49333 50709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 51077 50823 gene locus_tag LOCUS_11120 gene grxC 51077 50823 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948013.1 protein_id gnl|my_center|LOCUS_11120 51262 51978 gene locus_tag LOCUS_11130 51262 51978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 54074 52104 gene locus_tag LOCUS_11140 gene sppA 54074 52104 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898564.1 protein_id gnl|my_center|LOCUS_11140 54220 54432 gene locus_tag LOCUS_11150 54220 54432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 54472 54855 gene locus_tag LOCUS_11160 gene crcB 54472 54855 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHY7 protein_id gnl|my_center|LOCUS_11160 54890 56680 gene locus_tag LOCUS_11170 gene xseA 54890 56680 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_11170 56658 56888 gene locus_tag LOCUS_11180 56658 56888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 56888 58285 gene locus_tag LOCUS_11190 gene atoE 56888 58285 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071598.1 protein_id gnl|my_center|LOCUS_11190 58873 58310 gene locus_tag LOCUS_11200 58873 58310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 59423 61441 gene locus_tag LOCUS_11210 59423 61441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 62198 61491 gene locus_tag LOCUS_11220 62198 61491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 63858 62236 gene locus_tag LOCUS_11230 63858 62236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 64204 65952 gene locus_tag LOCUS_11240 64204 65952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 65981 66370 gene locus_tag LOCUS_11250 65981 66370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 67992 66928 gene locus_tag LOCUS_11260 67992 66928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 69553 68042 gene locus_tag LOCUS_11270 69553 68042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 71138 69645 gene locus_tag LOCUS_11280 71138 69645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 71061 71321 gene locus_tag LOCUS_11290 71061 71321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 71764 71579 gene locus_tag LOCUS_11300 71764 71579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 72031 72906 gene locus_tag LOCUS_11310 72031 72906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 73175 75493 gene locus_tag LOCUS_11320 73175 75493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 76183 75596 gene locus_tag LOCUS_11330 76183 75596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 78571 76472 gene locus_tag LOCUS_11340 78571 76472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 79656 79021 gene locus_tag LOCUS_11350 79656 79021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 79769 81151 gene locus_tag LOCUS_11360 79769 81151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 81305 82156 gene locus_tag LOCUS_11370 81305 82156 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256575.1 protein_id gnl|my_center|LOCUS_11370 82559 83353 gene locus_tag LOCUS_11380 82559 83353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 84369 83338 gene locus_tag LOCUS_11390 84369 83338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 85044 84631 gene locus_tag LOCUS_11400 85044 84631 CDS product lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972459.1 protein_id gnl|my_center|LOCUS_11400 85634 85170 gene locus_tag LOCUS_11410 85634 85170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 86516 85725 gene locus_tag LOCUS_11420 86516 85725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 86755 86827 gene locus_tag LOCUS_t00120 86755 86827 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 88432 87041 gene locus_tag LOCUS_11430 88432 87041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 89150 88449 gene locus_tag LOCUS_11440 89150 88449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 89944 89135 gene locus_tag LOCUS_11450 89944 89135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 90677 90219 gene locus_tag LOCUS_11460 gene phnA 90677 90219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061583.1 protein_id gnl|my_center|LOCUS_11460 90933 91634 gene locus_tag LOCUS_11470 90933 91634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 92926 91802 gene locus_tag LOCUS_11480 92926 91802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023739.1 protein_id gnl|my_center|LOCUS_11480 97824 93187 gene locus_tag LOCUS_11490 97824 93187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 99691 98099 gene locus_tag LOCUS_11500 99691 98099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 99959 99711 gene locus_tag LOCUS_11510 99959 99711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 100128 101399 gene locus_tag LOCUS_11520 100128 101399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 101399 103294 gene locus_tag LOCUS_11530 101399 103294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 105337 103295 gene locus_tag LOCUS_11540 105337 103295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 105707 106612 gene locus_tag LOCUS_11550 105707 106612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence012 1851 616 gene locus_tag LOCUS_11560 1851 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2200 2892 gene locus_tag LOCUS_11570 2200 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 4300 3800 gene locus_tag LOCUS_11580 4300 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 5274 4432 gene locus_tag LOCUS_11590 5274 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 5454 5644 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgcgtacgagatgtaacgggtttcctgatcggg 6419 6609 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcgtacgagatgtaacgggtttcctgatcggag 9277 6617 gene locus_tag LOCUS_11600 9277 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 9819 9355 gene locus_tag LOCUS_11610 gene nsrR 9819 9355 CDS product HTH-type transcriptional regulator NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07573 protein_id gnl|my_center|LOCUS_11610 11070 10018 gene locus_tag LOCUS_11620 11070 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 11273 12499 gene locus_tag LOCUS_11630 gene hmp 11273 12499 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIY1 protein_id gnl|my_center|LOCUS_11630 12521 13063 gene locus_tag LOCUS_11640 12521 13063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 13498 14073 gene locus_tag LOCUS_11650 13498 14073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 14714 14103 gene locus_tag LOCUS_11660 14714 14103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 15571 14933 gene locus_tag LOCUS_11670 15571 14933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 17780 16605 gene locus_tag LOCUS_11680 17780 16605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 18911 19219 gene locus_tag LOCUS_11690 18911 19219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 20182 19178 gene locus_tag LOCUS_11700 20182 19178 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399648.1 protein_id gnl|my_center|LOCUS_11700 20796 20347 gene locus_tag LOCUS_11710 20796 20347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 21579 21391 gene locus_tag LOCUS_11720 21579 21391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 21645 22196 gene locus_tag LOCUS_11730 21645 22196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 22258 22620 gene locus_tag LOCUS_11740 22258 22620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 23291 24745 gene locus_tag LOCUS_11750 23291 24745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 25512 24808 gene locus_tag LOCUS_11760 25512 24808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 26042 26575 gene locus_tag LOCUS_11770 26042 26575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 26776 28938 gene locus_tag LOCUS_11780 26776 28938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 29083 30504 gene locus_tag LOCUS_11790 29083 30504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 30498 31442 gene locus_tag LOCUS_11800 30498 31442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 31550 33493 gene locus_tag LOCUS_11810 31550 33493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550744.1 protein_id gnl|my_center|LOCUS_11810 37942 33542 gene locus_tag LOCUS_11820 37942 33542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 40115 38061 gene locus_tag LOCUS_11830 40115 38061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 41483 40125 gene locus_tag LOCUS_11840 41483 40125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 42590 41652 gene locus_tag LOCUS_11850 42590 41652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 43647 42529 gene locus_tag LOCUS_11860 43647 42529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 44834 43635 gene locus_tag LOCUS_11870 gene wecB 44834 43635 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM43 protein_id gnl|my_center|LOCUS_11870 45230 46363 gene locus_tag LOCUS_11880 45230 46363 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942620.1 protein_id gnl|my_center|LOCUS_11880 46360 47460 gene locus_tag LOCUS_11890 46360 47460 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_11890 47460 48683 gene locus_tag LOCUS_11900 47460 48683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176628.1 protein_id gnl|my_center|LOCUS_11900 48697 51771 gene locus_tag LOCUS_11910 48697 51771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 53141 51732 gene locus_tag LOCUS_11920 53141 51732 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148535.1 protein_id gnl|my_center|LOCUS_11920 53329 55707 gene locus_tag LOCUS_11930 53329 55707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 57091 55661 gene locus_tag LOCUS_11940 57091 55661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 60680 57156 gene locus_tag LOCUS_11950 60680 57156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 61953 60709 gene locus_tag LOCUS_11960 61953 60709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 63210 61963 gene locus_tag LOCUS_11970 63210 61963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 64553 63207 gene locus_tag LOCUS_11980 64553 63207 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105845.1 protein_id gnl|my_center|LOCUS_11980 66013 64550 gene locus_tag LOCUS_11990 66013 64550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 66552 66010 gene locus_tag LOCUS_12000 66552 66010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 66905 66549 gene locus_tag LOCUS_12010 66905 66549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 68168 66918 gene locus_tag LOCUS_12020 68168 66918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 70179 68395 gene locus_tag LOCUS_12030 70179 68395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 70571 70939 gene locus_tag LOCUS_12040 70571 70939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 71006 71713 gene locus_tag LOCUS_12050 71006 71713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 73204 71699 gene locus_tag LOCUS_12060 73204 71699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 73420 74217 gene locus_tag LOCUS_12070 73420 74217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 74342 75046 gene locus_tag LOCUS_12080 74342 75046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 75039 75893 gene locus_tag LOCUS_12090 75039 75893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 76019 77749 gene locus_tag LOCUS_12100 gene pnbA 76019 77749 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37967 protein_id gnl|my_center|LOCUS_12100 77928 78833 gene locus_tag LOCUS_12110 77928 78833 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944061.1 protein_id gnl|my_center|LOCUS_12110 79075 78836 gene locus_tag LOCUS_12120 79075 78836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 79881 79144 gene locus_tag LOCUS_12130 79881 79144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 80081 81034 gene locus_tag LOCUS_12140 80081 81034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 81910 81116 gene locus_tag LOCUS_12150 81910 81116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 82231 82584 gene locus_tag LOCUS_12160 82231 82584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 82728 83531 gene locus_tag LOCUS_12170 82728 83531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 84437 83541 gene locus_tag LOCUS_12180 84437 83541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 84717 85442 gene locus_tag LOCUS_12190 84717 85442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 85454 86236 gene locus_tag LOCUS_12200 85454 86236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 87254 86244 gene locus_tag LOCUS_12210 87254 86244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 87382 88230 gene locus_tag LOCUS_12220 87382 88230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 88277 90160 gene locus_tag LOCUS_12230 88277 90160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 92193 90166 gene locus_tag LOCUS_12240 92193 90166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_12240 92399 93451 gene locus_tag LOCUS_12250 92399 93451 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_12250 94810 93464 gene locus_tag LOCUS_12260 94810 93464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 95115 94861 gene locus_tag LOCUS_12270 95115 94861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 97101 95236 gene locus_tag LOCUS_12280 gene cshA 97101 95236 CDS product DEAD-box ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHF7 protein_id gnl|my_center|LOCUS_12280 97447 98658 gene locus_tag LOCUS_12290 97447 98658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 98725 99039 gene locus_tag LOCUS_12300 98725 99039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 100029 99058 gene locus_tag LOCUS_12310 100029 99058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 100209 100979 gene locus_tag LOCUS_12320 100209 100979 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731349.1 protein_id gnl|my_center|LOCUS_12320 101463 101807 gene locus_tag LOCUS_12330 101463 101807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence013 1186 92 gene locus_tag LOCUS_12340 1186 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2292 1273 gene locus_tag LOCUS_12350 2292 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 2606 3928 gene locus_tag LOCUS_12360 2606 3928 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867488.1 protein_id gnl|my_center|LOCUS_12360 4934 3978 gene locus_tag LOCUS_12370 4934 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 4821 5027 gene locus_tag LOCUS_12380 4821 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 8740 5192 gene locus_tag LOCUS_12390 8740 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 8933 9832 gene locus_tag LOCUS_12400 8933 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 10749 9931 gene locus_tag LOCUS_12410 10749 9931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 10867 11706 gene locus_tag LOCUS_12420 10867 11706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 11687 12955 gene locus_tag LOCUS_12430 11687 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 13072 13728 gene locus_tag LOCUS_12440 13072 13728 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_12440 14112 16223 gene locus_tag LOCUS_12450 14112 16223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_12450 16281 17465 gene locus_tag LOCUS_12460 16281 17465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 17676 18167 gene locus_tag LOCUS_12470 17676 18167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 19051 18158 gene locus_tag LOCUS_12480 19051 18158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 19496 20173 gene locus_tag LOCUS_12490 19496 20173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 20258 21295 gene locus_tag LOCUS_12500 20258 21295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 22600 21299 gene locus_tag LOCUS_12510 22600 21299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 22792 24171 gene locus_tag LOCUS_12520 22792 24171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 25903 24341 gene locus_tag LOCUS_12530 gene aplD 25903 24341 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941186.1 protein_id gnl|my_center|LOCUS_12530 26923 26282 gene locus_tag LOCUS_12540 26923 26282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_12540 27958 26927 gene locus_tag LOCUS_12550 27958 26927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 28560 28006 gene locus_tag LOCUS_12560 28560 28006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 29014 29568 gene locus_tag LOCUS_12570 29014 29568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144143.1 protein_id gnl|my_center|LOCUS_12570 30957 29665 gene locus_tag LOCUS_12580 30957 29665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 31519 30962 gene locus_tag LOCUS_12590 gene frr 31519 30962 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJP0 protein_id gnl|my_center|LOCUS_12590 32354 31596 gene locus_tag LOCUS_12600 gene pyrH 32354 31596 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM63 protein_id gnl|my_center|LOCUS_12600 33409 32516 gene locus_tag LOCUS_12610 gene tsf 33409 32516 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPG8 protein_id gnl|my_center|LOCUS_12610 34434 33628 gene locus_tag LOCUS_12620 gene rpsB 34434 33628 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW1 protein_id gnl|my_center|LOCUS_12620 34729 35697 gene locus_tag LOCUS_12630 34729 35697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 36235 35678 gene locus_tag LOCUS_12640 36235 35678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 37802 36537 gene locus_tag LOCUS_12650 37802 36537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 38598 37921 gene locus_tag LOCUS_12660 38598 37921 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_12660 39730 38717 gene locus_tag LOCUS_12670 gene dnaJ 39730 38717 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399410.1 protein_id gnl|my_center|LOCUS_12670 40489 39746 gene locus_tag LOCUS_12680 40489 39746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 40949 40491 gene locus_tag LOCUS_12690 40949 40491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 41423 40953 gene locus_tag LOCUS_12700 gene ribH 41423 40953 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPU4 protein_id gnl|my_center|LOCUS_12700 42622 41474 gene locus_tag LOCUS_12710 gene ribA 42622 41474 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI3 protein_id gnl|my_center|LOCUS_12710 43864 42719 gene locus_tag LOCUS_12720 43864 42719 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_12720 44347 43901 gene locus_tag LOCUS_12730 gene nrdR 44347 43901 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MN60 protein_id gnl|my_center|LOCUS_12730 45155 44469 gene locus_tag LOCUS_12740 45155 44469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 45581 45396 gene locus_tag LOCUS_12750 gene rpmF 45581 45396 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS3 protein_id gnl|my_center|LOCUS_12750 46340 45744 gene locus_tag LOCUS_12760 46340 45744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 47001 46471 gene locus_tag LOCUS_12770 47001 46471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 48190 47030 gene locus_tag LOCUS_12780 48190 47030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 48516 49505 gene locus_tag LOCUS_12790 48516 49505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 50421 49471 gene locus_tag LOCUS_12800 gene hemF 50421 49471 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEK3 protein_id gnl|my_center|LOCUS_12800 51617 50445 gene locus_tag LOCUS_12810 51617 50445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 51805 52773 gene locus_tag LOCUS_12820 51805 52773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 56992 52799 gene locus_tag LOCUS_12830 56992 52799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 57866 57165 gene locus_tag LOCUS_12840 57866 57165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 58195 58929 gene locus_tag LOCUS_12850 58195 58929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 58957 61065 gene locus_tag LOCUS_12860 58957 61065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 61948 61073 gene locus_tag LOCUS_12870 61948 61073 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533789.1 protein_id gnl|my_center|LOCUS_12870 62147 62788 gene locus_tag LOCUS_12880 62147 62788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 63224 65845 gene locus_tag LOCUS_12890 gene leuS 63224 65845 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S415 protein_id gnl|my_center|LOCUS_12890 68143 65939 gene locus_tag LOCUS_12900 68143 65939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 68390 70528 gene locus_tag LOCUS_12910 68390 70528 CDS product tungsten formylmethanofuran dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403352.1 protein_id gnl|my_center|LOCUS_12910 71571 70624 gene locus_tag LOCUS_12920 71571 70624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 71921 74809 gene locus_tag LOCUS_12930 71921 74809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 75117 74818 gene locus_tag LOCUS_12940 75117 74818 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE17 protein_id gnl|my_center|LOCUS_12940 79532 75219 gene locus_tag LOCUS_12950 79532 75219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 80073 79732 gene locus_tag LOCUS_12960 80073 79732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 80349 81734 gene locus_tag LOCUS_12970 gene tgt-1 80349 81734 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DZ0 protein_id gnl|my_center|LOCUS_12970 82294 81869 gene locus_tag LOCUS_12980 82294 81869 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316399.1 protein_id gnl|my_center|LOCUS_12980 82357 84564 gene locus_tag LOCUS_12990 82357 84564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 84595 85635 gene locus_tag LOCUS_13000 84595 85635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 87387 85636 gene locus_tag LOCUS_13010 87387 85636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 87892 88518 gene locus_tag LOCUS_13020 87892 88518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 88608 91646 gene locus_tag LOCUS_13030 88608 91646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 91643 92203 gene locus_tag LOCUS_13040 91643 92203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 92243 93967 gene locus_tag LOCUS_13050 92243 93967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 <95311 94026 gene locus_tag LOCUS_13060 <95311 94026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727485.1:peptidase M23 >Feature sequence014 1706 1059 gene locus_tag LOCUS_13070 1706 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2303 2935 gene locus_tag LOCUS_13080 2303 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 3748 2963 gene locus_tag LOCUS_13090 3748 2963 CDS product L-beta-lysine 5,6-aminomutase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX8 protein_id gnl|my_center|LOCUS_13090 4146 7823 gene locus_tag LOCUS_13100 4146 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 8044 9558 gene locus_tag LOCUS_13110 8044 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 9583 10080 gene locus_tag LOCUS_13120 9583 10080 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_13120 10178 10579 gene locus_tag LOCUS_13130 10178 10579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 10576 15165 gene locus_tag LOCUS_13140 10576 15165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 15276 17039 gene locus_tag LOCUS_13150 15276 17039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 17029 19308 gene locus_tag LOCUS_13160 17029 19308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 20185 19394 gene locus_tag LOCUS_13170 20185 19394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 23094 20443 gene locus_tag LOCUS_13180 23094 20443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 23310 24029 gene locus_tag LOCUS_13190 gene trmH 23310 24029 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S465 protein_id gnl|my_center|LOCUS_13190 24364 24678 gene locus_tag LOCUS_13200 gene rplU 24364 24678 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL02 protein_id gnl|my_center|LOCUS_13200 24795 25067 gene locus_tag LOCUS_13210 gene rpmA 24795 25067 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS69 protein_id gnl|my_center|LOCUS_13210 25255 26349 gene locus_tag LOCUS_13220 gene obg 25255 26349 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MVI5 protein_id gnl|my_center|LOCUS_13220 26594 26364 gene locus_tag LOCUS_13230 26594 26364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 26879 26601 gene locus_tag LOCUS_13240 26879 26601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 27629 26922 gene locus_tag LOCUS_13250 27629 26922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 27885 29015 gene locus_tag LOCUS_13260 27885 29015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 29089 31221 gene locus_tag LOCUS_13270 29089 31221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 31225 32160 gene locus_tag LOCUS_13280 31225 32160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 32267 33313 gene locus_tag LOCUS_13290 gene moaA 32267 33313 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZU05 protein_id gnl|my_center|LOCUS_13290 38696 33426 gene locus_tag LOCUS_13300 38696 33426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 41078 38913 gene locus_tag LOCUS_13310 41078 38913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 44714 41193 gene locus_tag LOCUS_13320 44714 41193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 46084 44894 gene locus_tag LOCUS_13330 46084 44894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 47284 46295 gene locus_tag LOCUS_13340 gene oxyR 47284 46295 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_13340 47752 48258 gene locus_tag LOCUS_13350 47752 48258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 48338 50569 gene locus_tag LOCUS_13360 gene ccmF 48338 50569 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997623.1 protein_id gnl|my_center|LOCUS_13360 50566 51183 gene locus_tag LOCUS_13370 50566 51183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 51201 52589 gene locus_tag LOCUS_13380 51201 52589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 52589 53281 gene locus_tag LOCUS_13390 52589 53281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_13390 53283 53972 gene locus_tag LOCUS_13400 53283 53972 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_13400 54742 54140 gene locus_tag LOCUS_13410 54742 54140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 56069 54807 gene locus_tag LOCUS_13420 56069 54807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 57336 56113 gene locus_tag LOCUS_13430 57336 56113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 58399 57449 gene locus_tag LOCUS_13440 58399 57449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 59382 58522 gene locus_tag LOCUS_13450 59382 58522 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812713.1 protein_id gnl|my_center|LOCUS_13450 61454 59562 gene locus_tag LOCUS_13460 61454 59562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 62909 61476 gene locus_tag LOCUS_13470 62909 61476 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810175.1 protein_id gnl|my_center|LOCUS_13470 64109 63252 gene locus_tag LOCUS_13480 64109 63252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 64890 64327 gene locus_tag LOCUS_13490 64890 64327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 64992 65609 gene locus_tag LOCUS_13500 64992 65609 CDS product oxetanocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248969.1 protein_id gnl|my_center|LOCUS_13500 67471 65639 gene locus_tag LOCUS_13510 67471 65639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 69093 67531 gene locus_tag LOCUS_13520 69093 67531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 69483 70622 gene locus_tag LOCUS_13530 69483 70622 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256700.1 protein_id gnl|my_center|LOCUS_13530 71038 72063 gene locus_tag LOCUS_13540 71038 72063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 72063 73634 gene locus_tag LOCUS_13550 72063 73634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 73706 74938 gene locus_tag LOCUS_13560 73706 74938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 75656 74946 gene locus_tag LOCUS_13570 75656 74946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 76513 75683 gene locus_tag LOCUS_13580 76513 75683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 77701 77018 gene locus_tag LOCUS_13590 77701 77018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 78092 83665 gene locus_tag LOCUS_13600 78092 83665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 84882 84019 gene locus_tag LOCUS_13610 84882 84019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 85924 84929 gene locus_tag LOCUS_13620 85924 84929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 86304 86732 gene locus_tag LOCUS_13630 86304 86732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 86860 87288 gene locus_tag LOCUS_13640 86860 87288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 87340 88755 gene locus_tag LOCUS_13650 87340 88755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 89371 88700 gene locus_tag LOCUS_13660 89371 88700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 90980 89391 gene locus_tag LOCUS_13670 90980 89391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 92630 91032 gene locus_tag LOCUS_13680 92630 91032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence015 1783 758 gene locus_tag LOCUS_13690 1783 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 2296 1895 gene locus_tag LOCUS_13700 gene doc 2296 1895 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_13700 2496 2296 gene locus_tag LOCUS_13710 2496 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 2816 4873 gene locus_tag LOCUS_13720 gene uvrB 2816 4873 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747K3 protein_id gnl|my_center|LOCUS_13720 5036 6070 gene locus_tag LOCUS_13730 5036 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 6054 6353 gene locus_tag LOCUS_13740 6054 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 6703 7296 gene locus_tag LOCUS_13750 6703 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 7502 7681 gene locus_tag LOCUS_13760 7502 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 7963 9204 gene locus_tag LOCUS_13770 gene gdhA 7963 9204 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPH7 protein_id gnl|my_center|LOCUS_13770 10905 9364 gene locus_tag LOCUS_13780 gene cysS 10905 9364 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747A2 protein_id gnl|my_center|LOCUS_13780 11232 13319 gene locus_tag LOCUS_13790 11232 13319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 13560 14363 gene locus_tag LOCUS_13800 13560 14363 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479170.1 protein_id gnl|my_center|LOCUS_13800 14858 14520 gene locus_tag LOCUS_13810 14858 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 15562 15101 gene locus_tag LOCUS_13820 15562 15101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 17304 15901 gene locus_tag LOCUS_13830 gene rimO 17304 15901 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747R0 protein_id gnl|my_center|LOCUS_13830 17612 17301 gene locus_tag LOCUS_13840 17612 17301 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659158.1 protein_id gnl|my_center|LOCUS_13840 17944 18498 gene locus_tag LOCUS_13850 17944 18498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 19212 20459 gene locus_tag LOCUS_13860 gene rho 19212 20459 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748A7 protein_id gnl|my_center|LOCUS_13860 20776 21855 gene locus_tag LOCUS_13870 gene prfA 20776 21855 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT29 protein_id gnl|my_center|LOCUS_13870 21905 22498 gene locus_tag LOCUS_13880 21905 22498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528306.1 protein_id gnl|my_center|LOCUS_13880 22719 23873 gene locus_tag LOCUS_13890 22719 23873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 26113 24221 gene locus_tag LOCUS_13900 26113 24221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 27096 26110 gene locus_tag LOCUS_13910 27096 26110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 27800 27093 gene locus_tag LOCUS_13920 27800 27093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 29004 27892 gene locus_tag LOCUS_13930 29004 27892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 29194 30012 gene locus_tag LOCUS_13940 29194 30012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 30015 31262 gene locus_tag LOCUS_13950 30015 31262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 31477 32283 gene locus_tag LOCUS_13960 31477 32283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 33170 32364 gene locus_tag LOCUS_13970 gene tatC 33170 32364 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D88 protein_id gnl|my_center|LOCUS_13970 33718 33167 gene locus_tag LOCUS_13980 33718 33167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 34382 33831 gene locus_tag LOCUS_13990 34382 33831 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_13990 36800 34731 gene locus_tag LOCUS_14000 36800 34731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 38875 36797 gene locus_tag LOCUS_14010 38875 36797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 41575 39584 gene locus_tag LOCUS_14020 gene tkt 41575 39584 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_14020 42095 44068 gene locus_tag LOCUS_14030 42095 44068 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H3 protein_id gnl|my_center|LOCUS_14030 44426 44229 gene locus_tag LOCUS_14040 44426 44229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 44781 44545 gene locus_tag LOCUS_14050 44781 44545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 45712 45278 gene locus_tag LOCUS_14060 45712 45278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 47568 46081 gene locus_tag LOCUS_14070 47568 46081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 48973 47672 gene locus_tag LOCUS_14080 gene thrC 48973 47672 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405095.1 protein_id gnl|my_center|LOCUS_14080 49967 49023 gene locus_tag LOCUS_14090 gene thrB 49967 49023 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Q0 protein_id gnl|my_center|LOCUS_14090 52453 49964 gene locus_tag LOCUS_14100 gene thrA 52453 49964 CDS product bifunctional aspartokinase I/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403462.1 protein_id gnl|my_center|LOCUS_14100 55454 52623 gene locus_tag LOCUS_14110 55454 52623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 55961 59134 gene locus_tag LOCUS_14120 55961 59134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 60427 59093 gene locus_tag LOCUS_14130 60427 59093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 60598 62358 gene locus_tag LOCUS_14140 60598 62358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 63054 62368 gene locus_tag LOCUS_14150 63054 62368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 64028 63051 gene locus_tag LOCUS_14160 64028 63051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 64868 64107 gene locus_tag LOCUS_14170 64868 64107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 65054 65560 gene locus_tag LOCUS_14180 65054 65560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 66749 65574 gene locus_tag LOCUS_14190 66749 65574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 67073 68473 gene locus_tag LOCUS_14200 67073 68473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 70498 68558 gene locus_tag LOCUS_14210 gene acsA 70498 68558 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WV5 protein_id gnl|my_center|LOCUS_14210 73115 71325 gene locus_tag LOCUS_14220 73115 71325 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_14220 74013 73168 gene locus_tag LOCUS_14230 74013 73168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 76980 74110 gene locus_tag LOCUS_14240 76980 74110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 77875 78936 gene locus_tag LOCUS_14250 77875 78936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 78989 79564 gene locus_tag LOCUS_14260 78989 79564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 80722 79574 gene locus_tag LOCUS_14270 80722 79574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550279.1 protein_id gnl|my_center|LOCUS_14270 82201 80816 gene locus_tag LOCUS_14280 82201 80816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204001.1 protein_id gnl|my_center|LOCUS_14280 83116 82304 gene locus_tag LOCUS_14290 83116 82304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331492.1 protein_id gnl|my_center|LOCUS_14290 83657 83187 gene locus_tag LOCUS_14300 83657 83187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 84250 83681 gene locus_tag LOCUS_14310 84250 83681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 85116 84388 gene locus_tag LOCUS_14320 85116 84388 CDS product RNA polymerase sigma factor for flagellar operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546657.1 protein_id gnl|my_center|LOCUS_14320 86258 85260 gene locus_tag LOCUS_14330 86258 85260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 87437 86349 gene locus_tag LOCUS_14340 87437 86349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 87739 90198 gene locus_tag LOCUS_14350 87739 90198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence016 1631 69 gene locus_tag LOCUS_14360 1631 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1889 2788 gene locus_tag LOCUS_14370 1889 2788 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939052.1 protein_id gnl|my_center|LOCUS_14370 3463 2792 gene locus_tag LOCUS_14380 3463 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3582 4517 gene locus_tag LOCUS_14390 3582 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 5020 4541 gene locus_tag LOCUS_14400 gene greA 5020 4541 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFC6 protein_id gnl|my_center|LOCUS_14400 7628 5196 gene locus_tag LOCUS_14410 gene lon 7628 5196 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2J0 protein_id gnl|my_center|LOCUS_14410 7995 9056 gene locus_tag LOCUS_14420 7995 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 9347 9940 gene locus_tag LOCUS_14430 9347 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 10234 10752 gene locus_tag LOCUS_14440 10234 10752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 10863 12146 gene locus_tag LOCUS_14450 10863 12146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 12954 12307 gene locus_tag LOCUS_14460 12954 12307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 13170 14351 gene locus_tag LOCUS_14470 13170 14351 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088637.1 protein_id gnl|my_center|LOCUS_14470 14445 15095 gene locus_tag LOCUS_14480 14445 15095 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404017.1 protein_id gnl|my_center|LOCUS_14480 15770 15111 gene locus_tag LOCUS_14490 15770 15111 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_14490 16053 15877 gene locus_tag LOCUS_14500 16053 15877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 17484 16183 gene locus_tag LOCUS_14510 17484 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 18131 17526 gene locus_tag LOCUS_14520 18131 17526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 18323 19315 gene locus_tag LOCUS_14530 18323 19315 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420592.1 protein_id gnl|my_center|LOCUS_14530 20721 19318 gene locus_tag LOCUS_14540 20721 19318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 20878 21735 gene locus_tag LOCUS_14550 gene hbd 20878 21735 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538869.1 protein_id gnl|my_center|LOCUS_14550 21744 22511 gene locus_tag LOCUS_14560 21744 22511 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_14560 22547 22975 gene locus_tag LOCUS_14570 22547 22975 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_14570 23015 23989 gene locus_tag LOCUS_14580 23015 23989 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_14580 25031 24171 gene locus_tag LOCUS_14590 25031 24171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 29006 25137 gene locus_tag LOCUS_14600 29006 25137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 29360 30043 gene locus_tag LOCUS_14610 29360 30043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 30157 30882 gene locus_tag LOCUS_14620 30157 30882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 31556 30885 gene locus_tag LOCUS_14630 31556 30885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 32895 31591 gene locus_tag LOCUS_14640 gene purA 32895 31591 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747F9 protein_id gnl|my_center|LOCUS_14640 34205 33066 gene locus_tag LOCUS_14650 34205 33066 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545576.1 protein_id gnl|my_center|LOCUS_14650 35500 34307 gene locus_tag LOCUS_14660 gene dprA 35500 34307 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_14660 36408 35617 gene locus_tag LOCUS_14670 gene prpC 36408 35617 CDS product protein phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34779 protein_id gnl|my_center|LOCUS_14670 38559 36745 gene locus_tag LOCUS_14680 38559 36745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 39389 38778 gene locus_tag LOCUS_14690 39389 38778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 39658 40356 gene locus_tag LOCUS_14700 39658 40356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 40369 42588 gene locus_tag LOCUS_14710 40369 42588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 45039 42610 gene locus_tag LOCUS_14720 45039 42610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 46580 45099 gene locus_tag LOCUS_14730 46580 45099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 46980 46684 gene locus_tag LOCUS_14740 46980 46684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 47597 47022 gene locus_tag LOCUS_14750 47597 47022 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110142.1 protein_id gnl|my_center|LOCUS_14750 51645 47803 gene locus_tag LOCUS_14760 gene sbcC 51645 47803 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDA7 protein_id gnl|my_center|LOCUS_14760 52972 51692 gene locus_tag LOCUS_14770 gene sbcD 52972 51692 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB67 protein_id gnl|my_center|LOCUS_14770 53832 53194 gene locus_tag LOCUS_14780 53832 53194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 54908 53958 gene locus_tag LOCUS_14790 54908 53958 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_14790 55606 57339 gene locus_tag LOCUS_14800 55606 57339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 58067 57444 gene locus_tag LOCUS_14810 gene pmgA 58067 57444 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658522.1 protein_id gnl|my_center|LOCUS_14810 58169 59719 gene locus_tag LOCUS_14820 58169 59719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 60856 59819 gene locus_tag LOCUS_14830 60856 59819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 61852 61076 gene locus_tag LOCUS_14840 gene pspA 61852 61076 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_14840 62441 61983 gene locus_tag LOCUS_14850 62441 61983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 63160 64461 gene locus_tag LOCUS_14860 63160 64461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 64677 66605 gene locus_tag LOCUS_14870 64677 66605 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141553.1 protein_id gnl|my_center|LOCUS_14870 67279 66968 gene locus_tag LOCUS_14880 67279 66968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 67927 68361 gene locus_tag LOCUS_14890 67927 68361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 68581 71904 gene locus_tag LOCUS_14900 68581 71904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 71970 72608 gene locus_tag LOCUS_14910 71970 72608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 72605 73588 gene locus_tag LOCUS_14920 72605 73588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 73599 74114 gene locus_tag LOCUS_14930 73599 74114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 74157 74471 gene locus_tag LOCUS_14940 74157 74471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 74927 75622 gene locus_tag LOCUS_14950 74927 75622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 77326 75629 gene locus_tag LOCUS_14960 77326 75629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 78584 77739 gene locus_tag LOCUS_14970 gene rsmA 78584 77739 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXX8 protein_id gnl|my_center|LOCUS_14970 78788 79162 gene locus_tag LOCUS_14980 78788 79162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 79964 79170 gene locus_tag LOCUS_14990 79964 79170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 80473 79967 gene locus_tag LOCUS_15000 gene moaC 80473 79967 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG82 protein_id gnl|my_center|LOCUS_15000 82811 80478 gene locus_tag LOCUS_15010 82811 80478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 83921 82971 gene locus_tag LOCUS_15020 83921 82971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 84504 84235 gene locus_tag LOCUS_15030 84504 84235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 86323 84644 gene locus_tag LOCUS_15040 gene yljF 86323 84644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_15040 89560 86366 gene locus_tag LOCUS_15050 89560 86366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence017 1752 490 gene locus_tag LOCUS_15060 1752 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 3288 1777 gene locus_tag LOCUS_15070 3288 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 4337 3444 gene locus_tag LOCUS_15080 4337 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4469 5806 gene locus_tag LOCUS_15090 4469 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 6561 5815 gene locus_tag LOCUS_15100 6561 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 6787 7569 gene locus_tag LOCUS_15110 6787 7569 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882004.1 protein_id gnl|my_center|LOCUS_15110 7688 8962 gene locus_tag LOCUS_15120 gene yfcY 7688 8962 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035450.1 protein_id gnl|my_center|LOCUS_15120 9259 9978 gene locus_tag LOCUS_15130 9259 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 11077 9995 gene locus_tag LOCUS_15140 11077 9995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 11703 11074 gene locus_tag LOCUS_15150 11703 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480777.1 protein_id gnl|my_center|LOCUS_15150 11954 12772 gene locus_tag LOCUS_15160 gene nei 11954 12772 CDS product endonuclease 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50465 protein_id gnl|my_center|LOCUS_15160 12919 13518 gene locus_tag LOCUS_15170 12919 13518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 13522 14649 gene locus_tag LOCUS_15180 13522 14649 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458821.1 protein_id gnl|my_center|LOCUS_15180 15123 14662 gene locus_tag LOCUS_15190 15123 14662 CDS product Rieske iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731351.1 protein_id gnl|my_center|LOCUS_15190 15084 15359 gene locus_tag LOCUS_15200 15084 15359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 15366 16820 gene locus_tag LOCUS_15210 15366 16820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 18164 17025 gene locus_tag LOCUS_15220 18164 17025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 20051 18276 gene locus_tag LOCUS_15230 20051 18276 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886676.1 protein_id gnl|my_center|LOCUS_15230 20919 20200 gene locus_tag LOCUS_15240 20919 20200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_15240 21056 21553 gene locus_tag LOCUS_15250 21056 21553 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224025.1 protein_id gnl|my_center|LOCUS_15250 21819 22067 gene locus_tag LOCUS_15260 21819 22067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 22712 22191 gene locus_tag LOCUS_15270 22712 22191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 22861 23673 gene locus_tag LOCUS_15280 22861 23673 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903881.1 protein_id gnl|my_center|LOCUS_15280 24297 23809 gene locus_tag LOCUS_15290 24297 23809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 25235 24393 gene locus_tag LOCUS_15300 25235 24393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 25392 26231 gene locus_tag LOCUS_15310 25392 26231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_15310 26256 26672 gene locus_tag LOCUS_15320 26256 26672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086091.1 protein_id gnl|my_center|LOCUS_15320 27080 26676 gene locus_tag LOCUS_15330 27080 26676 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876350.1 protein_id gnl|my_center|LOCUS_15330 28079 27234 gene locus_tag LOCUS_15340 28079 27234 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226336.1 protein_id gnl|my_center|LOCUS_15340 29057 28092 gene locus_tag LOCUS_15350 29057 28092 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 protein_id gnl|my_center|LOCUS_15350 30287 29082 gene locus_tag LOCUS_15360 30287 29082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 30430 31194 gene locus_tag LOCUS_15370 30430 31194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 31427 32935 gene locus_tag LOCUS_15380 31427 32935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 34542 33073 gene locus_tag LOCUS_15390 gene glnA 34542 33073 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C40 protein_id gnl|my_center|LOCUS_15390 34979 34638 gene locus_tag LOCUS_15400 gene glnB 34979 34638 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_15400 35686 35189 gene locus_tag LOCUS_15410 35686 35189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 36474 35683 gene locus_tag LOCUS_15420 36474 35683 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ99 protein_id gnl|my_center|LOCUS_15420 37410 36484 gene locus_tag LOCUS_15430 37410 36484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 37567 38346 gene locus_tag LOCUS_15440 37567 38346 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088784.1 protein_id gnl|my_center|LOCUS_15440 38506 40221 gene locus_tag LOCUS_15450 38506 40221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 40312 42939 gene locus_tag LOCUS_15460 40312 42939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 43585 42944 gene locus_tag LOCUS_15470 43585 42944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 43720 44523 gene locus_tag LOCUS_15480 43720 44523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 46391 44520 gene locus_tag LOCUS_15490 46391 44520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 46634 46894 gene locus_tag LOCUS_15500 46634 46894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 46983 47288 gene locus_tag LOCUS_15510 46983 47288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 47437 47354 gene locus_tag LOCUS_t00130 47437 47354 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 47790 48164 gene locus_tag LOCUS_15520 47790 48164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 48392 48964 gene locus_tag LOCUS_15530 48392 48964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 52294 49046 gene locus_tag LOCUS_15540 52294 49046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 55811 52422 gene locus_tag LOCUS_15550 55811 52422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 57198 55981 gene locus_tag LOCUS_15560 57198 55981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 58633 57383 gene locus_tag LOCUS_15570 58633 57383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 60059 58623 gene locus_tag LOCUS_15580 60059 58623 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118912.1 protein_id gnl|my_center|LOCUS_15580 60403 60098 gene locus_tag LOCUS_15590 60403 60098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 60514 61638 gene locus_tag LOCUS_15600 60514 61638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 61917 65561 gene locus_tag LOCUS_15610 61917 65561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 65815 68661 gene locus_tag LOCUS_15620 65815 68661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 68972 70465 gene locus_tag LOCUS_15630 68972 70465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 70593 70664 gene locus_tag LOCUS_t00140 70593 70664 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 70971 71594 gene locus_tag LOCUS_15640 gene rplY 70971 71594 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE7 protein_id gnl|my_center|LOCUS_15640 71687 72259 gene locus_tag LOCUS_15650 gene pth 71687 72259 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPW6 protein_id gnl|my_center|LOCUS_15650 72375 74798 gene locus_tag LOCUS_15660 gene hppA1 72375 74798 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_15660 74996 75364 gene locus_tag LOCUS_15670 gene rpsF 74996 75364 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21468 protein_id gnl|my_center|LOCUS_15670 75422 75865 gene locus_tag LOCUS_15680 gene rplI 75422 75865 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DH1 protein_id gnl|my_center|LOCUS_15680 76039 79038 gene locus_tag LOCUS_15690 76039 79038 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_15690 80388 79042 gene locus_tag LOCUS_15700 80388 79042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 80371 80634 gene locus_tag LOCUS_15710 80371 80634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 81844 80624 gene locus_tag LOCUS_15720 81844 80624 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D0V6 protein_id gnl|my_center|LOCUS_15720 83430 81994 gene locus_tag LOCUS_15730 83430 81994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 84379 83600 gene locus_tag LOCUS_15740 gene tam 84379 83600 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX93 protein_id gnl|my_center|LOCUS_15740 85069 84593 gene locus_tag LOCUS_15750 gene fur 85069 84593 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_15750 85283 86587 gene locus_tag LOCUS_15760 gene pfp 85283 86587 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYC5 protein_id gnl|my_center|LOCUS_15760 86828 87691 gene locus_tag LOCUS_15770 86828 87691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 87743 88669 gene locus_tag LOCUS_15780 87743 88669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 88723 89316 gene locus_tag LOCUS_15790 88723 89316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 89288 89908 gene locus_tag LOCUS_15800 89288 89908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence018 1093 68 gene locus_tag LOCUS_15810 1093 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2272 1106 gene locus_tag LOCUS_15820 gene aspC-2 2272 1106 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCN2 protein_id gnl|my_center|LOCUS_15820 3447 2419 gene locus_tag LOCUS_15830 3447 2419 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_15830 3807 3550 gene locus_tag LOCUS_15840 3807 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 3725 6172 gene locus_tag LOCUS_15850 3725 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 6284 7648 gene locus_tag LOCUS_15860 6284 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 11519 7662 gene locus_tag LOCUS_15870 11519 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 11636 13189 gene locus_tag LOCUS_15880 11636 13189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 13278 14792 gene locus_tag LOCUS_15890 13278 14792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 14789 15574 gene locus_tag LOCUS_15900 14789 15574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 15591 17018 gene locus_tag LOCUS_15910 15591 17018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 17111 17839 gene locus_tag LOCUS_15920 gene trmB 17111 17839 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNV5 protein_id gnl|my_center|LOCUS_15920 19990 17843 gene locus_tag LOCUS_15930 19990 17843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 21514 20081 gene locus_tag LOCUS_15940 21514 20081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 21834 22811 gene locus_tag LOCUS_15950 21834 22811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 25008 22831 gene locus_tag LOCUS_15960 25008 22831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 25229 25846 gene locus_tag LOCUS_15970 25229 25846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 25926 26576 gene locus_tag LOCUS_15980 25926 26576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 26723 27175 gene locus_tag LOCUS_15990 26723 27175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 30661 27191 gene locus_tag LOCUS_16000 gene pyc 30661 27191 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEL7 protein_id gnl|my_center|LOCUS_16000 30893 32179 gene locus_tag LOCUS_16010 30893 32179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 33201 37247 gene locus_tag LOCUS_16020 33201 37247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 37423 38694 gene locus_tag LOCUS_16030 37423 38694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 40048 38684 gene locus_tag LOCUS_16040 gene hutF 40048 38684 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727478.1 protein_id gnl|my_center|LOCUS_16040 40626 40081 gene locus_tag LOCUS_16050 40626 40081 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122464.1 protein_id gnl|my_center|LOCUS_16050 41930 41094 gene locus_tag LOCUS_16060 41930 41094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 42614 41976 gene locus_tag LOCUS_16070 42614 41976 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709194.1 protein_id gnl|my_center|LOCUS_16070 43841 42645 gene locus_tag LOCUS_16080 43841 42645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 45833 43860 gene locus_tag LOCUS_16090 45833 43860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 47386 45830 gene locus_tag LOCUS_16100 gene dnaK 47386 45830 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_16100 48583 48509 gene locus_tag LOCUS_t00150 48583 48509 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 48807 49802 gene locus_tag LOCUS_16110 48807 49802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 49952 50650 gene locus_tag LOCUS_16120 49952 50650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 50767 51678 gene locus_tag LOCUS_16130 50767 51678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 51786 54161 gene locus_tag LOCUS_16140 51786 54161 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769101.1 protein_id gnl|my_center|LOCUS_16140 54234 55661 gene locus_tag LOCUS_16150 54234 55661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_16150 56550 55663 gene locus_tag LOCUS_16160 56550 55663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 58594 56717 gene locus_tag LOCUS_16170 58594 56717 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_16170 59432 58776 gene locus_tag LOCUS_16180 gene raiA 59432 58776 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_16180 61016 59544 gene locus_tag LOCUS_16190 gene rpoN 61016 59544 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ1 protein_id gnl|my_center|LOCUS_16190 61437 61021 gene locus_tag LOCUS_16200 61437 61021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 62180 64807 gene locus_tag LOCUS_16210 62180 64807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 66454 64949 gene locus_tag LOCUS_16220 gene astD 66454 64949 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LN5 protein_id gnl|my_center|LOCUS_16220 66701 67714 gene locus_tag LOCUS_16230 66701 67714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 68199 69272 gene locus_tag LOCUS_16240 gene moxR 68199 69272 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_16240 69272 70507 gene locus_tag LOCUS_16250 69272 70507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 70504 71406 gene locus_tag LOCUS_16260 70504 71406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_16260 71437 73593 gene locus_tag LOCUS_16270 71437 73593 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120924.1 protein_id gnl|my_center|LOCUS_16270 73652 74371 gene locus_tag LOCUS_16280 73652 74371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 75901 74426 gene locus_tag LOCUS_16290 75901 74426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 76473 75898 gene locus_tag LOCUS_16300 gene algU 76473 75898 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIP2 protein_id gnl|my_center|LOCUS_16300 77785 76508 gene locus_tag LOCUS_16310 77785 76508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 79135 77927 gene locus_tag LOCUS_16320 79135 77927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814068.1 protein_id gnl|my_center|LOCUS_16320 80175 79246 gene locus_tag LOCUS_16330 80175 79246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 81799 80177 gene locus_tag LOCUS_16340 81799 80177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 81864 82880 gene locus_tag LOCUS_16350 81864 82880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 82922 83710 gene locus_tag LOCUS_16360 82922 83710 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_16360 83802 87248 gene locus_tag LOCUS_16370 83802 87248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 87245 88858 gene locus_tag LOCUS_16380 87245 88858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence019 490 1077 gene locus_tag LOCUS_16390 490 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1131 4550 gene locus_tag LOCUS_16400 1131 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4650 6515 gene locus_tag LOCUS_16410 4650 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 7185 6913 gene locus_tag LOCUS_16420 7185 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 7297 7743 gene locus_tag LOCUS_16430 7297 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 7821 9452 gene locus_tag LOCUS_16440 7821 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 10829 9453 gene locus_tag LOCUS_16450 10829 9453 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142768.1 protein_id gnl|my_center|LOCUS_16450 10979 11608 gene locus_tag LOCUS_16460 10979 11608 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089232.1 protein_id gnl|my_center|LOCUS_16460 13681 11615 gene locus_tag LOCUS_16470 13681 11615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 14394 13738 gene locus_tag LOCUS_16480 14394 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 14671 16098 gene locus_tag LOCUS_16490 14671 16098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 16587 17555 gene locus_tag LOCUS_16500 16587 17555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 18001 17654 gene locus_tag LOCUS_16510 18001 17654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 18313 18026 gene locus_tag LOCUS_16520 18313 18026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 19248 18373 gene locus_tag LOCUS_16530 19248 18373 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NU86 protein_id gnl|my_center|LOCUS_16530 19832 20446 gene locus_tag LOCUS_16540 19832 20446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 20493 20831 gene locus_tag LOCUS_16550 20493 20831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 20809 21315 gene locus_tag LOCUS_16560 20809 21315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16560 21924 22337 gene locus_tag LOCUS_16570 21924 22337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 22369 22626 gene locus_tag LOCUS_16580 22369 22626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 22623 22781 gene locus_tag LOCUS_16590 22623 22781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 23757 22795 gene locus_tag LOCUS_16600 23757 22795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 24502 23846 gene locus_tag LOCUS_16610 24502 23846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 25105 25419 gene locus_tag LOCUS_16620 25105 25419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 25560 26036 gene locus_tag LOCUS_16630 25560 26036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 26083 26364 gene locus_tag LOCUS_16640 26083 26364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 26410 29799 gene locus_tag LOCUS_16650 26410 29799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 30483 29830 gene locus_tag LOCUS_16660 30483 29830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 31466 30699 gene locus_tag LOCUS_16670 31466 30699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 32281 31463 gene locus_tag LOCUS_16680 32281 31463 CDS product molybdenum ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_16680 32952 32278 gene locus_tag LOCUS_16690 32952 32278 CDS product molybdate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775841.1 protein_id gnl|my_center|LOCUS_16690 33282 33905 gene locus_tag LOCUS_16700 33282 33905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 34669 34013 gene locus_tag LOCUS_16710 34669 34013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 38110 34856 gene locus_tag LOCUS_16720 38110 34856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 39556 38363 gene locus_tag LOCUS_16730 39556 38363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 40654 39560 gene locus_tag LOCUS_16740 40654 39560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 42819 40954 gene locus_tag LOCUS_16750 42819 40954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 44011 44487 gene locus_tag LOCUS_16760 44011 44487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 45001 44516 gene locus_tag LOCUS_16770 45001 44516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 45387 47144 gene locus_tag LOCUS_16780 45387 47144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 47090 47302 gene locus_tag LOCUS_16790 47090 47302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 47333 50383 gene locus_tag LOCUS_16800 47333 50383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 50544 51899 gene locus_tag LOCUS_16810 50544 51899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 54827 52083 gene locus_tag LOCUS_16820 54827 52083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 54820 55011 gene locus_tag LOCUS_16830 54820 55011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 54969 56477 gene locus_tag LOCUS_16840 54969 56477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 56470 58137 gene locus_tag LOCUS_16850 56470 58137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 58240 59310 gene locus_tag LOCUS_16860 58240 59310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 59463 59999 gene locus_tag LOCUS_16870 59463 59999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 60074 60709 gene locus_tag LOCUS_16880 60074 60709 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776561.1 protein_id gnl|my_center|LOCUS_16880 60934 62565 gene locus_tag LOCUS_16890 60934 62565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 62565 64577 gene locus_tag LOCUS_16900 62565 64577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 64621 66267 gene locus_tag LOCUS_16910 64621 66267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 66257 66961 gene locus_tag LOCUS_16920 66257 66961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 67337 68122 gene locus_tag LOCUS_16930 67337 68122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 68277 68933 gene locus_tag LOCUS_16940 68277 68933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 69016 69783 gene locus_tag LOCUS_16950 69016 69783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 69890 71098 gene locus_tag LOCUS_16960 69890 71098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731551.1 protein_id gnl|my_center|LOCUS_16960 72452 71115 gene locus_tag LOCUS_16970 72452 71115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 72795 73070 gene locus_tag LOCUS_16980 72795 73070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 73857 73171 gene locus_tag LOCUS_16990 73857 73171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 75486 74191 gene locus_tag LOCUS_17000 75486 74191 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704511.1 protein_id gnl|my_center|LOCUS_17000 75793 76974 gene locus_tag LOCUS_17010 75793 76974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 77270 79156 gene locus_tag LOCUS_17020 77270 79156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 79175 82858 gene locus_tag LOCUS_17030 79175 82858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 83198 83878 gene locus_tag LOCUS_17040 83198 83878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932797.1 protein_id gnl|my_center|LOCUS_17040 84107 85081 gene locus_tag LOCUS_17050 84107 85081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 85698 86441 gene locus_tag LOCUS_17060 85698 86441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 87005 87448 gene locus_tag LOCUS_17070 87005 87448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence020 2452 1697 gene locus_tag LOCUS_17080 2452 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 4059 2671 gene locus_tag LOCUS_17090 4059 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 5520 4144 gene locus_tag LOCUS_17100 5520 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 6405 7301 gene locus_tag LOCUS_17110 6405 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 8798 7449 gene locus_tag LOCUS_17120 8798 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 10354 9050 gene locus_tag LOCUS_17130 10354 9050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 13890 10429 gene locus_tag LOCUS_17140 13890 10429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 20524 14192 gene locus_tag LOCUS_17150 20524 14192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 20693 20899 gene locus_tag LOCUS_17160 20693 20899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 21443 20892 gene locus_tag LOCUS_17170 21443 20892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 27563 21546 gene locus_tag LOCUS_17180 27563 21546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 29176 27794 gene locus_tag LOCUS_17190 29176 27794 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545725.1 protein_id gnl|my_center|LOCUS_17190 29853 29125 gene locus_tag LOCUS_17200 29853 29125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 32771 31101 gene locus_tag LOCUS_17210 32771 31101 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_17210 33048 33206 gene locus_tag LOCUS_17220 33048 33206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 33273 33848 gene locus_tag LOCUS_17230 33273 33848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 35081 33912 gene locus_tag LOCUS_17240 35081 33912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 36384 35233 gene locus_tag LOCUS_17250 36384 35233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 37259 36504 gene locus_tag LOCUS_17260 37259 36504 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969776.1 protein_id gnl|my_center|LOCUS_17260 39103 37280 gene locus_tag LOCUS_17270 39103 37280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 40498 39413 gene locus_tag LOCUS_17280 40498 39413 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_17280 41087 40659 gene locus_tag LOCUS_17290 41087 40659 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122416.1 protein_id gnl|my_center|LOCUS_17290 41271 42221 gene locus_tag LOCUS_17300 41271 42221 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464972.1 protein_id gnl|my_center|LOCUS_17300 42344 45298 gene locus_tag LOCUS_17310 42344 45298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 45313 46134 gene locus_tag LOCUS_17320 45313 46134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776271.1 protein_id gnl|my_center|LOCUS_17320 46127 46612 gene locus_tag LOCUS_17330 46127 46612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 46640 48061 gene locus_tag LOCUS_17340 46640 48061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 48888 48043 gene locus_tag LOCUS_17350 48888 48043 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143748.1 protein_id gnl|my_center|LOCUS_17350 49103 49999 gene locus_tag LOCUS_17360 49103 49999 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262935.1 protein_id gnl|my_center|LOCUS_17360 50267 51121 gene locus_tag LOCUS_17370 50267 51121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 52755 51535 gene locus_tag LOCUS_17380 52755 51535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 53912 52752 gene locus_tag LOCUS_17390 53912 52752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 55270 57171 gene locus_tag LOCUS_17400 55270 57171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 57324 58127 gene locus_tag LOCUS_17410 57324 58127 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104155.1 protein_id gnl|my_center|LOCUS_17410 59663 58722 gene locus_tag LOCUS_17420 59663 58722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123165.1 protein_id gnl|my_center|LOCUS_17420 60540 59752 gene locus_tag LOCUS_17430 60540 59752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 61941 60565 gene locus_tag LOCUS_17440 61941 60565 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545725.1 protein_id gnl|my_center|LOCUS_17440 63460 61958 gene locus_tag LOCUS_17450 63460 61958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 63778 65376 gene locus_tag LOCUS_17460 gene ychM 63778 65376 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036716.1 protein_id gnl|my_center|LOCUS_17460 65792 67354 gene locus_tag LOCUS_17470 65792 67354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 protein_id gnl|my_center|LOCUS_17470 67429 68694 gene locus_tag LOCUS_17480 67429 68694 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804287.1 protein_id gnl|my_center|LOCUS_17480 68807 70591 gene locus_tag LOCUS_17490 68807 70591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 71643 70672 gene locus_tag LOCUS_17500 71643 70672 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_17500 72319 71870 gene locus_tag LOCUS_17510 72319 71870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 72535 73662 gene locus_tag LOCUS_17520 72535 73662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 73811 74278 gene locus_tag LOCUS_17530 73811 74278 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038637.1 protein_id gnl|my_center|LOCUS_17530 74424 75047 gene locus_tag LOCUS_17540 74424 75047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17540 75170 76105 gene locus_tag LOCUS_17550 75170 76105 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968526.1 protein_id gnl|my_center|LOCUS_17550 76185 76634 gene locus_tag LOCUS_17560 76185 76634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118347.1 protein_id gnl|my_center|LOCUS_17560 77612 76677 gene locus_tag LOCUS_17570 77612 76677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 78976 77792 gene locus_tag LOCUS_17580 78976 77792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 79183 79767 gene locus_tag LOCUS_17590 79183 79767 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259011.1 protein_id gnl|my_center|LOCUS_17590 80110 79754 gene locus_tag LOCUS_17600 80110 79754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 80330 81202 gene locus_tag LOCUS_17610 80330 81202 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_17610 82862 81279 gene locus_tag LOCUS_17620 82862 81279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117989.1 protein_id gnl|my_center|LOCUS_17620 85283 82881 gene locus_tag LOCUS_17630 85283 82881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 <86598 85283 gene locus_tag LOCUS_17640 <86598 85283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121212.1:filamin >Feature sequence021 1099 320 gene locus_tag LOCUS_17650 1099 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3350 1110 gene locus_tag LOCUS_17660 3350 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 4510 3383 gene locus_tag LOCUS_17670 gene pqqE 4510 3383 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C0 protein_id gnl|my_center|LOCUS_17670 5047 4523 gene locus_tag LOCUS_17680 5047 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 5632 5063 gene locus_tag LOCUS_17690 5632 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 5849 6064 gene locus_tag LOCUS_17700 5849 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 6057 6656 gene locus_tag LOCUS_17710 6057 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 8164 6626 gene locus_tag LOCUS_17720 8164 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_17720 9699 8161 gene locus_tag LOCUS_17730 9699 8161 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_17730 10119 11093 gene locus_tag LOCUS_17740 10119 11093 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986782.1 protein_id gnl|my_center|LOCUS_17740 11280 12338 gene locus_tag LOCUS_17750 11280 12338 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088806.1 protein_id gnl|my_center|LOCUS_17750 12335 13153 gene locus_tag LOCUS_17760 12335 13153 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_17760 13192 14205 gene locus_tag LOCUS_17770 13192 14205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 14251 14970 gene locus_tag LOCUS_17780 14251 14970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 15074 17395 gene locus_tag LOCUS_17790 15074 17395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 17531 18136 gene locus_tag LOCUS_17800 17531 18136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 18410 18156 gene locus_tag LOCUS_17810 18410 18156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 18814 20754 gene locus_tag LOCUS_17820 18814 20754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 21741 20947 gene locus_tag LOCUS_17830 21741 20947 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731334.1 protein_id gnl|my_center|LOCUS_17830 22157 21915 gene locus_tag LOCUS_17840 22157 21915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 22144 24582 gene locus_tag LOCUS_17850 22144 24582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 24641 25648 gene locus_tag LOCUS_17860 24641 25648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 26734 25688 gene locus_tag LOCUS_17870 26734 25688 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_17870 27792 26848 gene locus_tag LOCUS_17880 27792 26848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 27901 28722 gene locus_tag LOCUS_17890 gene deoC 27901 28722 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q839J1 protein_id gnl|my_center|LOCUS_17890 28760 30166 gene locus_tag LOCUS_17900 28760 30166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 30129 30629 gene locus_tag LOCUS_17910 30129 30629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 30626 31708 gene locus_tag LOCUS_17920 30626 31708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 31847 31719 gene locus_tag LOCUS_17930 31847 31719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 33619 31994 gene locus_tag LOCUS_17940 33619 31994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 33826 34152 gene locus_tag LOCUS_17950 33826 34152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 34610 35101 gene locus_tag LOCUS_17960 34610 35101 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_17960 36727 35204 gene locus_tag LOCUS_17970 36727 35204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 36909 37763 gene locus_tag LOCUS_17980 36909 37763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 38804 37752 gene locus_tag LOCUS_17990 38804 37752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 40366 38948 gene locus_tag LOCUS_18000 gene kamA 40366 38948 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902136.1 protein_id gnl|my_center|LOCUS_18000 42902 40890 gene locus_tag LOCUS_18010 42902 40890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 43207 44427 gene locus_tag LOCUS_18020 43207 44427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376590.1 protein_id gnl|my_center|LOCUS_18020 44457 45119 gene locus_tag LOCUS_18030 gene pssA 44457 45119 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037307.1 protein_id gnl|my_center|LOCUS_18030 46113 45301 gene locus_tag LOCUS_18040 gene truA 46113 45301 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60350 protein_id gnl|my_center|LOCUS_18040 47947 46136 gene locus_tag LOCUS_18050 47947 46136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 48984 47944 gene locus_tag LOCUS_18060 gene asd 48984 47944 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726Q8 protein_id gnl|my_center|LOCUS_18060 49669 49199 gene locus_tag LOCUS_18070 49669 49199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 50867 49992 gene locus_tag LOCUS_18080 50867 49992 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 protein_id gnl|my_center|LOCUS_18080 51007 51801 gene locus_tag LOCUS_18090 51007 51801 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082773.1 protein_id gnl|my_center|LOCUS_18090 51843 52262 gene locus_tag LOCUS_18100 51843 52262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 52341 53411 gene locus_tag LOCUS_18110 gene astA 52341 53411 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FXV2 protein_id gnl|my_center|LOCUS_18110 53711 54643 gene locus_tag LOCUS_18120 53711 54643 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975379.1 protein_id gnl|my_center|LOCUS_18120 56597 54654 gene locus_tag LOCUS_18130 56597 54654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 58103 57279 gene locus_tag LOCUS_18140 58103 57279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887971.1 protein_id gnl|my_center|LOCUS_18140 58452 60224 gene locus_tag LOCUS_18150 gene recN 58452 60224 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH7 protein_id gnl|my_center|LOCUS_18150 60728 61897 gene locus_tag LOCUS_18160 60728 61897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 62257 61985 gene locus_tag LOCUS_18170 62257 61985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 62298 63206 gene locus_tag LOCUS_18180 62298 63206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 63312 64043 gene locus_tag LOCUS_18190 63312 64043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 64969 64181 gene locus_tag LOCUS_18200 64969 64181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 66143 65061 gene locus_tag LOCUS_18210 66143 65061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 66586 69207 gene locus_tag LOCUS_18220 66586 69207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 69204 69806 gene locus_tag LOCUS_18230 69204 69806 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_18230 69986 71770 gene locus_tag LOCUS_18240 69986 71770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 72156 72710 gene locus_tag LOCUS_18250 72156 72710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 72899 73114 gene locus_tag LOCUS_18260 72899 73114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 73306 74574 gene locus_tag LOCUS_18270 73306 74574 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108679.1 protein_id gnl|my_center|LOCUS_18270 74687 76252 gene locus_tag LOCUS_18280 74687 76252 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_18280 78177 76273 gene locus_tag LOCUS_18290 78177 76273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 80000 78174 gene locus_tag LOCUS_18300 80000 78174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 80830 80003 gene locus_tag LOCUS_18310 80830 80003 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947356.1 protein_id gnl|my_center|LOCUS_18310 81409 80942 gene locus_tag LOCUS_18320 81409 80942 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109808.1 protein_id gnl|my_center|LOCUS_18320 84536 81540 gene locus_tag LOCUS_18330 84536 81540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 84973 85626 gene locus_tag LOCUS_18340 84973 85626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 85617 86174 gene locus_tag LOCUS_18350 gene nbaC 85617 86174 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_18350 >Feature sequence022 236 826 gene locus_tag LOCUS_18360 236 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 823 1776 gene locus_tag LOCUS_18370 823 1776 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038990.1 protein_id gnl|my_center|LOCUS_18370 3403 1691 gene locus_tag LOCUS_18380 3403 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 3861 4781 gene locus_tag LOCUS_18390 3861 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 4786 5463 gene locus_tag LOCUS_18400 4786 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 7171 5447 gene locus_tag LOCUS_18410 7171 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 8335 7382 gene locus_tag LOCUS_18420 8335 7382 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_18420 8853 8572 gene locus_tag LOCUS_18430 8853 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 10639 9167 gene locus_tag LOCUS_18440 gene pepA 10639 9167 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI46 protein_id gnl|my_center|LOCUS_18440 11510 10707 gene locus_tag LOCUS_18450 11510 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 12503 11538 gene locus_tag LOCUS_18460 12503 11538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_18460 13360 12500 gene locus_tag LOCUS_18470 13360 12500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 14339 13410 gene locus_tag LOCUS_18480 14339 13410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 15616 14408 gene locus_tag LOCUS_18490 15616 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 16115 15897 gene locus_tag LOCUS_18500 16115 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 17297 16287 gene locus_tag LOCUS_18510 17297 16287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 17562 19298 gene locus_tag LOCUS_18520 gene proS 17562 19298 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D59 protein_id gnl|my_center|LOCUS_18520 19531 20319 gene locus_tag LOCUS_18530 gene pyrF 19531 20319 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59654 protein_id gnl|my_center|LOCUS_18530 20366 21172 gene locus_tag LOCUS_18540 20366 21172 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093759.1 protein_id gnl|my_center|LOCUS_18540 21389 21461 gene locus_tag LOCUS_t00160 21389 21461 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 21509 21591 gene locus_tag LOCUS_t00170 21509 21591 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 21636 21708 gene locus_tag LOCUS_t00180 21636 21708 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21796 21868 gene locus_tag LOCUS_t00190 21796 21868 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 22200 23390 gene locus_tag LOCUS_18550 gene tuf 22200 23390 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J82 protein_id gnl|my_center|LOCUS_18550 23551 23625 gene locus_tag LOCUS_t00200 23551 23625 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 23770 24165 gene locus_tag LOCUS_18560 23770 24165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 24170 24724 gene locus_tag LOCUS_18570 gene nusG 24170 24724 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y1 protein_id gnl|my_center|LOCUS_18570 25034 25633 gene locus_tag LOCUS_18580 25034 25633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 25979 26413 gene locus_tag LOCUS_18590 gene rplK 25979 26413 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG19 protein_id gnl|my_center|LOCUS_18590 26413 27114 gene locus_tag LOCUS_18600 gene rplA 26413 27114 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTT4 protein_id gnl|my_center|LOCUS_18600 27631 28005 gene locus_tag LOCUS_18610 gene rplL 27631 28005 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A466 protein_id gnl|my_center|LOCUS_18610 28449 28967 gene locus_tag LOCUS_18620 gene rplJ 28449 28967 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y4 protein_id gnl|my_center|LOCUS_18620 29094 29477 gene locus_tag LOCUS_18630 gene rplL 29094 29477 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y5 protein_id gnl|my_center|LOCUS_18630 31467 29716 gene locus_tag LOCUS_18640 31467 29716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 32517 31789 gene locus_tag LOCUS_18650 32517 31789 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119848.1 protein_id gnl|my_center|LOCUS_18650 32724 32527 gene locus_tag LOCUS_18660 32724 32527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 32914 33516 gene locus_tag LOCUS_18670 32914 33516 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_18670 34952 33540 gene locus_tag LOCUS_18680 34952 33540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 36371 35091 gene locus_tag LOCUS_18690 36371 35091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 39400 36488 gene locus_tag LOCUS_18700 39400 36488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 40712 39519 gene locus_tag LOCUS_18710 40712 39519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 42496 40970 gene locus_tag LOCUS_18720 gene ppx 42496 40970 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036174.1 protein_id gnl|my_center|LOCUS_18720 43410 42571 gene locus_tag LOCUS_18730 43410 42571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 44015 47251 gene locus_tag LOCUS_18740 44015 47251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 47395 47637 gene locus_tag LOCUS_18750 gene rpoZ 47395 47637 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZY9 protein_id gnl|my_center|LOCUS_18750 48330 47737 gene locus_tag LOCUS_18760 48330 47737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 48619 50253 gene locus_tag LOCUS_18770 48619 50253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 50271 51314 gene locus_tag LOCUS_18780 50271 51314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 51327 53060 gene locus_tag LOCUS_18790 51327 53060 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021862.1 protein_id gnl|my_center|LOCUS_18790 53864 53079 gene locus_tag LOCUS_18800 53864 53079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 54078 55031 gene locus_tag LOCUS_18810 54078 55031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 55275 57029 gene locus_tag LOCUS_18820 55275 57029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 57218 57883 gene locus_tag LOCUS_18830 57218 57883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 59033 57885 gene locus_tag LOCUS_18840 59033 57885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 59612 59100 gene locus_tag LOCUS_18850 59612 59100 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 protein_id gnl|my_center|LOCUS_18850 60340 59741 gene locus_tag LOCUS_18860 60340 59741 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 protein_id gnl|my_center|LOCUS_18860 61661 60477 gene locus_tag LOCUS_18870 61661 60477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 64059 62293 gene locus_tag LOCUS_18880 64059 62293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 65178 64288 gene locus_tag LOCUS_18890 65178 64288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 65987 65142 gene locus_tag LOCUS_18900 65987 65142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 67666 66011 gene locus_tag LOCUS_18910 67666 66011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 68481 67765 gene locus_tag LOCUS_18920 68481 67765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 68725 70917 gene locus_tag LOCUS_18930 68725 70917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 70960 71826 gene locus_tag LOCUS_18940 70960 71826 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_18940 73612 71828 gene locus_tag LOCUS_18950 73612 71828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 73779 74471 gene locus_tag LOCUS_18960 73779 74471 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_18960 74792 74580 gene locus_tag LOCUS_18970 74792 74580 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891980.1 protein_id gnl|my_center|LOCUS_18970 75206 78382 gene locus_tag LOCUS_18980 75206 78382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 78742 80745 gene locus_tag LOCUS_18990 78742 80745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 82740 81010 gene locus_tag LOCUS_19000 82740 81010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence023 2116 32 gene locus_tag LOCUS_19010 gene fusA2 2116 32 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_19010 3644 2736 gene locus_tag LOCUS_19020 3644 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 4204 3647 gene locus_tag LOCUS_19030 gene nuoI1 4204 3647 CDS product NADH-quinone oxidoreductase subunit I 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA0 protein_id gnl|my_center|LOCUS_19030 5434 4286 gene locus_tag LOCUS_19040 gene nuoH 5434 4286 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q6 protein_id gnl|my_center|LOCUS_19040 7281 5572 gene locus_tag LOCUS_19050 gene nuoG 7281 5572 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_19050 8594 7389 gene locus_tag LOCUS_19060 gene nuoD 8594 7389 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA5 protein_id gnl|my_center|LOCUS_19060 9260 8706 gene locus_tag LOCUS_19070 9260 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 9867 9304 gene locus_tag LOCUS_19080 gene nuoB 9867 9304 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R3 protein_id gnl|my_center|LOCUS_19080 10238 9858 gene locus_tag LOCUS_19090 gene nuoA 10238 9858 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BQ5 protein_id gnl|my_center|LOCUS_19090 11477 10788 gene locus_tag LOCUS_19100 gene lexA 11477 10788 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81A92 protein_id gnl|my_center|LOCUS_19100 12777 11758 gene locus_tag LOCUS_19110 gene miaA 12777 11758 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP1 protein_id gnl|my_center|LOCUS_19110 14932 12848 gene locus_tag LOCUS_19120 14932 12848 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902072.1 protein_id gnl|my_center|LOCUS_19120 16915 15080 gene locus_tag LOCUS_19130 16915 15080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 17832 16999 gene locus_tag LOCUS_19140 17832 16999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 18079 19182 gene locus_tag LOCUS_19150 gene hisC2 18079 19182 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_19150 19196 19879 gene locus_tag LOCUS_19160 gene cmk 19196 19879 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ70 protein_id gnl|my_center|LOCUS_19160 19994 20593 gene locus_tag LOCUS_19170 19994 20593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 20590 23592 gene locus_tag LOCUS_19180 20590 23592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 25267 23735 gene locus_tag LOCUS_19190 gene kch 25267 23735 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881219.1 protein_id gnl|my_center|LOCUS_19190 26494 25298 gene locus_tag LOCUS_19200 26494 25298 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_19200 27559 26564 gene locus_tag LOCUS_19210 27559 26564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 29583 27868 gene locus_tag LOCUS_19220 gene rpsA 29583 27868 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_19220 30698 30027 gene locus_tag LOCUS_19230 30698 30027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 31134 32501 gene locus_tag LOCUS_19240 gene adcK4 31134 32501 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_19240 33126 32503 gene locus_tag LOCUS_19250 33126 32503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 34215 33283 gene locus_tag LOCUS_19260 34215 33283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 34883 34218 gene locus_tag LOCUS_19270 gene ktrA 34883 34218 CDS product potassium transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101677.1 protein_id gnl|my_center|LOCUS_19270 37025 34935 gene locus_tag LOCUS_19280 37025 34935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 37196 38026 gene locus_tag LOCUS_19290 37196 38026 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_19290 38875 38042 gene locus_tag LOCUS_19300 38875 38042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 39556 40728 gene locus_tag LOCUS_19310 39556 40728 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100953.1 protein_id gnl|my_center|LOCUS_19310 40842 41702 gene locus_tag LOCUS_19320 gene nfo 40842 41702 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FS7 protein_id gnl|my_center|LOCUS_19320 41711 42034 gene locus_tag LOCUS_19330 41711 42034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 48104 42036 gene locus_tag LOCUS_19340 48104 42036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 50670 48283 gene locus_tag LOCUS_19350 50670 48283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 50980 52587 gene locus_tag LOCUS_19360 50980 52587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 52685 54541 gene locus_tag LOCUS_19370 52685 54541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 54622 55596 gene locus_tag LOCUS_19380 54622 55596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 55621 56520 gene locus_tag LOCUS_19390 55621 56520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 57269 56529 gene locus_tag LOCUS_19400 57269 56529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 57535 57610 gene locus_tag LOCUS_t00210 57535 57610 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 57943 58317 gene locus_tag LOCUS_19410 57943 58317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 58674 60428 gene locus_tag LOCUS_19420 58674 60428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 60428 61459 gene locus_tag LOCUS_19430 60428 61459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 61598 62641 gene locus_tag LOCUS_19440 gene hrcA 61598 62641 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL1 protein_id gnl|my_center|LOCUS_19440 62882 63934 gene locus_tag LOCUS_19450 62882 63934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 64030 65883 gene locus_tag LOCUS_19460 gene dnaK 64030 65883 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_19460 66225 67358 gene locus_tag LOCUS_19470 gene dnaJ 66225 67358 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H58 protein_id gnl|my_center|LOCUS_19470 67358 68638 gene locus_tag LOCUS_19480 67358 68638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 68705 69682 gene locus_tag LOCUS_19490 68705 69682 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_19490 69842 70729 gene locus_tag LOCUS_19500 69842 70729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 70805 71818 gene locus_tag LOCUS_19510 gene thiL 70805 71818 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747S1 protein_id gnl|my_center|LOCUS_19510 71815 72630 gene locus_tag LOCUS_19520 71815 72630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 72997 72641 gene locus_tag LOCUS_19530 72997 72641 CDS product steroid Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704688.1 protein_id gnl|my_center|LOCUS_19530 73181 74023 gene locus_tag LOCUS_19540 73181 74023 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257620.1 protein_id gnl|my_center|LOCUS_19540 74829 74032 gene locus_tag LOCUS_19550 74829 74032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 76512 75331 gene locus_tag LOCUS_19560 76512 75331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 77625 76855 gene locus_tag LOCUS_19570 gene aacC 77625 76855 CDS product aminoglycoside 3-N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969832.1 protein_id gnl|my_center|LOCUS_19570 77778 79043 gene locus_tag LOCUS_19580 77778 79043 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_19580 79040 79744 gene locus_tag LOCUS_19590 79040 79744 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531071.1 protein_id gnl|my_center|LOCUS_19590 79741 80949 gene locus_tag LOCUS_19600 79741 80949 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971887.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence024 844 2220 gene locus_tag LOCUS_19610 844 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 2246 2530 gene locus_tag LOCUS_19620 2246 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2548 2964 gene locus_tag LOCUS_19630 2548 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 4238 2937 gene locus_tag LOCUS_19640 gene hutI 4238 2937 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFG1 protein_id gnl|my_center|LOCUS_19640 5896 4235 gene locus_tag LOCUS_19650 gene hutU 5896 4235 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81AC7 protein_id gnl|my_center|LOCUS_19650 8052 6115 gene locus_tag LOCUS_19660 8052 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 8284 8709 gene locus_tag LOCUS_19670 8284 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 8973 8764 gene locus_tag LOCUS_19680 8973 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 8900 10891 gene locus_tag LOCUS_19690 8900 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 12143 10893 gene locus_tag LOCUS_19700 12143 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 12919 12398 gene locus_tag LOCUS_19710 12919 12398 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945913.1 protein_id gnl|my_center|LOCUS_19710 13221 12952 gene locus_tag LOCUS_19720 13221 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 13943 15262 gene locus_tag LOCUS_19730 13943 15262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 15273 18407 gene locus_tag LOCUS_19740 15273 18407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 18549 20147 gene locus_tag LOCUS_19750 18549 20147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 20161 21894 gene locus_tag LOCUS_19760 20161 21894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 22049 22657 gene locus_tag LOCUS_19770 22049 22657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 22676 23605 gene locus_tag LOCUS_19780 22676 23605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 24296 23610 gene locus_tag LOCUS_19790 24296 23610 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200970.1 protein_id gnl|my_center|LOCUS_19790 25164 25670 gene locus_tag LOCUS_19800 25164 25670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 25783 26367 gene locus_tag LOCUS_19810 25783 26367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 26839 29025 gene locus_tag LOCUS_19820 26839 29025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 29052 29888 gene locus_tag LOCUS_19830 29052 29888 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_19830 30011 29808 gene locus_tag LOCUS_19840 30011 29808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 30564 31739 gene locus_tag LOCUS_19850 30564 31739 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE7 protein_id gnl|my_center|LOCUS_19850 31890 32876 gene locus_tag LOCUS_19860 gene mdh 31890 32876 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3J3 protein_id gnl|my_center|LOCUS_19860 33314 32997 gene locus_tag LOCUS_19870 33314 32997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 34617 33349 gene locus_tag LOCUS_19880 34617 33349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056396.1 protein_id gnl|my_center|LOCUS_19880 36827 34686 gene locus_tag LOCUS_19890 36827 34686 CDS product two-component hybrid sensor and regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085075.1 protein_id gnl|my_center|LOCUS_19890 37115 37780 gene locus_tag LOCUS_19900 37115 37780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 38916 37789 gene locus_tag LOCUS_19910 38916 37789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 40387 38906 gene locus_tag LOCUS_19920 40387 38906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 41100 40384 gene locus_tag LOCUS_19930 41100 40384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 43086 41353 gene locus_tag LOCUS_19940 gene thiC 43086 41353 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HB59 protein_id gnl|my_center|LOCUS_19940 43985 43341 gene locus_tag LOCUS_19950 gene pcp 43985 43341 CDS product pyrrolidone-carboxylate peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTN4 protein_id gnl|my_center|LOCUS_19950 44200 45048 gene locus_tag LOCUS_19960 44200 45048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 45070 46029 gene locus_tag LOCUS_19970 45070 46029 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972373.1 protein_id gnl|my_center|LOCUS_19970 48103 46499 gene locus_tag LOCUS_19980 48103 46499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 50017 48197 gene locus_tag LOCUS_19990 50017 48197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 54752 50322 gene locus_tag LOCUS_20000 54752 50322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 55305 56891 gene locus_tag LOCUS_20010 55305 56891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 57038 57250 gene locus_tag LOCUS_20020 57038 57250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 57237 58916 gene locus_tag LOCUS_20030 gene bmrA 57237 58916 CDS product multidrug resistance ABC transporter ATP-binding/permease protein BmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06967 protein_id gnl|my_center|LOCUS_20030 58957 59268 gene locus_tag LOCUS_20040 58957 59268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 59265 60209 gene locus_tag LOCUS_20050 59265 60209 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388576.1 protein_id gnl|my_center|LOCUS_20050 60541 60293 gene locus_tag LOCUS_20060 60541 60293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 60818 61879 gene locus_tag LOCUS_20070 60818 61879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 62203 62574 gene locus_tag LOCUS_20080 gene rpsL 62203 62574 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9P6 protein_id gnl|my_center|LOCUS_20080 62722 63210 gene locus_tag LOCUS_20090 gene rpsG 62722 63210 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV6 protein_id gnl|my_center|LOCUS_20090 63467 65608 gene locus_tag LOCUS_20100 gene fusA2 63467 65608 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_20100 65937 66245 gene locus_tag LOCUS_20110 gene rpsJ 65937 66245 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z0 protein_id gnl|my_center|LOCUS_20110 66530 67177 gene locus_tag LOCUS_20120 gene rplD 66530 67177 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024827.1 protein_id gnl|my_center|LOCUS_20120 67174 67530 gene locus_tag LOCUS_20130 gene rplW 67174 67530 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH68 protein_id gnl|my_center|LOCUS_20130 67647 68483 gene locus_tag LOCUS_20140 gene rplB 67647 68483 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60401 protein_id gnl|my_center|LOCUS_20140 68568 68846 gene locus_tag LOCUS_20150 gene rpsS 68568 68846 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF25 protein_id gnl|my_center|LOCUS_20150 68976 69344 gene locus_tag LOCUS_20160 gene rplV 68976 69344 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CRG5 protein_id gnl|my_center|LOCUS_20160 69392 70036 gene locus_tag LOCUS_20170 gene rpsC 69392 70036 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z4 protein_id gnl|my_center|LOCUS_20170 70394 70810 gene locus_tag LOCUS_20180 gene rplP 70394 70810 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG40 protein_id gnl|my_center|LOCUS_20180 70807 70995 gene locus_tag LOCUS_20190 70807 70995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 71119 71358 gene locus_tag LOCUS_20200 71119 71358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 71426 71704 gene locus_tag LOCUS_20210 gene rpsQ 71426 71704 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFQ6 protein_id gnl|my_center|LOCUS_20210 72121 72489 gene locus_tag LOCUS_20220 gene rplN 72121 72489 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX0 protein_id gnl|my_center|LOCUS_20220 72633 73019 gene locus_tag LOCUS_20230 gene rplX 72633 73019 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y443 protein_id gnl|my_center|LOCUS_20230 73378 73929 gene locus_tag LOCUS_20240 gene rplE 73378 73929 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH78 protein_id gnl|my_center|LOCUS_20240 74300 74701 gene locus_tag LOCUS_20250 gene rpsH 74300 74701 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12879 protein_id gnl|my_center|LOCUS_20250 74743 75279 gene locus_tag LOCUS_20260 gene rplF 74743 75279 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSG4 protein_id gnl|my_center|LOCUS_20260 75415 75783 gene locus_tag LOCUS_20270 gene rplR 75415 75783 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZAE3 protein_id gnl|my_center|LOCUS_20270 75795 76307 gene locus_tag LOCUS_20280 gene rpsE 75795 76307 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A4 protein_id gnl|my_center|LOCUS_20280 >Feature sequence025 3689 66 gene locus_tag LOCUS_20290 3689 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 5283 3973 gene locus_tag LOCUS_20300 5283 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 5444 5692 gene locus_tag LOCUS_20310 5444 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 5961 6353 gene locus_tag LOCUS_20320 5961 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 7314 6586 gene locus_tag LOCUS_20330 7314 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 8367 7411 gene locus_tag LOCUS_20340 8367 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 8587 9648 gene locus_tag LOCUS_20350 8587 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 9902 9684 gene locus_tag LOCUS_20360 9902 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 10223 10149 gene locus_tag LOCUS_t00220 10223 10149 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10506 13391 gene locus_tag LOCUS_20370 10506 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 13388 16246 gene locus_tag LOCUS_20380 13388 16246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 17132 16278 gene locus_tag LOCUS_20390 17132 16278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 17325 17519 gene locus_tag LOCUS_20400 17325 17519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 18848 17598 gene locus_tag LOCUS_20410 18848 17598 CDS product aromatic hydrocarbon degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_20410 21479 18921 gene locus_tag LOCUS_20420 21479 18921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 23598 21616 gene locus_tag LOCUS_20430 23598 21616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 23860 25917 gene locus_tag LOCUS_20440 23860 25917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 26926 25949 gene locus_tag LOCUS_20450 26926 25949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 27234 29312 gene locus_tag LOCUS_20460 27234 29312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 30467 29472 gene locus_tag LOCUS_20470 30467 29472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 33282 30658 gene locus_tag LOCUS_20480 33282 30658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 35577 33319 gene locus_tag LOCUS_20490 35577 33319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 36404 36000 gene locus_tag LOCUS_20500 36404 36000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 37419 36778 gene locus_tag LOCUS_20510 37419 36778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 37731 38102 gene locus_tag LOCUS_20520 37731 38102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 38102 38995 gene locus_tag LOCUS_20530 38102 38995 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_20530 39132 39746 gene locus_tag LOCUS_20540 39132 39746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 42826 39722 gene locus_tag LOCUS_20550 42826 39722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 43252 43719 gene locus_tag LOCUS_20560 gene ssb-2 43252 43719 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Z8 protein_id gnl|my_center|LOCUS_20560 44140 45423 gene locus_tag LOCUS_20570 44140 45423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 46400 45495 gene locus_tag LOCUS_20580 46400 45495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 46551 47825 gene locus_tag LOCUS_20590 46551 47825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 49683 47767 gene locus_tag LOCUS_20600 gene tmcA 49683 47767 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPS8 protein_id gnl|my_center|LOCUS_20600 50886 49870 gene locus_tag LOCUS_20610 50886 49870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977058.1 protein_id gnl|my_center|LOCUS_20610 53230 51125 gene locus_tag LOCUS_20620 gene glyS 53230 51125 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FM7 protein_id gnl|my_center|LOCUS_20620 54236 53304 gene locus_tag LOCUS_20630 gene glyQ 54236 53304 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FM8 protein_id gnl|my_center|LOCUS_20630 55848 54568 gene locus_tag LOCUS_20640 55848 54568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 59161 56144 gene locus_tag LOCUS_20650 59161 56144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 59684 60577 gene locus_tag LOCUS_20660 59684 60577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 60605 61396 gene locus_tag LOCUS_20670 60605 61396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 61885 61415 gene locus_tag LOCUS_20680 61885 61415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 63016 61985 gene locus_tag LOCUS_20690 63016 61985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 63775 63029 gene locus_tag LOCUS_20700 63775 63029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 64608 63772 gene locus_tag LOCUS_20710 64608 63772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 69545 65076 gene locus_tag LOCUS_20720 69545 65076 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 protein_id gnl|my_center|LOCUS_20720 69889 72039 gene locus_tag LOCUS_20730 69889 72039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 72210 72683 gene locus_tag LOCUS_20740 gene ybiA 72210 72683 CDS product swarming motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145139.1 protein_id gnl|my_center|LOCUS_20740 72680 72913 gene locus_tag LOCUS_20750 72680 72913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 72910 74352 gene locus_tag LOCUS_20760 gene gatA 72910 74352 CDS product glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727400.1 protein_id gnl|my_center|LOCUS_20760 74966 75670 gene locus_tag LOCUS_20770 74966 75670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 >Feature sequence026 227 676 gene locus_tag LOCUS_20780 227 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 829 1686 gene locus_tag LOCUS_20790 829 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 1866 4220 gene locus_tag LOCUS_20800 1866 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 4228 6057 gene locus_tag LOCUS_20810 4228 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 6263 7270 gene locus_tag LOCUS_20820 gene gapA 6263 7270 CDS product glyceraldehyde-3-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P09124 protein_id gnl|my_center|LOCUS_20820 7367 8593 gene locus_tag LOCUS_20830 gene pgk 7367 8593 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYC0 protein_id gnl|my_center|LOCUS_20830 8693 9454 gene locus_tag LOCUS_20840 gene tpiA 8693 9454 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP89 protein_id gnl|my_center|LOCUS_20840 11932 9836 gene locus_tag LOCUS_20850 gene recD 11932 9836 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWB7 protein_id gnl|my_center|LOCUS_20850 15646 11945 gene locus_tag LOCUS_20860 15646 11945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 19445 15804 gene locus_tag LOCUS_20870 19445 15804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 19774 20310 gene locus_tag LOCUS_20880 19774 20310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 20313 21116 gene locus_tag LOCUS_20890 20313 21116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 21788 21123 gene locus_tag LOCUS_20900 21788 21123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 24212 21888 gene locus_tag LOCUS_20910 24212 21888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 24763 24269 gene locus_tag LOCUS_20920 24763 24269 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707352.1 protein_id gnl|my_center|LOCUS_20920 24959 26308 gene locus_tag LOCUS_20930 gene ndh 24959 26308 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503612.1 protein_id gnl|my_center|LOCUS_20930 26651 29812 gene locus_tag LOCUS_20940 gene cypB 26651 29812 CDS product bifunctional cytochrome P450/NADPH--P450 reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O08336 protein_id gnl|my_center|LOCUS_20940 29833 30456 gene locus_tag LOCUS_20950 29833 30456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 31128 30475 gene locus_tag LOCUS_20960 31128 30475 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81AW2 protein_id gnl|my_center|LOCUS_20960 32116 31457 gene locus_tag LOCUS_20970 32116 31457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040618.1 protein_id gnl|my_center|LOCUS_20970 33123 32362 gene locus_tag LOCUS_20980 gene map 33123 32362 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UI28 protein_id gnl|my_center|LOCUS_20980 33480 34283 gene locus_tag LOCUS_20990 33480 34283 CDS product EscR/YscR/HrcR family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377232.1 protein_id gnl|my_center|LOCUS_20990 34294 34548 gene locus_tag LOCUS_21000 34294 34548 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392308.1 protein_id gnl|my_center|LOCUS_21000 34573 35400 gene locus_tag LOCUS_21010 34573 35400 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V886 protein_id gnl|my_center|LOCUS_21010 35405 36451 gene locus_tag LOCUS_21020 35405 36451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21020 36475 36849 gene locus_tag LOCUS_21030 36475 36849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 36969 38624 gene locus_tag LOCUS_21040 36969 38624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21040 38678 39055 gene locus_tag LOCUS_21050 38678 39055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 40628 39072 gene locus_tag LOCUS_21060 gene hutH 40628 39072 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCB3 protein_id gnl|my_center|LOCUS_21060 41279 41530 gene locus_tag LOCUS_21070 41279 41530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 41530 41811 gene locus_tag LOCUS_21080 41530 41811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 43012 41849 gene locus_tag LOCUS_21090 43012 41849 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_21090 44007 43042 gene locus_tag LOCUS_21100 44007 43042 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230565.1 protein_id gnl|my_center|LOCUS_21100 45310 44201 gene locus_tag LOCUS_21110 45310 44201 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_21110 45552 46373 gene locus_tag LOCUS_21120 gene uppS 45552 46373 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RE08 protein_id gnl|my_center|LOCUS_21120 46377 47222 gene locus_tag LOCUS_21130 46377 47222 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228119.1 protein_id gnl|my_center|LOCUS_21130 47215 49761 gene locus_tag LOCUS_21140 47215 49761 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257666.1 protein_id gnl|my_center|LOCUS_21140 49780 50814 gene locus_tag LOCUS_21150 49780 50814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 51456 50863 gene locus_tag LOCUS_21160 51456 50863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 51684 53048 gene locus_tag LOCUS_21170 51684 53048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_21170 53079 53768 gene locus_tag LOCUS_21180 53079 53768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 53781 54170 gene locus_tag LOCUS_21190 53781 54170 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_21190 54951 54184 gene locus_tag LOCUS_21200 54951 54184 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036962.1 protein_id gnl|my_center|LOCUS_21200 55608 55018 gene locus_tag LOCUS_21210 55608 55018 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119942.1 protein_id gnl|my_center|LOCUS_21210 58380 55810 gene locus_tag LOCUS_21220 58380 55810 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_21220 58657 59388 gene locus_tag LOCUS_21230 58657 59388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 60390 59515 gene locus_tag LOCUS_21240 60390 59515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 60510 61262 gene locus_tag LOCUS_21250 60510 61262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 61380 61862 gene locus_tag LOCUS_21260 61380 61862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 62100 63416 gene locus_tag LOCUS_21270 62100 63416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 65243 63693 gene locus_tag LOCUS_21280 65243 63693 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGF9 protein_id gnl|my_center|LOCUS_21280 66505 65240 gene locus_tag LOCUS_21290 gene recF 66505 65240 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H90 protein_id gnl|my_center|LOCUS_21290 67908 66787 gene locus_tag LOCUS_21300 gene dnaN 67908 66787 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H91 protein_id gnl|my_center|LOCUS_21300 69986 69378 gene locus_tag LOCUS_21310 69986 69378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 70314 70135 gene locus_tag LOCUS_21320 70314 70135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 70339 71025 gene locus_tag LOCUS_21330 70339 71025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 71012 71353 gene locus_tag LOCUS_21340 71012 71353 CDS product divalent ion tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 protein_id gnl|my_center|LOCUS_21340 71411 74014 gene locus_tag LOCUS_21350 71411 74014 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272585.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence027 881 216 gene locus_tag LOCUS_21360 881 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 1166 2557 gene locus_tag LOCUS_21370 gene ylaK 1166 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07635 protein_id gnl|my_center|LOCUS_21370 2817 4979 gene locus_tag LOCUS_21380 2817 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 5325 7211 gene locus_tag LOCUS_21390 5325 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 7308 8243 gene locus_tag LOCUS_21400 7308 8243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 11181 8245 gene locus_tag LOCUS_21410 11181 8245 CDS product ABC-ATPase UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_21410 11974 11393 gene locus_tag LOCUS_21420 11974 11393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 12830 12057 gene locus_tag LOCUS_21430 12830 12057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 13572 12859 gene locus_tag LOCUS_21440 13572 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 14121 13714 gene locus_tag LOCUS_21450 14121 13714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 15879 14251 gene locus_tag LOCUS_21460 15879 14251 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 protein_id gnl|my_center|LOCUS_21460 16159 17508 gene locus_tag LOCUS_21470 16159 17508 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_21470 17693 18457 gene locus_tag LOCUS_21480 17693 18457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 18530 21538 gene locus_tag LOCUS_21490 18530 21538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 21729 24194 gene locus_tag LOCUS_21500 21729 24194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 24382 25032 gene locus_tag LOCUS_21510 24382 25032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 25509 26549 gene locus_tag LOCUS_21520 25509 26549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 26722 29244 gene locus_tag LOCUS_21530 gene gspD 26722 29244 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_21530 29345 31126 gene locus_tag LOCUS_21540 29345 31126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 31210 32433 gene locus_tag LOCUS_21550 gene gspF 31210 32433 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_21550 32546 33010 gene locus_tag LOCUS_21560 gene gspG 32546 33010 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880232.1 protein_id gnl|my_center|LOCUS_21560 33078 33527 gene locus_tag LOCUS_21570 gene gspG 33078 33527 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880232.1 protein_id gnl|my_center|LOCUS_21570 33530 33949 gene locus_tag LOCUS_21580 33530 33949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 33968 34675 gene locus_tag LOCUS_21590 33968 34675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 34668 35279 gene locus_tag LOCUS_21600 34668 35279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 35276 36064 gene locus_tag LOCUS_21610 35276 36064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 36064 37656 gene locus_tag LOCUS_21620 36064 37656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 37721 39472 gene locus_tag LOCUS_21630 37721 39472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 39496 40116 gene locus_tag LOCUS_21640 39496 40116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 40120 41283 gene locus_tag LOCUS_21650 40120 41283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 41752 41291 gene locus_tag LOCUS_21660 41752 41291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 42024 43658 gene locus_tag LOCUS_21670 42024 43658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 43768 45003 gene locus_tag LOCUS_21680 gene glgC 43768 45003 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SMC1 protein_id gnl|my_center|LOCUS_21680 45018 46055 gene locus_tag LOCUS_21690 45018 46055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 48472 46133 gene locus_tag LOCUS_21700 48472 46133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 49182 48700 gene locus_tag LOCUS_21710 49182 48700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 49602 50312 gene locus_tag LOCUS_21720 49602 50312 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599551.1 protein_id gnl|my_center|LOCUS_21720 50479 52074 gene locus_tag LOCUS_21730 50479 52074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 52300 57081 gene locus_tag LOCUS_21740 52300 57081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 57142 58272 gene locus_tag LOCUS_21750 57142 58272 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_21750 58835 59104 gene locus_tag LOCUS_21760 58835 59104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 60018 59230 gene locus_tag LOCUS_21770 gene dapB 60018 59230 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI48 protein_id gnl|my_center|LOCUS_21770 60964 60065 gene locus_tag LOCUS_21780 gene dapA 60964 60065 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKK4 protein_id gnl|my_center|LOCUS_21780 61415 61251 gene locus_tag LOCUS_21790 61415 61251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 63736 61673 gene locus_tag LOCUS_21800 63736 61673 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZU4 protein_id gnl|my_center|LOCUS_21800 64350 65273 gene locus_tag LOCUS_21810 64350 65273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 65368 65859 gene locus_tag LOCUS_21820 65368 65859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 65856 66290 gene locus_tag LOCUS_21830 65856 66290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 66598 68697 gene locus_tag LOCUS_21840 66598 68697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 68718 70622 gene locus_tag LOCUS_21850 68718 70622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence028 184 1122 gene locus_tag LOCUS_21860 184 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 1202 3619 gene locus_tag LOCUS_21870 1202 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 4855 3647 gene locus_tag LOCUS_21880 4855 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 6637 4997 gene locus_tag LOCUS_21890 6637 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 7374 8021 gene locus_tag LOCUS_21900 7374 8021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 8159 10513 gene locus_tag LOCUS_21910 8159 10513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 11190 11555 gene locus_tag LOCUS_21920 11190 11555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 11775 12269 gene locus_tag LOCUS_21930 11775 12269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 12852 13004 gene locus_tag LOCUS_21940 gene rpmH 12852 13004 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL08 protein_id gnl|my_center|LOCUS_21940 13220 13654 gene locus_tag LOCUS_21950 13220 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 13729 14025 gene locus_tag LOCUS_21960 13729 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 14132 15811 gene locus_tag LOCUS_21970 gene yidC 14132 15811 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Q2 protein_id gnl|my_center|LOCUS_21970 15956 16873 gene locus_tag LOCUS_21980 15956 16873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 17014 18357 gene locus_tag LOCUS_21990 gene mnmE 17014 18357 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6H2 protein_id gnl|my_center|LOCUS_21990 18821 18456 gene locus_tag LOCUS_22000 18821 18456 CDS product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073477.1 protein_id gnl|my_center|LOCUS_22000 19969 19016 gene locus_tag LOCUS_22010 19969 19016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 20476 20673 gene locus_tag LOCUS_22020 20476 20673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 21388 20801 gene locus_tag LOCUS_22030 21388 20801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 22911 21460 gene locus_tag LOCUS_22040 22911 21460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 23604 22987 gene locus_tag LOCUS_22050 23604 22987 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071314.1 protein_id gnl|my_center|LOCUS_22050 23994 25106 gene locus_tag LOCUS_22060 23994 25106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 25460 26350 gene locus_tag LOCUS_22070 25460 26350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 26419 28212 gene locus_tag LOCUS_22080 26419 28212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 28271 29047 gene locus_tag LOCUS_22090 28271 29047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 29044 30378 gene locus_tag LOCUS_22100 29044 30378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 30446 32395 gene locus_tag LOCUS_22110 30446 32395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 32771 32460 gene locus_tag LOCUS_22120 32771 32460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 33826 32879 gene locus_tag LOCUS_22130 33826 32879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 34218 34913 gene locus_tag LOCUS_22140 34218 34913 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_22140 36294 34882 gene locus_tag LOCUS_22150 36294 34882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 36813 36295 gene locus_tag LOCUS_22160 gene dtd 36813 36295 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183H9 protein_id gnl|my_center|LOCUS_22160 37608 36919 gene locus_tag LOCUS_22170 37608 36919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 40531 38096 gene locus_tag LOCUS_22180 40531 38096 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_22180 41266 44094 gene locus_tag LOCUS_22190 gene secA 41266 44094 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ1 protein_id gnl|my_center|LOCUS_22190 44110 44466 gene locus_tag LOCUS_22200 44110 44466 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKV4 protein_id gnl|my_center|LOCUS_22200 44483 45493 gene locus_tag LOCUS_22210 44483 45493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 46132 45806 gene locus_tag LOCUS_22220 46132 45806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 47889 46468 gene locus_tag LOCUS_22230 47889 46468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 50502 48118 gene locus_tag LOCUS_22240 50502 48118 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 protein_id gnl|my_center|LOCUS_22240 52674 50521 gene locus_tag LOCUS_22250 52674 50521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 53133 52678 gene locus_tag LOCUS_22260 53133 52678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 53696 53136 gene locus_tag LOCUS_22270 53696 53136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 54177 53812 gene locus_tag LOCUS_22280 54177 53812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 55747 54377 gene locus_tag LOCUS_22290 55747 54377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411121.1 protein_id gnl|my_center|LOCUS_22290 55987 56745 gene locus_tag LOCUS_22300 55987 56745 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402891.1 protein_id gnl|my_center|LOCUS_22300 56948 57190 gene locus_tag LOCUS_22310 56948 57190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 57218 57718 gene locus_tag LOCUS_22320 57218 57718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 58027 57722 gene locus_tag LOCUS_22330 58027 57722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 59205 58147 gene locus_tag LOCUS_22340 gene tsaD 59205 58147 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C11 protein_id gnl|my_center|LOCUS_22340 62950 59213 gene locus_tag LOCUS_22350 62950 59213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 65782 63221 gene locus_tag LOCUS_22360 gene pcrA 65782 63221 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U2J5 protein_id gnl|my_center|LOCUS_22360 66836 65916 gene locus_tag LOCUS_22370 66836 65916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 67942 66917 gene locus_tag LOCUS_22380 67942 66917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 69013 70188 gene locus_tag LOCUS_22390 69013 70188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence029 756 2198 gene locus_tag LOCUS_22400 756 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2438 3718 gene locus_tag LOCUS_22410 2438 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 3933 4238 gene locus_tag LOCUS_22420 3933 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 4291 5010 gene locus_tag LOCUS_22430 4291 5010 CDS product phosphopantetheine-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957443.1 protein_id gnl|my_center|LOCUS_22430 5982 4987 gene locus_tag LOCUS_22440 5982 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 6242 7054 gene locus_tag LOCUS_22450 gene pssA 6242 7054 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957377.1 protein_id gnl|my_center|LOCUS_22450 7147 8010 gene locus_tag LOCUS_22460 7147 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 8007 8966 gene locus_tag LOCUS_22470 8007 8966 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257108.1 protein_id gnl|my_center|LOCUS_22470 9207 9749 gene locus_tag LOCUS_22480 9207 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 11032 9746 gene locus_tag LOCUS_22490 11032 9746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 12907 11282 gene locus_tag LOCUS_22500 12907 11282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 14808 13015 gene locus_tag LOCUS_22510 14808 13015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 14988 15506 gene locus_tag LOCUS_22520 14988 15506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 16007 15669 gene locus_tag LOCUS_22530 16007 15669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 16975 16163 gene locus_tag LOCUS_22540 gene atpB 16975 16163 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DL1 protein_id gnl|my_center|LOCUS_22540 17433 17005 gene locus_tag LOCUS_22550 17433 17005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 17717 17430 gene locus_tag LOCUS_22560 17717 17430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 20428 17873 gene locus_tag LOCUS_22570 gene gyrA 20428 17873 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H88 protein_id gnl|my_center|LOCUS_22570 21167 21865 gene locus_tag LOCUS_22580 gene sigR 21167 21865 CDS product ECF RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKG9 protein_id gnl|my_center|LOCUS_22580 22305 24092 gene locus_tag LOCUS_22590 22305 24092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 25808 24192 gene locus_tag LOCUS_22600 25808 24192 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257549.1 protein_id gnl|my_center|LOCUS_22600 27316 26315 gene locus_tag LOCUS_22610 27316 26315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 29325 27316 gene locus_tag LOCUS_22620 29325 27316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 29790 29548 gene locus_tag LOCUS_22630 gene rpmB 29790 29548 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGM8 protein_id gnl|my_center|LOCUS_22630 31908 30004 gene locus_tag LOCUS_22640 31908 30004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 32409 33668 gene locus_tag LOCUS_22650 32409 33668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 34055 34351 gene locus_tag LOCUS_22660 gene ihfB-1 34055 34351 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_22660 38267 34608 gene locus_tag LOCUS_22670 38267 34608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 40029 38536 gene locus_tag LOCUS_22680 40029 38536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 40853 41668 gene locus_tag LOCUS_22690 40853 41668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 42793 41717 gene locus_tag LOCUS_22700 42793 41717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 44273 42879 gene locus_tag LOCUS_22710 44273 42879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 44632 44270 gene locus_tag LOCUS_22720 44632 44270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 45053 44670 gene locus_tag LOCUS_22730 gene fliS 45053 44670 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748G6 protein_id gnl|my_center|LOCUS_22730 46655 45282 gene locus_tag LOCUS_22740 gene fliD 46655 45282 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748G5 protein_id gnl|my_center|LOCUS_22740 47784 46951 gene locus_tag LOCUS_22750 gene fliC 47784 46951 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748G4 protein_id gnl|my_center|LOCUS_22750 49369 48122 gene locus_tag LOCUS_22760 gene flgE 49369 48122 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G30 protein_id gnl|my_center|LOCUS_22760 50169 49492 gene locus_tag LOCUS_22770 gene flgD 50169 49492 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYG7 protein_id gnl|my_center|LOCUS_22770 51562 50297 gene locus_tag LOCUS_22780 51562 50297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 52110 51568 gene locus_tag LOCUS_22790 52110 51568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 53665 52277 gene locus_tag LOCUS_22800 53665 52277 CDS product EscN/YscN/HrcN family type III secretion system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_22800 54483 53665 gene locus_tag LOCUS_22810 54483 53665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 55483 54470 gene locus_tag LOCUS_22820 55483 54470 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQT4 protein_id gnl|my_center|LOCUS_22820 57324 55549 gene locus_tag LOCUS_22830 gene fliF 57324 55549 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FA1 protein_id gnl|my_center|LOCUS_22830 57732 57418 gene locus_tag LOCUS_22840 gene fliE 57732 57418 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6C8 protein_id gnl|my_center|LOCUS_22840 58193 57768 gene locus_tag LOCUS_22850 gene flgC 58193 57768 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G41 protein_id gnl|my_center|LOCUS_22850 58561 58196 gene locus_tag LOCUS_22860 gene flgB 58561 58196 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNP4 protein_id gnl|my_center|LOCUS_22860 59750 58878 gene locus_tag LOCUS_22870 gene flgL 59750 58878 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_22870 61233 59866 gene locus_tag LOCUS_22880 gene flgK 61233 59866 CDS product flagellar hook-associated protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F9 protein_id gnl|my_center|LOCUS_22880 61781 61245 gene locus_tag LOCUS_22890 61781 61245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 62049 63167 gene locus_tag LOCUS_22900 62049 63167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 64431 63178 gene locus_tag LOCUS_22910 64431 63178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 64652 66721 gene locus_tag LOCUS_22920 64652 66721 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256147.1 protein_id gnl|my_center|LOCUS_22920 66802 68328 gene locus_tag LOCUS_22930 gene gltB2 66802 68328 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_22930 69476 68367 gene locus_tag LOCUS_22940 69476 68367 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC70 protein_id gnl|my_center|LOCUS_22940 69701 70087 gene locus_tag LOCUS_22950 69701 70087 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4N0 protein_id gnl|my_center|LOCUS_22950 >Feature sequence030 1023 34 gene locus_tag LOCUS_22960 1023 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 1305 1583 gene locus_tag LOCUS_22970 1305 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 1755 2186 gene locus_tag LOCUS_22980 1755 2186 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538074.1 protein_id gnl|my_center|LOCUS_22980 3742 2444 gene locus_tag LOCUS_22990 3742 2444 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_22990 6401 3780 gene locus_tag LOCUS_23000 gene hrpB 6401 3780 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_23000 8933 6405 gene locus_tag LOCUS_23010 gene thrA 8933 6405 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933685.1 protein_id gnl|my_center|LOCUS_23010 10194 9001 gene locus_tag LOCUS_23020 10194 9001 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 protein_id gnl|my_center|LOCUS_23020 10433 11086 gene locus_tag LOCUS_23030 10433 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 11818 11105 gene locus_tag LOCUS_23040 11818 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 12269 11850 gene locus_tag LOCUS_23050 12269 11850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 12757 12266 gene locus_tag LOCUS_23060 12757 12266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 14128 12791 gene locus_tag LOCUS_23070 14128 12791 CDS product EscN/YscN/HrcN family type III secretion system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_23070 14808 14125 gene locus_tag LOCUS_23080 14808 14125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 15749 14805 gene locus_tag LOCUS_23090 15749 14805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 16554 15742 gene locus_tag LOCUS_23100 16554 15742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 16966 16565 gene locus_tag LOCUS_23110 16966 16565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 19259 17205 gene locus_tag LOCUS_23120 19259 17205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 22544 19398 gene locus_tag LOCUS_23130 22544 19398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 22944 24272 gene locus_tag LOCUS_23140 gene pncC 22944 24272 CDS product nicotinamide-nucleotide amidohydrolase PncC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK32 protein_id gnl|my_center|LOCUS_23140 24367 24945 gene locus_tag LOCUS_23150 24367 24945 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM43 protein_id gnl|my_center|LOCUS_23150 25493 26551 gene locus_tag LOCUS_23160 gene recA 25493 26551 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5X5 protein_id gnl|my_center|LOCUS_23160 26850 28061 gene locus_tag LOCUS_23170 gene pilT-1 26850 28061 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_23170 28212 29528 gene locus_tag LOCUS_23180 28212 29528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 29677 30171 gene locus_tag LOCUS_23190 29677 30171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 30175 31038 gene locus_tag LOCUS_23200 30175 31038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 31035 33347 gene locus_tag LOCUS_23210 31035 33347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 33696 35870 gene locus_tag LOCUS_23220 33696 35870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 37193 35904 gene locus_tag LOCUS_23230 gene purD 37193 35904 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EJ4 protein_id gnl|my_center|LOCUS_23230 38809 37226 gene locus_tag LOCUS_23240 gene purH 38809 37226 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MEK0 protein_id gnl|my_center|LOCUS_23240 39062 39493 gene locus_tag LOCUS_23250 39062 39493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 39774 40529 gene locus_tag LOCUS_23260 39774 40529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 40789 41718 gene locus_tag LOCUS_23270 40789 41718 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_23270 41731 42585 gene locus_tag LOCUS_23280 gene oppC 41731 42585 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_23280 42585 43706 gene locus_tag LOCUS_23290 42585 43706 CDS product glycoside hydrolase family 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_23290 43973 44272 gene locus_tag LOCUS_23300 43973 44272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 46659 44317 gene locus_tag LOCUS_23310 46659 44317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 50056 46640 gene locus_tag LOCUS_23320 50056 46640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 53468 50067 gene locus_tag LOCUS_23330 53468 50067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 53696 57196 gene locus_tag LOCUS_23340 53696 57196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 57323 58414 gene locus_tag LOCUS_23350 57323 58414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086694.1 protein_id gnl|my_center|LOCUS_23350 59033 58401 gene locus_tag LOCUS_23360 gene thiE-2 59033 58401 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729I8 protein_id gnl|my_center|LOCUS_23360 60037 59030 gene locus_tag LOCUS_23370 gene lipA 60037 59030 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_23370 60959 60384 gene locus_tag LOCUS_23380 60959 60384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 65984 61089 gene locus_tag LOCUS_23390 65984 61089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 66821 66315 gene locus_tag LOCUS_23400 66821 66315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 68074 66917 gene locus_tag LOCUS_23410 68074 66917 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_23410 68378 69250 gene locus_tag LOCUS_23420 gene mtnP 68378 69250 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E52 protein_id gnl|my_center|LOCUS_23420 69323 69703 gene locus_tag LOCUS_23430 69323 69703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence031 4210 4632 gene locus_tag LOCUS_23440 4210 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 4940 7069 gene locus_tag LOCUS_23450 4940 7069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 7126 8370 gene locus_tag LOCUS_23460 7126 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 8851 9747 gene locus_tag LOCUS_23470 8851 9747 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_23470 9744 12113 gene locus_tag LOCUS_23480 9744 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 12110 13753 gene locus_tag LOCUS_23490 12110 13753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 13750 15591 gene locus_tag LOCUS_23500 13750 15591 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114551.1 protein_id gnl|my_center|LOCUS_23500 15588 16241 gene locus_tag LOCUS_23510 15588 16241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 17757 16363 gene locus_tag LOCUS_23520 17757 16363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 18821 17997 gene locus_tag LOCUS_23530 18821 17997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 19255 19584 gene locus_tag LOCUS_23540 19255 19584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048896.1 protein_id gnl|my_center|LOCUS_23540 19712 21190 gene locus_tag LOCUS_23550 19712 21190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 21287 21946 gene locus_tag LOCUS_23560 gene yegL 21287 21946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003141.1 protein_id gnl|my_center|LOCUS_23560 21994 22704 gene locus_tag LOCUS_23570 21994 22704 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001863367.1 protein_id gnl|my_center|LOCUS_23570 22701 24185 gene locus_tag LOCUS_23580 22701 24185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 24175 27516 gene locus_tag LOCUS_23590 24175 27516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 27500 29722 gene locus_tag LOCUS_23600 27500 29722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 29706 32327 gene locus_tag LOCUS_23610 29706 32327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 32328 36161 gene locus_tag LOCUS_23620 32328 36161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 37695 36430 gene locus_tag LOCUS_23630 37695 36430 CDS product CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582979.1 protein_id gnl|my_center|LOCUS_23630 37951 38298 gene locus_tag LOCUS_23640 37951 38298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 38645 39346 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acccttcctcgatttggagaggactgaaac 42174 39532 gene locus_tag LOCUS_23650 42174 39532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 43468 42230 gene locus_tag LOCUS_23660 43468 42230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 43673 44728 gene locus_tag LOCUS_23670 43673 44728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 44766 45596 gene locus_tag LOCUS_23680 44766 45596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 45718 46761 gene locus_tag LOCUS_23690 45718 46761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 46758 48581 gene locus_tag LOCUS_23700 46758 48581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 48988 48659 gene locus_tag LOCUS_23710 48988 48659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 49424 50461 gene locus_tag LOCUS_23720 gene cas6_1 49424 50461 CDS product CRISPR-associated protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_23720 50458 51786 gene locus_tag LOCUS_23730 50458 51786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 51849 53867 gene locus_tag LOCUS_23740 51849 53867 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229144.1 protein_id gnl|my_center|LOCUS_23740 54002 54985 gene locus_tag LOCUS_23750 54002 54985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23750 56058 56279 gene locus_tag LOCUS_23760 56058 56279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 56324 57214 gene locus_tag LOCUS_23770 56324 57214 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 protein_id gnl|my_center|LOCUS_23770 57211 57600 gene locus_tag LOCUS_23780 57211 57600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 57590 59044 gene locus_tag LOCUS_23790 57590 59044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 59506 59231 gene locus_tag LOCUS_23800 59506 59231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 59579 60541 gene locus_tag LOCUS_23810 59579 60541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 60679 61074 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcagtcctctcaaagtcgaggaaggg 61487 64345 gene locus_tag LOCUS_23820 61487 64345 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102944.1 protein_id gnl|my_center|LOCUS_23820 64435 65403 gene locus_tag LOCUS_23830 64435 65403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 65811 66578 gene locus_tag LOCUS_23840 65811 66578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 68359 66581 gene locus_tag LOCUS_23850 68359 66581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 68584 69177 gene locus_tag LOCUS_23860 68584 69177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence032 4413 88 gene locus_tag LOCUS_23870 4413 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 4692 4997 gene locus_tag LOCUS_23880 4692 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 5128 6501 gene locus_tag LOCUS_23890 5128 6501 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_23890 6564 8285 gene locus_tag LOCUS_23900 6564 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 8299 8883 gene locus_tag LOCUS_23910 8299 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 9048 9380 gene locus_tag LOCUS_23920 9048 9380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 9467 9793 gene locus_tag LOCUS_23930 9467 9793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 12956 9798 gene locus_tag LOCUS_23940 12956 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 13176 14003 gene locus_tag LOCUS_23950 13176 14003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 14154 15350 gene locus_tag LOCUS_23960 14154 15350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 16034 15438 gene locus_tag LOCUS_23970 16034 15438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 16501 16031 gene locus_tag LOCUS_23980 gene rpoE 16501 16031 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_23980 17253 18878 gene locus_tag LOCUS_23990 17253 18878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 19125 19946 gene locus_tag LOCUS_24000 19125 19946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 20292 21191 gene locus_tag LOCUS_24010 20292 21191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 21230 22108 gene locus_tag LOCUS_24020 21230 22108 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_24020 22566 23606 gene locus_tag LOCUS_24030 22566 23606 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_24030 23623 24069 gene locus_tag LOCUS_24040 gene arsC 23623 24069 CDS product protein ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45947 protein_id gnl|my_center|LOCUS_24040 24128 24200 gene locus_tag LOCUS_t00230 24128 24200 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 24362 25174 gene locus_tag LOCUS_24050 24362 25174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 25331 26443 gene locus_tag LOCUS_24060 25331 26443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267015.1 protein_id gnl|my_center|LOCUS_24060 26536 26976 gene locus_tag LOCUS_24070 26536 26976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 28113 26977 gene locus_tag LOCUS_24080 28113 26977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 28721 28110 gene locus_tag LOCUS_24090 28721 28110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 32738 28851 gene locus_tag LOCUS_24100 32738 28851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 33168 34055 gene locus_tag LOCUS_24110 33168 34055 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113750.1 protein_id gnl|my_center|LOCUS_24110 34249 34527 gene locus_tag LOCUS_24120 34249 34527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 34569 35093 gene locus_tag LOCUS_24130 34569 35093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087369.1 protein_id gnl|my_center|LOCUS_24130 35610 35993 gene locus_tag LOCUS_24140 35610 35993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 36943 36035 gene locus_tag LOCUS_24150 gene yrbG 36943 36035 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_24150 37872 37222 gene locus_tag LOCUS_24160 37872 37222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 38163 38831 gene locus_tag LOCUS_24170 38163 38831 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537687.1 protein_id gnl|my_center|LOCUS_24170 38828 40129 gene locus_tag LOCUS_24180 38828 40129 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706362.1 protein_id gnl|my_center|LOCUS_24180 40184 40843 gene locus_tag LOCUS_24190 40184 40843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 41428 40970 gene locus_tag LOCUS_24200 41428 40970 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387782.1 protein_id gnl|my_center|LOCUS_24200 41848 41432 gene locus_tag LOCUS_24210 41848 41432 CDS product putative organic hydroperoxide resistance protein/OsmC-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701670.1 protein_id gnl|my_center|LOCUS_24210 42156 42440 gene locus_tag LOCUS_24220 42156 42440 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455496.1 protein_id gnl|my_center|LOCUS_24220 42442 44367 gene locus_tag LOCUS_24230 42442 44367 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089263.1 protein_id gnl|my_center|LOCUS_24230 44481 45278 gene locus_tag LOCUS_24240 44481 45278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 47411 45282 gene locus_tag LOCUS_24250 47411 45282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 47715 49526 gene locus_tag LOCUS_24260 47715 49526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 49766 51679 gene locus_tag LOCUS_24270 49766 51679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 52295 51687 gene locus_tag LOCUS_24280 52295 51687 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978560.1 protein_id gnl|my_center|LOCUS_24280 53371 52388 gene locus_tag LOCUS_24290 53371 52388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 53430 54245 gene locus_tag LOCUS_24300 53430 54245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 54351 54716 gene locus_tag LOCUS_24310 54351 54716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 54972 56081 gene locus_tag LOCUS_24320 54972 56081 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5F2 protein_id gnl|my_center|LOCUS_24320 56201 57028 gene locus_tag LOCUS_24330 56201 57028 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5F4 protein_id gnl|my_center|LOCUS_24330 59207 57132 gene locus_tag LOCUS_24340 gene irgA 59207 57132 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074140.1 protein_id gnl|my_center|LOCUS_24340 60367 59207 gene locus_tag LOCUS_24350 60367 59207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 61266 60370 gene locus_tag LOCUS_24360 61266 60370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 61500 62435 gene locus_tag LOCUS_24370 61500 62435 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_24370 62432 63469 gene locus_tag LOCUS_24380 62432 63469 CDS product hemin ABC transporter membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529789.1 protein_id gnl|my_center|LOCUS_24380 63466 64314 gene locus_tag LOCUS_24390 gene hmuV 63466 64314 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68877 protein_id gnl|my_center|LOCUS_24390 64311 65423 gene locus_tag LOCUS_24400 64311 65423 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405436.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence033 1371 22 gene locus_tag LOCUS_24410 gene gsh1 1371 22 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_24410 1777 4179 gene locus_tag LOCUS_24420 1777 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 4207 5166 gene locus_tag LOCUS_24430 gene manA 4207 5166 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_24430 5330 7276 gene locus_tag LOCUS_24440 5330 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 8813 7344 gene locus_tag LOCUS_24450 8813 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 9306 10163 gene locus_tag LOCUS_24460 9306 10163 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562943.1 protein_id gnl|my_center|LOCUS_24460 10329 11486 gene locus_tag LOCUS_24470 10329 11486 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529278.1 protein_id gnl|my_center|LOCUS_24470 11978 11559 gene locus_tag LOCUS_24480 11978 11559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 12635 14311 gene locus_tag LOCUS_24490 12635 14311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 15439 14333 gene locus_tag LOCUS_24500 15439 14333 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025115.1 protein_id gnl|my_center|LOCUS_24500 15587 16066 gene locus_tag LOCUS_24510 15587 16066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 17246 16632 gene locus_tag LOCUS_24520 17246 16632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 18207 17257 gene locus_tag LOCUS_24530 18207 17257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 20208 18412 gene locus_tag LOCUS_24540 20208 18412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 21099 20251 gene locus_tag LOCUS_24550 21099 20251 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389560.1 protein_id gnl|my_center|LOCUS_24550 21878 21123 gene locus_tag LOCUS_24560 21878 21123 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393241.1 protein_id gnl|my_center|LOCUS_24560 22854 21943 gene locus_tag LOCUS_24570 22854 21943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 24089 22860 gene locus_tag LOCUS_24580 24089 22860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 25219 24164 gene locus_tag LOCUS_24590 25219 24164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 27456 25216 gene locus_tag LOCUS_24600 27456 25216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 28205 27456 gene locus_tag LOCUS_24610 28205 27456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 29911 28202 gene locus_tag LOCUS_24620 29911 28202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 30406 31461 gene locus_tag LOCUS_24630 30406 31461 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258491.1 protein_id gnl|my_center|LOCUS_24630 31558 32220 gene locus_tag LOCUS_24640 31558 32220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 32300 32917 gene locus_tag LOCUS_24650 32300 32917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 32929 33795 gene locus_tag LOCUS_24660 gene uppP3 32929 33795 CDS product undecaprenyl-diphosphatase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81CP1 protein_id gnl|my_center|LOCUS_24660 37288 33923 gene locus_tag LOCUS_24670 37288 33923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 38203 37532 gene locus_tag LOCUS_24680 gene rpe 38203 37532 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD84 protein_id gnl|my_center|LOCUS_24680 38102 38338 gene locus_tag LOCUS_24690 38102 38338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 39695 38355 gene locus_tag LOCUS_24700 gene rsmB 39695 38355 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z4 protein_id gnl|my_center|LOCUS_24700 40727 39738 gene locus_tag LOCUS_24710 gene fmt 40727 39738 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_24710 41277 40741 gene locus_tag LOCUS_24720 gene def 41277 40741 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIL7 protein_id gnl|my_center|LOCUS_24720 41534 43480 gene locus_tag LOCUS_24730 41534 43480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 43524 45371 gene locus_tag LOCUS_24740 43524 45371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 46463 45438 gene locus_tag LOCUS_24750 46463 45438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 47255 46536 gene locus_tag LOCUS_24760 47255 46536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 48014 47262 gene locus_tag LOCUS_24770 48014 47262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 48300 50210 gene locus_tag LOCUS_24780 48300 50210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 50458 51357 gene locus_tag LOCUS_24790 50458 51357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 51570 52181 gene locus_tag LOCUS_24800 51570 52181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 52237 53985 gene locus_tag LOCUS_24810 52237 53985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 54286 54915 gene locus_tag LOCUS_24820 54286 54915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 54968 56155 gene locus_tag LOCUS_24830 54968 56155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 56297 57739 gene locus_tag LOCUS_24840 56297 57739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 57903 58976 gene locus_tag LOCUS_24850 57903 58976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 61070 59046 gene locus_tag LOCUS_24860 61070 59046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 61539 61213 gene locus_tag LOCUS_24870 61539 61213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 61770 61609 gene locus_tag LOCUS_24880 61770 61609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 61933 63291 gene locus_tag LOCUS_24890 61933 63291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 63338 64969 gene locus_tag LOCUS_24900 63338 64969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence034 479 1291 gene locus_tag LOCUS_24910 479 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090970.1 protein_id gnl|my_center|LOCUS_24910 3556 1301 gene locus_tag LOCUS_24920 3556 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 4536 3733 gene locus_tag LOCUS_24930 4536 3733 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120450.1 protein_id gnl|my_center|LOCUS_24930 4732 5994 gene locus_tag LOCUS_24940 4732 5994 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713000.1 protein_id gnl|my_center|LOCUS_24940 5991 6908 gene locus_tag LOCUS_24950 5991 6908 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727809.1 protein_id gnl|my_center|LOCUS_24950 7558 6887 gene locus_tag LOCUS_24960 7558 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 9748 7637 gene locus_tag LOCUS_24970 9748 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 11519 9918 gene locus_tag LOCUS_24980 11519 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 12060 11512 gene locus_tag LOCUS_24990 12060 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331451.1 protein_id gnl|my_center|LOCUS_24990 13251 12208 gene locus_tag LOCUS_25000 13251 12208 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404885.1 protein_id gnl|my_center|LOCUS_25000 14089 13262 gene locus_tag LOCUS_25010 gene mtap 14089 13262 CDS product 5'-methylthioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404886.1 protein_id gnl|my_center|LOCUS_25010 14321 15946 gene locus_tag LOCUS_25020 14321 15946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 16898 16134 gene locus_tag LOCUS_25030 16898 16134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 17196 16993 gene locus_tag LOCUS_25040 17196 16993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 17653 18972 gene locus_tag LOCUS_25050 17653 18972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 19116 20582 gene locus_tag LOCUS_25060 19116 20582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 20624 21103 gene locus_tag LOCUS_25070 20624 21103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 21174 21698 gene locus_tag LOCUS_25080 21174 21698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 22042 22620 gene locus_tag LOCUS_25090 22042 22620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 22620 23237 gene locus_tag LOCUS_25100 22620 23237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 23365 24333 gene locus_tag LOCUS_25110 gene trxB 23365 24333 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE48 protein_id gnl|my_center|LOCUS_25110 24413 27946 gene locus_tag LOCUS_25120 24413 27946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 28024 28293 gene locus_tag LOCUS_25130 28024 28293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 29160 28333 gene locus_tag LOCUS_25140 29160 28333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 30179 29316 gene locus_tag LOCUS_25150 30179 29316 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705765.1 protein_id gnl|my_center|LOCUS_25150 31100 30201 gene locus_tag LOCUS_25160 gene truB 31100 30201 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGQ0 protein_id gnl|my_center|LOCUS_25160 32285 31251 gene locus_tag LOCUS_25170 32285 31251 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_25170 32711 32340 gene locus_tag LOCUS_25180 gene rbfA 32711 32340 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MX24 protein_id gnl|my_center|LOCUS_25180 33419 34162 gene locus_tag LOCUS_25190 33419 34162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 35503 34166 gene locus_tag LOCUS_25200 35503 34166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 38604 35719 gene locus_tag LOCUS_25210 38604 35719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 39396 38797 gene locus_tag LOCUS_25220 39396 38797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 41313 39676 gene locus_tag LOCUS_25230 41313 39676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 41983 41393 gene locus_tag LOCUS_25240 gene rimP 41983 41393 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BR9 protein_id gnl|my_center|LOCUS_25240 44000 42324 gene locus_tag LOCUS_25250 44000 42324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 44192 44923 gene locus_tag LOCUS_25260 44192 44923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 45185 47362 gene locus_tag LOCUS_25270 45185 47362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 47397 48209 gene locus_tag LOCUS_25280 47397 48209 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_25280 48223 49320 gene locus_tag LOCUS_25290 48223 49320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 49561 50391 gene locus_tag LOCUS_25300 49561 50391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 50404 51681 gene locus_tag LOCUS_25310 gene hemA 50404 51681 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72C23 protein_id gnl|my_center|LOCUS_25310 51736 52659 gene locus_tag LOCUS_25320 gene hemC 51736 52659 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKN2 protein_id gnl|my_center|LOCUS_25320 52664 53416 gene locus_tag LOCUS_25330 52664 53416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 53518 54546 gene locus_tag LOCUS_25340 gene hemE 53518 54546 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EP0 protein_id gnl|my_center|LOCUS_25340 54566 55996 gene locus_tag LOCUS_25350 gene hemG 54566 55996 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_25350 56069 57157 gene locus_tag LOCUS_25360 gene hemH 56069 57157 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_25360 57215 58501 gene locus_tag LOCUS_25370 gene hemL 57215 58501 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHB0 protein_id gnl|my_center|LOCUS_25370 59692 58619 gene locus_tag LOCUS_25380 59692 58619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 61120 59921 gene locus_tag LOCUS_25390 61120 59921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_25390 62534 61107 gene locus_tag LOCUS_25400 62534 61107 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_25400 63065 63841 gene locus_tag LOCUS_25410 63065 63841 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227636.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence035 194 1099 gene locus_tag LOCUS_25420 194 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2665 1121 gene locus_tag LOCUS_25430 2665 1121 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058287.1 protein_id gnl|my_center|LOCUS_25430 2873 3085 gene locus_tag LOCUS_25440 2873 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 3231 5354 gene locus_tag LOCUS_25450 3231 5354 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460118.1 protein_id gnl|my_center|LOCUS_25450 5351 6085 gene locus_tag LOCUS_25460 5351 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 6313 7032 gene locus_tag LOCUS_25470 gene phoB 6313 7032 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_25470 7029 8861 gene locus_tag LOCUS_25480 gene phoR 7029 8861 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_25480 9057 9998 gene locus_tag LOCUS_25490 9057 9998 CDS product voltage-gated potassium channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584156.1 protein_id gnl|my_center|LOCUS_25490 10098 11291 gene locus_tag LOCUS_25500 10098 11291 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 protein_id gnl|my_center|LOCUS_25500 11401 12489 gene locus_tag LOCUS_25510 11401 12489 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762579.1 protein_id gnl|my_center|LOCUS_25510 12554 14515 gene locus_tag LOCUS_25520 12554 14515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 15748 14537 gene locus_tag LOCUS_25530 15748 14537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 16514 18052 gene locus_tag LOCUS_25540 gene cafA 16514 18052 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_25540 18183 18536 gene locus_tag LOCUS_25550 18183 18536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 18676 19056 gene locus_tag LOCUS_25560 18676 19056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 19251 19892 gene locus_tag LOCUS_25570 19251 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 20421 20047 gene locus_tag LOCUS_25580 20421 20047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 21325 20456 gene locus_tag LOCUS_25590 21325 20456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 21535 22944 gene locus_tag LOCUS_25600 21535 22944 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEM2 protein_id gnl|my_center|LOCUS_25600 23068 24438 gene locus_tag LOCUS_25610 23068 24438 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCB7 protein_id gnl|my_center|LOCUS_25610 24935 24771 gene locus_tag LOCUS_25620 24935 24771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 25226 25543 gene locus_tag LOCUS_25630 gene trx 25226 25543 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ76 protein_id gnl|my_center|LOCUS_25630 25789 27261 gene locus_tag LOCUS_25640 25789 27261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 27596 30298 gene locus_tag LOCUS_25650 gene topA 27596 30298 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR4 protein_id gnl|my_center|LOCUS_25650 31162 30398 gene locus_tag LOCUS_25660 31162 30398 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_25660 32529 31183 gene locus_tag LOCUS_25670 32529 31183 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454923.1 protein_id gnl|my_center|LOCUS_25670 32792 33328 gene locus_tag LOCUS_25680 32792 33328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 34363 33761 gene locus_tag LOCUS_25690 34363 33761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 34549 35316 gene locus_tag LOCUS_25700 34549 35316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 35303 36487 gene locus_tag LOCUS_25710 35303 36487 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926967.1 protein_id gnl|my_center|LOCUS_25710 36487 41307 gene locus_tag LOCUS_25720 36487 41307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 41600 42541 gene locus_tag LOCUS_25730 41600 42541 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZB4 protein_id gnl|my_center|LOCUS_25730 42547 43593 gene locus_tag LOCUS_25740 42547 43593 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529567.1 protein_id gnl|my_center|LOCUS_25740 43577 44908 gene locus_tag LOCUS_25750 43577 44908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 45725 45225 gene locus_tag LOCUS_25760 45725 45225 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KML0 protein_id gnl|my_center|LOCUS_25760 46720 45722 gene locus_tag LOCUS_25770 46720 45722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 47784 47083 gene locus_tag LOCUS_25780 47784 47083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 48104 47781 gene locus_tag LOCUS_25790 48104 47781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 50180 48420 gene locus_tag LOCUS_25800 50180 48420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 51558 50407 gene locus_tag LOCUS_25810 51558 50407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259713.1 protein_id gnl|my_center|LOCUS_25810 52272 52198 gene locus_tag LOCUS_t00240 52272 52198 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 52458 52384 gene locus_tag LOCUS_t00250 52458 52384 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 52725 52650 gene locus_tag LOCUS_t00260 52725 52650 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 52908 52835 gene locus_tag LOCUS_t00270 52908 52835 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 52948 53145 gene locus_tag LOCUS_25820 52948 53145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 55033 53369 gene locus_tag LOCUS_25830 gene gpmI 55033 53369 CDS product putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59173 protein_id gnl|my_center|LOCUS_25830 55199 55681 gene locus_tag LOCUS_25840 55199 55681 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_25840 55933 56811 gene locus_tag LOCUS_25850 55933 56811 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941678.1 protein_id gnl|my_center|LOCUS_25850 56880 57761 gene locus_tag LOCUS_25860 56880 57761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 58473 57784 gene locus_tag LOCUS_25870 58473 57784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 59875 58460 gene locus_tag LOCUS_25880 59875 58460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25880 60003 61970 gene locus_tag LOCUS_25890 60003 61970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 61967 63427 gene locus_tag LOCUS_25900 61967 63427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence036 875 84 gene locus_tag LOCUS_25910 875 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 1939 995 gene locus_tag LOCUS_25920 1939 995 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480502.1 protein_id gnl|my_center|LOCUS_25920 2812 1994 gene locus_tag LOCUS_25930 2812 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 4287 2998 gene locus_tag LOCUS_25940 4287 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 5012 4416 gene locus_tag LOCUS_25950 gene mglA 5012 4416 CDS product cell polarity determinant GTPase MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_25950 5750 5274 gene locus_tag LOCUS_25960 gene mglB 5750 5274 CDS product dynein regulation protein LC7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_25960 5999 5799 gene locus_tag LOCUS_25970 5999 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 7930 6071 gene locus_tag LOCUS_25980 7930 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 8814 8179 gene locus_tag LOCUS_25990 gene recR 8814 8179 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y3X7 protein_id gnl|my_center|LOCUS_25990 9190 8888 gene locus_tag LOCUS_26000 9190 8888 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CA3 protein_id gnl|my_center|LOCUS_26000 9363 10010 gene locus_tag LOCUS_26010 9363 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 10014 10631 gene locus_tag LOCUS_26020 10014 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 11177 10635 gene locus_tag LOCUS_26030 11177 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 14287 11174 gene locus_tag LOCUS_26040 gene czcA 14287 11174 CDS product resistance-nodulation-cell division divalent metal cation efflux transporter CzcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115707.1 protein_id gnl|my_center|LOCUS_26040 15759 14287 gene locus_tag LOCUS_26050 15759 14287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 16139 15756 gene locus_tag LOCUS_26060 16139 15756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 16756 16349 gene locus_tag LOCUS_26070 16756 16349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 16649 16930 gene locus_tag LOCUS_26080 16649 16930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 16988 17845 gene locus_tag LOCUS_26090 gene nadC 16988 17845 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_26090 17874 18632 gene locus_tag LOCUS_26100 17874 18632 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545308.1 protein_id gnl|my_center|LOCUS_26100 18719 19909 gene locus_tag LOCUS_26110 18719 19909 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140377.1 protein_id gnl|my_center|LOCUS_26110 19909 20889 gene locus_tag LOCUS_26120 19909 20889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 21576 22892 gene locus_tag LOCUS_26130 21576 22892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 23065 23805 gene locus_tag LOCUS_26140 23065 23805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 23802 24653 gene locus_tag LOCUS_26150 23802 24653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 25486 24728 gene locus_tag LOCUS_26160 25486 24728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 25687 26541 gene locus_tag LOCUS_26170 25687 26541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 26546 27532 gene locus_tag LOCUS_26180 26546 27532 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967060.1 protein_id gnl|my_center|LOCUS_26180 27586 28440 gene locus_tag LOCUS_26190 27586 28440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 30122 28923 gene locus_tag LOCUS_26200 gene larA 30122 28923 CDS product lactate racemization operon protein LarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100883.1 protein_id gnl|my_center|LOCUS_26200 32470 30119 gene locus_tag LOCUS_26210 32470 30119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 33443 32544 gene locus_tag LOCUS_26220 33443 32544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 34626 33646 gene locus_tag LOCUS_26230 34626 33646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 35310 34681 gene locus_tag LOCUS_26240 35310 34681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 35683 36651 gene locus_tag LOCUS_26250 gene yrbG 35683 36651 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_26250 36949 36665 gene locus_tag LOCUS_26260 36949 36665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 37295 37498 gene locus_tag LOCUS_26270 37295 37498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 37765 37953 gene locus_tag LOCUS_26280 37765 37953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 37973 38581 gene locus_tag LOCUS_26290 37973 38581 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391876.1 protein_id gnl|my_center|LOCUS_26290 40543 39221 gene locus_tag LOCUS_26300 40543 39221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 41526 40690 gene locus_tag LOCUS_26310 41526 40690 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_26310 41710 42459 gene locus_tag LOCUS_26320 41710 42459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 44435 42651 gene locus_tag LOCUS_26330 44435 42651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 44536 45747 gene locus_tag LOCUS_26340 44536 45747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 46663 45749 gene locus_tag LOCUS_26350 46663 45749 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_26350 46959 46660 gene locus_tag LOCUS_26360 46959 46660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 47258 48337 gene locus_tag LOCUS_26370 47258 48337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 48629 51013 gene locus_tag LOCUS_26380 48629 51013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 51903 51145 gene locus_tag LOCUS_26390 51903 51145 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_26390 52184 53008 gene locus_tag LOCUS_26400 52184 53008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 53108 54100 gene locus_tag LOCUS_26410 53108 54100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 54630 54058 gene locus_tag LOCUS_26420 54630 54058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 55394 54627 gene locus_tag LOCUS_26430 55394 54627 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941299.1 protein_id gnl|my_center|LOCUS_26430 56039 55488 gene locus_tag LOCUS_26440 56039 55488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 57140 56052 gene locus_tag LOCUS_26450 57140 56052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 58590 57256 gene locus_tag LOCUS_26460 58590 57256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 60331 58907 gene locus_tag LOCUS_26470 60331 58907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 60787 60398 gene locus_tag LOCUS_26480 60787 60398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 62287 60932 gene locus_tag LOCUS_26490 62287 60932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 62565 62490 gene locus_tag LOCUS_t00280 62565 62490 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 62682 62611 gene locus_tag LOCUS_t00290 62682 62611 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence037 1019 441 gene locus_tag LOCUS_26500 1019 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140719.1 protein_id gnl|my_center|LOCUS_26500 1290 2402 gene locus_tag LOCUS_26510 1290 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 2405 3187 gene locus_tag LOCUS_26520 2405 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 4418 3201 gene locus_tag LOCUS_26530 4418 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 5859 4582 gene locus_tag LOCUS_26540 gene kynU 5859 4582 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_26540 6734 5892 gene locus_tag LOCUS_26550 6734 5892 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_26550 7808 6738 gene locus_tag LOCUS_26560 7808 6738 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030812.1 protein_id gnl|my_center|LOCUS_26560 8397 7891 gene locus_tag LOCUS_26570 gene nbaC 8397 7891 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_26570 8905 8516 gene locus_tag LOCUS_26580 8905 8516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 9120 9902 gene locus_tag LOCUS_26590 9120 9902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 10922 9909 gene locus_tag LOCUS_26600 10922 9909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 12286 10919 gene locus_tag LOCUS_26610 12286 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 12562 13236 gene locus_tag LOCUS_26620 12562 13236 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_26620 14038 16314 gene locus_tag LOCUS_26630 gene maeB 14038 16314 CDS product bifunctional malic enzyme oxidoreductase/phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_26630 16476 19409 gene locus_tag LOCUS_26640 16476 19409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 20913 19468 gene locus_tag LOCUS_26650 20913 19468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 21177 22610 gene locus_tag LOCUS_26660 21177 22610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 22632 23858 gene locus_tag LOCUS_26670 22632 23858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 23896 24885 gene locus_tag LOCUS_26680 23896 24885 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 protein_id gnl|my_center|LOCUS_26680 25416 24898 gene locus_tag LOCUS_26690 25416 24898 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_26690 27425 25413 gene locus_tag LOCUS_26700 27425 25413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 30175 27581 gene locus_tag LOCUS_26710 30175 27581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 32027 30324 gene locus_tag LOCUS_26720 32027 30324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 34295 32364 gene locus_tag LOCUS_26730 34295 32364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 37320 34477 gene locus_tag LOCUS_26740 gene mutS 37320 34477 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJG2 protein_id gnl|my_center|LOCUS_26740 37587 38129 gene locus_tag LOCUS_26750 37587 38129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 38632 38201 gene locus_tag LOCUS_26760 38632 38201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 41811 38665 gene locus_tag LOCUS_26770 41811 38665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 44998 41840 gene locus_tag LOCUS_26780 44998 41840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 46762 45602 gene locus_tag LOCUS_26790 46762 45602 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405365.1 protein_id gnl|my_center|LOCUS_26790 47225 48754 gene locus_tag LOCUS_26800 47225 48754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 48965 49909 gene locus_tag LOCUS_26810 48965 49909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 50011 51846 gene locus_tag LOCUS_26820 50011 51846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 51843 52751 gene locus_tag LOCUS_26830 51843 52751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 52781 53845 gene locus_tag LOCUS_26840 52781 53845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 54470 53883 gene locus_tag LOCUS_26850 54470 53883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 56288 54474 gene locus_tag LOCUS_26860 56288 54474 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_26860 58021 56357 gene locus_tag LOCUS_26870 gene rpsA 58021 56357 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_26870 58489 60564 gene locus_tag LOCUS_26880 58489 60564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 61310 61705 gene locus_tag LOCUS_26890 61310 61705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 62024 62506 gene locus_tag LOCUS_26900 62024 62506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence038 2675 3367 gene locus_tag LOCUS_26910 2675 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 3500 4276 gene locus_tag LOCUS_26920 3500 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 4331 5104 gene locus_tag LOCUS_26930 4331 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 5145 6437 gene locus_tag LOCUS_26940 5145 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 6948 6454 gene locus_tag LOCUS_26950 6948 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 9683 7014 gene locus_tag LOCUS_26960 9683 7014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 9926 10600 gene locus_tag LOCUS_26970 9926 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 12363 10672 gene locus_tag LOCUS_26980 12363 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 13162 12476 gene locus_tag LOCUS_26990 gene ung 13162 12476 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q836Z5 protein_id gnl|my_center|LOCUS_26990 13388 14143 gene locus_tag LOCUS_27000 13388 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 14264 15646 gene locus_tag LOCUS_27010 14264 15646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122297.1 protein_id gnl|my_center|LOCUS_27010 16611 17552 gene locus_tag LOCUS_27020 16611 17552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 19552 17588 gene locus_tag LOCUS_27030 19552 17588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 21501 19552 gene locus_tag LOCUS_27040 21501 19552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 23238 21745 gene locus_tag LOCUS_27050 23238 21745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 24515 24910 gene locus_tag LOCUS_27060 24515 24910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 25204 27393 gene locus_tag LOCUS_27070 25204 27393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 29806 27383 gene locus_tag LOCUS_27080 29806 27383 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_27080 35539 29807 gene locus_tag LOCUS_27090 35539 29807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 37212 35773 gene locus_tag LOCUS_27100 37212 35773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 37454 38914 gene locus_tag LOCUS_27110 37454 38914 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_27110 39044 39625 gene locus_tag LOCUS_27120 39044 39625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 40081 39647 gene locus_tag LOCUS_27130 40081 39647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 42307 40358 gene locus_tag LOCUS_27140 gene glgB 42307 40358 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJB4 protein_id gnl|my_center|LOCUS_27140 42429 42758 gene locus_tag LOCUS_27150 42429 42758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 43296 42835 gene locus_tag LOCUS_27160 43296 42835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 44336 43377 gene locus_tag LOCUS_27170 44336 43377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 44951 44361 gene locus_tag LOCUS_27180 44951 44361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 45054 47882 gene locus_tag LOCUS_27190 45054 47882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 48288 47884 gene locus_tag LOCUS_27200 48288 47884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 49401 48397 gene locus_tag LOCUS_27210 49401 48397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029600.1 protein_id gnl|my_center|LOCUS_27210 57667 49577 gene locus_tag LOCUS_27220 57667 49577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 59838 58258 gene locus_tag LOCUS_27230 59838 58258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 >Feature sequence039 185 1381 gene locus_tag LOCUS_27240 185 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 1776 1342 gene locus_tag LOCUS_27250 1776 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 4331 1782 gene locus_tag LOCUS_27260 4331 1782 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_27260 4600 5031 gene locus_tag LOCUS_27270 4600 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 5094 8882 gene locus_tag LOCUS_27280 5094 8882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 9494 8892 gene locus_tag LOCUS_27290 9494 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 9875 11446 gene locus_tag LOCUS_27300 9875 11446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 11556 11720 gene locus_tag LOCUS_27310 11556 11720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 13388 11766 gene locus_tag LOCUS_27320 13388 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 13644 16511 gene locus_tag LOCUS_27330 13644 16511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 17282 16653 gene locus_tag LOCUS_27340 17282 16653 CDS product NADH-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_27340 18061 19890 gene locus_tag LOCUS_27350 18061 19890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 20263 20979 gene locus_tag LOCUS_27360 20263 20979 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530139.1 protein_id gnl|my_center|LOCUS_27360 24002 20976 gene locus_tag LOCUS_27370 24002 20976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 25726 24002 gene locus_tag LOCUS_27380 25726 24002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 25957 26946 gene locus_tag LOCUS_27390 25957 26946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 27064 27384 gene locus_tag LOCUS_27400 27064 27384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 28175 27486 gene locus_tag LOCUS_27410 28175 27486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 29070 28282 gene locus_tag LOCUS_27420 29070 28282 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_27420 29707 29102 gene locus_tag LOCUS_27430 29707 29102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 32099 29712 gene locus_tag LOCUS_27440 32099 29712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 32328 32948 gene locus_tag LOCUS_27450 32328 32948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 33745 32963 gene locus_tag LOCUS_27460 33745 32963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 34771 33824 gene locus_tag LOCUS_27470 34771 33824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 36123 34780 gene locus_tag LOCUS_27480 36123 34780 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202627.1 protein_id gnl|my_center|LOCUS_27480 36966 36154 gene locus_tag LOCUS_27490 36966 36154 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_27490 37625 36963 gene locus_tag LOCUS_27500 37625 36963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 38785 37622 gene locus_tag LOCUS_27510 38785 37622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 39714 38782 gene locus_tag LOCUS_27520 39714 38782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 40889 39732 gene locus_tag LOCUS_27530 40889 39732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 41369 40974 gene locus_tag LOCUS_27540 41369 40974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581246.1 protein_id gnl|my_center|LOCUS_27540 41908 41495 gene locus_tag LOCUS_27550 gene dksA 41908 41495 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9J6 protein_id gnl|my_center|LOCUS_27550 42360 42986 gene locus_tag LOCUS_27560 42360 42986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 44118 43075 gene locus_tag LOCUS_27570 44118 43075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 45261 44236 gene locus_tag LOCUS_27580 45261 44236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 46586 45297 gene locus_tag LOCUS_27590 46586 45297 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_27590 46847 47545 gene locus_tag LOCUS_27600 gene fabG 46847 47545 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 protein_id gnl|my_center|LOCUS_27600 48927 47695 gene locus_tag LOCUS_27610 48927 47695 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_27610 49085 49927 gene locus_tag LOCUS_27620 49085 49927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 49986 52829 gene locus_tag LOCUS_27630 49986 52829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 53968 52856 gene locus_tag LOCUS_27640 53968 52856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 54114 54584 gene locus_tag LOCUS_27650 54114 54584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 55025 54717 gene locus_tag LOCUS_27660 55025 54717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 56545 55094 gene locus_tag LOCUS_27670 56545 55094 CDS product inosine 5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027797.1 protein_id gnl|my_center|LOCUS_27670 56685 57962 gene locus_tag LOCUS_27680 gene aspC 56685 57962 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EAN6 protein_id gnl|my_center|LOCUS_27680 58949 57981 gene locus_tag LOCUS_27690 58949 57981 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_27690 59235 59702 gene locus_tag LOCUS_27700 59235 59702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence040 2864 420 gene locus_tag LOCUS_27710 2864 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 5666 3093 gene locus_tag LOCUS_27720 5666 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 6450 5845 gene locus_tag LOCUS_27730 6450 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 6758 7336 gene locus_tag LOCUS_27740 6758 7336 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_27740 7905 7441 gene locus_tag LOCUS_27750 7905 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 8625 8014 gene locus_tag LOCUS_27760 8625 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 9333 11441 gene locus_tag LOCUS_27770 9333 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 11530 12552 gene locus_tag LOCUS_27780 11530 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 12740 12656 gene locus_tag LOCUS_t00300 12740 12656 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13714 12797 gene locus_tag LOCUS_27790 13714 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 14400 13711 gene locus_tag LOCUS_27800 14400 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 15955 14588 gene locus_tag LOCUS_27810 gene tolB 15955 14588 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H67 protein_id gnl|my_center|LOCUS_27810 16865 16062 gene locus_tag LOCUS_27820 16865 16062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 17542 16991 gene locus_tag LOCUS_27830 17542 16991 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932318.1 protein_id gnl|my_center|LOCUS_27830 18342 17608 gene locus_tag LOCUS_27840 18342 17608 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_27840 18598 19323 gene locus_tag LOCUS_27850 18598 19323 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972089.1 protein_id gnl|my_center|LOCUS_27850 20309 19392 gene locus_tag LOCUS_27860 20309 19392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 20713 20372 gene locus_tag LOCUS_27870 20713 20372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 21975 20767 gene locus_tag LOCUS_27880 21975 20767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 24229 22031 gene locus_tag LOCUS_27890 24229 22031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 25007 24360 gene locus_tag LOCUS_27900 25007 24360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 25152 27983 gene locus_tag LOCUS_27910 gene tolB 25152 27983 CDS product TolB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120765.1 protein_id gnl|my_center|LOCUS_27910 28089 29333 gene locus_tag LOCUS_27920 28089 29333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 30189 29368 gene locus_tag LOCUS_27930 30189 29368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 31335 30253 gene locus_tag LOCUS_27940 31335 30253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 31781 31392 gene locus_tag LOCUS_27950 31781 31392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 32838 31990 gene locus_tag LOCUS_27960 gene ttcA 32838 31990 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKM7 protein_id gnl|my_center|LOCUS_27960 33593 32916 gene locus_tag LOCUS_27970 33593 32916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 34029 34742 gene locus_tag LOCUS_27980 34029 34742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 37569 34774 gene locus_tag LOCUS_27990 37569 34774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 38728 37757 gene locus_tag LOCUS_28000 38728 37757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 40920 38725 gene locus_tag LOCUS_28010 40920 38725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 41491 41919 gene locus_tag LOCUS_28020 41491 41919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 41900 43024 gene locus_tag LOCUS_28030 41900 43024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 43306 43614 gene locus_tag LOCUS_28040 43306 43614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 43716 44594 gene locus_tag LOCUS_28050 43716 44594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 44604 45098 gene locus_tag LOCUS_28060 44604 45098 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258700.1 protein_id gnl|my_center|LOCUS_28060 46392 45127 gene locus_tag LOCUS_28070 46392 45127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 58557 46600 gene locus_tag LOCUS_28080 58557 46600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 <59698 58736 gene locus_tag LOCUS_28090 <59698 58736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001170072.1:coproporphyrinogen III oxidase >Feature sequence041 841 1515 gene locus_tag LOCUS_28100 841 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143958.1 protein_id gnl|my_center|LOCUS_28100 6588 2194 gene locus_tag LOCUS_28110 6588 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 8397 6745 gene locus_tag LOCUS_28120 gene bglB 8397 6745 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D8I7 protein_id gnl|my_center|LOCUS_28120 8747 10411 gene locus_tag LOCUS_28130 8747 10411 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_28130 11023 11427 gene locus_tag LOCUS_28140 11023 11427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 12567 11338 gene locus_tag LOCUS_28150 12567 11338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 protein_id gnl|my_center|LOCUS_28150 12751 13050 gene locus_tag LOCUS_28160 12751 13050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 13510 13007 gene locus_tag LOCUS_28170 13510 13007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 14554 13601 gene locus_tag LOCUS_28180 14554 13601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 15096 14551 gene locus_tag LOCUS_28190 15096 14551 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948161.1 protein_id gnl|my_center|LOCUS_28190 15434 15360 gene locus_tag LOCUS_t00310 15434 15360 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15660 15586 gene locus_tag LOCUS_t00320 15660 15586 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16138 16959 gene locus_tag LOCUS_28200 gene soj 16138 16959 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_28200 17205 18239 gene locus_tag LOCUS_28210 17205 18239 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940615.1 protein_id gnl|my_center|LOCUS_28210 19798 18341 gene locus_tag LOCUS_28220 19798 18341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 20334 20158 gene locus_tag LOCUS_28230 20334 20158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 21442 20822 gene locus_tag LOCUS_28240 21442 20822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 25373 21459 gene locus_tag LOCUS_28250 25373 21459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 27054 25459 gene locus_tag LOCUS_28260 27054 25459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 27279 27366 gene locus_tag LOCUS_t00330 27279 27366 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27494 27584 gene locus_tag LOCUS_t00340 27494 27584 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27790 27879 gene locus_tag LOCUS_t00350 27790 27879 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27937 28027 gene locus_tag LOCUS_t00360 27937 28027 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 28473 28546 gene locus_tag LOCUS_t00370 28473 28546 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 28665 29123 gene locus_tag LOCUS_28270 gene tadA 28665 29123 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2VEQ5 protein_id gnl|my_center|LOCUS_28270 29516 30766 gene locus_tag LOCUS_28280 29516 30766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 30950 32548 gene locus_tag LOCUS_28290 30950 32548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 32623 34023 gene locus_tag LOCUS_28300 32623 34023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 35935 34112 gene locus_tag LOCUS_28310 35935 34112 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213295.1 protein_id gnl|my_center|LOCUS_28310 36437 37486 gene locus_tag LOCUS_28320 36437 37486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 38358 37516 gene locus_tag LOCUS_28330 38358 37516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 38558 39040 gene locus_tag LOCUS_28340 38558 39040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 39954 39037 gene locus_tag LOCUS_28350 39954 39037 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_28350 40629 39967 gene locus_tag LOCUS_28360 40629 39967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_28360 40847 41530 gene locus_tag LOCUS_28370 40847 41530 CDS product SM-20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454888.1 protein_id gnl|my_center|LOCUS_28370 43166 41649 gene locus_tag LOCUS_28380 43166 41649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 43473 44288 gene locus_tag LOCUS_28390 43473 44288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 44473 45264 gene locus_tag LOCUS_28400 44473 45264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 45261 46835 gene locus_tag LOCUS_28410 45261 46835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 46976 47977 gene locus_tag LOCUS_28420 46976 47977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 48641 48090 gene locus_tag LOCUS_28430 48641 48090 CDS product forkhead-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259645.1 protein_id gnl|my_center|LOCUS_28430 49169 48693 gene locus_tag LOCUS_28440 49169 48693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 50045 49224 gene locus_tag LOCUS_28450 gene hisN 50045 49224 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_28450 51256 50117 gene locus_tag LOCUS_28460 51256 50117 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031746.1 protein_id gnl|my_center|LOCUS_28460 52200 51253 gene locus_tag LOCUS_28470 52200 51253 CDS product putative carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBI5 protein_id gnl|my_center|LOCUS_28470 53152 52208 gene locus_tag LOCUS_28480 53152 52208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 53453 55465 gene locus_tag LOCUS_28490 53453 55465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 55500 56552 gene locus_tag LOCUS_28500 gene manC 55500 56552 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_28500 >Feature sequence042 1011 697 gene locus_tag LOCUS_28510 1011 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2837 1110 gene locus_tag LOCUS_28520 2837 1110 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460549.1 protein_id gnl|my_center|LOCUS_28520 5966 2874 gene locus_tag LOCUS_28530 5966 2874 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028629.1 protein_id gnl|my_center|LOCUS_28530 7145 6177 gene locus_tag LOCUS_28540 7145 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 7720 7349 gene locus_tag LOCUS_28550 7720 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 8024 7689 gene locus_tag LOCUS_28560 8024 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 8246 10459 gene locus_tag LOCUS_28570 8246 10459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 10506 12146 gene locus_tag LOCUS_28580 10506 12146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 12272 12940 gene locus_tag LOCUS_28590 12272 12940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 13607 12996 gene locus_tag LOCUS_28600 13607 12996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 17000 13635 gene locus_tag LOCUS_28610 17000 13635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 18434 17247 gene locus_tag LOCUS_28620 18434 17247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 18667 18966 gene locus_tag LOCUS_28630 18667 18966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 19173 22007 gene locus_tag LOCUS_28640 19173 22007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 22124 22945 gene locus_tag LOCUS_28650 22124 22945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 22949 26359 gene locus_tag LOCUS_28660 22949 26359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 27386 26496 gene locus_tag LOCUS_28670 27386 26496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 29068 27413 gene locus_tag LOCUS_28680 29068 27413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 29281 34134 gene locus_tag LOCUS_28690 29281 34134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 34162 35985 gene locus_tag LOCUS_28700 34162 35985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 35982 37883 gene locus_tag LOCUS_28710 35982 37883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 37929 40136 gene locus_tag LOCUS_28720 37929 40136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 41288 41545 gene locus_tag LOCUS_28730 41288 41545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 41664 41942 gene locus_tag LOCUS_28740 41664 41942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 42116 42892 gene locus_tag LOCUS_28750 42116 42892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 43611 47510 gene locus_tag LOCUS_28760 43611 47510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 47510 54055 gene locus_tag LOCUS_28770 47510 54055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 54163 55290 gene locus_tag LOCUS_28780 54163 55290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 56654 55665 gene locus_tag LOCUS_28790 gene ydiP 56654 55665 CDS product putative BsuMI modification methylase subunit YdiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34680 protein_id gnl|my_center|LOCUS_28790 >Feature sequence043 199 1605 gene locus_tag LOCUS_28800 199 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 1662 3077 gene locus_tag LOCUS_28810 1662 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 4157 3090 gene locus_tag LOCUS_28820 4157 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 4633 5748 gene locus_tag LOCUS_28830 4633 5748 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208437.1 protein_id gnl|my_center|LOCUS_28830 5938 10194 gene locus_tag LOCUS_28840 5938 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 10286 12328 gene locus_tag LOCUS_28850 10286 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248417.1 protein_id gnl|my_center|LOCUS_28850 12495 13760 gene locus_tag LOCUS_28860 12495 13760 CDS product 8-amino-7-oxononanoate synthase/2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHZ8 protein_id gnl|my_center|LOCUS_28860 13769 14932 gene locus_tag LOCUS_28870 13769 14932 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061465.1 protein_id gnl|my_center|LOCUS_28870 14925 15509 gene locus_tag LOCUS_28880 14925 15509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 17226 15643 gene locus_tag LOCUS_28890 17226 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 19952 17223 gene locus_tag LOCUS_28900 19952 17223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 20172 21047 gene locus_tag LOCUS_28910 20172 21047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 21055 22557 gene locus_tag LOCUS_28920 21055 22557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 25286 22530 gene locus_tag LOCUS_28930 25286 22530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 25533 26933 gene locus_tag LOCUS_28940 25533 26933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 29350 27083 gene locus_tag LOCUS_28950 29350 27083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 32922 29350 gene locus_tag LOCUS_28960 32922 29350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 36301 32927 gene locus_tag LOCUS_28970 36301 32927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 36658 38466 gene locus_tag LOCUS_28980 36658 38466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 38629 39201 gene locus_tag LOCUS_28990 gene kptA 38629 39201 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HH75 protein_id gnl|my_center|LOCUS_28990 39854 39264 gene locus_tag LOCUS_29000 39854 39264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 41354 40005 gene locus_tag LOCUS_29010 41354 40005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 43381 41591 gene locus_tag LOCUS_29020 43381 41591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 44231 43374 gene locus_tag LOCUS_29030 44231 43374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 45283 44357 gene locus_tag LOCUS_29040 gene cysK1 45283 44357 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WP55 protein_id gnl|my_center|LOCUS_29040 47238 45328 gene locus_tag LOCUS_29050 gene yitJ 47238 45328 CDS product bifunctional homocysteine S-methyltransferase/5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06745 protein_id gnl|my_center|LOCUS_29050 47493 48383 gene locus_tag LOCUS_29060 47493 48383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 48384 49262 gene locus_tag LOCUS_29070 48384 49262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 49704 49234 gene locus_tag LOCUS_29080 49704 49234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 50142 49792 gene locus_tag LOCUS_29090 50142 49792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 50605 50679 gene locus_tag LOCUS_t00380 50605 50679 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 50682 50755 gene locus_tag LOCUS_t00390 50682 50755 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 50870 52258 gene locus_tag LOCUS_29100 50870 52258 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_29100 52439 53764 gene locus_tag LOCUS_29110 52439 53764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 53978 55345 gene locus_tag LOCUS_29120 53978 55345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 >Feature sequence044 1539 112 gene locus_tag LOCUS_29130 1539 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 3386 1605 gene locus_tag LOCUS_29140 3386 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 3654 4595 gene locus_tag LOCUS_29150 3654 4595 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_29150 4807 4571 gene locus_tag LOCUS_29160 4807 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 4689 6725 gene locus_tag LOCUS_29170 4689 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 6990 8057 gene locus_tag LOCUS_29180 6990 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 11409 8065 gene locus_tag LOCUS_29190 11409 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 11683 13173 gene locus_tag LOCUS_29200 11683 13173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 13234 14439 gene locus_tag LOCUS_29210 gene ybbC 13234 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40407 protein_id gnl|my_center|LOCUS_29210 14505 15095 gene locus_tag LOCUS_29220 gene nadD 14505 15095 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0V3 protein_id gnl|my_center|LOCUS_29220 15269 15916 gene locus_tag LOCUS_29230 15269 15916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 19275 16069 gene locus_tag LOCUS_29240 19275 16069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 19603 20235 gene locus_tag LOCUS_29250 19603 20235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 22089 20239 gene locus_tag LOCUS_29260 22089 20239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 22321 22929 gene locus_tag LOCUS_29270 22321 22929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 23006 27019 gene locus_tag LOCUS_29280 23006 27019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 28284 27181 gene locus_tag LOCUS_29290 28284 27181 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405365.1 protein_id gnl|my_center|LOCUS_29290 28613 28281 gene locus_tag LOCUS_29300 28613 28281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 29251 28610 gene locus_tag LOCUS_29310 gene coaE 29251 28610 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCU7 protein_id gnl|my_center|LOCUS_29310 29504 30682 gene locus_tag LOCUS_29320 29504 30682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 30685 32034 gene locus_tag LOCUS_29330 30685 32034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 32136 32744 gene locus_tag LOCUS_29340 gene engB 32136 32744 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748I9 protein_id gnl|my_center|LOCUS_29340 32775 33269 gene locus_tag LOCUS_29350 32775 33269 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5I6 protein_id gnl|my_center|LOCUS_29350 33424 34365 gene locus_tag LOCUS_29360 gene prs 33424 34365 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHU3 protein_id gnl|my_center|LOCUS_29360 35202 34357 gene locus_tag LOCUS_29370 35202 34357 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258710.1 protein_id gnl|my_center|LOCUS_29370 35944 35435 gene locus_tag LOCUS_29380 35944 35435 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143719.1 protein_id gnl|my_center|LOCUS_29380 37162 36392 gene locus_tag LOCUS_29390 37162 36392 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_29390 37277 37744 gene locus_tag LOCUS_29400 gene rlmH 37277 37744 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X82 protein_id gnl|my_center|LOCUS_29400 37883 39994 gene locus_tag LOCUS_29410 37883 39994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 40562 40122 gene locus_tag LOCUS_29420 gene rsfS 40562 40122 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGK3 protein_id gnl|my_center|LOCUS_29420 42084 40738 gene locus_tag LOCUS_29430 gene proA 42084 40738 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Q4 protein_id gnl|my_center|LOCUS_29430 42380 42670 gene locus_tag LOCUS_29440 gene groS 42380 42670 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWV5 protein_id gnl|my_center|LOCUS_29440 42797 44449 gene locus_tag LOCUS_29450 gene groL 42797 44449 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AL6 protein_id gnl|my_center|LOCUS_29450 44698 46602 gene locus_tag LOCUS_29460 44698 46602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 46623 48065 gene locus_tag LOCUS_29470 46623 48065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 48250 49563 gene locus_tag LOCUS_29480 48250 49563 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE7 protein_id gnl|my_center|LOCUS_29480 52125 49855 gene locus_tag LOCUS_29490 52125 49855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence045 2217 3638 gene locus_tag LOCUS_29500 2217 3638 CDS product lignostilbene alpha-beta-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055870.1 protein_id gnl|my_center|LOCUS_29500 5635 3701 gene locus_tag LOCUS_29510 5635 3701 CDS product lipid A ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_29510 7560 5662 gene locus_tag LOCUS_29520 7560 5662 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110315.1 protein_id gnl|my_center|LOCUS_29520 7776 12686 gene locus_tag LOCUS_29530 7776 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 12965 13531 gene locus_tag LOCUS_29540 12965 13531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 13528 15168 gene locus_tag LOCUS_29550 13528 15168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 15165 15812 gene locus_tag LOCUS_29560 15165 15812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 16005 17408 gene locus_tag LOCUS_29570 16005 17408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 17483 18712 gene locus_tag LOCUS_29580 17483 18712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 20296 18734 gene locus_tag LOCUS_29590 20296 18734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 21957 20293 gene locus_tag LOCUS_29600 21957 20293 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528784.1 protein_id gnl|my_center|LOCUS_29600 22663 21938 gene locus_tag LOCUS_29610 22663 21938 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090346.1 protein_id gnl|my_center|LOCUS_29610 24198 22672 gene locus_tag LOCUS_29620 24198 22672 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_29620 25203 24226 gene locus_tag LOCUS_29630 25203 24226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 26798 25287 gene locus_tag LOCUS_29640 26798 25287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 27014 27403 gene locus_tag LOCUS_29650 27014 27403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 27551 27916 gene locus_tag LOCUS_29660 27551 27916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 28559 28014 gene locus_tag LOCUS_29670 28559 28014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 29473 28715 gene locus_tag LOCUS_29680 29473 28715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337288.1 protein_id gnl|my_center|LOCUS_29680 31846 29486 gene locus_tag LOCUS_29690 31846 29486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 34599 31843 gene locus_tag LOCUS_29700 34599 31843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 35950 34838 gene locus_tag LOCUS_29710 gene selD 35950 34838 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQF1 protein_id gnl|my_center|LOCUS_29710 37028 35985 gene locus_tag LOCUS_29720 37028 35985 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EL0 protein_id gnl|my_center|LOCUS_29720 37990 37034 gene locus_tag LOCUS_29730 37990 37034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 38288 39790 gene locus_tag LOCUS_29740 38288 39790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 39860 40495 gene locus_tag LOCUS_29750 39860 40495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 40598 41533 gene locus_tag LOCUS_29760 40598 41533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 41933 42763 gene locus_tag LOCUS_29770 gene ldhA 41933 42763 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112591.1 protein_id gnl|my_center|LOCUS_29770 46813 42989 gene locus_tag LOCUS_29780 46813 42989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 48652 47078 gene locus_tag LOCUS_29790 48652 47078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 48836 50389 gene locus_tag LOCUS_29800 48836 50389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 51436 50408 gene locus_tag LOCUS_29810 51436 50408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 >Feature sequence046 701 54 gene locus_tag LOCUS_29820 701 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 2668 1004 gene locus_tag LOCUS_29830 2668 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 4442 2901 gene locus_tag LOCUS_29840 4442 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 6237 4594 gene locus_tag LOCUS_29850 gene prfC 6237 4594 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LD2 protein_id gnl|my_center|LOCUS_29850 6592 7746 gene locus_tag LOCUS_29860 6592 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 7919 9991 gene locus_tag LOCUS_29870 7919 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 11900 10083 gene locus_tag LOCUS_29880 11900 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 12788 11937 gene locus_tag LOCUS_29890 12788 11937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 13176 16586 gene locus_tag LOCUS_29900 13176 16586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 16989 16723 gene locus_tag LOCUS_29910 16989 16723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 17066 19000 gene locus_tag LOCUS_29920 17066 19000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 19049 19768 gene locus_tag LOCUS_29930 19049 19768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 19769 21415 gene locus_tag LOCUS_29940 19769 21415 CDS product putative flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704612.1 protein_id gnl|my_center|LOCUS_29940 21412 22584 gene locus_tag LOCUS_29950 21412 22584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 22669 23811 gene locus_tag LOCUS_29960 22669 23811 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878013.1 protein_id gnl|my_center|LOCUS_29960 23909 24910 gene locus_tag LOCUS_29970 23909 24910 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_29970 25307 26998 gene locus_tag LOCUS_29980 25307 26998 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144132.1 protein_id gnl|my_center|LOCUS_29980 27526 28758 gene locus_tag LOCUS_29990 27526 28758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 29968 28796 gene locus_tag LOCUS_30000 29968 28796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 30813 30055 gene locus_tag LOCUS_30010 30813 30055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 33306 31000 gene locus_tag LOCUS_30020 33306 31000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 34576 33494 gene locus_tag LOCUS_30030 34576 33494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 35570 34764 gene locus_tag LOCUS_30040 35570 34764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 37177 35567 gene locus_tag LOCUS_30050 37177 35567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 38328 37174 gene locus_tag LOCUS_30060 38328 37174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199806.1 protein_id gnl|my_center|LOCUS_30060 38897 38364 gene locus_tag LOCUS_30070 38897 38364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 39274 38894 gene locus_tag LOCUS_30080 39274 38894 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658059.1 protein_id gnl|my_center|LOCUS_30080 39650 40627 gene locus_tag LOCUS_30090 39650 40627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 43166 40611 gene locus_tag LOCUS_30100 43166 40611 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483542.1 protein_id gnl|my_center|LOCUS_30100 45817 43451 gene locus_tag LOCUS_30110 45817 43451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 46383 46928 gene locus_tag LOCUS_30120 46383 46928 CDS product chromate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_458096.3 protein_id gnl|my_center|LOCUS_30120 47427 46939 gene locus_tag LOCUS_30130 47427 46939 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_30130 48714 47542 gene locus_tag LOCUS_30140 48714 47542 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIE0 protein_id gnl|my_center|LOCUS_30140 49264 48782 gene locus_tag LOCUS_30150 gene coaD 49264 48782 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAI3 protein_id gnl|my_center|LOCUS_30150 49921 49376 gene locus_tag LOCUS_30160 49921 49376 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_30160 >Feature sequence047 1837 434 gene locus_tag LOCUS_30170 1837 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 4876 2015 gene locus_tag LOCUS_30180 gene sucA 4876 2015 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326049.1 protein_id gnl|my_center|LOCUS_30180 5299 7305 gene locus_tag LOCUS_30190 5299 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 7482 9578 gene locus_tag LOCUS_30200 7482 9578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 9643 10956 gene locus_tag LOCUS_30210 9643 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 11321 11788 gene locus_tag LOCUS_30220 11321 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 11856 12473 gene locus_tag LOCUS_30230 11856 12473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 12627 13175 gene locus_tag LOCUS_30240 gene atpH 12627 13175 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWL8 protein_id gnl|my_center|LOCUS_30240 13282 14838 gene locus_tag LOCUS_30250 gene atpA 13282 14838 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY2 protein_id gnl|my_center|LOCUS_30250 14876 15757 gene locus_tag LOCUS_30260 gene atpG 14876 15757 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY1 protein_id gnl|my_center|LOCUS_30260 15865 17493 gene locus_tag LOCUS_30270 gene atpD 15865 17493 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFX9 protein_id gnl|my_center|LOCUS_30270 17581 18018 gene locus_tag LOCUS_30280 gene atpC 17581 18018 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462228.1 protein_id gnl|my_center|LOCUS_30280 18665 20467 gene locus_tag LOCUS_30290 18665 20467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 21256 20600 gene locus_tag LOCUS_30300 21256 20600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 21949 21287 gene locus_tag LOCUS_30310 21949 21287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 22910 22053 gene locus_tag LOCUS_30320 22910 22053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 23893 23057 gene locus_tag LOCUS_30330 23893 23057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402809.1 protein_id gnl|my_center|LOCUS_30330 25905 23911 gene locus_tag LOCUS_30340 25905 23911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 26169 27563 gene locus_tag LOCUS_30350 gene lpdA2 26169 27563 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK0 protein_id gnl|my_center|LOCUS_30350 27641 28066 gene locus_tag LOCUS_30360 27641 28066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 28131 30344 gene locus_tag LOCUS_30370 28131 30344 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_30370 30555 32003 gene locus_tag LOCUS_30380 30555 32003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 32226 33644 gene locus_tag LOCUS_30390 32226 33644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 33679 34683 gene locus_tag LOCUS_30400 33679 34683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 35067 34699 gene locus_tag LOCUS_30410 35067 34699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 38442 35137 gene locus_tag LOCUS_30420 38442 35137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141887.1 protein_id gnl|my_center|LOCUS_30420 39405 38470 gene locus_tag LOCUS_30430 39405 38470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 39440 39721 gene locus_tag LOCUS_30440 39440 39721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 40066 41859 gene locus_tag LOCUS_30450 40066 41859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 41932 44118 gene locus_tag LOCUS_30460 41932 44118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 44140 45648 gene locus_tag LOCUS_30470 44140 45648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 45660 46283 gene locus_tag LOCUS_30480 45660 46283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 47474 46311 gene locus_tag LOCUS_30490 47474 46311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 48994 47477 gene locus_tag LOCUS_30500 48994 47477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 49520 49092 gene locus_tag LOCUS_30510 49520 49092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 49801 50823 gene locus_tag LOCUS_30520 gene icd 49801 50823 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036181.1 protein_id gnl|my_center|LOCUS_30520 >Feature sequence048 1081 50 gene locus_tag LOCUS_30530 1081 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 1386 2093 gene locus_tag LOCUS_30540 1386 2093 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704333.1 protein_id gnl|my_center|LOCUS_30540 2303 4372 gene locus_tag LOCUS_30550 2303 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 4532 5734 gene locus_tag LOCUS_30560 4532 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 5870 7063 gene locus_tag LOCUS_30570 5870 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 7610 7104 gene locus_tag LOCUS_30580 7610 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 10203 7495 gene locus_tag LOCUS_30590 10203 7495 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_30590 11492 10404 gene locus_tag LOCUS_30600 11492 10404 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939167.1 protein_id gnl|my_center|LOCUS_30600 12560 11961 gene locus_tag LOCUS_30610 12560 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 14595 12553 gene locus_tag LOCUS_30620 14595 12553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 14755 15987 gene locus_tag LOCUS_30630 14755 15987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 16068 16487 gene locus_tag LOCUS_30640 16068 16487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 16714 18423 gene locus_tag LOCUS_30650 16714 18423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 18819 18613 gene locus_tag LOCUS_30660 18819 18613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 20417 18984 gene locus_tag LOCUS_30670 20417 18984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 20688 22121 gene locus_tag LOCUS_30680 gene murC 20688 22121 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDM9 protein_id gnl|my_center|LOCUS_30680 22124 23515 gene locus_tag LOCUS_30690 gene murD 22124 23515 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S530 protein_id gnl|my_center|LOCUS_30690 23719 23561 gene locus_tag LOCUS_30700 23719 23561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 24827 23838 gene locus_tag LOCUS_30710 24827 23838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 25399 24824 gene locus_tag LOCUS_30720 gene folE 25399 24824 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D580 protein_id gnl|my_center|LOCUS_30720 26514 25501 gene locus_tag LOCUS_30730 gene ruvB 26514 25501 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZ86 protein_id gnl|my_center|LOCUS_30730 27243 26647 gene locus_tag LOCUS_30740 gene ruvA 27243 26647 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E87 protein_id gnl|my_center|LOCUS_30740 27855 27367 gene locus_tag LOCUS_30750 gene ruvC 27855 27367 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E88 protein_id gnl|my_center|LOCUS_30750 28763 27996 gene locus_tag LOCUS_30760 28763 27996 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIE0 protein_id gnl|my_center|LOCUS_30760 29438 28971 gene locus_tag LOCUS_30770 29438 28971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 30827 29745 gene locus_tag LOCUS_30780 30827 29745 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528474.1 protein_id gnl|my_center|LOCUS_30780 30946 31260 gene locus_tag LOCUS_30790 30946 31260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 31345 31950 gene locus_tag LOCUS_30800 31345 31950 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_30800 32150 32455 gene locus_tag LOCUS_30810 32150 32455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 32527 33036 gene locus_tag LOCUS_30820 32527 33036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 33420 33043 gene locus_tag LOCUS_30830 33420 33043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 33924 33421 gene locus_tag LOCUS_30840 33924 33421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 34768 33950 gene locus_tag LOCUS_30850 34768 33950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 35827 34844 gene locus_tag LOCUS_30860 35827 34844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 36744 35824 gene locus_tag LOCUS_30870 36744 35824 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_30870 38687 36786 gene locus_tag LOCUS_30880 38687 36786 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118571.1 protein_id gnl|my_center|LOCUS_30880 39919 38684 gene locus_tag LOCUS_30890 39919 38684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 42271 40349 gene locus_tag LOCUS_30900 42271 40349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 42565 43191 gene locus_tag LOCUS_30910 42565 43191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 43226 44185 gene locus_tag LOCUS_30920 43226 44185 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561204.1 protein_id gnl|my_center|LOCUS_30920 44231 46036 gene locus_tag LOCUS_30930 44231 46036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 45967 47103 gene locus_tag LOCUS_30940 45967 47103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 47124 47870 gene locus_tag LOCUS_30950 47124 47870 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461832.1 protein_id gnl|my_center|LOCUS_30950 47872 48609 gene locus_tag LOCUS_30960 47872 48609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927773.1 protein_id gnl|my_center|LOCUS_30960 49337 48615 gene locus_tag LOCUS_30970 49337 48615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 49826 49356 gene locus_tag LOCUS_30980 49826 49356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 50150 50512 gene locus_tag LOCUS_30990 50150 50512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 >Feature sequence049 862 179 gene locus_tag LOCUS_31000 gene lon 862 179 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327343.1 protein_id gnl|my_center|LOCUS_31000 2878 1034 gene locus_tag LOCUS_31010 2878 1034 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_31010 4758 2878 gene locus_tag LOCUS_31020 4758 2878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_31020 5943 4906 gene locus_tag LOCUS_31030 5943 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 7557 6643 gene locus_tag LOCUS_31040 7557 6643 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419748.1 protein_id gnl|my_center|LOCUS_31040 10862 7599 gene locus_tag LOCUS_31050 10862 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 11238 12311 gene locus_tag LOCUS_31060 11238 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 12308 13051 gene locus_tag LOCUS_31070 12308 13051 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_31070 13102 13893 gene locus_tag LOCUS_31080 13102 13893 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938542.1 protein_id gnl|my_center|LOCUS_31080 13912 14766 gene locus_tag LOCUS_31090 gene ycf63 13912 14766 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057285.1 protein_id gnl|my_center|LOCUS_31090 14787 15437 gene locus_tag LOCUS_31100 14787 15437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 15459 16940 gene locus_tag LOCUS_31110 15459 16940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 16937 18439 gene locus_tag LOCUS_31120 16937 18439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 18532 19281 gene locus_tag LOCUS_31130 gene ttg2A 18532 19281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_31130 19626 20708 gene locus_tag LOCUS_31140 19626 20708 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941594.1 protein_id gnl|my_center|LOCUS_31140 23256 20992 gene locus_tag LOCUS_31150 23256 20992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 25031 23448 gene locus_tag LOCUS_31160 25031 23448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227635.1 protein_id gnl|my_center|LOCUS_31160 26451 25156 gene locus_tag LOCUS_31170 26451 25156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 29705 26466 gene locus_tag LOCUS_31180 29705 26466 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_31180 30874 29702 gene locus_tag LOCUS_31190 30874 29702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 31279 31962 gene locus_tag LOCUS_31200 gene rplC 31279 31962 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIF5 protein_id gnl|my_center|LOCUS_31200 32029 34230 gene locus_tag LOCUS_31210 32029 34230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 34458 35924 gene locus_tag LOCUS_31220 34458 35924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 36681 35935 gene locus_tag LOCUS_31230 36681 35935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 40371 36760 gene locus_tag LOCUS_31240 40371 36760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 40462 40677 gene locus_tag LOCUS_31250 40462 40677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 40837 41571 gene locus_tag LOCUS_31260 40837 41571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 41761 43230 gene locus_tag LOCUS_31270 gene guaB 41761 43230 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B47 protein_id gnl|my_center|LOCUS_31270 43309 44862 gene locus_tag LOCUS_31280 gene guaA 43309 44862 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHY9 protein_id gnl|my_center|LOCUS_31280 44974 45945 gene locus_tag LOCUS_31290 44974 45945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 46072 47556 gene locus_tag LOCUS_31300 46072 47556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 47684 49828 gene locus_tag LOCUS_31310 47684 49828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 50049 50576 gene locus_tag LOCUS_31320 50049 50576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 >Feature sequence050 3 1625 gene locus_tag LOCUS_31330 3 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 4400 1635 gene locus_tag LOCUS_31340 4400 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 4781 6151 gene locus_tag LOCUS_31350 4781 6151 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860267.1 protein_id gnl|my_center|LOCUS_31350 6880 6269 gene locus_tag LOCUS_31360 6880 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 7536 7015 gene locus_tag LOCUS_31370 7536 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 8423 7692 gene locus_tag LOCUS_31380 8423 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 10992 8674 gene locus_tag LOCUS_31390 10992 8674 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_31390 12154 11276 gene locus_tag LOCUS_31400 12154 11276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 13387 12440 gene locus_tag LOCUS_31410 gene desC1 13387 12440 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058212.1 protein_id gnl|my_center|LOCUS_31410 13854 15026 gene locus_tag LOCUS_31420 13854 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 15190 16578 gene locus_tag LOCUS_31430 gene asnS 15190 16578 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43829 protein_id gnl|my_center|LOCUS_31430 16825 17304 gene locus_tag LOCUS_31440 16825 17304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 18282 17362 gene locus_tag LOCUS_31450 18282 17362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 19556 18636 gene locus_tag LOCUS_31460 19556 18636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 19918 19691 gene locus_tag LOCUS_31470 19918 19691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 20002 21708 gene locus_tag LOCUS_31480 20002 21708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 21879 22532 gene locus_tag LOCUS_31490 21879 22532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 23176 22625 gene locus_tag LOCUS_31500 23176 22625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 23456 23947 gene locus_tag LOCUS_31510 gene rppH 23456 23947 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5H3 protein_id gnl|my_center|LOCUS_31510 24857 23961 gene locus_tag LOCUS_31520 24857 23961 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX92 protein_id gnl|my_center|LOCUS_31520 25098 26483 gene locus_tag LOCUS_31530 gene rtcB 25098 26483 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX85 protein_id gnl|my_center|LOCUS_31530 26795 27502 gene locus_tag LOCUS_31540 26795 27502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 27523 27942 gene locus_tag LOCUS_31550 27523 27942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 29325 28000 gene locus_tag LOCUS_31560 29325 28000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31560 29724 29506 gene locus_tag LOCUS_31570 29724 29506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 32131 29783 gene locus_tag LOCUS_31580 32131 29783 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_31580 32441 34063 gene locus_tag LOCUS_31590 32441 34063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 34060 35685 gene locus_tag LOCUS_31600 gene agpS 34060 35685 CDS product alkyldihydroxyacetonephosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_31600 35847 36533 gene locus_tag LOCUS_31610 35847 36533 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974611.1 protein_id gnl|my_center|LOCUS_31610 36981 36655 gene locus_tag LOCUS_31620 36981 36655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 37769 36978 gene locus_tag LOCUS_31630 37769 36978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 39987 37762 gene locus_tag LOCUS_31640 39987 37762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 41322 40114 gene locus_tag LOCUS_31650 41322 40114 CDS product calcineurin-like phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551577.1 protein_id gnl|my_center|LOCUS_31650 41995 41456 gene locus_tag LOCUS_31660 41995 41456 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9J6 protein_id gnl|my_center|LOCUS_31660 42237 42959 gene locus_tag LOCUS_31670 gene fliA 42237 42959 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECD3 protein_id gnl|my_center|LOCUS_31670 43032 43355 gene locus_tag LOCUS_31680 43032 43355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 43476 44663 gene locus_tag LOCUS_31690 43476 44663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 46184 44664 gene locus_tag LOCUS_31700 46184 44664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 46594 47712 gene locus_tag LOCUS_31710 46594 47712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 >Feature sequence051 598 1125 gene locus_tag LOCUS_31720 gene mtnD 598 1125 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819E5 protein_id gnl|my_center|LOCUS_31720 1245 2735 gene locus_tag LOCUS_31730 1245 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 2838 4019 gene locus_tag LOCUS_31740 2838 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 4138 4623 gene locus_tag LOCUS_31750 4138 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 5164 4712 gene locus_tag LOCUS_31760 5164 4712 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_31760 5947 5282 gene locus_tag LOCUS_31770 5947 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 7516 6128 gene locus_tag LOCUS_31780 7516 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 8072 7509 gene locus_tag LOCUS_31790 8072 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 8270 13363 gene locus_tag LOCUS_31800 8270 13363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 14760 14101 gene locus_tag LOCUS_31810 14760 14101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 15011 15268 gene locus_tag LOCUS_31820 15011 15268 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_31820 15346 15897 gene locus_tag LOCUS_31830 15346 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 17810 15873 gene locus_tag LOCUS_31840 17810 15873 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937746.1 protein_id gnl|my_center|LOCUS_31840 18188 18571 gene locus_tag LOCUS_31850 18188 18571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 18568 19290 gene locus_tag LOCUS_31860 18568 19290 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF6 protein_id gnl|my_center|LOCUS_31860 19315 20094 gene locus_tag LOCUS_31870 gene flgG 19315 20094 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F1 protein_id gnl|my_center|LOCUS_31870 20181 20852 gene locus_tag LOCUS_31880 20181 20852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 21036 21707 gene locus_tag LOCUS_31890 gene flgH1 21036 21707 CDS product flagellar L-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZHZ5 protein_id gnl|my_center|LOCUS_31890 21668 21862 gene locus_tag LOCUS_31900 21668 21862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 22378 21992 gene locus_tag LOCUS_31910 22378 21992 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039053.1 protein_id gnl|my_center|LOCUS_31910 23423 22401 gene locus_tag LOCUS_31920 gene nrdB 23423 22401 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3C2 protein_id gnl|my_center|LOCUS_31920 25771 23420 gene locus_tag LOCUS_31930 25771 23420 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K496 protein_id gnl|my_center|LOCUS_31930 26475 27719 gene locus_tag LOCUS_31940 gene flgI 26475 27719 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F5 protein_id gnl|my_center|LOCUS_31940 27719 28174 gene locus_tag LOCUS_31950 27719 28174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 28304 32389 gene locus_tag LOCUS_31960 28304 32389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 32392 33345 gene locus_tag LOCUS_31970 gene myg1 32392 33345 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973334.1 protein_id gnl|my_center|LOCUS_31970 34709 33354 gene locus_tag LOCUS_31980 gene flhF 34709 33354 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392312.1 protein_id gnl|my_center|LOCUS_31980 35631 35248 gene locus_tag LOCUS_31990 35631 35248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 37987 35879 gene locus_tag LOCUS_32000 gene flhA 37987 35879 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_32000 39131 38061 gene locus_tag LOCUS_32010 gene flhB 39131 38061 CDS product flagellar biosynthetic protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35538 protein_id gnl|my_center|LOCUS_32010 39915 39145 gene locus_tag LOCUS_32020 gene fliR 39915 39145 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLL2 protein_id gnl|my_center|LOCUS_32020 40190 39915 gene locus_tag LOCUS_32030 gene fliQ 40190 39915 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097797.1 protein_id gnl|my_center|LOCUS_32030 41046 40192 gene locus_tag LOCUS_32040 41046 40192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 41760 41101 gene locus_tag LOCUS_32050 41760 41101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 41693 42004 gene locus_tag LOCUS_32060 41693 42004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 42432 42085 gene locus_tag LOCUS_32070 42432 42085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 43547 42573 gene locus_tag LOCUS_32080 43547 42573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 44134 43604 gene locus_tag LOCUS_32090 gene fliL 44134 43604 CDS product flagellar protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67712 protein_id gnl|my_center|LOCUS_32090 44968 44237 gene locus_tag LOCUS_32100 44968 44237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 45663 44965 gene locus_tag LOCUS_32110 gene motB 45663 44965 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435983.1 protein_id gnl|my_center|LOCUS_32110 46431 45667 gene locus_tag LOCUS_32120 gene motA-1 46431 45667 CDS product chemotaxis protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_32120 46797 47237 gene locus_tag LOCUS_32130 46797 47237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 47338 48522 gene locus_tag LOCUS_32140 47338 48522 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937637.1 protein_id gnl|my_center|LOCUS_32140 48587 49831 gene locus_tag LOCUS_32150 48587 49831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 >Feature sequence052 1122 1196 gene locus_tag LOCUS_t00400 1122 1196 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1275 1351 gene locus_tag LOCUS_t00410 1275 1351 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1377 1449 gene locus_tag LOCUS_t00420 1377 1449 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1522 1595 gene locus_tag LOCUS_t00430 1522 1595 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1642 1716 gene locus_tag LOCUS_t00440 1642 1716 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1796 1868 gene locus_tag LOCUS_t00450 1796 1868 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1893 1968 gene locus_tag LOCUS_t00460 1893 1968 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1999 2072 gene locus_tag LOCUS_t00470 1999 2072 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2185 2256 gene locus_tag LOCUS_t00480 2185 2256 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2583 2658 gene locus_tag LOCUS_t00490 2583 2658 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2702 2774 gene locus_tag LOCUS_t00500 2702 2774 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2838 2908 gene locus_tag LOCUS_t00510 2838 2908 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3216 3289 gene locus_tag LOCUS_t00520 3216 3289 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3359 3433 gene locus_tag LOCUS_t00530 3359 3433 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3479 3551 gene locus_tag LOCUS_t00540 3479 3551 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3688 3906 gene locus_tag LOCUS_32160 3688 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 3927 3997 gene locus_tag LOCUS_t00550 3927 3997 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5053 4082 gene locus_tag LOCUS_32170 5053 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 6338 5448 gene locus_tag LOCUS_32180 6338 5448 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083250.1 protein_id gnl|my_center|LOCUS_32180 6919 6422 gene locus_tag LOCUS_32190 6919 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 11702 7077 gene locus_tag LOCUS_32200 11702 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 13348 11699 gene locus_tag LOCUS_32210 13348 11699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 14667 13381 gene locus_tag LOCUS_32220 14667 13381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 18886 14675 gene locus_tag LOCUS_32230 18886 14675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 19789 19028 gene locus_tag LOCUS_32240 19789 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 19779 21401 gene locus_tag LOCUS_32250 19779 21401 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140950.1 protein_id gnl|my_center|LOCUS_32250 21398 22474 gene locus_tag LOCUS_32260 21398 22474 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966901.1 protein_id gnl|my_center|LOCUS_32260 22476 23351 gene locus_tag LOCUS_32270 22476 23351 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966905.1 protein_id gnl|my_center|LOCUS_32270 24817 23363 gene locus_tag LOCUS_32280 24817 23363 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948610.1 protein_id gnl|my_center|LOCUS_32280 26018 24810 gene locus_tag LOCUS_32290 26018 24810 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971887.1 protein_id gnl|my_center|LOCUS_32290 26716 26015 gene locus_tag LOCUS_32300 26716 26015 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_32300 28113 26713 gene locus_tag LOCUS_32310 28113 26713 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339255.1 protein_id gnl|my_center|LOCUS_32310 28414 29145 gene locus_tag LOCUS_32320 28414 29145 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728051.1 protein_id gnl|my_center|LOCUS_32320 29204 29440 gene locus_tag LOCUS_32330 29204 29440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 30155 29442 gene locus_tag LOCUS_32340 30155 29442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 30319 30618 gene locus_tag LOCUS_32350 30319 30618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 30635 34291 gene locus_tag LOCUS_32360 30635 34291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 34595 36232 gene locus_tag LOCUS_32370 34595 36232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 37235 36222 gene locus_tag LOCUS_32380 gene dusA 37235 36222 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L85 protein_id gnl|my_center|LOCUS_32380 38106 37312 gene locus_tag LOCUS_32390 gene fepB 38106 37312 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580059.1 protein_id gnl|my_center|LOCUS_32390 38976 38176 gene locus_tag LOCUS_32400 38976 38176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255317.1 protein_id gnl|my_center|LOCUS_32400 42086 38967 gene locus_tag LOCUS_32410 42086 38967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 45307 42233 gene locus_tag LOCUS_32420 45307 42233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 45554 48388 gene locus_tag LOCUS_32430 45554 48388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 >Feature sequence053 935 57 gene locus_tag LOCUS_32440 gene hslO 935 57 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6M3 protein_id gnl|my_center|LOCUS_32440 2044 932 gene locus_tag LOCUS_32450 2044 932 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_32450 2781 2089 gene locus_tag LOCUS_32460 2781 2089 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_32460 3367 3002 gene locus_tag LOCUS_32470 3367 3002 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_32470 4030 3563 gene locus_tag LOCUS_32480 4030 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 4558 4082 gene locus_tag LOCUS_32490 4558 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 5341 4685 gene locus_tag LOCUS_32500 5341 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 6861 5338 gene locus_tag LOCUS_32510 6861 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 7098 7592 gene locus_tag LOCUS_32520 7098 7592 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887W2 protein_id gnl|my_center|LOCUS_32520 8457 7681 gene locus_tag LOCUS_32530 8457 7681 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705086.1 protein_id gnl|my_center|LOCUS_32530 9230 8454 gene locus_tag LOCUS_32540 9230 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 9340 11673 gene locus_tag LOCUS_32550 9340 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 11686 12507 gene locus_tag LOCUS_32560 11686 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 12561 12905 gene locus_tag LOCUS_32570 12561 12905 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDK8 protein_id gnl|my_center|LOCUS_32570 13785 12907 gene locus_tag LOCUS_32580 13785 12907 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_32580 13930 14910 gene locus_tag LOCUS_32590 13930 14910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 15371 14937 gene locus_tag LOCUS_32600 15371 14937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 15516 16196 gene locus_tag LOCUS_32610 15516 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 16307 17938 gene locus_tag LOCUS_32620 16307 17938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 18150 19592 gene locus_tag LOCUS_32630 18150 19592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 20380 19766 gene locus_tag LOCUS_32640 20380 19766 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227779.1 protein_id gnl|my_center|LOCUS_32640 20570 21994 gene locus_tag LOCUS_32650 20570 21994 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_32650 23369 21978 gene locus_tag LOCUS_32660 gene sthA 23369 21978 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66009 protein_id gnl|my_center|LOCUS_32660 23581 25113 gene locus_tag LOCUS_32670 23581 25113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 25110 26603 gene locus_tag LOCUS_32680 25110 26603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 26782 28557 gene locus_tag LOCUS_32690 26782 28557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 28665 29741 gene locus_tag LOCUS_32700 28665 29741 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815913.1 protein_id gnl|my_center|LOCUS_32700 31784 29757 gene locus_tag LOCUS_32710 31784 29757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 32276 33802 gene locus_tag LOCUS_32720 32276 33802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 33799 35175 gene locus_tag LOCUS_32730 33799 35175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_32730 35172 36134 gene locus_tag LOCUS_32740 35172 36134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 36269 39715 gene locus_tag LOCUS_32750 36269 39715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 39852 42161 gene locus_tag LOCUS_32760 39852 42161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 42175 43785 gene locus_tag LOCUS_32770 42175 43785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224279.1 protein_id gnl|my_center|LOCUS_32770 44100 43798 gene locus_tag LOCUS_32780 44100 43798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 44381 44869 gene locus_tag LOCUS_32790 44381 44869 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200519.1 protein_id gnl|my_center|LOCUS_32790 45273 44956 gene locus_tag LOCUS_32800 45273 44956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 45462 46988 gene locus_tag LOCUS_32810 45462 46988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403607.1 protein_id gnl|my_center|LOCUS_32810 47059 48288 gene locus_tag LOCUS_32820 47059 48288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 >Feature sequence054 853 29 gene locus_tag LOCUS_32830 853 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 1618 1010 gene locus_tag LOCUS_32840 1618 1010 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404544.1 protein_id gnl|my_center|LOCUS_32840 2380 1727 gene locus_tag LOCUS_32850 gene tal 2380 1727 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66520 protein_id gnl|my_center|LOCUS_32850 3386 2511 gene locus_tag LOCUS_32860 3386 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 3581 4864 gene locus_tag LOCUS_32870 gene serS 3581 4864 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUV5 protein_id gnl|my_center|LOCUS_32870 5564 4869 gene locus_tag LOCUS_32880 5564 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 5866 7731 gene locus_tag LOCUS_32890 5866 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 8102 7824 gene locus_tag LOCUS_32900 8102 7824 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249855.1 protein_id gnl|my_center|LOCUS_32900 8706 8251 gene locus_tag LOCUS_32910 8706 8251 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463773.1 protein_id gnl|my_center|LOCUS_32910 8852 9964 gene locus_tag LOCUS_32920 8852 9964 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937475.1 protein_id gnl|my_center|LOCUS_32920 12381 9907 gene locus_tag LOCUS_32930 12381 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 13152 12520 gene locus_tag LOCUS_32940 13152 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 13996 13316 gene locus_tag LOCUS_32950 13996 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 14341 14024 gene locus_tag LOCUS_32960 14341 14024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 14788 14348 gene locus_tag LOCUS_32970 14788 14348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 15708 14785 gene locus_tag LOCUS_32980 15708 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 18137 15738 gene locus_tag LOCUS_32990 18137 15738 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_32990 18253 18699 gene locus_tag LOCUS_33000 18253 18699 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Z8 protein_id gnl|my_center|LOCUS_33000 18807 19850 gene locus_tag LOCUS_33010 gene yceG 18807 19850 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_33010 22117 19952 gene locus_tag LOCUS_33020 22117 19952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460248.1 protein_id gnl|my_center|LOCUS_33020 22417 24021 gene locus_tag LOCUS_33030 22417 24021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 24134 24997 gene locus_tag LOCUS_33040 24134 24997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 26379 25126 gene locus_tag LOCUS_33050 gene yhaM 26379 25126 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_33050 26335 26559 gene locus_tag LOCUS_33060 26335 26559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 26716 28980 gene locus_tag LOCUS_33070 26716 28980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 29119 29628 gene locus_tag LOCUS_33080 29119 29628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 29891 32329 gene locus_tag LOCUS_33090 29891 32329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 32435 33748 gene locus_tag LOCUS_33100 gene purB 32435 33748 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CP1 protein_id gnl|my_center|LOCUS_33100 33870 34616 gene locus_tag LOCUS_33110 gene purC 33870 34616 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12046 protein_id gnl|my_center|LOCUS_33110 34677 34931 gene locus_tag LOCUS_33120 gene purS 34677 34931 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92AN7 protein_id gnl|my_center|LOCUS_33120 34936 35622 gene locus_tag LOCUS_33130 gene purQ 34936 35622 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU4 protein_id gnl|my_center|LOCUS_33130 35633 37840 gene locus_tag LOCUS_33140 gene purL 35633 37840 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU5 protein_id gnl|my_center|LOCUS_33140 38056 39732 gene locus_tag LOCUS_33150 38056 39732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 39966 41687 gene locus_tag LOCUS_33160 39966 41687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 42040 41777 gene locus_tag LOCUS_33170 42040 41777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 44026 42161 gene locus_tag LOCUS_33180 44026 42161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 44187 45026 gene locus_tag LOCUS_33190 44187 45026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 45087 45998 gene locus_tag LOCUS_33200 gene galE 45087 45998 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222403.1 protein_id gnl|my_center|LOCUS_33200 46234 47949 gene locus_tag LOCUS_33210 46234 47949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 >Feature sequence055 74 2668 gene locus_tag LOCUS_33220 74 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 5086 2753 gene locus_tag LOCUS_33230 5086 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 5406 6848 gene locus_tag LOCUS_33240 5406 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 8640 6853 gene locus_tag LOCUS_33250 8640 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 8837 10348 gene locus_tag LOCUS_33260 8837 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 10341 11696 gene locus_tag LOCUS_33270 10341 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 11707 12549 gene locus_tag LOCUS_33280 11707 12549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 12546 13904 gene locus_tag LOCUS_33290 12546 13904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 14290 15648 gene locus_tag LOCUS_33300 14290 15648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 15844 16941 gene locus_tag LOCUS_33310 15844 16941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 16963 19911 gene locus_tag LOCUS_33320 16963 19911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 20953 19934 gene locus_tag LOCUS_33330 20953 19934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 21072 21713 gene locus_tag LOCUS_33340 21072 21713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 21759 22892 gene locus_tag LOCUS_33350 21759 22892 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_33350 24659 22896 gene locus_tag LOCUS_33360 24659 22896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 27915 24673 gene locus_tag LOCUS_33370 gene mcm 27915 24673 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D452 protein_id gnl|my_center|LOCUS_33370 28810 28100 gene locus_tag LOCUS_33380 28810 28100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 30208 29156 gene locus_tag LOCUS_33390 30208 29156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 31044 30598 gene locus_tag LOCUS_33400 gene sufE 31044 30598 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_33400 31613 31041 gene locus_tag LOCUS_33410 31613 31041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 32915 31623 gene locus_tag LOCUS_33420 32915 31623 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_33420 34199 32949 gene locus_tag LOCUS_33430 34199 32949 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141372.1 protein_id gnl|my_center|LOCUS_33430 34954 34199 gene locus_tag LOCUS_33440 34954 34199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946339.1 protein_id gnl|my_center|LOCUS_33440 36511 35075 gene locus_tag LOCUS_33450 gene ycf24 36511 35075 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_33450 37117 36626 gene locus_tag LOCUS_33460 37117 36626 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_33460 38718 37492 gene locus_tag LOCUS_33470 gene rfaG 38718 37492 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124212.1 protein_id gnl|my_center|LOCUS_33470 42353 38859 gene locus_tag LOCUS_33480 42353 38859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 42601 43746 gene locus_tag LOCUS_33490 42601 43746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 43943 47836 gene locus_tag LOCUS_33500 43943 47836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 >Feature sequence056 9346 389 gene locus_tag LOCUS_33510 9346 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 9953 11617 gene locus_tag LOCUS_33520 9953 11617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 11665 13146 gene locus_tag LOCUS_33530 gene glpK 11665 13146 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749I1 protein_id gnl|my_center|LOCUS_33530 13349 13750 gene locus_tag LOCUS_33540 13349 13750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 13815 14093 gene locus_tag LOCUS_33550 13815 14093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 14313 14717 gene locus_tag LOCUS_33560 14313 14717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 14789 15118 gene locus_tag LOCUS_33570 14789 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 15185 15520 gene locus_tag LOCUS_33580 15185 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 15616 15945 gene locus_tag LOCUS_33590 15616 15945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 16097 16927 gene locus_tag LOCUS_33600 16097 16927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 17860 16931 gene locus_tag LOCUS_33610 17860 16931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368588.1 protein_id gnl|my_center|LOCUS_33610 19246 17978 gene locus_tag LOCUS_33620 19246 17978 CDS product serpin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023315.1 protein_id gnl|my_center|LOCUS_33620 20566 19517 gene locus_tag LOCUS_33630 20566 19517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 20720 21895 gene locus_tag LOCUS_33640 gene deoB 20720 21895 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RID0 protein_id gnl|my_center|LOCUS_33640 22484 22074 gene locus_tag LOCUS_33650 22484 22074 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071464.1 protein_id gnl|my_center|LOCUS_33650 23209 22730 gene locus_tag LOCUS_33660 23209 22730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 23332 24693 gene locus_tag LOCUS_33670 23332 24693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 25620 24727 gene locus_tag LOCUS_33680 25620 24727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 29251 25577 gene locus_tag LOCUS_33690 29251 25577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 30336 29413 gene locus_tag LOCUS_33700 30336 29413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 30919 30443 gene locus_tag LOCUS_33710 30919 30443 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81E75 protein_id gnl|my_center|LOCUS_33710 31640 30969 gene locus_tag LOCUS_33720 31640 30969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 34169 31905 gene locus_tag LOCUS_33730 34169 31905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 37007 34191 gene locus_tag LOCUS_33740 37007 34191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 37382 39211 gene locus_tag LOCUS_33750 37382 39211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 39211 39792 gene locus_tag LOCUS_33760 39211 39792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 39802 40683 gene locus_tag LOCUS_33770 39802 40683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 41019 41642 gene locus_tag LOCUS_33780 41019 41642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 41785 42546 gene locus_tag LOCUS_33790 41785 42546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 42756 44585 gene locus_tag LOCUS_33800 42756 44585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 46424 44784 gene locus_tag LOCUS_33810 46424 44784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 47582 46632 gene locus_tag LOCUS_33820 47582 46632 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927682.1 protein_id gnl|my_center|LOCUS_33820 >Feature sequence057 1607 69 gene locus_tag LOCUS_33830 1607 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 2852 1935 gene locus_tag LOCUS_33840 2852 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 3769 2867 gene locus_tag LOCUS_33850 3769 2867 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038808.1 protein_id gnl|my_center|LOCUS_33850 4493 3906 gene locus_tag LOCUS_33860 4493 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 4858 4490 gene locus_tag LOCUS_33870 4858 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 6539 5076 gene locus_tag LOCUS_33880 6539 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 6864 7397 gene locus_tag LOCUS_33890 6864 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 7437 8744 gene locus_tag LOCUS_33900 7437 8744 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_33900 8904 10463 gene locus_tag LOCUS_33910 8904 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 11195 10473 gene locus_tag LOCUS_33920 11195 10473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_33920 11500 12690 gene locus_tag LOCUS_33930 11500 12690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 12969 15539 gene locus_tag LOCUS_33940 12969 15539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 16203 15505 gene locus_tag LOCUS_33950 16203 15505 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250354.1 protein_id gnl|my_center|LOCUS_33950 16991 16200 gene locus_tag LOCUS_33960 16991 16200 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730077.1 protein_id gnl|my_center|LOCUS_33960 17923 16988 gene locus_tag LOCUS_33970 17923 16988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 18159 19046 gene locus_tag LOCUS_33980 gene prmC 18159 19046 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT2 protein_id gnl|my_center|LOCUS_33980 19083 22397 gene locus_tag LOCUS_33990 19083 22397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 22608 23225 gene locus_tag LOCUS_34000 gene clpP 22608 23225 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA83 protein_id gnl|my_center|LOCUS_34000 23504 25081 gene locus_tag LOCUS_34010 23504 25081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 25257 26057 gene locus_tag LOCUS_34020 25257 26057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 protein_id gnl|my_center|LOCUS_34020 26474 28942 gene locus_tag LOCUS_34030 gene gyrB 26474 28942 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8Y9 protein_id gnl|my_center|LOCUS_34030 28973 29569 gene locus_tag LOCUS_34040 28973 29569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 29664 30533 gene locus_tag LOCUS_34050 29664 30533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704940.1 protein_id gnl|my_center|LOCUS_34050 30675 31910 gene locus_tag LOCUS_34060 30675 31910 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 protein_id gnl|my_center|LOCUS_34060 32378 34495 gene locus_tag LOCUS_34070 32378 34495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 35401 34514 gene locus_tag LOCUS_34080 gene kynA 35401 34514 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HHX9 protein_id gnl|my_center|LOCUS_34080 37490 35526 gene locus_tag LOCUS_34090 37490 35526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 37927 38907 gene locus_tag LOCUS_34100 gene argE 37927 38907 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_34100 39309 38920 gene locus_tag LOCUS_34110 39309 38920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 39432 41138 gene locus_tag LOCUS_34120 39432 41138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 41560 42417 gene locus_tag LOCUS_34130 41560 42417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 43082 42474 gene locus_tag LOCUS_34140 43082 42474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 43227 43057 gene locus_tag LOCUS_34150 43227 43057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 44291 43296 gene locus_tag LOCUS_34160 gene cdh 44291 43296 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035475.1 protein_id gnl|my_center|LOCUS_34160 45401 44349 gene locus_tag LOCUS_34170 45401 44349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 47074 45401 gene locus_tag LOCUS_34180 47074 45401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 >Feature sequence058 1614 142 gene locus_tag LOCUS_34190 1614 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 5182 1745 gene locus_tag LOCUS_34200 5182 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 6918 5302 gene locus_tag LOCUS_34210 6918 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 7540 7232 gene locus_tag LOCUS_34220 7540 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 8064 7804 gene locus_tag LOCUS_34230 8064 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 8349 9926 gene locus_tag LOCUS_34240 8349 9926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 10401 9958 gene locus_tag LOCUS_34250 10401 9958 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G5R9 protein_id gnl|my_center|LOCUS_34250 11168 10479 gene locus_tag LOCUS_34260 gene rnhB 11168 10479 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FG0 protein_id gnl|my_center|LOCUS_34260 12930 11176 gene locus_tag LOCUS_34270 12930 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 13489 13127 gene locus_tag LOCUS_34280 gene rplS 13489 13127 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WU89 protein_id gnl|my_center|LOCUS_34280 14454 13747 gene locus_tag LOCUS_34290 gene trmD 14454 13747 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88WJ2 protein_id gnl|my_center|LOCUS_34290 15069 14458 gene locus_tag LOCUS_34300 gene rimM 15069 14458 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X39 protein_id gnl|my_center|LOCUS_34300 15467 15207 gene locus_tag LOCUS_34310 15467 15207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 16091 15582 gene locus_tag LOCUS_34320 16091 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 16966 16577 gene locus_tag LOCUS_34330 16966 16577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 17290 17039 gene locus_tag LOCUS_34340 17290 17039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 17794 20196 gene locus_tag LOCUS_34350 17794 20196 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486377.1 protein_id gnl|my_center|LOCUS_34350 20347 21522 gene locus_tag LOCUS_34360 20347 21522 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_34360 22672 21647 gene locus_tag LOCUS_34370 22672 21647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440515.1 protein_id gnl|my_center|LOCUS_34370 23007 24881 gene locus_tag LOCUS_34380 23007 24881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 24888 25346 gene locus_tag LOCUS_34390 24888 25346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 25549 26457 gene locus_tag LOCUS_34400 25549 26457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 26476 26928 gene locus_tag LOCUS_34410 26476 26928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 27079 29355 gene locus_tag LOCUS_34420 27079 29355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 30438 29398 gene locus_tag LOCUS_34430 30438 29398 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037440.1 protein_id gnl|my_center|LOCUS_34430 32328 30562 gene locus_tag LOCUS_34440 32328 30562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 33802 32558 gene locus_tag LOCUS_34450 33802 32558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 34444 33809 gene locus_tag LOCUS_34460 34444 33809 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LN3 protein_id gnl|my_center|LOCUS_34460 35596 34616 gene locus_tag LOCUS_34470 35596 34616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 35764 36879 gene locus_tag LOCUS_34480 35764 36879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 38830 36893 gene locus_tag LOCUS_34490 38830 36893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 40773 38989 gene locus_tag LOCUS_34500 40773 38989 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932828.1 protein_id gnl|my_center|LOCUS_34500 40900 42366 gene locus_tag LOCUS_34510 40900 42366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 42468 44165 gene locus_tag LOCUS_34520 gene lysS 42468 44165 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXH3 protein_id gnl|my_center|LOCUS_34520 44492 45130 gene locus_tag LOCUS_34530 44492 45130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 45276 45947 gene locus_tag LOCUS_34540 45276 45947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34540 45978 46937 gene locus_tag LOCUS_34550 45978 46937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34550 >Feature sequence059 4519 458 gene locus_tag LOCUS_34560 4519 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 5991 4516 gene locus_tag LOCUS_34570 5991 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 6661 6071 gene locus_tag LOCUS_34580 6661 6071 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN2 protein_id gnl|my_center|LOCUS_34580 7872 6673 gene locus_tag LOCUS_34590 7872 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 10049 7965 gene locus_tag LOCUS_34600 10049 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 13056 10135 gene locus_tag LOCUS_34610 13056 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 13336 14154 gene locus_tag LOCUS_34620 gene gloB 13336 14154 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIK2 protein_id gnl|my_center|LOCUS_34620 14403 15275 gene locus_tag LOCUS_34630 14403 15275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 15401 15997 gene locus_tag LOCUS_34640 15401 15997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 16347 16006 gene locus_tag LOCUS_34650 16347 16006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 18515 16608 gene locus_tag LOCUS_34660 18515 16608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 19155 18757 gene locus_tag LOCUS_34670 19155 18757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 19436 20227 gene locus_tag LOCUS_34680 19436 20227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_34680 20285 21922 gene locus_tag LOCUS_34690 20285 21922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 21922 23169 gene locus_tag LOCUS_34700 21922 23169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 23198 24427 gene locus_tag LOCUS_34710 23198 24427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 24564 26288 gene locus_tag LOCUS_34720 24564 26288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 26452 28809 gene locus_tag LOCUS_34730 26452 28809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 29003 31615 gene locus_tag LOCUS_34740 29003 31615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 31775 35590 gene locus_tag LOCUS_34750 31775 35590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 35688 39905 gene locus_tag LOCUS_34760 35688 39905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 40079 40630 gene locus_tag LOCUS_34770 40079 40630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 41744 40689 gene locus_tag LOCUS_34780 41744 40689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 41865 42398 gene locus_tag LOCUS_34790 gene rpoE 41865 42398 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222027.1 protein_id gnl|my_center|LOCUS_34790 42395 43321 gene locus_tag LOCUS_34800 42395 43321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 43765 44322 gene locus_tag LOCUS_34810 43765 44322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 44571 45986 gene locus_tag LOCUS_34820 44571 45986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 >Feature sequence060 <1 544 gene locus_tag LOCUS_34830 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970757.1:GNAT family acetyltransferase 634 1968 gene locus_tag LOCUS_34840 634 1968 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_34840 2766 2047 gene locus_tag LOCUS_34850 2766 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 5045 2763 gene locus_tag LOCUS_34860 5045 2763 CDS product oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532900.1 protein_id gnl|my_center|LOCUS_34860 5529 5047 gene locus_tag LOCUS_34870 5529 5047 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808116.1 protein_id gnl|my_center|LOCUS_34870 6123 5605 gene locus_tag LOCUS_34880 6123 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 6761 6120 gene locus_tag LOCUS_34890 6761 6120 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_34890 7957 6761 gene locus_tag LOCUS_34900 gene xdhC 7957 6761 CDS product xanthine dehydrogenase accessory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_34900 9027 8311 gene locus_tag LOCUS_34910 9027 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 11018 9333 gene locus_tag LOCUS_34920 11018 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 11185 11454 gene locus_tag LOCUS_34930 11185 11454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 12614 11451 gene locus_tag LOCUS_34940 12614 11451 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_34940 12875 14158 gene locus_tag LOCUS_34950 12875 14158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 15059 14163 gene locus_tag LOCUS_34960 15059 14163 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929840.1 protein_id gnl|my_center|LOCUS_34960 15167 15442 gene locus_tag LOCUS_34970 15167 15442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 15852 15544 gene locus_tag LOCUS_34980 15852 15544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 16575 16057 gene locus_tag LOCUS_34990 16575 16057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 17858 16773 gene locus_tag LOCUS_35000 17858 16773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 19398 17986 gene locus_tag LOCUS_35010 19398 17986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 20063 19515 gene locus_tag LOCUS_35020 20063 19515 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086729.1 protein_id gnl|my_center|LOCUS_35020 20351 21958 gene locus_tag LOCUS_35030 20351 21958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 22571 23242 gene locus_tag LOCUS_35040 22571 23242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 23328 24104 gene locus_tag LOCUS_35050 23328 24104 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_35050 24129 25352 gene locus_tag LOCUS_35060 24129 25352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_35060 25372 26580 gene locus_tag LOCUS_35070 25372 26580 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_35070 26631 27338 gene locus_tag LOCUS_35080 26631 27338 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_35080 27335 28777 gene locus_tag LOCUS_35090 27335 28777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 30112 28808 gene locus_tag LOCUS_35100 30112 28808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 30733 30317 gene locus_tag LOCUS_35110 30733 30317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 31804 30839 gene locus_tag LOCUS_35120 31804 30839 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258990.1 protein_id gnl|my_center|LOCUS_35120 31945 32208 gene locus_tag LOCUS_35130 31945 32208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 32429 33442 gene locus_tag LOCUS_35140 32429 33442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 33849 38918 gene locus_tag LOCUS_35150 33849 38918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 39002 41032 gene locus_tag LOCUS_35160 39002 41032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 41528 44455 gene locus_tag LOCUS_35170 41528 44455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 44579 44507 gene locus_tag LOCUS_t00560 44579 44507 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 45366 44695 gene locus_tag LOCUS_35180 45366 44695 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040654.1 protein_id gnl|my_center|LOCUS_35180 >Feature sequence061 4140 6212 gene locus_tag LOCUS_35190 4140 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 6315 7316 gene locus_tag LOCUS_35200 6315 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 9482 7419 gene locus_tag LOCUS_35210 9482 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 9829 10989 gene locus_tag LOCUS_35220 9829 10989 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884030.1 protein_id gnl|my_center|LOCUS_35220 11091 12233 gene locus_tag LOCUS_35230 11091 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 14413 12323 gene locus_tag LOCUS_35240 14413 12323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 15573 14665 gene locus_tag LOCUS_35250 15573 14665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 16417 15602 gene locus_tag LOCUS_35260 16417 15602 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547623.1 protein_id gnl|my_center|LOCUS_35260 16616 17776 gene locus_tag LOCUS_35270 16616 17776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 19353 17815 gene locus_tag LOCUS_35280 19353 17815 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119512.1 protein_id gnl|my_center|LOCUS_35280 19454 21265 gene locus_tag LOCUS_35290 19454 21265 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_35290 21438 22745 gene locus_tag LOCUS_35300 21438 22745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 24558 23044 gene locus_tag LOCUS_35310 24558 23044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 25441 24794 gene locus_tag LOCUS_35320 25441 24794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 26550 25438 gene locus_tag LOCUS_35330 26550 25438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 26666 26899 gene locus_tag LOCUS_35340 26666 26899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 27332 26913 gene locus_tag LOCUS_35350 27332 26913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 27504 29135 gene locus_tag LOCUS_35360 gene gabD2 27504 29135 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_35360 29284 31056 gene locus_tag LOCUS_35370 29284 31056 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_35370 32722 31139 gene locus_tag LOCUS_35380 32722 31139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 33476 32742 gene locus_tag LOCUS_35390 33476 32742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 35177 33570 gene locus_tag LOCUS_35400 35177 33570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 36117 35182 gene locus_tag LOCUS_35410 36117 35182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 36611 36114 gene locus_tag LOCUS_35420 36611 36114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 36916 38556 gene locus_tag LOCUS_35430 36916 38556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 38791 40590 gene locus_tag LOCUS_35440 38791 40590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 40962 41591 gene locus_tag LOCUS_35450 gene upp 40962 41591 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTB9 protein_id gnl|my_center|LOCUS_35450 41641 42411 gene locus_tag LOCUS_35460 gene dltE 41641 42411 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123022.1 protein_id gnl|my_center|LOCUS_35460 43133 42414 gene locus_tag LOCUS_35470 43133 42414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 43790 43179 gene locus_tag LOCUS_35480 43790 43179 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943986.1 protein_id gnl|my_center|LOCUS_35480 44753 43806 gene locus_tag LOCUS_35490 44753 43806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 >Feature sequence062 1581 280 gene locus_tag LOCUS_35500 1581 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 3393 1615 gene locus_tag LOCUS_35510 3393 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 5144 3390 gene locus_tag LOCUS_35520 5144 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 5215 6084 gene locus_tag LOCUS_35530 5215 6084 CDS product putative epoxide hydrolase EphC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705296.1 protein_id gnl|my_center|LOCUS_35530 8035 6317 gene locus_tag LOCUS_35540 8035 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 9682 8087 gene locus_tag LOCUS_35550 9682 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 11312 9708 gene locus_tag LOCUS_35560 11312 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 13379 11331 gene locus_tag LOCUS_35570 13379 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 13648 14442 gene locus_tag LOCUS_35580 gene thyA 13648 14442 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NQ5 protein_id gnl|my_center|LOCUS_35580 14467 15015 gene locus_tag LOCUS_35590 gene folA 14467 15015 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_35590 15263 15829 gene locus_tag LOCUS_35600 15263 15829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 15846 17876 gene locus_tag LOCUS_35610 15846 17876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 17901 18404 gene locus_tag LOCUS_35620 17901 18404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 18473 18841 gene locus_tag LOCUS_35630 gene cheY-1 18473 18841 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938884.1 protein_id gnl|my_center|LOCUS_35630 18880 19794 gene locus_tag LOCUS_35640 18880 19794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 19890 21326 gene locus_tag LOCUS_35650 19890 21326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 21981 21328 gene locus_tag LOCUS_35660 21981 21328 CDS product tRNA (adenine-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624577.1 protein_id gnl|my_center|LOCUS_35660 22225 22046 gene locus_tag LOCUS_35670 22225 22046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 22531 24909 gene locus_tag LOCUS_35680 22531 24909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 24945 25328 gene locus_tag LOCUS_35690 24945 25328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 25357 27303 gene locus_tag LOCUS_35700 25357 27303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 28062 27307 gene locus_tag LOCUS_35710 28062 27307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 28199 29377 gene locus_tag LOCUS_35720 28199 29377 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_35720 29374 30801 gene locus_tag LOCUS_35730 29374 30801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 30874 31590 gene locus_tag LOCUS_35740 30874 31590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 31587 31787 gene locus_tag LOCUS_35750 31587 31787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 32161 33858 gene locus_tag LOCUS_35760 32161 33858 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_35760 35871 33871 gene locus_tag LOCUS_35770 35871 33871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 38044 35957 gene locus_tag LOCUS_35780 38044 35957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 40725 38047 gene locus_tag LOCUS_35790 40725 38047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 40684 41217 gene locus_tag LOCUS_35800 40684 41217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 41235 41645 gene locus_tag LOCUS_35810 41235 41645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 41692 42171 gene locus_tag LOCUS_35820 41692 42171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 42432 44012 gene locus_tag LOCUS_35830 42432 44012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 >Feature sequence063 838 2865 gene locus_tag LOCUS_35840 838 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 3515 2994 gene locus_tag LOCUS_35850 3515 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 4532 3540 gene locus_tag LOCUS_35860 4532 3540 CDS product isoaspartyl peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 protein_id gnl|my_center|LOCUS_35860 4826 7192 gene locus_tag LOCUS_35870 4826 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 8987 7317 gene locus_tag LOCUS_35880 gene pyrG 8987 7317 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY3 protein_id gnl|my_center|LOCUS_35880 9263 9892 gene locus_tag LOCUS_35890 9263 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 9944 10828 gene locus_tag LOCUS_35900 9944 10828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 13525 10922 gene locus_tag LOCUS_35910 gene clpB 13525 10922 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF1 protein_id gnl|my_center|LOCUS_35910 16000 13793 gene locus_tag LOCUS_35920 16000 13793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 16544 16248 gene locus_tag LOCUS_35930 16544 16248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 16431 17921 gene locus_tag LOCUS_35940 16431 17921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 19654 18524 gene locus_tag LOCUS_35950 19654 18524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 20886 19906 gene locus_tag LOCUS_35960 gene etfA 20886 19906 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815622.1 protein_id gnl|my_center|LOCUS_35960 21762 21016 gene locus_tag LOCUS_35970 21762 21016 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709196.1 protein_id gnl|my_center|LOCUS_35970 22563 21955 gene locus_tag LOCUS_35980 gene tetR 22563 21955 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742222.1 protein_id gnl|my_center|LOCUS_35980 23597 22731 gene locus_tag LOCUS_35990 gene panC 23597 22731 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM60 protein_id gnl|my_center|LOCUS_35990 24475 23660 gene locus_tag LOCUS_36000 gene panB 24475 23660 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM79 protein_id gnl|my_center|LOCUS_36000 26972 24747 gene locus_tag LOCUS_36010 26972 24747 CDS product chromosome condensation regulator RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258200.1 protein_id gnl|my_center|LOCUS_36010 27652 29085 gene locus_tag LOCUS_36020 27652 29085 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030574.1 protein_id gnl|my_center|LOCUS_36020 29082 31649 gene locus_tag LOCUS_36030 29082 31649 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530161.1 protein_id gnl|my_center|LOCUS_36030 32241 31786 gene locus_tag LOCUS_36040 32241 31786 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX32 protein_id gnl|my_center|LOCUS_36040 34949 32265 gene locus_tag LOCUS_36050 34949 32265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 36636 35041 gene locus_tag LOCUS_36060 36636 35041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 37342 36854 gene locus_tag LOCUS_36070 gene rplQ 37342 36854 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB04 protein_id gnl|my_center|LOCUS_36070 38440 37442 gene locus_tag LOCUS_36080 gene rpoA 38440 37442 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B3 protein_id gnl|my_center|LOCUS_36080 39120 38731 gene locus_tag LOCUS_36090 gene rpsK 39120 38731 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE40 protein_id gnl|my_center|LOCUS_36090 39640 39269 gene locus_tag LOCUS_36100 gene rpsM 39640 39269 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80377 protein_id gnl|my_center|LOCUS_36100 40381 40163 gene locus_tag LOCUS_36110 gene infA 40381 40163 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61688 protein_id gnl|my_center|LOCUS_36110 40547 40398 gene locus_tag LOCUS_36120 40547 40398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 41207 40569 gene locus_tag LOCUS_36130 41207 40569 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_36130 42716 41373 gene locus_tag LOCUS_36140 gene secY 42716 41373 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A7 protein_id gnl|my_center|LOCUS_36140 43529 42984 gene locus_tag LOCUS_36150 gene rplO 43529 42984 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EJ7 protein_id gnl|my_center|LOCUS_36150 43719 43534 gene locus_tag LOCUS_36160 gene rpmD 43719 43534 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SZ5 protein_id gnl|my_center|LOCUS_36160 >Feature sequence064 338 1360 gene locus_tag LOCUS_36170 338 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 1357 2181 gene locus_tag LOCUS_36180 1357 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933215.1 protein_id gnl|my_center|LOCUS_36180 3189 2194 gene locus_tag LOCUS_36190 3189 2194 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903696.1 protein_id gnl|my_center|LOCUS_36190 3477 4415 gene locus_tag LOCUS_36200 gene carH 3477 4415 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53W62 protein_id gnl|my_center|LOCUS_36200 4737 5312 gene locus_tag LOCUS_36210 4737 5312 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1T4 protein_id gnl|my_center|LOCUS_36210 5526 6506 gene locus_tag LOCUS_36220 5526 6506 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_36220 6583 7347 gene locus_tag LOCUS_36230 6583 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 7429 8805 gene locus_tag LOCUS_36240 7429 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403492.1 protein_id gnl|my_center|LOCUS_36240 9916 8951 gene locus_tag LOCUS_36250 9916 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 10724 10044 gene locus_tag LOCUS_36260 10724 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 11752 10766 gene locus_tag LOCUS_36270 11752 10766 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFW2 protein_id gnl|my_center|LOCUS_36270 11917 12153 gene locus_tag LOCUS_36280 gene rpmE2 11917 12153 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DTN5 protein_id gnl|my_center|LOCUS_36280 12779 14362 gene locus_tag LOCUS_36290 12779 14362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 14507 15262 gene locus_tag LOCUS_36300 14507 15262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 16276 15290 gene locus_tag LOCUS_36310 16276 15290 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE7 protein_id gnl|my_center|LOCUS_36310 17656 16370 gene locus_tag LOCUS_36320 gene murA 17656 16370 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W71 protein_id gnl|my_center|LOCUS_36320 17924 19249 gene locus_tag LOCUS_36330 17924 19249 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475699.1 protein_id gnl|my_center|LOCUS_36330 19313 20215 gene locus_tag LOCUS_36340 19313 20215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 21917 20352 gene locus_tag LOCUS_36350 gene comM 21917 20352 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_36350 23415 22078 gene locus_tag LOCUS_36360 23415 22078 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090834.1 protein_id gnl|my_center|LOCUS_36360 27197 24345 gene locus_tag LOCUS_36370 27197 24345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 27586 27975 gene locus_tag LOCUS_36380 27586 27975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 28798 28127 gene locus_tag LOCUS_36390 28798 28127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 30645 28882 gene locus_tag LOCUS_36400 30645 28882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 31249 30788 gene locus_tag LOCUS_36410 31249 30788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 31756 31355 gene locus_tag LOCUS_36420 31756 31355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 34477 31799 gene locus_tag LOCUS_36430 34477 31799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 35742 34561 gene locus_tag LOCUS_36440 35742 34561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 36120 37619 gene locus_tag LOCUS_36450 36120 37619 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_36450 38401 37736 gene locus_tag LOCUS_36460 38401 37736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 39289 38531 gene locus_tag LOCUS_36470 39289 38531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 40702 39440 gene locus_tag LOCUS_36480 40702 39440 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_36480 41037 42905 gene locus_tag LOCUS_36490 41037 42905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 >Feature sequence065 86 1216 gene locus_tag LOCUS_36500 86 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256855.1 protein_id gnl|my_center|LOCUS_36500 1297 3999 gene locus_tag LOCUS_36510 1297 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 4113 5210 gene locus_tag LOCUS_36520 gene pyrD 4113 5210 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NC99 protein_id gnl|my_center|LOCUS_36520 5471 5899 gene locus_tag LOCUS_36530 5471 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 6324 5998 gene locus_tag LOCUS_36540 6324 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 6921 12686 gene locus_tag LOCUS_36550 6921 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 12903 14222 gene locus_tag LOCUS_36560 12903 14222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 14241 15542 gene locus_tag LOCUS_36570 14241 15542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 18033 15544 gene locus_tag LOCUS_36580 gene priA 18033 15544 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819T9 protein_id gnl|my_center|LOCUS_36580 20240 18153 gene locus_tag LOCUS_36590 gene recG 20240 18153 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DJ0 protein_id gnl|my_center|LOCUS_36590 21230 20478 gene locus_tag LOCUS_36600 gene yeaZ 21230 20478 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942558.1 protein_id gnl|my_center|LOCUS_36600 22978 21251 gene locus_tag LOCUS_36610 22978 21251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 24017 23148 gene locus_tag LOCUS_36620 gene cdsA 24017 23148 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_36620 24992 24105 gene locus_tag LOCUS_36630 24992 24105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 25215 26096 gene locus_tag LOCUS_36640 gene gtaB 25215 26096 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183E9 protein_id gnl|my_center|LOCUS_36640 26096 26776 gene locus_tag LOCUS_36650 26096 26776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 26882 27481 gene locus_tag LOCUS_36660 26882 27481 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_36660 27596 31075 gene locus_tag LOCUS_36670 27596 31075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 31991 31083 gene locus_tag LOCUS_36680 31991 31083 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513305.1 protein_id gnl|my_center|LOCUS_36680 32288 34627 gene locus_tag LOCUS_36690 32288 34627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 35267 34758 gene locus_tag LOCUS_36700 35267 34758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 35842 35498 gene locus_tag LOCUS_36710 35842 35498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 36343 35858 gene locus_tag LOCUS_36720 36343 35858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 37380 36340 gene locus_tag LOCUS_36730 gene aroC 37380 36340 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_36730 39294 37441 gene locus_tag LOCUS_36740 39294 37441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 40640 39291 gene locus_tag LOCUS_36750 40640 39291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 41058 41447 gene locus_tag LOCUS_36760 41058 41447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 41629 42120 gene locus_tag LOCUS_36770 41629 42120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 >Feature sequence066 1431 253 gene locus_tag LOCUS_36780 1431 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_36780 2013 1444 gene locus_tag LOCUS_36790 2013 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 4105 2642 gene locus_tag LOCUS_36800 4105 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 6216 4120 gene locus_tag LOCUS_36810 6216 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 7121 6354 gene locus_tag LOCUS_36820 7121 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 7205 7642 gene locus_tag LOCUS_36830 7205 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705410.1 protein_id gnl|my_center|LOCUS_36830 8499 7663 gene locus_tag LOCUS_36840 8499 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_36840 9153 8659 gene locus_tag LOCUS_36850 9153 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 10290 9298 gene locus_tag LOCUS_36860 10290 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 11159 10389 gene locus_tag LOCUS_36870 11159 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 12435 11173 gene locus_tag LOCUS_36880 12435 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 12656 16072 gene locus_tag LOCUS_36890 12656 16072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 16888 16082 gene locus_tag LOCUS_36900 16888 16082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 17991 16885 gene locus_tag LOCUS_36910 17991 16885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 18314 20824 gene locus_tag LOCUS_36920 18314 20824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 22641 20857 gene locus_tag LOCUS_36930 22641 20857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 22777 25680 gene locus_tag LOCUS_36940 22777 25680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 26003 26437 gene locus_tag LOCUS_36950 26003 26437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 26469 26996 gene locus_tag LOCUS_36960 26469 26996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 28306 27098 gene locus_tag LOCUS_36970 28306 27098 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031173.1 protein_id gnl|my_center|LOCUS_36970 28615 29532 gene locus_tag LOCUS_36980 28615 29532 CDS product hydrolase glyoxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089212.1 protein_id gnl|my_center|LOCUS_36980 31152 29548 gene locus_tag LOCUS_36990 31152 29548 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881759.1 protein_id gnl|my_center|LOCUS_36990 31424 31957 gene locus_tag LOCUS_37000 31424 31957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 32134 33402 gene locus_tag LOCUS_37010 32134 33402 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_37010 33726 34934 gene locus_tag LOCUS_37020 33726 34934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 35050 35478 gene locus_tag LOCUS_37030 35050 35478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 36035 36583 gene locus_tag LOCUS_37040 36035 36583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 37968 36661 gene locus_tag LOCUS_37050 37968 36661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 38211 39944 gene locus_tag LOCUS_37060 38211 39944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 40529 39960 gene locus_tag LOCUS_37070 40529 39960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 40756 40950 gene locus_tag LOCUS_37080 40756 40950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 41293 40886 gene locus_tag LOCUS_37090 41293 40886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 41656 41318 gene locus_tag LOCUS_37100 41656 41318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 >Feature sequence067 117 1463 gene locus_tag LOCUS_37110 117 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 1592 1987 gene locus_tag LOCUS_37120 1592 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 2070 3272 gene locus_tag LOCUS_37130 2070 3272 CDS product amino acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373777.1 protein_id gnl|my_center|LOCUS_37130 3497 3925 gene locus_tag LOCUS_37140 3497 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 5201 3933 gene locus_tag LOCUS_37150 5201 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 6200 5208 gene locus_tag LOCUS_37160 6200 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 6454 8562 gene locus_tag LOCUS_37170 6454 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 8748 10169 gene locus_tag LOCUS_37180 8748 10169 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 protein_id gnl|my_center|LOCUS_37180 10737 10177 gene locus_tag LOCUS_37190 10737 10177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 11193 12641 gene locus_tag LOCUS_37200 11193 12641 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_37200 13536 12673 gene locus_tag LOCUS_37210 gene atuB 13536 12673 CDS product citronellol catabolism dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_37210 14324 13620 gene locus_tag LOCUS_37220 14324 13620 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227842.1 protein_id gnl|my_center|LOCUS_37220 16218 14386 gene locus_tag LOCUS_37230 16218 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 16808 18463 gene locus_tag LOCUS_37240 16808 18463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 18549 19217 gene locus_tag LOCUS_37250 18549 19217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 protein_id gnl|my_center|LOCUS_37250 19242 20807 gene locus_tag LOCUS_37260 19242 20807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 20957 20874 gene locus_tag LOCUS_t00570 20957 20874 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21253 21960 gene locus_tag LOCUS_37270 21253 21960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 22442 23278 gene locus_tag LOCUS_37280 22442 23278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 25529 23307 gene locus_tag LOCUS_37290 gene recD2 25529 23307 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DN4 protein_id gnl|my_center|LOCUS_37290 26206 28917 gene locus_tag LOCUS_37300 26206 28917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 29045 33643 gene locus_tag LOCUS_37310 29045 33643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 33987 34664 gene locus_tag LOCUS_37320 33987 34664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 34779 36677 gene locus_tag LOCUS_37330 34779 36677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 36924 38723 gene locus_tag LOCUS_37340 36924 38723 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_37340 38860 38945 gene locus_tag LOCUS_t00580 38860 38945 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 40290 39013 gene locus_tag LOCUS_37350 40290 39013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 40689 41648 gene locus_tag LOCUS_37360 40689 41648 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_37360 41931 42356 gene locus_tag LOCUS_37370 41931 42356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 >Feature sequence068 1370 564 gene locus_tag LOCUS_37380 1370 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 2273 1497 gene locus_tag LOCUS_37390 2273 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 2592 4985 gene locus_tag LOCUS_37400 2592 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 4975 6087 gene locus_tag LOCUS_37410 4975 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 6084 8522 gene locus_tag LOCUS_37420 6084 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 10183 8552 gene locus_tag LOCUS_37430 10183 8552 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_37430 8726 8651 gene locus_tag LOCUS_t00590 8726 8651 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10216 11208 gene locus_tag LOCUS_37440 10216 11208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 11205 14009 gene locus_tag LOCUS_37450 11205 14009 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836868.1 protein_id gnl|my_center|LOCUS_37450 14009 15136 gene locus_tag LOCUS_37460 14009 15136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836869.1 protein_id gnl|my_center|LOCUS_37460 15254 16393 gene locus_tag LOCUS_37470 15254 16393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 16448 17410 gene locus_tag LOCUS_37480 16448 17410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 17544 18011 gene locus_tag LOCUS_37490 17544 18011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 19762 18314 gene locus_tag LOCUS_37500 19762 18314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 21291 19996 gene locus_tag LOCUS_37510 21291 19996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 21563 23236 gene locus_tag LOCUS_37520 21563 23236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 23248 24273 gene locus_tag LOCUS_37530 23248 24273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 24542 24342 gene locus_tag LOCUS_37540 24542 24342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 24953 25696 gene locus_tag LOCUS_37550 24953 25696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 27891 25801 gene locus_tag LOCUS_37560 27891 25801 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776627.1 protein_id gnl|my_center|LOCUS_37560 28171 28938 gene locus_tag LOCUS_37570 28171 28938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476068.1 protein_id gnl|my_center|LOCUS_37570 29528 28968 gene locus_tag LOCUS_37580 29528 28968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 30077 29541 gene locus_tag LOCUS_37590 30077 29541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 31517 30294 gene locus_tag LOCUS_37600 31517 30294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 32806 31514 gene locus_tag LOCUS_37610 32806 31514 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812847.1 protein_id gnl|my_center|LOCUS_37610 32723 32995 gene locus_tag LOCUS_37620 32723 32995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 33320 34534 gene locus_tag LOCUS_37630 33320 34534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 34943 36283 gene locus_tag LOCUS_37640 34943 36283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 37636 36395 gene locus_tag LOCUS_37650 37636 36395 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886672.1 protein_id gnl|my_center|LOCUS_37650 37517 37783 gene locus_tag LOCUS_37660 37517 37783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 38823 41753 gene locus_tag LOCUS_37670 gene nrdJ 38823 41753 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69981 protein_id gnl|my_center|LOCUS_37670 >Feature sequence069 338 2182 gene locus_tag LOCUS_37680 338 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 2291 3448 gene locus_tag LOCUS_37690 2291 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 3677 5665 gene locus_tag LOCUS_37700 3677 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 5871 7421 gene locus_tag LOCUS_37710 5871 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 7418 8308 gene locus_tag LOCUS_37720 7418 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 9556 8414 gene locus_tag LOCUS_37730 9556 8414 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_37730 9921 12434 gene locus_tag LOCUS_37740 9921 12434 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729310.1 protein_id gnl|my_center|LOCUS_37740 12499 13821 gene locus_tag LOCUS_37750 12499 13821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 13822 14904 gene locus_tag LOCUS_37760 13822 14904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 15707 15075 gene locus_tag LOCUS_37770 15707 15075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 17626 15764 gene locus_tag LOCUS_37780 17626 15764 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 protein_id gnl|my_center|LOCUS_37780 21510 17875 gene locus_tag LOCUS_37790 21510 17875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 21663 22538 gene locus_tag LOCUS_37800 21663 22538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 24209 22584 gene locus_tag LOCUS_37810 24209 22584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 25366 24374 gene locus_tag LOCUS_37820 25366 24374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 25552 27126 gene locus_tag LOCUS_37830 25552 27126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 27240 27992 gene locus_tag LOCUS_37840 27240 27992 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_37840 29313 28177 gene locus_tag LOCUS_37850 29313 28177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 30088 29444 gene locus_tag LOCUS_37860 gene mtnB 30088 29444 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31668 protein_id gnl|my_center|LOCUS_37860 31593 30142 gene locus_tag LOCUS_37870 31593 30142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 40350 31600 gene locus_tag LOCUS_37880 40350 31600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 41202 40504 gene locus_tag LOCUS_37890 41202 40504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525454.1 protein_id gnl|my_center|LOCUS_37890 >Feature sequence070 714 950 gene locus_tag LOCUS_37900 714 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 2835 1153 gene locus_tag LOCUS_37910 2835 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 3105 5288 gene locus_tag LOCUS_37920 3105 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 5577 5299 gene locus_tag LOCUS_37930 5577 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 5876 6523 gene locus_tag LOCUS_37940 gene nrdG 5876 6523 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0J4 protein_id gnl|my_center|LOCUS_37940 6523 7638 gene locus_tag LOCUS_37950 6523 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 7852 8415 gene locus_tag LOCUS_37960 7852 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 9463 8492 gene locus_tag LOCUS_37970 9463 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 10018 12225 gene locus_tag LOCUS_37980 10018 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 12367 12630 gene locus_tag LOCUS_37990 12367 12630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 12724 16059 gene locus_tag LOCUS_38000 12724 16059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 16324 17883 gene locus_tag LOCUS_38010 16324 17883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 19147 17891 gene locus_tag LOCUS_38020 19147 17891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 20042 21058 gene locus_tag LOCUS_38030 20042 21058 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_38030 21058 22683 gene locus_tag LOCUS_38040 gene trpE 21058 22683 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMC6 protein_id gnl|my_center|LOCUS_38040 22680 23276 gene locus_tag LOCUS_38050 gene trpG 22680 23276 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816408.1 protein_id gnl|my_center|LOCUS_38050 23267 24283 gene locus_tag LOCUS_38060 gene trpD 23267 24283 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMC8 protein_id gnl|my_center|LOCUS_38060 24390 25673 gene locus_tag LOCUS_38070 gene trpC 24390 25673 CDS product tryptophan biosynthesis protein TrpCF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZEG8 protein_id gnl|my_center|LOCUS_38070 25670 26848 gene locus_tag LOCUS_38080 gene trpB 25670 26848 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E623 protein_id gnl|my_center|LOCUS_38080 26848 27663 gene locus_tag LOCUS_38090 gene trpA 26848 27663 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECU9 protein_id gnl|my_center|LOCUS_38090 27845 28747 gene locus_tag LOCUS_38100 gene rnz 27845 28747 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDW3 protein_id gnl|my_center|LOCUS_38100 29360 28749 gene locus_tag LOCUS_38110 29360 28749 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_38110 30155 29445 gene locus_tag LOCUS_38120 30155 29445 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_38120 32152 30152 gene locus_tag LOCUS_38130 gene nadE 32152 30152 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_38130 33700 32222 gene locus_tag LOCUS_38140 33700 32222 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_38140 37841 33906 gene locus_tag LOCUS_38150 37841 33906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 38138 38596 gene locus_tag LOCUS_38160 gene ydiI 38138 38596 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422946.1 protein_id gnl|my_center|LOCUS_38160 39020 39598 gene locus_tag LOCUS_38170 39020 39598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 40432 39605 gene locus_tag LOCUS_38180 40432 39605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 40617 41300 gene locus_tag LOCUS_38190 40617 41300 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894979.1 protein_id gnl|my_center|LOCUS_38190 >Feature sequence071 251 694 gene locus_tag LOCUS_38200 251 694 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479368.1 protein_id gnl|my_center|LOCUS_38200 691 1137 gene locus_tag LOCUS_38210 691 1137 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 protein_id gnl|my_center|LOCUS_38210 1191 2012 gene locus_tag LOCUS_38220 1191 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 3132 2104 gene locus_tag LOCUS_38230 3132 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 3599 4570 gene locus_tag LOCUS_38240 3599 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 4619 5800 gene locus_tag LOCUS_38250 4619 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_38250 6246 7472 gene locus_tag LOCUS_38260 6246 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 7569 8336 gene locus_tag LOCUS_38270 7569 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 9143 8451 gene locus_tag LOCUS_38280 9143 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 9558 12803 gene locus_tag LOCUS_38290 9558 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 13011 13946 gene locus_tag LOCUS_38300 13011 13946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 14713 14048 gene locus_tag LOCUS_38310 14713 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 16010 14760 gene locus_tag LOCUS_38320 16010 14760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 16693 16217 gene locus_tag LOCUS_38330 16693 16217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 17743 18018 gene locus_tag LOCUS_38340 17743 18018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 18018 18827 gene locus_tag LOCUS_38350 18018 18827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 19634 18858 gene locus_tag LOCUS_38360 19634 18858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 20447 19896 gene locus_tag LOCUS_38370 20447 19896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 20678 21628 gene locus_tag LOCUS_38380 20678 21628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 22042 23214 gene locus_tag LOCUS_38390 22042 23214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 25344 23227 gene locus_tag LOCUS_38400 25344 23227 CDS product 3-hydroxyalkanoate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086240.1 protein_id gnl|my_center|LOCUS_38400 26797 25637 gene locus_tag LOCUS_38410 26797 25637 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963526.1 protein_id gnl|my_center|LOCUS_38410 27845 26832 gene locus_tag LOCUS_38420 27845 26832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697738.1 protein_id gnl|my_center|LOCUS_38420 28212 30287 gene locus_tag LOCUS_38430 28212 30287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 30909 30292 gene locus_tag LOCUS_38440 30909 30292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 32361 30955 gene locus_tag LOCUS_38450 32361 30955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 32635 35142 gene locus_tag LOCUS_38460 32635 35142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 35631 35152 gene locus_tag LOCUS_38470 35631 35152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 36896 35760 gene locus_tag LOCUS_38480 36896 35760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 36943 37821 gene locus_tag LOCUS_38490 36943 37821 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889174.1 protein_id gnl|my_center|LOCUS_38490 38923 37955 gene locus_tag LOCUS_38500 38923 37955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 40799 38925 gene locus_tag LOCUS_38510 40799 38925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 >Feature sequence072 1049 1687 gene locus_tag LOCUS_38520 1049 1687 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_38520 7613 1851 gene locus_tag LOCUS_38530 7613 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 8430 7966 gene locus_tag LOCUS_38540 8430 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 9064 8450 gene locus_tag LOCUS_38550 9064 8450 CDS product iron-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060766.1 protein_id gnl|my_center|LOCUS_38550 9300 10160 gene locus_tag LOCUS_38560 9300 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 11127 10171 gene locus_tag LOCUS_38570 11127 10171 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815989.1 protein_id gnl|my_center|LOCUS_38570 11249 12739 gene locus_tag LOCUS_38580 11249 12739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 12912 13994 gene locus_tag LOCUS_38590 12912 13994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 14094 14987 gene locus_tag LOCUS_38600 14094 14987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 15169 18093 gene locus_tag LOCUS_38610 15169 18093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 19507 18212 gene locus_tag LOCUS_38620 19507 18212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 20693 19497 gene locus_tag LOCUS_38630 20693 19497 CDS product signaling protein with FIST domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072499.1 protein_id gnl|my_center|LOCUS_38630 21216 21710 gene locus_tag LOCUS_38640 21216 21710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 21707 23326 gene locus_tag LOCUS_38650 21707 23326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 23554 24918 gene locus_tag LOCUS_38660 23554 24918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 24919 25518 gene locus_tag LOCUS_38670 24919 25518 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_38670 25603 27675 gene locus_tag LOCUS_38680 25603 27675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 27682 29373 gene locus_tag LOCUS_38690 27682 29373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 30847 29384 gene locus_tag LOCUS_38700 30847 29384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 31140 31820 gene locus_tag LOCUS_38710 31140 31820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 32749 31961 gene locus_tag LOCUS_38720 32749 31961 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_38720 33919 32777 gene locus_tag LOCUS_38730 33919 32777 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_38730 34410 33916 gene locus_tag LOCUS_38740 34410 33916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 34964 35575 gene locus_tag LOCUS_38750 gene rpsD 34964 35575 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59134 protein_id gnl|my_center|LOCUS_38750 36472 40809 gene locus_tag LOCUS_38760 gene rpoB 36472 40809 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y6 protein_id gnl|my_center|LOCUS_38760 >Feature sequence073 917 348 gene locus_tag LOCUS_38770 917 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 1704 1063 gene locus_tag LOCUS_38780 1704 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 2354 1791 gene locus_tag LOCUS_38790 2354 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 5188 2558 gene locus_tag LOCUS_38800 gene clpB 5188 2558 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI87 protein_id gnl|my_center|LOCUS_38800 7011 5398 gene locus_tag LOCUS_38810 7011 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 7616 7008 gene locus_tag LOCUS_38820 7616 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 9020 7761 gene locus_tag LOCUS_38830 9020 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 9626 9282 gene locus_tag LOCUS_38840 9626 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 9878 9684 gene locus_tag LOCUS_38850 9878 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 10801 10136 gene locus_tag LOCUS_38860 10801 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 10894 12207 gene locus_tag LOCUS_38870 10894 12207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 12525 12166 gene locus_tag LOCUS_38880 12525 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 14348 12555 gene locus_tag LOCUS_38890 14348 12555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 14601 15866 gene locus_tag LOCUS_38900 gene lolE 14601 15866 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_38900 19321 15998 gene locus_tag LOCUS_38910 19321 15998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 19357 19545 gene locus_tag LOCUS_38920 19357 19545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 19586 20314 gene locus_tag LOCUS_38930 19586 20314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 20462 23410 gene locus_tag LOCUS_38940 20462 23410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 23619 23810 gene locus_tag LOCUS_38950 23619 23810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 24764 23889 gene locus_tag LOCUS_38960 24764 23889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 25411 24923 gene locus_tag LOCUS_38970 25411 24923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 26707 31086 gene locus_tag LOCUS_38980 26707 31086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 31193 31810 gene locus_tag LOCUS_38990 31193 31810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 32502 31981 gene locus_tag LOCUS_39000 32502 31981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 33082 32588 gene locus_tag LOCUS_39010 33082 32588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 33945 34130 gene locus_tag LOCUS_39020 33945 34130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 35227 34490 gene locus_tag LOCUS_39030 35227 34490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 36030 36239 gene locus_tag LOCUS_39040 36030 36239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 37283 36831 gene locus_tag LOCUS_39050 37283 36831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 38456 37632 gene locus_tag LOCUS_39060 38456 37632 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_39060 39201 38596 gene locus_tag LOCUS_39070 39201 38596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 40259 39561 gene locus_tag LOCUS_39080 40259 39561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 >Feature sequence074 2691 502 gene locus_tag LOCUS_39090 gene relA 2691 502 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_39090 3467 2862 gene locus_tag LOCUS_39100 gene gmk 3467 2862 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DM9 protein_id gnl|my_center|LOCUS_39100 4421 3534 gene locus_tag LOCUS_39110 4421 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225470.1 protein_id gnl|my_center|LOCUS_39110 4923 4660 gene locus_tag LOCUS_39120 4923 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 5859 5062 gene locus_tag LOCUS_39130 gene rnc 5859 5062 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51648 protein_id gnl|my_center|LOCUS_39130 6968 5856 gene locus_tag LOCUS_39140 gene mnmA 6968 5856 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A22 protein_id gnl|my_center|LOCUS_39140 8247 7081 gene locus_tag LOCUS_39150 gene iscS 8247 7081 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933651.1 protein_id gnl|my_center|LOCUS_39150 9977 8547 gene locus_tag LOCUS_39160 9977 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 11210 10107 gene locus_tag LOCUS_39170 11210 10107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 11539 12306 gene locus_tag LOCUS_39180 11539 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 12465 13181 gene locus_tag LOCUS_39190 12465 13181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 15953 13167 gene locus_tag LOCUS_39200 15953 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 16856 17851 gene locus_tag LOCUS_39210 16856 17851 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106385.1 protein_id gnl|my_center|LOCUS_39210 17958 18602 gene locus_tag LOCUS_39220 17958 18602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 18691 19068 gene locus_tag LOCUS_39230 18691 19068 CDS product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971695.1 protein_id gnl|my_center|LOCUS_39230 19932 19159 gene locus_tag LOCUS_39240 gene pdxJ 19932 19159 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEG8 protein_id gnl|my_center|LOCUS_39240 20117 20518 gene locus_tag LOCUS_39250 20117 20518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 20637 21536 gene locus_tag LOCUS_39260 20637 21536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 22952 21978 gene locus_tag LOCUS_39270 22952 21978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 23933 22968 gene locus_tag LOCUS_39280 23933 22968 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_39280 24058 24777 gene locus_tag LOCUS_39290 24058 24777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 24813 28316 gene locus_tag LOCUS_39300 24813 28316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 28593 31457 gene locus_tag LOCUS_39310 28593 31457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 34137 31465 gene locus_tag LOCUS_39320 34137 31465 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121420.1 protein_id gnl|my_center|LOCUS_39320 36023 34134 gene locus_tag LOCUS_39330 36023 34134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 36916 36023 gene locus_tag LOCUS_39340 36916 36023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 37951 36959 gene locus_tag LOCUS_39350 37951 36959 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_39350 40036 38069 gene locus_tag LOCUS_39360 40036 38069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 >Feature sequence075 717 496 gene locus_tag LOCUS_39370 717 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 2640 754 gene locus_tag LOCUS_39380 2640 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 4268 2826 gene locus_tag LOCUS_39390 4268 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 5822 4446 gene locus_tag LOCUS_39400 gene dht 5822 4446 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969947.1 protein_id gnl|my_center|LOCUS_39400 6100 7164 gene locus_tag LOCUS_39410 6100 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 8122 7418 gene locus_tag LOCUS_39420 8122 7418 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765580.1 protein_id gnl|my_center|LOCUS_39420 9045 8119 gene locus_tag LOCUS_39430 9045 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 9527 9345 gene locus_tag LOCUS_39440 9527 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 9905 10441 gene locus_tag LOCUS_39450 9905 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 10621 11307 gene locus_tag LOCUS_39460 10621 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 11323 11517 gene locus_tag LOCUS_39470 11323 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 11579 12124 gene locus_tag LOCUS_39480 11579 12124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 12631 13041 gene locus_tag LOCUS_39490 12631 13041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 13495 13950 gene locus_tag LOCUS_39500 13495 13950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 14320 14745 gene locus_tag LOCUS_39510 14320 14745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 15550 15804 gene locus_tag LOCUS_39520 15550 15804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 15815 16717 gene locus_tag LOCUS_39530 15815 16717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 16952 17338 gene locus_tag LOCUS_39540 16952 17338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 17370 17969 gene locus_tag LOCUS_39550 17370 17969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 17979 18557 gene locus_tag LOCUS_39560 17979 18557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 19611 18661 gene locus_tag LOCUS_39570 gene ephA 19611 18661 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120198.1 protein_id gnl|my_center|LOCUS_39570 19775 20536 gene locus_tag LOCUS_39580 19775 20536 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120197.1 protein_id gnl|my_center|LOCUS_39580 20644 21537 gene locus_tag LOCUS_39590 gene ablB 20644 21537 CDS product putative beta-lysine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023872.1 protein_id gnl|my_center|LOCUS_39590 21584 22318 gene locus_tag LOCUS_39600 21584 22318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 24821 22722 gene locus_tag LOCUS_39610 24821 22722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 25058 27316 gene locus_tag LOCUS_39620 25058 27316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 27424 29526 gene locus_tag LOCUS_39630 27424 29526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 29592 31136 gene locus_tag LOCUS_39640 29592 31136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 31384 32568 gene locus_tag LOCUS_39650 31384 32568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 33154 32588 gene locus_tag LOCUS_39660 33154 32588 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_39660 34119 33178 gene locus_tag LOCUS_39670 34119 33178 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_39670 34571 35254 gene locus_tag LOCUS_39680 34571 35254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 36055 35288 gene locus_tag LOCUS_39690 36055 35288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 36178 36747 gene locus_tag LOCUS_39700 36178 36747 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389625.1 protein_id gnl|my_center|LOCUS_39700 38982 36811 gene locus_tag LOCUS_39710 gene katG 38982 36811 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRS6 protein_id gnl|my_center|LOCUS_39710 >Feature sequence076 835 218 gene locus_tag LOCUS_39720 gene pdxH 835 218 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6T5 protein_id gnl|my_center|LOCUS_39720 1210 1518 gene locus_tag LOCUS_39730 1210 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 1786 4221 gene locus_tag LOCUS_39740 1786 4221 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_39740 5978 4320 gene locus_tag LOCUS_39750 5978 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 6606 5983 gene locus_tag LOCUS_39760 gene nth 6606 5983 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_39760 7340 6708 gene locus_tag LOCUS_39770 7340 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 7469 8860 gene locus_tag LOCUS_39780 gene fumC 7469 8860 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYR9 protein_id gnl|my_center|LOCUS_39780 9129 12902 gene locus_tag LOCUS_39790 9129 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 13237 13830 gene locus_tag LOCUS_39800 gene aat 13237 13830 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLT7 protein_id gnl|my_center|LOCUS_39800 13911 15056 gene locus_tag LOCUS_39810 13911 15056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525235.1 protein_id gnl|my_center|LOCUS_39810 15105 16730 gene locus_tag LOCUS_39820 15105 16730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 17792 16740 gene locus_tag LOCUS_39830 gene yfbL 17792 16740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76482 protein_id gnl|my_center|LOCUS_39830 18944 17910 gene locus_tag LOCUS_39840 gene rlmK 18944 17910 CDS product ribosomal RNA large subunit methyltransferase K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYY8 protein_id gnl|my_center|LOCUS_39840 19267 18941 gene locus_tag LOCUS_39850 19267 18941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 19151 19729 gene locus_tag LOCUS_39860 19151 19729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 19743 20729 gene locus_tag LOCUS_39870 19743 20729 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875686.1 protein_id gnl|my_center|LOCUS_39870 20729 21706 gene locus_tag LOCUS_39880 gene mvaD 20729 21706 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_39880 21948 23513 gene locus_tag LOCUS_39890 21948 23513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 23576 24646 gene locus_tag LOCUS_39900 23576 24646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 25563 24661 gene locus_tag LOCUS_39910 25563 24661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 26648 25662 gene locus_tag LOCUS_39920 gene mvaK2 26648 25662 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101526.1 protein_id gnl|my_center|LOCUS_39920 27525 26770 gene locus_tag LOCUS_39930 27525 26770 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_39930 29549 27600 gene locus_tag LOCUS_39940 gene sdhA 29549 27600 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_39940 30274 29570 gene locus_tag LOCUS_39950 30274 29570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_39950 30697 32253 gene locus_tag LOCUS_39960 30697 32253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 32536 32327 gene locus_tag LOCUS_39970 32536 32327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 32758 35397 gene locus_tag LOCUS_39980 32758 35397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 35720 38020 gene locus_tag LOCUS_39990 35720 38020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 38032 39306 gene locus_tag LOCUS_40000 38032 39306 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120681.1 protein_id gnl|my_center|LOCUS_40000 >Feature sequence077 2005 98 gene locus_tag LOCUS_40010 2005 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 2403 3263 gene locus_tag LOCUS_40020 2403 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_40020 3363 4364 gene locus_tag LOCUS_40030 3363 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 4349 5458 gene locus_tag LOCUS_40040 4349 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 7269 5950 gene locus_tag LOCUS_40050 gene der 7269 5950 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX4 protein_id gnl|my_center|LOCUS_40050 8300 7320 gene locus_tag LOCUS_40060 gene era 8300 7320 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX3 protein_id gnl|my_center|LOCUS_40060 8353 8673 gene locus_tag LOCUS_40070 8353 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 8728 10260 gene locus_tag LOCUS_40080 8728 10260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 10264 11040 gene locus_tag LOCUS_40090 10264 11040 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251003.1 protein_id gnl|my_center|LOCUS_40090 13377 11062 gene locus_tag LOCUS_40100 13377 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 13572 14378 gene locus_tag LOCUS_40110 13572 14378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 14375 15271 gene locus_tag LOCUS_40120 14375 15271 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403573.1 protein_id gnl|my_center|LOCUS_40120 16448 15414 gene locus_tag LOCUS_40130 16448 15414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 17004 19667 gene locus_tag LOCUS_40140 gene alaS 17004 19667 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 protein_id gnl|my_center|LOCUS_40140 21189 19765 gene locus_tag LOCUS_40150 21189 19765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 23582 21447 gene locus_tag LOCUS_40160 23582 21447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 23877 24737 gene locus_tag LOCUS_40170 23877 24737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 25792 24869 gene locus_tag LOCUS_40180 25792 24869 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_40180 27087 25918 gene locus_tag LOCUS_40190 gene rlmN 27087 25918 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E53 protein_id gnl|my_center|LOCUS_40190 27740 27321 gene locus_tag LOCUS_40200 gene ndk 27740 27321 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9D7 protein_id gnl|my_center|LOCUS_40200 28825 27953 gene locus_tag LOCUS_40210 28825 27953 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV32 protein_id gnl|my_center|LOCUS_40210 30082 28922 gene locus_tag LOCUS_40220 gene sucC 30082 28922 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEX9 protein_id gnl|my_center|LOCUS_40220 30447 33545 gene locus_tag LOCUS_40230 30447 33545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 34935 33742 gene locus_tag LOCUS_40240 34935 33742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 35675 35004 gene locus_tag LOCUS_40250 35675 35004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 36265 35678 gene locus_tag LOCUS_40260 36265 35678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 37071 36358 gene locus_tag LOCUS_40270 37071 36358 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259190.1 protein_id gnl|my_center|LOCUS_40270 37487 38587 gene locus_tag LOCUS_40280 37487 38587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 >Feature sequence078 981 49 gene locus_tag LOCUS_40290 981 49 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986927.1 protein_id gnl|my_center|LOCUS_40290 2502 1093 gene locus_tag LOCUS_40300 2502 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 3634 2492 gene locus_tag LOCUS_40310 3634 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946040.1 protein_id gnl|my_center|LOCUS_40310 4035 3667 gene locus_tag LOCUS_40320 4035 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 4220 5269 gene locus_tag LOCUS_40330 4220 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097980.1 protein_id gnl|my_center|LOCUS_40330 5320 6906 gene locus_tag LOCUS_40340 5320 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 7130 8494 gene locus_tag LOCUS_40350 7130 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105320.1 protein_id gnl|my_center|LOCUS_40350 8497 9294 gene locus_tag LOCUS_40360 8497 9294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 9434 10309 gene locus_tag LOCUS_40370 9434 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 10614 11648 gene locus_tag LOCUS_40380 10614 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 11754 12383 gene locus_tag LOCUS_40390 11754 12383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 12781 13320 gene locus_tag LOCUS_40400 12781 13320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 13928 13431 gene locus_tag LOCUS_40410 13928 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 14508 14014 gene locus_tag LOCUS_40420 14508 14014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 14867 14508 gene locus_tag LOCUS_40430 gene cheY64H-1 14867 14508 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_40430 15751 14930 gene locus_tag LOCUS_40440 gene cheR1 15751 14930 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XC4 protein_id gnl|my_center|LOCUS_40440 17069 15756 gene locus_tag LOCUS_40450 17069 15756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 17552 17184 gene locus_tag LOCUS_40460 17552 17184 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388280.1 protein_id gnl|my_center|LOCUS_40460 18013 17549 gene locus_tag LOCUS_40470 gene cheW-2 18013 17549 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_40470 20423 18006 gene locus_tag LOCUS_40480 20423 18006 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083225.1 protein_id gnl|my_center|LOCUS_40480 23252 20670 gene locus_tag LOCUS_40490 23252 20670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 23482 23823 gene locus_tag LOCUS_40500 23482 23823 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198376.1 protein_id gnl|my_center|LOCUS_40500 23849 24382 gene locus_tag LOCUS_40510 23849 24382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 24452 25864 gene locus_tag LOCUS_40520 24452 25864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 25912 26364 gene locus_tag LOCUS_40530 25912 26364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 26365 27825 gene locus_tag LOCUS_40540 26365 27825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 28383 28456 gene locus_tag LOCUS_t00600 28383 28456 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 28576 28649 gene locus_tag LOCUS_t00610 28576 28649 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 28689 28761 gene locus_tag LOCUS_t00620 28689 28761 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 28804 28876 gene locus_tag LOCUS_t00630 28804 28876 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 28906 28978 gene locus_tag LOCUS_t00640 28906 28978 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 29012 29084 gene locus_tag LOCUS_t00650 29012 29084 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 29132 29204 gene locus_tag LOCUS_t00660 29132 29204 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 29234 29307 gene locus_tag LOCUS_t00670 29234 29307 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 29897 29382 gene locus_tag LOCUS_40550 29897 29382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 30474 31667 gene locus_tag LOCUS_40560 30474 31667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 32692 31661 gene locus_tag LOCUS_40570 gene cydB 32692 31661 CDS product cytochrome D oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_40570 34166 32697 gene locus_tag LOCUS_40580 gene cydA 34166 32697 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_40580 36334 34286 gene locus_tag LOCUS_40590 36334 34286 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530971.1 protein_id gnl|my_center|LOCUS_40590 38380 36419 gene locus_tag LOCUS_40600 38380 36419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 >Feature sequence079 2029 38 gene locus_tag LOCUS_40610 2029 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 2973 2128 gene locus_tag LOCUS_40620 gene map 2973 2128 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX4 protein_id gnl|my_center|LOCUS_40620 3881 3105 gene locus_tag LOCUS_40630 3881 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 4074 5387 gene locus_tag LOCUS_40640 gene nhaP 4074 5387 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_40640 5384 5992 gene locus_tag LOCUS_40650 5384 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 8651 6012 gene locus_tag LOCUS_40660 8651 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 9751 8648 gene locus_tag LOCUS_40670 9751 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 9966 11804 gene locus_tag LOCUS_40680 9966 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 11835 12641 gene locus_tag LOCUS_40690 11835 12641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 13493 12654 gene locus_tag LOCUS_40700 13493 12654 CDS product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529602.1 protein_id gnl|my_center|LOCUS_40700 14855 13599 gene locus_tag LOCUS_40710 14855 13599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 15597 14968 gene locus_tag LOCUS_40720 15597 14968 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976241.1 protein_id gnl|my_center|LOCUS_40720 16727 15594 gene locus_tag LOCUS_40730 16727 15594 CDS product S-adenosylmethionine--diacylglycerol 3-amino-3-carboxypropyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969759.1 protein_id gnl|my_center|LOCUS_40730 17783 17064 gene locus_tag LOCUS_40740 17783 17064 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI57 protein_id gnl|my_center|LOCUS_40740 18722 17946 gene locus_tag LOCUS_40750 18722 17946 CDS product photosystem I assembly BtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257265.1 protein_id gnl|my_center|LOCUS_40750 19170 20204 gene locus_tag LOCUS_40760 19170 20204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 20334 22202 gene locus_tag LOCUS_40770 20334 22202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 22591 22205 gene locus_tag LOCUS_40780 22591 22205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 23802 22741 gene locus_tag LOCUS_40790 gene phaC 23802 22741 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206335.1 protein_id gnl|my_center|LOCUS_40790 25697 23955 gene locus_tag LOCUS_40800 25697 23955 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729678.1 protein_id gnl|my_center|LOCUS_40800 26100 25798 gene locus_tag LOCUS_40810 26100 25798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 27058 26198 gene locus_tag LOCUS_40820 27058 26198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 28673 27078 gene locus_tag LOCUS_40830 28673 27078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 29743 28670 gene locus_tag LOCUS_40840 29743 28670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 30753 29740 gene locus_tag LOCUS_40850 30753 29740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 31021 31728 gene locus_tag LOCUS_40860 31021 31728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 32055 32330 gene locus_tag LOCUS_40870 32055 32330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 32593 33816 gene locus_tag LOCUS_40880 gene phaC 32593 33816 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206335.1 protein_id gnl|my_center|LOCUS_40880 33980 34744 gene locus_tag LOCUS_40890 gene speA 33980 34744 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_40890 35007 37184 gene locus_tag LOCUS_40900 35007 37184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 37389 37883 gene locus_tag LOCUS_40910 37389 37883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 >Feature sequence080 741 2297 gene locus_tag LOCUS_40920 741 2297 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728281.1 protein_id gnl|my_center|LOCUS_40920 4760 2283 gene locus_tag LOCUS_40930 4760 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 4944 5564 gene locus_tag LOCUS_40940 4944 5564 CDS product OmdA-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265685.1 protein_id gnl|my_center|LOCUS_40940 5694 6128 gene locus_tag LOCUS_40950 5694 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 11220 6283 gene locus_tag LOCUS_40960 11220 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 12883 11429 gene locus_tag LOCUS_40970 12883 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 13239 15008 gene locus_tag LOCUS_40980 13239 15008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 15789 15058 gene locus_tag LOCUS_40990 15789 15058 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_40990 17284 15935 gene locus_tag LOCUS_41000 17284 15935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 18703 17348 gene locus_tag LOCUS_41010 18703 17348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 20081 18762 gene locus_tag LOCUS_41020 20081 18762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 20463 21971 gene locus_tag LOCUS_41030 20463 21971 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085767.1 protein_id gnl|my_center|LOCUS_41030 22184 22720 gene locus_tag LOCUS_41040 22184 22720 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B9 protein_id gnl|my_center|LOCUS_41040 23480 22725 gene locus_tag LOCUS_41050 23480 22725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 24236 23628 gene locus_tag LOCUS_41060 24236 23628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 25213 24527 gene locus_tag LOCUS_41070 25213 24527 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968227.1 protein_id gnl|my_center|LOCUS_41070 26774 25482 gene locus_tag LOCUS_41080 26774 25482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 28048 26771 gene locus_tag LOCUS_41090 28048 26771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 30126 28243 gene locus_tag LOCUS_41100 30126 28243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 30992 30123 gene locus_tag LOCUS_41110 30992 30123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 31698 30985 gene locus_tag LOCUS_41120 31698 30985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 33049 31907 gene locus_tag LOCUS_41130 33049 31907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 33759 33049 gene locus_tag LOCUS_41140 33759 33049 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 protein_id gnl|my_center|LOCUS_41140 34057 35046 gene locus_tag LOCUS_41150 34057 35046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 36674 35151 gene locus_tag LOCUS_41160 36674 35151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 38129 36705 gene locus_tag LOCUS_41170 38129 36705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 >Feature sequence081 2 400 gene locus_tag LOCUS_41180 2 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 1427 546 gene locus_tag LOCUS_41190 1427 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 1709 3268 gene locus_tag LOCUS_41200 gene gltX 1709 3268 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG28 protein_id gnl|my_center|LOCUS_41200 3385 4164 gene locus_tag LOCUS_41210 3385 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 4236 5276 gene locus_tag LOCUS_41220 4236 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 7697 5283 gene locus_tag LOCUS_41230 7697 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 7929 9026 gene locus_tag LOCUS_41240 7929 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 9038 11530 gene locus_tag LOCUS_41250 9038 11530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 11537 12481 gene locus_tag LOCUS_41260 11537 12481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_41260 13198 12692 gene locus_tag LOCUS_41270 gene tpx 13198 12692 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KED5 protein_id gnl|my_center|LOCUS_41270 13427 15523 gene locus_tag LOCUS_41280 13427 15523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 15622 16965 gene locus_tag LOCUS_41290 15622 16965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 17090 18208 gene locus_tag LOCUS_41300 17090 18208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 18230 18817 gene locus_tag LOCUS_41310 18230 18817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 18827 19459 gene locus_tag LOCUS_41320 18827 19459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 20279 19479 gene locus_tag LOCUS_41330 20279 19479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 20526 20984 gene locus_tag LOCUS_41340 20526 20984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 22031 20988 gene locus_tag LOCUS_41350 gene czcD 22031 20988 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510049.1 protein_id gnl|my_center|LOCUS_41350 22296 22051 gene locus_tag LOCUS_41360 22296 22051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 22744 27138 gene locus_tag LOCUS_41370 22744 27138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 27181 28695 gene locus_tag LOCUS_41380 27181 28695 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_41380 28976 29935 gene locus_tag LOCUS_41390 28976 29935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 30241 29963 gene locus_tag LOCUS_41400 30241 29963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 30362 31372 gene locus_tag LOCUS_41410 30362 31372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 33004 31373 gene locus_tag LOCUS_41420 33004 31373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 34611 33001 gene locus_tag LOCUS_41430 34611 33001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 35705 34611 gene locus_tag LOCUS_41440 35705 34611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 36870 35920 gene locus_tag LOCUS_41450 gene rluD 36870 35920 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H11 protein_id gnl|my_center|LOCUS_41450 37200 36928 gene locus_tag LOCUS_41460 37200 36928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 >Feature sequence082 1526 1705 gene locus_tag LOCUS_41470 1526 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 2142 1870 gene locus_tag LOCUS_41480 2142 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 3350 2262 gene locus_tag LOCUS_41490 3350 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 6448 3347 gene locus_tag LOCUS_41500 6448 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 6716 6516 gene locus_tag LOCUS_41510 6716 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 6747 7109 gene locus_tag LOCUS_41520 6747 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 8028 7072 gene locus_tag LOCUS_41530 8028 7072 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_41530 8143 9723 gene locus_tag LOCUS_41540 8143 9723 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_41540 10044 11561 gene locus_tag LOCUS_41550 gene lysS 10044 11561 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S442 protein_id gnl|my_center|LOCUS_41550 11656 12459 gene locus_tag LOCUS_41560 11656 12459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 13281 15209 gene locus_tag LOCUS_41570 13281 15209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 15303 15980 gene locus_tag LOCUS_41580 15303 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 16137 17093 gene locus_tag LOCUS_41590 16137 17093 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123806.1 protein_id gnl|my_center|LOCUS_41590 18042 17110 gene locus_tag LOCUS_41600 18042 17110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 19045 18209 gene locus_tag LOCUS_41610 19045 18209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 19114 21120 gene locus_tag LOCUS_41620 19114 21120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 21236 21889 gene locus_tag LOCUS_41630 21236 21889 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_41630 22144 22887 gene locus_tag LOCUS_41640 22144 22887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 22884 24089 gene locus_tag LOCUS_41650 gene coaBC 22884 24089 CDS product coenzyme A biosynthesis bifunctional protein CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T89 protein_id gnl|my_center|LOCUS_41650 24102 25448 gene locus_tag LOCUS_41660 24102 25448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 25540 26586 gene locus_tag LOCUS_41670 gene kdd 25540 26586 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX3 protein_id gnl|my_center|LOCUS_41670 27665 26718 gene locus_tag LOCUS_41680 27665 26718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 29209 27665 gene locus_tag LOCUS_41690 29209 27665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 29547 35372 gene locus_tag LOCUS_41700 29547 35372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 35412 35744 gene locus_tag LOCUS_41710 35412 35744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 >Feature sequence083 433 65 gene locus_tag LOCUS_41720 433 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 4689 460 gene locus_tag LOCUS_41730 4689 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 4975 5622 gene locus_tag LOCUS_41740 4975 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 5696 7624 gene locus_tag LOCUS_41750 gene caiA 5696 7624 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572082.1 protein_id gnl|my_center|LOCUS_41750 7907 11971 gene locus_tag LOCUS_41760 7907 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 12279 12962 gene locus_tag LOCUS_41770 12279 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 14743 12968 gene locus_tag LOCUS_41780 14743 12968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 14884 16887 gene locus_tag LOCUS_41790 14884 16887 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729974.1 protein_id gnl|my_center|LOCUS_41790 16957 18567 gene locus_tag LOCUS_41800 16957 18567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227635.1 protein_id gnl|my_center|LOCUS_41800 18802 20142 gene locus_tag LOCUS_41810 18802 20142 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_41810 20165 20509 gene locus_tag LOCUS_41820 20165 20509 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932665.1 protein_id gnl|my_center|LOCUS_41820 20919 21272 gene locus_tag LOCUS_41830 20919 21272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189643.1 protein_id gnl|my_center|LOCUS_41830 22076 21288 gene locus_tag LOCUS_41840 22076 21288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 22994 22215 gene locus_tag LOCUS_41850 22994 22215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 23710 22991 gene locus_tag LOCUS_41860 23710 22991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 24807 23788 gene locus_tag LOCUS_41870 24807 23788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 24779 26146 gene locus_tag LOCUS_41880 24779 26146 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329168.1 protein_id gnl|my_center|LOCUS_41880 26143 26691 gene locus_tag LOCUS_41890 26143 26691 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329169.1 protein_id gnl|my_center|LOCUS_41890 31723 26711 gene locus_tag LOCUS_41900 31723 26711 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_41900 34196 32013 gene locus_tag LOCUS_41910 34196 32013 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791176.1 protein_id gnl|my_center|LOCUS_41910 <35918 34254 gene locus_tag LOCUS_41920 <35918 34254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000791176.1:membrane protein >Feature sequence084 2234 246 gene locus_tag LOCUS_41930 2234 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 2398 2619 gene locus_tag LOCUS_41940 2398 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 3291 2737 gene locus_tag LOCUS_41950 3291 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 4800 3382 gene locus_tag LOCUS_41960 4800 3382 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHK0 protein_id gnl|my_center|LOCUS_41960 6435 5302 gene locus_tag LOCUS_41970 6435 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 6898 6518 gene locus_tag LOCUS_41980 6898 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 7056 6983 gene locus_tag LOCUS_t00680 7056 6983 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8123 7128 gene locus_tag LOCUS_41990 8123 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 8288 9709 gene locus_tag LOCUS_42000 8288 9709 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058287.1 protein_id gnl|my_center|LOCUS_42000 10028 10690 gene locus_tag LOCUS_42010 gene exbB 10028 10690 CDS product TolQ transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177702.1 protein_id gnl|my_center|LOCUS_42010 10740 11153 gene locus_tag LOCUS_42020 gene exbD3 10740 11153 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_42020 11181 12230 gene locus_tag LOCUS_42030 11181 12230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 13095 13661 gene locus_tag LOCUS_42040 13095 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 14786 13689 gene locus_tag LOCUS_42050 gene purM 14786 13689 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12043 protein_id gnl|my_center|LOCUS_42050 14828 15595 gene locus_tag LOCUS_42060 14828 15595 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_42060 15592 16311 gene locus_tag LOCUS_42070 15592 16311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_42070 16330 16998 gene locus_tag LOCUS_42080 16330 16998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 17004 18266 gene locus_tag LOCUS_42090 gene folC 17004 18266 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709858.1 protein_id gnl|my_center|LOCUS_42090 18362 18574 gene locus_tag LOCUS_42100 18362 18574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 20684 18663 gene locus_tag LOCUS_42110 20684 18663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 21100 22200 gene locus_tag LOCUS_42120 21100 22200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 22267 23361 gene locus_tag LOCUS_42130 22267 23361 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704267.1 protein_id gnl|my_center|LOCUS_42130 27044 26274 gene locus_tag LOCUS_42140 27044 26274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 27383 28921 gene locus_tag LOCUS_42150 27383 28921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 30958 28958 gene locus_tag LOCUS_42160 30958 28958 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_42160 31071 32186 gene locus_tag LOCUS_42170 31071 32186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 34210 32285 gene locus_tag LOCUS_42180 34210 32285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 34602 34312 gene locus_tag LOCUS_42190 34602 34312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 >Feature sequence085 3091 59 gene locus_tag LOCUS_42200 3091 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 3265 3975 gene locus_tag LOCUS_42210 3265 3975 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262216.1 protein_id gnl|my_center|LOCUS_42210 4205 5881 gene locus_tag LOCUS_42220 4205 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 6355 8982 gene locus_tag LOCUS_42230 6355 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 9075 11153 gene locus_tag LOCUS_42240 9075 11153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 11221 12453 gene locus_tag LOCUS_42250 11221 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 14081 12438 gene locus_tag LOCUS_42260 14081 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 13963 14184 gene locus_tag LOCUS_42270 13963 14184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 14181 16049 gene locus_tag LOCUS_42280 gene spoVB 14181 16049 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_42280 16036 16566 gene locus_tag LOCUS_42290 16036 16566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 17329 16568 gene locus_tag LOCUS_42300 17329 16568 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729133.1 protein_id gnl|my_center|LOCUS_42300 19745 17544 gene locus_tag LOCUS_42310 19745 17544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 21641 19956 gene locus_tag LOCUS_42320 21641 19956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 22111 21686 gene locus_tag LOCUS_42330 22111 21686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 23537 22185 gene locus_tag LOCUS_42340 23537 22185 CDS product GDL motif peptide-associated radical SAM/SPASM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200682.1 protein_id gnl|my_center|LOCUS_42340 24029 23571 gene locus_tag LOCUS_42350 24029 23571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 24556 24077 gene locus_tag LOCUS_42360 24556 24077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 24890 25300 gene locus_tag LOCUS_42370 gene dksA 24890 25300 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCE1 protein_id gnl|my_center|LOCUS_42370 25513 26784 gene locus_tag LOCUS_42380 gene clpX 25513 26784 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C83 protein_id gnl|my_center|LOCUS_42380 26887 27126 gene locus_tag LOCUS_42390 26887 27126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 27770 27300 gene locus_tag LOCUS_42400 27770 27300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 31389 28003 gene locus_tag LOCUS_42410 31389 28003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 32024 31632 gene locus_tag LOCUS_42420 32024 31632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 32620 33435 gene locus_tag LOCUS_42430 32620 33435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 34789 33536 gene locus_tag LOCUS_42440 34789 33536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 >Feature sequence086 408 2504 gene locus_tag LOCUS_42450 408 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 2506 4473 gene locus_tag LOCUS_42460 2506 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 4654 5559 gene locus_tag LOCUS_42470 4654 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 5745 6014 gene locus_tag LOCUS_42480 gene rpsO 5745 6014 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3TYE5 protein_id gnl|my_center|LOCUS_42480 6720 8858 gene locus_tag LOCUS_42490 gene pnp 6720 8858 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS9 protein_id gnl|my_center|LOCUS_42490 9363 9010 gene locus_tag LOCUS_42500 9363 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 10130 9489 gene locus_tag LOCUS_42510 10130 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 11510 10290 gene locus_tag LOCUS_42520 11510 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 12143 11592 gene locus_tag LOCUS_42530 12143 11592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 12997 12446 gene locus_tag LOCUS_42540 12997 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 13248 14258 gene locus_tag LOCUS_42550 13248 14258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 14453 15808 gene locus_tag LOCUS_42560 14453 15808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 16715 15816 gene locus_tag LOCUS_42570 16715 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 16835 18259 gene locus_tag LOCUS_42580 16835 18259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 19050 18802 gene locus_tag LOCUS_42590 19050 18802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 19186 21108 gene locus_tag LOCUS_42600 gene dnaK 19186 21108 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_42600 21298 22257 gene locus_tag LOCUS_42610 21298 22257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 22366 22438 gene locus_tag LOCUS_t00690 22366 22438 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22998 23070 gene locus_tag LOCUS_t00700 22998 23070 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23866 23432 gene locus_tag LOCUS_42620 23866 23432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 25416 24025 gene locus_tag LOCUS_42630 25416 24025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 26802 25435 gene locus_tag LOCUS_42640 26802 25435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 28719 26899 gene locus_tag LOCUS_42650 28719 26899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 29582 28851 gene locus_tag LOCUS_42660 29582 28851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 29793 30617 gene locus_tag LOCUS_42670 29793 30617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 31853 30627 gene locus_tag LOCUS_42680 31853 30627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 32008 33096 gene locus_tag LOCUS_42690 32008 33096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 33130 34923 gene locus_tag LOCUS_42700 33130 34923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 >Feature sequence087 1584 724 gene locus_tag LOCUS_42710 1584 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 2118 3602 gene locus_tag LOCUS_42720 2118 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 3595 4977 gene locus_tag LOCUS_42730 3595 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 6258 4981 gene locus_tag LOCUS_42740 6258 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 8622 6364 gene locus_tag LOCUS_42750 8622 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 10348 8720 gene locus_tag LOCUS_42760 10348 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 11490 10345 gene locus_tag LOCUS_42770 11490 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 12469 11498 gene locus_tag LOCUS_42780 12469 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 13486 12491 gene locus_tag LOCUS_42790 13486 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 15437 13605 gene locus_tag LOCUS_42800 15437 13605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 16296 15571 gene locus_tag LOCUS_42810 gene rluB 16296 15571 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB4 protein_id gnl|my_center|LOCUS_42810 17462 16452 gene locus_tag LOCUS_42820 17462 16452 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038646.1 protein_id gnl|my_center|LOCUS_42820 18603 17836 gene locus_tag LOCUS_42830 18603 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 19338 18733 gene locus_tag LOCUS_42840 19338 18733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 20738 19347 gene locus_tag LOCUS_42850 20738 19347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_42850 22551 20740 gene locus_tag LOCUS_42860 22551 20740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 23337 22810 gene locus_tag LOCUS_42870 23337 22810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 24175 23420 gene locus_tag LOCUS_42880 24175 23420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 24262 25671 gene locus_tag LOCUS_42890 24262 25671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 25781 27355 gene locus_tag LOCUS_42900 25781 27355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 28644 27976 gene locus_tag LOCUS_42910 gene gstA 28644 27976 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 protein_id gnl|my_center|LOCUS_42910 30068 28668 gene locus_tag LOCUS_42920 30068 28668 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706123.1 protein_id gnl|my_center|LOCUS_42920 31431 30133 gene locus_tag LOCUS_42930 31431 30133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 31315 31533 gene locus_tag LOCUS_42940 31315 31533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 31670 32746 gene locus_tag LOCUS_42950 31670 32746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 32876 34126 gene locus_tag LOCUS_42960 32876 34126 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035879.1 protein_id gnl|my_center|LOCUS_42960 >Feature sequence088 337 1134 gene locus_tag LOCUS_42970 337 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 1191 2033 gene locus_tag LOCUS_42980 gene rsmI 1191 2033 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T7 protein_id gnl|my_center|LOCUS_42980 3132 2053 gene locus_tag LOCUS_42990 3132 2053 CDS product ribosome small subunit-dependent GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_42990 3331 5013 gene locus_tag LOCUS_43000 3331 5013 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142253.1 protein_id gnl|my_center|LOCUS_43000 5151 7883 gene locus_tag LOCUS_43010 5151 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 8891 7905 gene locus_tag LOCUS_43020 8891 7905 CDS product trans-2-enoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_43020 12050 9144 gene locus_tag LOCUS_43030 12050 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 12768 12253 gene locus_tag LOCUS_43040 12768 12253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 13765 12791 gene locus_tag LOCUS_43050 13765 12791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 14331 15635 gene locus_tag LOCUS_43060 14331 15635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 15645 16730 gene locus_tag LOCUS_43070 15645 16730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 18360 17068 gene locus_tag LOCUS_43080 18360 17068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030365.1 protein_id gnl|my_center|LOCUS_43080 18521 19519 gene locus_tag LOCUS_43090 18521 19519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 19710 21005 gene locus_tag LOCUS_43100 19710 21005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 21628 21101 gene locus_tag LOCUS_43110 21628 21101 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYB0 protein_id gnl|my_center|LOCUS_43110 22494 21799 gene locus_tag LOCUS_43120 22494 21799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 24896 22596 gene locus_tag LOCUS_43130 24896 22596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 25754 25068 gene locus_tag LOCUS_43140 25754 25068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 26633 26046 gene locus_tag LOCUS_43150 26633 26046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 protein_id gnl|my_center|LOCUS_43150 26838 27938 gene locus_tag LOCUS_43160 26838 27938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 27928 28128 gene locus_tag LOCUS_43170 27928 28128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 >Feature sequence089 893 2362 gene locus_tag LOCUS_43180 893 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 2399 3988 gene locus_tag LOCUS_43190 2399 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 4014 5390 gene locus_tag LOCUS_43200 4014 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 5690 6409 gene locus_tag LOCUS_43210 5690 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 6499 7440 gene locus_tag LOCUS_43220 6499 7440 CDS product hydrocarbon oxygenase MocD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142496.1 protein_id gnl|my_center|LOCUS_43220 8889 7828 gene locus_tag LOCUS_43230 8889 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 9172 11274 gene locus_tag LOCUS_43240 9172 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 12256 11435 gene locus_tag LOCUS_43250 12256 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 12447 14438 gene locus_tag LOCUS_43260 gene ligA 12447 14438 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774556.1 protein_id gnl|my_center|LOCUS_43260 14575 15792 gene locus_tag LOCUS_43270 14575 15792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 16784 15924 gene locus_tag LOCUS_43280 16784 15924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 20425 16781 gene locus_tag LOCUS_43290 20425 16781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 20646 21776 gene locus_tag LOCUS_43300 gene yfeW 20646 21776 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 protein_id gnl|my_center|LOCUS_43300 24254 21903 gene locus_tag LOCUS_43310 24254 21903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 24543 27626 gene locus_tag LOCUS_43320 24543 27626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 29402 27630 gene locus_tag LOCUS_43330 29402 27630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 29763 33035 gene locus_tag LOCUS_43340 gene carB 29763 33035 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9L7 protein_id gnl|my_center|LOCUS_43340 33468 33061 gene locus_tag LOCUS_43350 33468 33061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 >Feature sequence090 2343 208 gene locus_tag LOCUS_43360 2343 208 CDS product fatty oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524570.1 protein_id gnl|my_center|LOCUS_43360 3572 2364 gene locus_tag LOCUS_43370 3572 2364 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525801.1 protein_id gnl|my_center|LOCUS_43370 3879 4817 gene locus_tag LOCUS_43380 3879 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 6859 4841 gene locus_tag LOCUS_43390 6859 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 7752 6856 gene locus_tag LOCUS_43400 7752 6856 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531310.1 protein_id gnl|my_center|LOCUS_43400 8770 7913 gene locus_tag LOCUS_43410 gene cobB 8770 7913 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D8W3 protein_id gnl|my_center|LOCUS_43410 8987 10396 gene locus_tag LOCUS_43420 8987 10396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 12241 10427 gene locus_tag LOCUS_43430 12241 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 12441 14132 gene locus_tag LOCUS_43440 12441 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 14781 14149 gene locus_tag LOCUS_43450 14781 14149 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LK0 protein_id gnl|my_center|LOCUS_43450 15222 14953 gene locus_tag LOCUS_43460 15222 14953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 16397 15435 gene locus_tag LOCUS_43470 16397 15435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 18933 16900 gene locus_tag LOCUS_43480 18933 16900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 20243 18930 gene locus_tag LOCUS_43490 20243 18930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 21990 20260 gene locus_tag LOCUS_43500 21990 20260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 22812 22279 gene locus_tag LOCUS_43510 gene orn 22812 22279 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C93 protein_id gnl|my_center|LOCUS_43510 23435 22986 gene locus_tag LOCUS_43520 23435 22986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 23519 24619 gene locus_tag LOCUS_43530 23519 24619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 25511 24744 gene locus_tag LOCUS_43540 25511 24744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 25758 26183 gene locus_tag LOCUS_43550 25758 26183 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217592.1 protein_id gnl|my_center|LOCUS_43550 27126 26176 gene locus_tag LOCUS_43560 27126 26176 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ3 protein_id gnl|my_center|LOCUS_43560 28378 27197 gene locus_tag LOCUS_43570 28378 27197 CDS product rRNA (guanine-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886697.1 protein_id gnl|my_center|LOCUS_43570 29722 28391 gene locus_tag LOCUS_43580 29722 28391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_43580 30680 29907 gene locus_tag LOCUS_43590 30680 29907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 31971 31144 gene locus_tag LOCUS_43600 31971 31144 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_43600 32191 33282 gene locus_tag LOCUS_43610 32191 33282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 >Feature sequence091 1682 93 gene locus_tag LOCUS_43620 1682 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 1968 2687 gene locus_tag LOCUS_43630 1968 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 5179 2726 gene locus_tag LOCUS_43640 5179 2726 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035312.1 protein_id gnl|my_center|LOCUS_43640 6149 5421 gene locus_tag LOCUS_43650 6149 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 6345 6818 gene locus_tag LOCUS_43660 6345 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 6815 7369 gene locus_tag LOCUS_43670 gene mog 6815 7369 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AF04 protein_id gnl|my_center|LOCUS_43670 7543 9147 gene locus_tag LOCUS_43680 7543 9147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 9158 10156 gene locus_tag LOCUS_43690 9158 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 10711 10274 gene locus_tag LOCUS_43700 10711 10274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 11995 10790 gene locus_tag LOCUS_43710 11995 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 13074 12058 gene locus_tag LOCUS_43720 13074 12058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 13553 16876 gene locus_tag LOCUS_43730 13553 16876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 17015 18376 gene locus_tag LOCUS_43740 17015 18376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 19405 18572 gene locus_tag LOCUS_43750 19405 18572 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775665.1 protein_id gnl|my_center|LOCUS_43750 19860 23879 gene locus_tag LOCUS_43760 19860 23879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 23881 24969 gene locus_tag LOCUS_43770 gene cheB 23881 24969 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBT0 protein_id gnl|my_center|LOCUS_43770 24972 26357 gene locus_tag LOCUS_43780 24972 26357 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257542.1 protein_id gnl|my_center|LOCUS_43780 26444 27403 gene locus_tag LOCUS_43790 26444 27403 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228552.1 protein_id gnl|my_center|LOCUS_43790 28649 27330 gene locus_tag LOCUS_43800 28649 27330 CDS product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457553.1 protein_id gnl|my_center|LOCUS_43800 28850 29551 gene locus_tag LOCUS_43810 28850 29551 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_43810 30614 29757 gene locus_tag LOCUS_43820 30614 29757 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391395.1 protein_id gnl|my_center|LOCUS_43820 30820 30617 gene locus_tag LOCUS_43830 30820 30617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 30819 31871 gene locus_tag LOCUS_43840 30819 31871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 31897 33111 gene locus_tag LOCUS_43850 31897 33111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 >Feature sequence092 1766 45 gene locus_tag LOCUS_43860 1766 45 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_43860 1974 3413 gene locus_tag LOCUS_43870 1974 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 3601 4746 gene locus_tag LOCUS_43880 3601 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 4781 5542 gene locus_tag LOCUS_43890 4781 5542 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256276.1 protein_id gnl|my_center|LOCUS_43890 10300 5552 gene locus_tag LOCUS_43900 10300 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 10786 11787 gene locus_tag LOCUS_43910 10786 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 11941 13128 gene locus_tag LOCUS_43920 11941 13128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 14685 13216 gene locus_tag LOCUS_43930 14685 13216 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143249.1 protein_id gnl|my_center|LOCUS_43930 15725 14802 gene locus_tag LOCUS_43940 15725 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 15921 16889 gene locus_tag LOCUS_43950 15921 16889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 16935 17741 gene locus_tag LOCUS_43960 gene mutM 16935 17741 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHE9 protein_id gnl|my_center|LOCUS_43960 17940 19748 gene locus_tag LOCUS_43970 17940 19748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 21767 19755 gene locus_tag LOCUS_43980 21767 19755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 22989 22027 gene locus_tag LOCUS_43990 22989 22027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 23650 23012 gene locus_tag LOCUS_44000 23650 23012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 23947 24165 gene locus_tag LOCUS_44010 23947 24165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 25783 24188 gene locus_tag LOCUS_44020 25783 24188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 26777 25821 gene locus_tag LOCUS_44030 gene glkA 26777 25821 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4E1 protein_id gnl|my_center|LOCUS_44030 26908 27783 gene locus_tag LOCUS_44040 26908 27783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 27956 28522 gene locus_tag LOCUS_44050 27956 28522 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVB9 protein_id gnl|my_center|LOCUS_44050 28525 29409 gene locus_tag LOCUS_44060 28525 29409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 29542 32013 gene locus_tag LOCUS_44070 gene ppk 29542 32013 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBZ5 protein_id gnl|my_center|LOCUS_44070 32019 32234 gene locus_tag LOCUS_44080 32019 32234 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_44080 32288 33079 gene locus_tag LOCUS_44090 gene thiG 32288 33079 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S371 protein_id gnl|my_center|LOCUS_44090 >Feature sequence093 987 1445 gene locus_tag LOCUS_44100 gene mraZ 987 1445 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5L6 protein_id gnl|my_center|LOCUS_44100 1816 1577 gene locus_tag LOCUS_44110 1816 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 1730 2686 gene locus_tag LOCUS_44120 gene rsmH 1730 2686 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60396 protein_id gnl|my_center|LOCUS_44120 2773 3246 gene locus_tag LOCUS_44130 2773 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 3333 5453 gene locus_tag LOCUS_44140 gene ftsI 3333 5453 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_44140 5473 7035 gene locus_tag LOCUS_44150 gene murE 5473 7035 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFN2 protein_id gnl|my_center|LOCUS_44150 7032 8525 gene locus_tag LOCUS_44160 gene murF 7032 8525 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNU1 protein_id gnl|my_center|LOCUS_44160 8657 9796 gene locus_tag LOCUS_44170 gene mraY 8657 9796 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D3 protein_id gnl|my_center|LOCUS_44170 9919 11190 gene locus_tag LOCUS_44180 gene ftsW 9919 11190 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D5 protein_id gnl|my_center|LOCUS_44180 11313 12413 gene locus_tag LOCUS_44190 gene murG 11313 12413 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D6 protein_id gnl|my_center|LOCUS_44190 12758 13795 gene locus_tag LOCUS_44200 12758 13795 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_44200 13788 14786 gene locus_tag LOCUS_44210 gene ddlB 13788 14786 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJJ5 protein_id gnl|my_center|LOCUS_44210 14915 15787 gene locus_tag LOCUS_44220 14915 15787 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392366.1 protein_id gnl|my_center|LOCUS_44220 15881 17110 gene locus_tag LOCUS_44230 gene ftsA 15881 17110 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E0 protein_id gnl|my_center|LOCUS_44230 17383 18762 gene locus_tag LOCUS_44240 17383 18762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 20383 19031 gene locus_tag LOCUS_44250 20383 19031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 24753 20485 gene locus_tag LOCUS_44260 24753 20485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 24878 26671 gene locus_tag LOCUS_44270 24878 26671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 26763 27917 gene locus_tag LOCUS_44280 26763 27917 CDS product conjugal transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_44280 29320 27938 gene locus_tag LOCUS_44290 29320 27938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 29496 29801 gene locus_tag LOCUS_44300 29496 29801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 29806 31683 gene locus_tag LOCUS_44310 29806 31683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 32071 31685 gene locus_tag LOCUS_44320 32071 31685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 32860 32096 gene locus_tag LOCUS_44330 gene trmJ 32860 32096 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D44 protein_id gnl|my_center|LOCUS_44330 >Feature sequence094 1428 76 gene locus_tag LOCUS_44340 1428 76 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066917.1 protein_id gnl|my_center|LOCUS_44340 1635 2276 gene locus_tag LOCUS_44350 1635 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 2418 3056 gene locus_tag LOCUS_44360 2418 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142687.1 protein_id gnl|my_center|LOCUS_44360 3401 3706 gene locus_tag LOCUS_44370 3401 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 3939 4940 gene locus_tag LOCUS_44380 3939 4940 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089202.1 protein_id gnl|my_center|LOCUS_44380 5074 6597 gene locus_tag LOCUS_44390 5074 6597 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761157.1 protein_id gnl|my_center|LOCUS_44390 6661 7182 gene locus_tag LOCUS_44400 6661 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 7219 8922 gene locus_tag LOCUS_44410 7219 8922 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_44410 9166 10497 gene locus_tag LOCUS_44420 9166 10497 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403440.1 protein_id gnl|my_center|LOCUS_44420 11919 10522 gene locus_tag LOCUS_44430 11919 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 12692 12000 gene locus_tag LOCUS_44440 12692 12000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 13129 12689 gene locus_tag LOCUS_44450 13129 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 13966 13202 gene locus_tag LOCUS_44460 13966 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 14592 14260 gene locus_tag LOCUS_44470 14592 14260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 14649 15599 gene locus_tag LOCUS_44480 14649 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 16282 15671 gene locus_tag LOCUS_44490 16282 15671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 16569 17750 gene locus_tag LOCUS_44500 16569 17750 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583240.1 protein_id gnl|my_center|LOCUS_44500 21363 18280 gene locus_tag LOCUS_44510 21363 18280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 21737 21360 gene locus_tag LOCUS_44520 21737 21360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 21700 23274 gene locus_tag LOCUS_44530 21700 23274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 23441 24835 gene locus_tag LOCUS_44540 23441 24835 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_44540 25222 26814 gene locus_tag LOCUS_44550 gene pckA2 25222 26814 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S008 protein_id gnl|my_center|LOCUS_44550 26918 27700 gene locus_tag LOCUS_44560 26918 27700 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119176.1 protein_id gnl|my_center|LOCUS_44560 28374 27820 gene locus_tag LOCUS_44570 28374 27820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 29808 28519 gene locus_tag LOCUS_44580 29808 28519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 30132 32828 gene locus_tag LOCUS_44590 gene pepN 30132 32828 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038275.1 protein_id gnl|my_center|LOCUS_44590 >Feature sequence095 8 853 gene locus_tag LOCUS_44600 8 853 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263170.1 protein_id gnl|my_center|LOCUS_44600 1066 3288 gene locus_tag LOCUS_44610 1066 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 3354 4322 gene locus_tag LOCUS_44620 3354 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 6397 4487 gene locus_tag LOCUS_44630 6397 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 7809 6685 gene locus_tag LOCUS_44640 7809 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 10123 8459 gene locus_tag LOCUS_44650 10123 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 10168 10422 gene locus_tag LOCUS_44660 10168 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 10840 11403 gene locus_tag LOCUS_44670 10840 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 11495 12868 gene locus_tag LOCUS_44680 11495 12868 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182C2 protein_id gnl|my_center|LOCUS_44680 14120 12843 gene locus_tag LOCUS_44690 14120 12843 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937602.1 protein_id gnl|my_center|LOCUS_44690 14618 14148 gene locus_tag LOCUS_44700 14618 14148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 16400 14649 gene locus_tag LOCUS_44710 16400 14649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 16887 17432 gene locus_tag LOCUS_44720 16887 17432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 17429 18646 gene locus_tag LOCUS_44730 17429 18646 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140868.1 protein_id gnl|my_center|LOCUS_44730 18755 20743 gene locus_tag LOCUS_44740 18755 20743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 22946 20772 gene locus_tag LOCUS_44750 22946 20772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 23193 23465 gene locus_tag LOCUS_44760 23193 23465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 23558 24508 gene locus_tag LOCUS_44770 23558 24508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 26105 24477 gene locus_tag LOCUS_44780 26105 24477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 27467 26250 gene locus_tag LOCUS_44790 27467 26250 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_44790 27611 30571 gene locus_tag LOCUS_44800 gene putA 27611 30571 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q725V6 protein_id gnl|my_center|LOCUS_44800 30650 31501 gene locus_tag LOCUS_44810 30650 31501 CDS product metallo-mystery pair system four-Cys motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538118.1 protein_id gnl|my_center|LOCUS_44810 31561 32703 gene locus_tag LOCUS_44820 gene mauG 31561 32703 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_44820 >Feature sequence096 1194 289 gene locus_tag LOCUS_44830 1194 289 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123806.1 protein_id gnl|my_center|LOCUS_44830 2873 1449 gene locus_tag LOCUS_44840 gene pgi 2873 1449 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFP0 protein_id gnl|my_center|LOCUS_44840 3739 6996 gene locus_tag LOCUS_44850 3739 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 7157 6993 gene locus_tag LOCUS_44860 7157 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 7284 8516 gene locus_tag LOCUS_44870 7284 8516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 9050 8667 gene locus_tag LOCUS_44880 gene gcvH 9050 8667 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_44880 10227 9130 gene locus_tag LOCUS_44890 gene gcvT 10227 9130 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDT6 protein_id gnl|my_center|LOCUS_44890 11245 10310 gene locus_tag LOCUS_44900 gene folD1 11245 10310 CDS product bifunctional protein FolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVN1 protein_id gnl|my_center|LOCUS_44900 11990 11322 gene locus_tag LOCUS_44910 11990 11322 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_44910 13007 12060 gene locus_tag LOCUS_44920 gene mntD 13007 12060 CDS product manganese transport system membrane protein MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34500 protein_id gnl|my_center|LOCUS_44920 13981 13007 gene locus_tag LOCUS_44930 13981 13007 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256104.1 protein_id gnl|my_center|LOCUS_44930 14748 13978 gene locus_tag LOCUS_44940 gene mntB 14748 13978 CDS product manganese transport system ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34338 protein_id gnl|my_center|LOCUS_44940 15758 14745 gene locus_tag LOCUS_44950 15758 14745 CDS product manganese ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143301.1 protein_id gnl|my_center|LOCUS_44950 21266 16044 gene locus_tag LOCUS_44960 21266 16044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 22358 21366 gene locus_tag LOCUS_44970 22358 21366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 22861 23352 gene locus_tag LOCUS_44980 22861 23352 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191904.1 protein_id gnl|my_center|LOCUS_44980 23485 24231 gene locus_tag LOCUS_44990 23485 24231 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096539.1 protein_id gnl|my_center|LOCUS_44990 25335 24412 gene locus_tag LOCUS_45000 25335 24412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 26135 25332 gene locus_tag LOCUS_45010 gene proC 26135 25332 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R27 protein_id gnl|my_center|LOCUS_45010 26898 26167 gene locus_tag LOCUS_45020 gene yggS 26898 26167 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_45020 27594 26965 gene locus_tag LOCUS_45030 27594 26965 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A46 protein_id gnl|my_center|LOCUS_45030 27767 28237 gene locus_tag LOCUS_45040 27767 28237 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939520.1 protein_id gnl|my_center|LOCUS_45040 28289 31147 gene locus_tag LOCUS_45050 28289 31147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 31294 32460 gene locus_tag LOCUS_45060 31294 32460 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_45060 >Feature sequence097 1304 969 gene locus_tag LOCUS_45070 1304 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 1680 1973 gene locus_tag LOCUS_45080 1680 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 2049 3044 gene locus_tag LOCUS_45090 2049 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 3041 4402 gene locus_tag LOCUS_45100 3041 4402 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_45100 4690 4427 gene locus_tag LOCUS_45110 4690 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 5002 6717 gene locus_tag LOCUS_45120 5002 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 6707 9538 gene locus_tag LOCUS_45130 6707 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 9718 11151 gene locus_tag LOCUS_45140 9718 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 11242 11823 gene locus_tag LOCUS_45150 11242 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 13322 11961 gene locus_tag LOCUS_45160 13322 11961 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_45160 13864 13322 gene locus_tag LOCUS_45170 13864 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 16764 14122 gene locus_tag LOCUS_45180 16764 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402856.1 protein_id gnl|my_center|LOCUS_45180 17328 18179 gene locus_tag LOCUS_45190 17328 18179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 18181 18966 gene locus_tag LOCUS_45200 18181 18966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 19025 19906 gene locus_tag LOCUS_45210 19025 19906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 19982 23185 gene locus_tag LOCUS_45220 19982 23185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 23477 27031 gene locus_tag LOCUS_45230 23477 27031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 27095 30337 gene locus_tag LOCUS_45240 27095 30337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 30929 30435 gene locus_tag LOCUS_45250 30929 30435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 32006 30948 gene locus_tag LOCUS_45260 32006 30948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 >Feature sequence098 1630 134 gene locus_tag LOCUS_45270 1630 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 3436 1655 gene locus_tag LOCUS_45280 3436 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 4620 3508 gene locus_tag LOCUS_45290 4620 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 5435 4692 gene locus_tag LOCUS_45300 5435 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 7594 5507 gene locus_tag LOCUS_45310 7594 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 7916 9343 gene locus_tag LOCUS_45320 7916 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 9360 10382 gene locus_tag LOCUS_45330 9360 10382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 10375 11532 gene locus_tag LOCUS_45340 gene proB 10375 11532 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ7 protein_id gnl|my_center|LOCUS_45340 12171 18542 gene locus_tag LOCUS_45350 12171 18542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 19136 18744 gene locus_tag LOCUS_45360 19136 18744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 19501 19244 gene locus_tag LOCUS_45370 19501 19244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 20027 21088 gene locus_tag LOCUS_45380 gene pilM 20027 21088 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_45380 21085 21783 gene locus_tag LOCUS_45390 gene pilN 21085 21783 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_45390 21881 22489 gene locus_tag LOCUS_45400 21881 22489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 22626 23393 gene locus_tag LOCUS_45410 22626 23393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 23558 26551 gene locus_tag LOCUS_45420 23558 26551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 26663 27475 gene locus_tag LOCUS_45430 26663 27475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 27905 27630 gene locus_tag LOCUS_45440 27905 27630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 29708 27936 gene locus_tag LOCUS_45450 29708 27936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 31446 29767 gene locus_tag LOCUS_45460 31446 29767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 >Feature sequence099 128 823 gene locus_tag LOCUS_45470 128 823 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537687.1 protein_id gnl|my_center|LOCUS_45470 823 1323 gene locus_tag LOCUS_45480 823 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 1320 1775 gene locus_tag LOCUS_45490 1320 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 3097 2915 gene locus_tag LOCUS_45500 3097 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 4535 3399 gene locus_tag LOCUS_45510 gene thiO 4535 3399 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403986.1 protein_id gnl|my_center|LOCUS_45510 5206 4535 gene locus_tag LOCUS_45520 gene rsmG 5206 4535 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215587.1 protein_id gnl|my_center|LOCUS_45520 8018 5352 gene locus_tag LOCUS_45530 8018 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 8457 9179 gene locus_tag LOCUS_45540 8457 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 9512 12052 gene locus_tag LOCUS_45550 9512 12052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 12249 13235 gene locus_tag LOCUS_45560 12249 13235 CDS product fructose-bisphosphatase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_45560 14312 13494 gene locus_tag LOCUS_45570 14312 13494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 14955 14539 gene locus_tag LOCUS_45580 14955 14539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 15177 17987 gene locus_tag LOCUS_45590 15177 17987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 18190 19188 gene locus_tag LOCUS_45600 18190 19188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 19460 22291 gene locus_tag LOCUS_45610 19460 22291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 22428 22850 gene locus_tag LOCUS_45620 22428 22850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 22938 23831 gene locus_tag LOCUS_45630 22938 23831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 24273 26819 gene locus_tag LOCUS_45640 24273 26819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 26826 27830 gene locus_tag LOCUS_45650 26826 27830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 28205 27861 gene locus_tag LOCUS_45660 28205 27861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 28628 29179 gene locus_tag LOCUS_45670 28628 29179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 29604 29194 gene locus_tag LOCUS_45680 29604 29194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 29792 30754 gene locus_tag LOCUS_45690 29792 30754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 >Feature sequence100 1925 594 gene locus_tag LOCUS_45700 1925 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 3010 1934 gene locus_tag LOCUS_45710 3010 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 4031 3105 gene locus_tag LOCUS_45720 4031 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 5626 4103 gene locus_tag LOCUS_45730 5626 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 6735 5626 gene locus_tag LOCUS_45740 6735 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 8538 6910 gene locus_tag LOCUS_45750 8538 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 8793 10484 gene locus_tag LOCUS_45760 8793 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45760 10481 11887 gene locus_tag LOCUS_45770 10481 11887 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_45770 12011 12658 gene locus_tag LOCUS_45780 12011 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 13408 12668 gene locus_tag LOCUS_45790 13408 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 14186 17068 gene locus_tag LOCUS_45800 gene ileS 14186 17068 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747X9 protein_id gnl|my_center|LOCUS_45800 17287 18060 gene locus_tag LOCUS_45810 17287 18060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 18176 19390 gene locus_tag LOCUS_45820 18176 19390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 19435 20472 gene locus_tag LOCUS_45830 19435 20472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 20526 21158 gene locus_tag LOCUS_45840 20526 21158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 21261 21998 gene locus_tag LOCUS_45850 21261 21998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 23334 22129 gene locus_tag LOCUS_45860 23334 22129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 23789 23571 gene locus_tag LOCUS_45870 23789 23571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 23788 25101 gene locus_tag LOCUS_45880 23788 25101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 26037 25114 gene locus_tag LOCUS_45890 26037 25114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 26014 26217 gene locus_tag LOCUS_45900 26014 26217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 27746 26229 gene locus_tag LOCUS_45910 gene ahcY 27746 26229 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZM1 protein_id gnl|my_center|LOCUS_45910 28254 30242 gene locus_tag LOCUS_45920 28254 30242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 >Feature sequence101 4024 3479 gene locus_tag LOCUS_45930 4024 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 6209 4104 gene locus_tag LOCUS_45940 gene ydcI 6209 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31489 protein_id gnl|my_center|LOCUS_45940 6654 6977 gene locus_tag LOCUS_45950 6654 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 6974 8416 gene locus_tag LOCUS_45960 6974 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 10141 8420 gene locus_tag LOCUS_45970 10141 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 11991 10402 gene locus_tag LOCUS_45980 11991 10402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 13941 12178 gene locus_tag LOCUS_45990 13941 12178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 14171 15319 gene locus_tag LOCUS_46000 gene narK1 14171 15319 CDS product nitrite extrusion protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113773.1 protein_id gnl|my_center|LOCUS_46000 15465 16022 gene locus_tag LOCUS_46010 gene lspA 15465 16022 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK54 protein_id gnl|my_center|LOCUS_46010 16073 17218 gene locus_tag LOCUS_46020 16073 17218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 17315 17845 gene locus_tag LOCUS_46030 gene gloA 17315 17845 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU72 protein_id gnl|my_center|LOCUS_46030 18042 17797 gene locus_tag LOCUS_46040 18042 17797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 18120 18503 gene locus_tag LOCUS_46050 18120 18503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 18805 20883 gene locus_tag LOCUS_46060 18805 20883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 20880 22307 gene locus_tag LOCUS_46070 20880 22307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 22751 22296 gene locus_tag LOCUS_46080 gene fur 22751 22296 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124041.1 protein_id gnl|my_center|LOCUS_46080 22921 24144 gene locus_tag LOCUS_46090 22921 24144 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_46090 24141 24536 gene locus_tag LOCUS_46100 24141 24536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 24577 26817 gene locus_tag LOCUS_46110 24577 26817 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142107.1 protein_id gnl|my_center|LOCUS_46110 28478 26847 gene locus_tag LOCUS_46120 28478 26847 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552128.1 protein_id gnl|my_center|LOCUS_46120 29586 28681 gene locus_tag LOCUS_46130 29586 28681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 30025 29717 gene locus_tag LOCUS_46140 30025 29717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 30993 30337 gene locus_tag LOCUS_46150 30993 30337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 >Feature sequence102 410 69 gene locus_tag LOCUS_46160 410 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 1894 413 gene locus_tag LOCUS_46170 1894 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 4357 1946 gene locus_tag LOCUS_46180 4357 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 5539 4454 gene locus_tag LOCUS_46190 5539 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 6016 5693 gene locus_tag LOCUS_46200 6016 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 7031 6093 gene locus_tag LOCUS_46210 7031 6093 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225603.1 protein_id gnl|my_center|LOCUS_46210 7177 8028 gene locus_tag LOCUS_46220 7177 8028 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971279.1 protein_id gnl|my_center|LOCUS_46220 8382 9191 gene locus_tag LOCUS_46230 8382 9191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 9423 11330 gene locus_tag LOCUS_46240 9423 11330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 11383 12117 gene locus_tag LOCUS_46250 11383 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 12198 12643 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgatcgcaaaagcctacac 14331 13267 gene locus_tag LOCUS_46260 14331 13267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 15499 14372 gene locus_tag LOCUS_46270 15499 14372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 17331 15748 gene locus_tag LOCUS_46280 17331 15748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 21223 17465 gene locus_tag LOCUS_46290 21223 17465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 21441 22064 gene locus_tag LOCUS_46300 21441 22064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 22068 22898 gene locus_tag LOCUS_46310 22068 22898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755956.1 protein_id gnl|my_center|LOCUS_46310 23507 22920 gene locus_tag LOCUS_46320 23507 22920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 24910 23642 gene locus_tag LOCUS_46330 24910 23642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 25640 24939 gene locus_tag LOCUS_46340 25640 24939 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095301.1 protein_id gnl|my_center|LOCUS_46340 27035 25671 gene locus_tag LOCUS_46350 27035 25671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 27796 27275 gene locus_tag LOCUS_46360 27796 27275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 28360 28953 gene locus_tag LOCUS_46370 28360 28953 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_46370 29792 28962 gene locus_tag LOCUS_46380 29792 28962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 30015 30875 gene locus_tag LOCUS_46390 30015 30875 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880855.1 protein_id gnl|my_center|LOCUS_46390 >Feature sequence103 1315 1662 gene locus_tag LOCUS_46400 1315 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 2451 1663 gene locus_tag LOCUS_46410 2451 1663 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_46410 2693 3013 gene locus_tag LOCUS_46420 2693 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 3133 3207 gene locus_tag LOCUS_t00710 3133 3207 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5648 3333 gene locus_tag LOCUS_46430 5648 3333 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937936.1 protein_id gnl|my_center|LOCUS_46430 6087 7082 gene locus_tag LOCUS_46440 gene yeaC 6087 7082 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_46440 9521 7137 gene locus_tag LOCUS_46450 9521 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 10787 9525 gene locus_tag LOCUS_46460 10787 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880980.1 protein_id gnl|my_center|LOCUS_46460 11875 10925 gene locus_tag LOCUS_46470 11875 10925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 13676 11859 gene locus_tag LOCUS_46480 13676 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 14778 13825 gene locus_tag LOCUS_46490 14778 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 14940 16292 gene locus_tag LOCUS_46500 gene mgtE 14940 16292 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F430 protein_id gnl|my_center|LOCUS_46500 16389 17492 gene locus_tag LOCUS_46510 16389 17492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 19848 17536 gene locus_tag LOCUS_46520 19848 17536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 21106 20030 gene locus_tag LOCUS_46530 21106 20030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 21450 22562 gene locus_tag LOCUS_46540 21450 22562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 24378 22717 gene locus_tag LOCUS_46550 24378 22717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 27004 24386 gene locus_tag LOCUS_46560 27004 24386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 27457 27050 gene locus_tag LOCUS_46570 27457 27050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 28859 27450 gene locus_tag LOCUS_46580 28859 27450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 29426 28974 gene locus_tag LOCUS_46590 29426 28974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 29651 30055 gene locus_tag LOCUS_46600 29651 30055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265867.1 protein_id gnl|my_center|LOCUS_46600 30113 30922 gene locus_tag LOCUS_46610 30113 30922 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227999.1 protein_id gnl|my_center|LOCUS_46610 >Feature sequence104 940 521 gene locus_tag LOCUS_46620 940 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 1981 962 gene locus_tag LOCUS_46630 1981 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 2293 2943 gene locus_tag LOCUS_46640 2293 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 3166 4911 gene locus_tag LOCUS_46650 3166 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 5181 6014 gene locus_tag LOCUS_46660 5181 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 6213 6659 gene locus_tag LOCUS_46670 6213 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 6747 7511 gene locus_tag LOCUS_46680 gene recO 6747 7511 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MD78 protein_id gnl|my_center|LOCUS_46680 8289 9362 gene locus_tag LOCUS_46690 gene scrK 8289 9362 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_46690 9450 11153 gene locus_tag LOCUS_46700 9450 11153 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085439.1 protein_id gnl|my_center|LOCUS_46700 11956 11165 gene locus_tag LOCUS_46710 11956 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 13113 11953 gene locus_tag LOCUS_46720 13113 11953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 14822 13296 gene locus_tag LOCUS_46730 14822 13296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 15197 15757 gene locus_tag LOCUS_46740 15197 15757 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480324.1 protein_id gnl|my_center|LOCUS_46740 16322 15738 gene locus_tag LOCUS_46750 16322 15738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 16786 18507 gene locus_tag LOCUS_46760 16786 18507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 18686 19447 gene locus_tag LOCUS_46770 gene salX 18686 19447 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903135.1 protein_id gnl|my_center|LOCUS_46770 19453 20934 gene locus_tag LOCUS_46780 19453 20934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 20977 22008 gene locus_tag LOCUS_46790 20977 22008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_46790 22619 22011 gene locus_tag LOCUS_46800 22619 22011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 23555 22701 gene locus_tag LOCUS_46810 23555 22701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 24440 23775 gene locus_tag LOCUS_46820 24440 23775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259108.1 protein_id gnl|my_center|LOCUS_46820 24751 24437 gene locus_tag LOCUS_46830 gene sdpR 24751 24437 CDS product transcriptional repressor SdpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32242 protein_id gnl|my_center|LOCUS_46830 25025 27091 gene locus_tag LOCUS_46840 25025 27091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 27230 29020 gene locus_tag LOCUS_46850 27230 29020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 29111 30286 gene locus_tag LOCUS_46860 29111 30286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 >Feature sequence105 876 94 gene locus_tag LOCUS_46870 876 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 1191 2249 gene locus_tag LOCUS_46880 1191 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 2425 3354 gene locus_tag LOCUS_46890 2425 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 3351 4205 gene locus_tag LOCUS_46900 3351 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 4341 5651 gene locus_tag LOCUS_46910 4341 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 5746 6879 gene locus_tag LOCUS_46920 5746 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 6892 7866 gene locus_tag LOCUS_46930 6892 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 9073 7985 gene locus_tag LOCUS_46940 9073 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 9579 9217 gene locus_tag LOCUS_46950 9579 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 10400 9936 gene locus_tag LOCUS_46960 10400 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 12320 10599 gene locus_tag LOCUS_46970 gene nuoN-1 12320 10599 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_46970 14276 12456 gene locus_tag LOCUS_46980 gene nuoM-1 14276 12456 CDS product NADH:ubiquinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_46980 16577 14451 gene locus_tag LOCUS_46990 gene nuoL-1 16577 14451 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_46990 17039 16728 gene locus_tag LOCUS_47000 gene nuoK1 17039 16728 CDS product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G98 protein_id gnl|my_center|LOCUS_47000 17918 17118 gene locus_tag LOCUS_47010 17918 17118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 19669 18359 gene locus_tag LOCUS_47020 gene nuoF1 19669 18359 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708730.1 protein_id gnl|my_center|LOCUS_47020 20313 19762 gene locus_tag LOCUS_47030 gene nuoE 20313 19762 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDH5 protein_id gnl|my_center|LOCUS_47030 20926 22674 gene locus_tag LOCUS_47040 20926 22674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 22740 23720 gene locus_tag LOCUS_47050 22740 23720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 23729 25186 gene locus_tag LOCUS_47060 23729 25186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 25170 25967 gene locus_tag LOCUS_47070 25170 25967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 25987 27369 gene locus_tag LOCUS_47080 25987 27369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 27944 27462 gene locus_tag LOCUS_47090 27944 27462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 28494 27985 gene locus_tag LOCUS_47100 28494 27985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 29308 28688 gene locus_tag LOCUS_47110 29308 28688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 30008 30316 gene locus_tag LOCUS_47120 30008 30316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 >Feature sequence106 1170 76 gene locus_tag LOCUS_47130 gene ychF 1170 76 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ1 protein_id gnl|my_center|LOCUS_47130 1478 1876 gene locus_tag LOCUS_47140 1478 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 1882 2886 gene locus_tag LOCUS_47150 1882 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 2883 3611 gene locus_tag LOCUS_47160 2883 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 3657 5117 gene locus_tag LOCUS_47170 3657 5117 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_47170 5163 5585 gene locus_tag LOCUS_47180 5163 5585 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729322.1 protein_id gnl|my_center|LOCUS_47180 5796 7217 gene locus_tag LOCUS_47190 5796 7217 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_47190 7214 9010 gene locus_tag LOCUS_47200 7214 9010 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902775.1 protein_id gnl|my_center|LOCUS_47200 9031 9945 gene locus_tag LOCUS_47210 gene menA 9031 9945 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBE2 protein_id gnl|my_center|LOCUS_47210 9942 12536 gene locus_tag LOCUS_47220 9942 12536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 12643 13617 gene locus_tag LOCUS_47230 12643 13617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 13679 14410 gene locus_tag LOCUS_47240 gene ubiE 13679 14410 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU2 protein_id gnl|my_center|LOCUS_47240 15244 14501 gene locus_tag LOCUS_47250 15244 14501 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460930.1 protein_id gnl|my_center|LOCUS_47250 15381 15731 gene locus_tag LOCUS_47260 15381 15731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 16204 18078 gene locus_tag LOCUS_47270 16204 18078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 19205 18225 gene locus_tag LOCUS_47280 19205 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 21272 19719 gene locus_tag LOCUS_47290 21272 19719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 22539 21379 gene locus_tag LOCUS_47300 22539 21379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 22964 22536 gene locus_tag LOCUS_47310 22964 22536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 24483 23326 gene locus_tag LOCUS_47320 gene metK 24483 23326 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NI05 protein_id gnl|my_center|LOCUS_47320 26051 24651 gene locus_tag LOCUS_47330 gene miaB 26051 24651 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZF8 protein_id gnl|my_center|LOCUS_47330 26696 26337 gene locus_tag LOCUS_47340 26696 26337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 27250 29136 gene locus_tag LOCUS_47350 27250 29136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 29443 30066 gene locus_tag LOCUS_47360 29443 30066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 >Feature sequence107 2079 343 gene locus_tag LOCUS_47370 2079 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 3611 2091 gene locus_tag LOCUS_47380 3611 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 4549 3734 gene locus_tag LOCUS_47390 4549 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 5317 4562 gene locus_tag LOCUS_47400 5317 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 6121 5597 gene locus_tag LOCUS_47410 6121 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 7797 6118 gene locus_tag LOCUS_47420 7797 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 8036 8302 gene locus_tag LOCUS_47430 8036 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 9622 8408 gene locus_tag LOCUS_47440 9622 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 10467 10901 gene locus_tag LOCUS_47450 10467 10901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 17874 11329 gene locus_tag LOCUS_47460 17874 11329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 19298 18375 gene locus_tag LOCUS_47470 19298 18375 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106346.1 protein_id gnl|my_center|LOCUS_47470 22970 19323 gene locus_tag LOCUS_47480 22970 19323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 24012 22993 gene locus_tag LOCUS_47490 24012 22993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098754.1 protein_id gnl|my_center|LOCUS_47490 24240 25793 gene locus_tag LOCUS_47500 24240 25793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 25790 26695 gene locus_tag LOCUS_47510 25790 26695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705118.1 protein_id gnl|my_center|LOCUS_47510 27305 26703 gene locus_tag LOCUS_47520 27305 26703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 27790 27302 gene locus_tag LOCUS_47530 gene rpoE 27790 27302 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_47530 28947 27931 gene locus_tag LOCUS_47540 28947 27931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 >Feature sequence108 3529 1907 gene locus_tag LOCUS_47550 3529 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 3735 5897 gene locus_tag LOCUS_47560 3735 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 6012 6590 gene locus_tag LOCUS_47570 6012 6590 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_47570 6612 7463 gene locus_tag LOCUS_47580 6612 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 8222 7554 gene locus_tag LOCUS_47590 8222 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 8788 8219 gene locus_tag LOCUS_47600 8788 8219 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707772.1 protein_id gnl|my_center|LOCUS_47600 9330 8944 gene locus_tag LOCUS_47610 9330 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706385.1 protein_id gnl|my_center|LOCUS_47610 9591 10769 gene locus_tag LOCUS_47620 9591 10769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 10827 11561 gene locus_tag LOCUS_47630 10827 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 12623 11586 gene locus_tag LOCUS_47640 12623 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 13176 12718 gene locus_tag LOCUS_47650 13176 12718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140128.1 protein_id gnl|my_center|LOCUS_47650 13326 13949 gene locus_tag LOCUS_47660 13326 13949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 15656 13980 gene locus_tag LOCUS_47670 15656 13980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 17219 15993 gene locus_tag LOCUS_47680 17219 15993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 19723 17219 gene locus_tag LOCUS_47690 19723 17219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 20000 20386 gene locus_tag LOCUS_47700 20000 20386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 21887 20484 gene locus_tag LOCUS_47710 21887 20484 CDS product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457553.1 protein_id gnl|my_center|LOCUS_47710 25537 22325 gene locus_tag LOCUS_47720 25537 22325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 26851 26096 gene locus_tag LOCUS_47730 26851 26096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 26979 27482 gene locus_tag LOCUS_47740 gene purE 26979 27482 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIL3 protein_id gnl|my_center|LOCUS_47740 27482 28561 gene locus_tag LOCUS_47750 gene purK 27482 28561 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ3 protein_id gnl|my_center|LOCUS_47750 >Feature sequence109 174 431 gene locus_tag LOCUS_47760 174 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 522 1748 gene locus_tag LOCUS_47770 522 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 1833 2531 gene locus_tag LOCUS_47780 1833 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 3628 2615 gene locus_tag LOCUS_47790 3628 2615 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 protein_id gnl|my_center|LOCUS_47790 3803 4186 gene locus_tag LOCUS_47800 3803 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 4186 4773 gene locus_tag LOCUS_47810 4186 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 6711 4819 gene locus_tag LOCUS_47820 6711 4819 CDS product bifunctional glutathionylspermidine amidase/glutathionylspermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391470.1 protein_id gnl|my_center|LOCUS_47820 6929 7729 gene locus_tag LOCUS_47830 6929 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 8776 10338 gene locus_tag LOCUS_47840 8776 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 10644 11753 gene locus_tag LOCUS_47850 10644 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 11895 12470 gene locus_tag LOCUS_47860 11895 12470 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D77 protein_id gnl|my_center|LOCUS_47860 12659 13507 gene locus_tag LOCUS_47870 12659 13507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 14578 13514 gene locus_tag LOCUS_47880 14578 13514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 15142 14819 gene locus_tag LOCUS_47890 15142 14819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 16574 15414 gene locus_tag LOCUS_47900 16574 15414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 18186 16768 gene locus_tag LOCUS_47910 18186 16768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 19287 18421 gene locus_tag LOCUS_47920 19287 18421 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318655.1 protein_id gnl|my_center|LOCUS_47920 19657 19965 gene locus_tag LOCUS_47930 19657 19965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 20924 19947 gene locus_tag LOCUS_47940 20924 19947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 21010 21381 gene locus_tag LOCUS_47950 21010 21381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 21428 21790 gene locus_tag LOCUS_47960 21428 21790 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142140.1 protein_id gnl|my_center|LOCUS_47960 22022 21861 gene locus_tag LOCUS_47970 22022 21861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 22591 22022 gene locus_tag LOCUS_47980 22591 22022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 23218 22712 gene locus_tag LOCUS_47990 23218 22712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_47990 24654 23488 gene locus_tag LOCUS_48000 gene caiA 24654 23488 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215329.1 protein_id gnl|my_center|LOCUS_48000 24749 25030 gene locus_tag LOCUS_48010 24749 25030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 25035 25826 gene locus_tag LOCUS_48020 25035 25826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 25972 28698 gene locus_tag LOCUS_48030 25972 28698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 >Feature sequence110 530 1384 gene locus_tag LOCUS_48040 530 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100672.1 protein_id gnl|my_center|LOCUS_48040 1667 3955 gene locus_tag LOCUS_48050 1667 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113833.1 protein_id gnl|my_center|LOCUS_48050 4118 9856 gene locus_tag LOCUS_48060 4118 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_48060 9921 11057 gene locus_tag LOCUS_48070 9921 11057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 11105 12208 gene locus_tag LOCUS_48080 11105 12208 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE7 protein_id gnl|my_center|LOCUS_48080 12332 12730 gene locus_tag LOCUS_48090 12332 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 13039 14091 gene locus_tag LOCUS_48100 13039 14091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 14101 14511 gene locus_tag LOCUS_48110 14101 14511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 15476 14670 gene locus_tag LOCUS_48120 15476 14670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 16673 16269 gene locus_tag LOCUS_48130 16673 16269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 16642 18009 gene locus_tag LOCUS_48140 gene pyrC 16642 18009 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NF57 protein_id gnl|my_center|LOCUS_48140 18655 18044 gene locus_tag LOCUS_48150 18655 18044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 18920 19543 gene locus_tag LOCUS_48160 18920 19543 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 protein_id gnl|my_center|LOCUS_48160 20215 19550 gene locus_tag LOCUS_48170 gene perB 20215 19550 CDS product hexapeptide transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 protein_id gnl|my_center|LOCUS_48170 20359 21501 gene locus_tag LOCUS_48180 20359 21501 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868793.1 protein_id gnl|my_center|LOCUS_48180 21572 22780 gene locus_tag LOCUS_48190 21572 22780 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530553.1 protein_id gnl|my_center|LOCUS_48190 23028 24293 gene locus_tag LOCUS_48200 23028 24293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 25534 24287 gene locus_tag LOCUS_48210 25534 24287 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_48210 27192 25519 gene locus_tag LOCUS_48220 27192 25519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027077.1 protein_id gnl|my_center|LOCUS_48220 >Feature sequence111 50 661 gene locus_tag LOCUS_48230 50 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 947 1618 gene locus_tag LOCUS_48240 947 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 1729 2544 gene locus_tag LOCUS_48250 1729 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 2796 5486 gene locus_tag LOCUS_48260 2796 5486 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205369.1 protein_id gnl|my_center|LOCUS_48260 5718 6707 gene locus_tag LOCUS_48270 gene rfbB 5718 6707 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFL8 protein_id gnl|my_center|LOCUS_48270 6807 7526 gene locus_tag LOCUS_48280 6807 7526 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676157.1 protein_id gnl|my_center|LOCUS_48280 7564 8052 gene locus_tag LOCUS_48290 7564 8052 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942724.1 protein_id gnl|my_center|LOCUS_48290 8069 9232 gene locus_tag LOCUS_48300 8069 9232 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039039.1 protein_id gnl|my_center|LOCUS_48300 9237 11102 gene locus_tag LOCUS_48310 9237 11102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_48310 13626 11071 gene locus_tag LOCUS_48320 13626 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 13889 15403 gene locus_tag LOCUS_48330 13889 15403 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107349.1 protein_id gnl|my_center|LOCUS_48330 15396 16085 gene locus_tag LOCUS_48340 15396 16085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 16315 18570 gene locus_tag LOCUS_48350 16315 18570 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_48350 19701 18583 gene locus_tag LOCUS_48360 19701 18583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_48360 20296 19703 gene locus_tag LOCUS_48370 20296 19703 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_48370 21359 20289 gene locus_tag LOCUS_48380 gene wlbA 21359 20289 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_48380 22068 21352 gene locus_tag LOCUS_48390 22068 21352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 22281 22997 gene locus_tag LOCUS_48400 22281 22997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 23474 25510 gene locus_tag LOCUS_48410 23474 25510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 25773 27728 gene locus_tag LOCUS_48420 25773 27728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 >Feature sequence112 210 959 gene locus_tag LOCUS_48430 210 959 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405485.1 protein_id gnl|my_center|LOCUS_48430 2556 1045 gene locus_tag LOCUS_48440 2556 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 2761 3657 gene locus_tag LOCUS_48450 2761 3657 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974445.1 protein_id gnl|my_center|LOCUS_48450 6491 3819 gene locus_tag LOCUS_48460 6491 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 7192 6629 gene locus_tag LOCUS_48470 gene efp 7192 6629 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BH0 protein_id gnl|my_center|LOCUS_48470 7758 7402 gene locus_tag LOCUS_48480 7758 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 10806 8029 gene locus_tag LOCUS_48490 10806 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 12412 11093 gene locus_tag LOCUS_48500 12412 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 12645 13958 gene locus_tag LOCUS_48510 12645 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 14064 16886 gene locus_tag LOCUS_48520 14064 16886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 19721 16965 gene locus_tag LOCUS_48530 19721 16965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 20049 22163 gene locus_tag LOCUS_48540 20049 22163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 22331 22738 gene locus_tag LOCUS_48550 gene kal 22331 22738 CDS product 3-aminobutyryl-CoA ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX1 protein_id gnl|my_center|LOCUS_48550 22751 23569 gene locus_tag LOCUS_48560 gene kce 22751 23569 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX2 protein_id gnl|my_center|LOCUS_48560 23896 24186 gene locus_tag LOCUS_48570 gene hupA 23896 24186 CDS product DNA-binding protein HU 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08821 protein_id gnl|my_center|LOCUS_48570 25922 24333 gene locus_tag LOCUS_48580 gene mviN-1 25922 24333 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938470.1 protein_id gnl|my_center|LOCUS_48580 27081 26050 gene locus_tag LOCUS_48590 27081 26050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 >Feature sequence113 699 460 gene locus_tag LOCUS_48600 699 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 586 2430 gene locus_tag LOCUS_48610 586 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48610 3171 2449 gene locus_tag LOCUS_48620 gene udk 3171 2449 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4Y5 protein_id gnl|my_center|LOCUS_48620 5097 3208 gene locus_tag LOCUS_48630 5097 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 5658 5101 gene locus_tag LOCUS_48640 gene skp 5658 5101 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071793.1 protein_id gnl|my_center|LOCUS_48640 8321 5910 gene locus_tag LOCUS_48650 gene yaeT 8321 5910 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT3 protein_id gnl|my_center|LOCUS_48650 9341 8568 gene locus_tag LOCUS_48660 gene lolD 9341 8568 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT2 protein_id gnl|my_center|LOCUS_48660 11079 9334 gene locus_tag LOCUS_48670 11079 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 12261 11230 gene locus_tag LOCUS_48680 gene prfB 12261 11230 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AS3 protein_id gnl|my_center|LOCUS_48680 14070 12793 gene locus_tag LOCUS_48690 gene eno 14070 12793 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HBF3 protein_id gnl|my_center|LOCUS_48690 14788 14237 gene locus_tag LOCUS_48700 14788 14237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 16085 14796 gene locus_tag LOCUS_48710 16085 14796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 16929 16264 gene locus_tag LOCUS_48720 16929 16264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 19340 16926 gene locus_tag LOCUS_48730 19340 16926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 21494 19503 gene locus_tag LOCUS_48740 21494 19503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 22735 21527 gene locus_tag LOCUS_48750 gene carA 22735 21527 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ6 protein_id gnl|my_center|LOCUS_48750 23763 22831 gene locus_tag LOCUS_48760 gene pyrB 23763 22831 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAR1 protein_id gnl|my_center|LOCUS_48760 24838 23870 gene locus_tag LOCUS_48770 24838 23870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 26916 25093 gene locus_tag LOCUS_48780 gene lepA 26916 25093 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60789 protein_id gnl|my_center|LOCUS_48780 >Feature sequence114 1418 102 gene locus_tag LOCUS_48790 gene tyrS 1418 102 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM14 protein_id gnl|my_center|LOCUS_48790 1770 3047 gene locus_tag LOCUS_48800 1770 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 3067 4308 gene locus_tag LOCUS_48810 3067 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 6069 4318 gene locus_tag LOCUS_48820 gene rny 6069 4318 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E27 protein_id gnl|my_center|LOCUS_48820 7207 6686 gene locus_tag LOCUS_48830 7207 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 7707 7309 gene locus_tag LOCUS_48840 7707 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 8059 7754 gene locus_tag LOCUS_48850 8059 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 8084 8926 gene locus_tag LOCUS_48860 8084 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 9217 10062 gene locus_tag LOCUS_48870 9217 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 10354 12501 gene locus_tag LOCUS_48880 10354 12501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 12532 13482 gene locus_tag LOCUS_48890 12532 13482 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986927.1 protein_id gnl|my_center|LOCUS_48890 13604 13419 gene locus_tag LOCUS_48900 13604 13419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 13702 14439 gene locus_tag LOCUS_48910 13702 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 15869 14577 gene locus_tag LOCUS_48920 15869 14577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 19360 15896 gene locus_tag LOCUS_48930 19360 15896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 23897 19455 gene locus_tag LOCUS_48940 23897 19455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 23989 25242 gene locus_tag LOCUS_48950 23989 25242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 25400 27025 gene locus_tag LOCUS_48960 25400 27025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 >Feature sequence115 493 1593 gene locus_tag LOCUS_48970 gene truD 493 1593 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI49 protein_id gnl|my_center|LOCUS_48970 1660 4380 gene locus_tag LOCUS_48980 1660 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 4604 7237 gene locus_tag LOCUS_48990 4604 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 7377 8573 gene locus_tag LOCUS_49000 7377 8573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 9218 8577 gene locus_tag LOCUS_49010 gene ymaB 9218 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50619 protein_id gnl|my_center|LOCUS_49010 11115 9709 gene locus_tag LOCUS_49020 11115 9709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 12747 11161 gene locus_tag LOCUS_49030 12747 11161 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_49030 13250 14551 gene locus_tag LOCUS_49040 13250 14551 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAX0 protein_id gnl|my_center|LOCUS_49040 16347 14554 gene locus_tag LOCUS_49050 gene dfrA 16347 14554 CDS product bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208109.1 protein_id gnl|my_center|LOCUS_49050 17019 16450 gene locus_tag LOCUS_49060 17019 16450 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230163.1 protein_id gnl|my_center|LOCUS_49060 18236 17307 gene locus_tag LOCUS_49070 18236 17307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 19125 18355 gene locus_tag LOCUS_49080 19125 18355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 21317 19128 gene locus_tag LOCUS_49090 21317 19128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 21608 22018 gene locus_tag LOCUS_49100 gene mceE 21608 22018 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_49100 22621 22031 gene locus_tag LOCUS_49110 22621 22031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_49110 23349 22627 gene locus_tag LOCUS_49120 23349 22627 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BAA9 protein_id gnl|my_center|LOCUS_49120 23786 25837 gene locus_tag LOCUS_49130 23786 25837 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_49130 >Feature sequence116 361 128 gene locus_tag LOCUS_49140 361 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 1876 452 gene locus_tag LOCUS_49150 1876 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 2031 4697 gene locus_tag LOCUS_49160 2031 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 5552 4659 gene locus_tag LOCUS_49170 5552 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 7329 5653 gene locus_tag LOCUS_49180 7329 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 8888 7446 gene locus_tag LOCUS_49190 8888 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 9610 8885 gene locus_tag LOCUS_49200 9610 8885 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_49200 12674 9612 gene locus_tag LOCUS_49210 12674 9612 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_49210 13789 12683 gene locus_tag LOCUS_49220 13789 12683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 15060 13786 gene locus_tag LOCUS_49230 15060 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 15285 17774 gene locus_tag LOCUS_49240 15285 17774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 18280 17762 gene locus_tag LOCUS_49250 18280 17762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404126.1 protein_id gnl|my_center|LOCUS_49250 18555 18950 gene locus_tag LOCUS_49260 18555 18950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 18947 20293 gene locus_tag LOCUS_49270 18947 20293 CDS product GDL motif peptide-associated radical SAM/SPASM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200682.1 protein_id gnl|my_center|LOCUS_49270 20914 20300 gene locus_tag LOCUS_49280 20914 20300 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403546.1 protein_id gnl|my_center|LOCUS_49280 22638 21106 gene locus_tag LOCUS_49290 22638 21106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 23252 22635 gene locus_tag LOCUS_49300 23252 22635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 23619 23254 gene locus_tag LOCUS_49310 23619 23254 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095875.1 protein_id gnl|my_center|LOCUS_49310 23857 24237 gene locus_tag LOCUS_49320 23857 24237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 24271 25092 gene locus_tag LOCUS_49330 24271 25092 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811895.1 protein_id gnl|my_center|LOCUS_49330 25159 25302 gene locus_tag LOCUS_49340 25159 25302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 >Feature sequence117 1573 89 gene locus_tag LOCUS_49350 1573 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 2781 1654 gene locus_tag LOCUS_49360 2781 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 3208 4116 gene locus_tag LOCUS_49370 3208 4116 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938239.1 protein_id gnl|my_center|LOCUS_49370 4223 4798 gene locus_tag LOCUS_49380 4223 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 5037 5110 gene locus_tag LOCUS_t00720 5037 5110 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5753 5169 gene locus_tag LOCUS_49390 5753 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 5982 7508 gene locus_tag LOCUS_49400 5982 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 8824 7517 gene locus_tag LOCUS_49410 8824 7517 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225960.1 protein_id gnl|my_center|LOCUS_49410 9975 8821 gene locus_tag LOCUS_49420 9975 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 11191 10052 gene locus_tag LOCUS_49430 11191 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 11426 11499 gene locus_tag LOCUS_t00730 11426 11499 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11982 12356 gene locus_tag LOCUS_49440 11982 12356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 12484 13338 gene locus_tag LOCUS_49450 gene srtN 12484 13338 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943708.1 protein_id gnl|my_center|LOCUS_49450 14175 13360 gene locus_tag LOCUS_49460 14175 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 14371 15153 gene locus_tag LOCUS_49470 14371 15153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 17031 15163 gene locus_tag LOCUS_49480 17031 15163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 17422 19446 gene locus_tag LOCUS_49490 17422 19446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 19457 20809 gene locus_tag LOCUS_49500 19457 20809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122547.1 protein_id gnl|my_center|LOCUS_49500 21016 25305 gene locus_tag LOCUS_49510 21016 25305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 >Feature sequence118 1169 441 gene locus_tag LOCUS_49520 1169 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 1328 2470 gene locus_tag LOCUS_49530 gene queA 1328 2470 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67043 protein_id gnl|my_center|LOCUS_49530 2467 3612 gene locus_tag LOCUS_49540 gene tgt-2 2467 3612 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X3 protein_id gnl|my_center|LOCUS_49540 3786 4214 gene locus_tag LOCUS_49550 3786 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 4302 6095 gene locus_tag LOCUS_49560 gene secD 4302 6095 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X5 protein_id gnl|my_center|LOCUS_49560 6271 7485 gene locus_tag LOCUS_49570 6271 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 7713 9644 gene locus_tag LOCUS_49580 gene recJ 7713 9644 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_49580 9699 9971 gene locus_tag LOCUS_49590 9699 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 11196 9949 gene locus_tag LOCUS_49600 11196 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 14465 11625 gene locus_tag LOCUS_49610 14465 11625 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6Y6 protein_id gnl|my_center|LOCUS_49610 18304 14462 gene locus_tag LOCUS_49620 18304 14462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 19575 18475 gene locus_tag LOCUS_49630 19575 18475 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_49630 20660 19572 gene locus_tag LOCUS_49640 20660 19572 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_49640 22070 20718 gene locus_tag LOCUS_49650 22070 20718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 22998 22084 gene locus_tag LOCUS_49660 gene oppB 22998 22084 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816417.1 protein_id gnl|my_center|LOCUS_49660 22961 23167 gene locus_tag LOCUS_49670 22961 23167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 24944 23238 gene locus_tag LOCUS_49680 24944 23238 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920793.1 protein_id gnl|my_center|LOCUS_49680 >Feature sequence119 123 1850 gene locus_tag LOCUS_49690 123 1850 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 protein_id gnl|my_center|LOCUS_49690 1847 4576 gene locus_tag LOCUS_49700 1847 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 4685 5605 gene locus_tag LOCUS_49710 4685 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 6455 5613 gene locus_tag LOCUS_49720 6455 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 6901 7830 gene locus_tag LOCUS_49730 6901 7830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 7964 9481 gene locus_tag LOCUS_49740 7964 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 11610 9643 gene locus_tag LOCUS_49750 gene argS 11610 9643 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 protein_id gnl|my_center|LOCUS_49750 16618 11900 gene locus_tag LOCUS_49760 16618 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 16967 17335 gene locus_tag LOCUS_49770 16967 17335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 17925 17431 gene locus_tag LOCUS_49780 17925 17431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 19103 18165 gene locus_tag LOCUS_49790 19103 18165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918456.1 protein_id gnl|my_center|LOCUS_49790 20122 19100 gene locus_tag LOCUS_49800 20122 19100 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918455.1 protein_id gnl|my_center|LOCUS_49800 21438 20119 gene locus_tag LOCUS_49810 21438 20119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918454.1 protein_id gnl|my_center|LOCUS_49810 22432 21476 gene locus_tag LOCUS_49820 22432 21476 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918453.1 protein_id gnl|my_center|LOCUS_49820 23693 22422 gene locus_tag LOCUS_49830 23693 22422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 >Feature sequence120 1724 51 gene locus_tag LOCUS_49840 1724 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_49840 1958 2647 gene locus_tag LOCUS_49850 1958 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 2859 4646 gene locus_tag LOCUS_49860 2859 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 4979 6370 gene locus_tag LOCUS_49870 4979 6370 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_49870 6482 7765 gene locus_tag LOCUS_49880 6482 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 7878 9209 gene locus_tag LOCUS_49890 7878 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 12317 9381 gene locus_tag LOCUS_49900 12317 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 12476 13423 gene locus_tag LOCUS_49910 12476 13423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 13531 14841 gene locus_tag LOCUS_49920 13531 14841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 17698 14849 gene locus_tag LOCUS_49930 17698 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 18053 17703 gene locus_tag LOCUS_49940 18053 17703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 18473 20131 gene locus_tag LOCUS_49950 18473 20131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 20388 20203 gene locus_tag LOCUS_49960 20388 20203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 20353 21033 gene locus_tag LOCUS_49970 20353 21033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 21030 21251 gene locus_tag LOCUS_49980 21030 21251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 21402 21557 gene locus_tag LOCUS_49990 gene rpmG 21402 21557 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57187 protein_id gnl|my_center|LOCUS_49990 21738 21980 gene locus_tag LOCUS_50000 gene rpsR 21738 21980 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CDN0 protein_id gnl|my_center|LOCUS_50000 22333 24090 gene locus_tag LOCUS_50010 22333 24090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 >Feature sequence121 206 700 gene locus_tag LOCUS_50020 206 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 890 693 gene locus_tag LOCUS_50030 890 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 1819 1130 gene locus_tag LOCUS_50040 1819 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 2750 1884 gene locus_tag LOCUS_50050 2750 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 3232 4212 gene locus_tag LOCUS_50060 3232 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 4221 5117 gene locus_tag LOCUS_50070 4221 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 6579 6145 gene locus_tag LOCUS_50080 6579 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 7374 9332 gene locus_tag LOCUS_50090 7374 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 9476 9213 gene locus_tag LOCUS_50100 9476 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 9640 9476 gene locus_tag LOCUS_50110 9640 9476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 10548 11303 gene locus_tag LOCUS_50120 10548 11303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 11339 12799 gene locus_tag LOCUS_50130 11339 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 13012 12836 gene locus_tag LOCUS_50140 13012 12836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 13478 13149 gene locus_tag LOCUS_50150 13478 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 14621 13575 gene locus_tag LOCUS_50160 14621 13575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 15705 14680 gene locus_tag LOCUS_50170 15705 14680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 16980 16069 gene locus_tag LOCUS_50180 16980 16069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 17566 17291 gene locus_tag LOCUS_50190 17566 17291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 17956 19320 gene locus_tag LOCUS_50200 17956 19320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 19514 20596 gene locus_tag LOCUS_50210 gene yqiG 19514 20596 CDS product putative NADH-dependent flavin oxidoreductase YqiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54524 protein_id gnl|my_center|LOCUS_50210 21600 20635 gene locus_tag LOCUS_50220 21600 20635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084260.1 protein_id gnl|my_center|LOCUS_50220 22094 21915 gene locus_tag LOCUS_50230 22094 21915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 22175 23464 gene locus_tag LOCUS_50240 22175 23464 CDS product L-gulono-1,4-lactone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIT3 protein_id gnl|my_center|LOCUS_50240 23550 23711 gene locus_tag LOCUS_50250 23550 23711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 >Feature sequence122 4751 879 gene locus_tag LOCUS_50260 4751 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 4968 6341 gene locus_tag LOCUS_50270 4968 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 6777 7847 gene locus_tag LOCUS_50280 6777 7847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 10156 7961 gene locus_tag LOCUS_50290 10156 7961 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_50290 11512 10427 gene locus_tag LOCUS_50300 11512 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 11803 13539 gene locus_tag LOCUS_50310 11803 13539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 13644 14672 gene locus_tag LOCUS_50320 13644 14672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 14772 15839 gene locus_tag LOCUS_50330 14772 15839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 16099 18033 gene locus_tag LOCUS_50340 16099 18033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_50340 18034 18870 gene locus_tag LOCUS_50350 18034 18870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 19602 18907 gene locus_tag LOCUS_50360 19602 18907 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_50360 19671 22928 gene locus_tag LOCUS_50370 19671 22928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 >Feature sequence123 1713 421 gene locus_tag LOCUS_50380 1713 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 1887 2795 gene locus_tag LOCUS_50390 1887 2795 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_50390 4338 2770 gene locus_tag LOCUS_50400 4338 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 4847 4335 gene locus_tag LOCUS_50410 4847 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 6223 4871 gene locus_tag LOCUS_50420 6223 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 6435 8135 gene locus_tag LOCUS_50430 6435 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 8179 8850 gene locus_tag LOCUS_50440 8179 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 10179 8929 gene locus_tag LOCUS_50450 10179 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 11860 10250 gene locus_tag LOCUS_50460 11860 10250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 13115 12213 gene locus_tag LOCUS_50470 13115 12213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 13453 13965 gene locus_tag LOCUS_50480 13453 13965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 14894 14124 gene locus_tag LOCUS_50490 14894 14124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 16213 14882 gene locus_tag LOCUS_50500 16213 14882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 16477 16977 gene locus_tag LOCUS_50510 16477 16977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 17022 19928 gene locus_tag LOCUS_50520 17022 19928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 20026 21381 gene locus_tag LOCUS_50530 20026 21381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 22188 21397 gene locus_tag LOCUS_50540 22188 21397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50540 22678 22349 gene locus_tag LOCUS_50550 22678 22349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 >Feature sequence124 869 1675 gene locus_tag LOCUS_50560 869 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 1826 2866 gene locus_tag LOCUS_50570 gene mreB-1 1826 2866 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_50570 2913 3773 gene locus_tag LOCUS_50580 2913 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 3774 4292 gene locus_tag LOCUS_50590 3774 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 4285 6399 gene locus_tag LOCUS_50600 gene mrdA 4285 6399 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_50600 6392 7519 gene locus_tag LOCUS_50610 gene rodA 6392 7519 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_50610 8454 7516 gene locus_tag LOCUS_50620 8454 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 8826 8458 gene locus_tag LOCUS_50630 gene trx 8826 8458 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6A2 protein_id gnl|my_center|LOCUS_50630 8936 10588 gene locus_tag LOCUS_50640 8936 10588 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775830.1 protein_id gnl|my_center|LOCUS_50640 10797 11660 gene locus_tag LOCUS_50650 10797 11660 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404058.1 protein_id gnl|my_center|LOCUS_50650 11739 13040 gene locus_tag LOCUS_50660 11739 13040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 13479 13135 gene locus_tag LOCUS_50670 13479 13135 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808431.1 protein_id gnl|my_center|LOCUS_50670 13661 14971 gene locus_tag LOCUS_50680 13661 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 15111 15449 gene locus_tag LOCUS_50690 15111 15449 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941509.1 protein_id gnl|my_center|LOCUS_50690 16375 15446 gene locus_tag LOCUS_50700 16375 15446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 17611 16553 gene locus_tag LOCUS_50710 17611 16553 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224399.1 protein_id gnl|my_center|LOCUS_50710 18851 17709 gene locus_tag LOCUS_50720 gene purT 18851 17709 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWZ4 protein_id gnl|my_center|LOCUS_50720 20559 19027 gene locus_tag LOCUS_50730 20559 19027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 >Feature sequence125 1 726 gene locus_tag LOCUS_50740 1 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 756 1775 gene locus_tag LOCUS_50750 756 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 2018 3826 gene locus_tag LOCUS_50760 2018 3826 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_50760 4002 4496 gene locus_tag LOCUS_50770 4002 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 4509 6308 gene locus_tag LOCUS_50780 4509 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 6800 6333 gene locus_tag LOCUS_50790 6800 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 7076 6873 gene locus_tag LOCUS_50800 7076 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 7248 8093 gene locus_tag LOCUS_50810 7248 8093 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_50810 8687 8097 gene locus_tag LOCUS_50820 8687 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 9093 8701 gene locus_tag LOCUS_50830 9093 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 9270 10514 gene locus_tag LOCUS_50840 9270 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 12142 10607 gene locus_tag LOCUS_50850 12142 10607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 13466 12948 gene locus_tag LOCUS_50860 13466 12948 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_50860 13756 13472 gene locus_tag LOCUS_50870 13756 13472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 15794 13812 gene locus_tag LOCUS_50880 15794 13812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 16350 15856 gene locus_tag LOCUS_50890 16350 15856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 18642 16420 gene locus_tag LOCUS_50900 18642 16420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 20540 18810 gene locus_tag LOCUS_50910 20540 18810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 21203 20613 gene locus_tag LOCUS_50920 gene hpt 21203 20613 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_50920 21883 21323 gene locus_tag LOCUS_50930 gene tdk 21883 21323 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G4 protein_id gnl|my_center|LOCUS_50930 22633 22007 gene locus_tag LOCUS_50940 22633 22007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 >Feature sequence126 1032 3668 gene locus_tag LOCUS_50950 1032 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 3771 5426 gene locus_tag LOCUS_50960 3771 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 6192 5518 gene locus_tag LOCUS_50970 6192 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 7272 6523 gene locus_tag LOCUS_50980 7272 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 7659 9560 gene locus_tag LOCUS_50990 7659 9560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783199.1 protein_id gnl|my_center|LOCUS_50990 9598 10851 gene locus_tag LOCUS_51000 9598 10851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 11750 11073 gene locus_tag LOCUS_51010 11750 11073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180345.1 protein_id gnl|my_center|LOCUS_51010 12578 11832 gene locus_tag LOCUS_51020 12578 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 13463 12660 gene locus_tag LOCUS_51030 13463 12660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 15503 13797 gene locus_tag LOCUS_51040 15503 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 16020 15643 gene locus_tag LOCUS_51050 16020 15643 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918475.1 protein_id gnl|my_center|LOCUS_51050 17246 16107 gene locus_tag LOCUS_51060 17246 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 17569 19509 gene locus_tag LOCUS_51070 17569 19509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 19600 20553 gene locus_tag LOCUS_51080 19600 20553 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122378.1 protein_id gnl|my_center|LOCUS_51080 20873 21607 gene locus_tag LOCUS_51090 20873 21607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 >Feature sequence127 675 382 gene locus_tag LOCUS_51100 675 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 953 672 gene locus_tag LOCUS_51110 953 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 2557 1181 gene locus_tag LOCUS_51120 2557 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 2671 3144 gene locus_tag LOCUS_51130 2671 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119866.1 protein_id gnl|my_center|LOCUS_51130 4427 3141 gene locus_tag LOCUS_51140 4427 3141 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 protein_id gnl|my_center|LOCUS_51140 5746 4427 gene locus_tag LOCUS_51150 5746 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140776.1 protein_id gnl|my_center|LOCUS_51150 6783 5743 gene locus_tag LOCUS_51160 6783 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 7487 6780 gene locus_tag LOCUS_51170 7487 6780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609099.1 protein_id gnl|my_center|LOCUS_51170 8809 7484 gene locus_tag LOCUS_51180 8809 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103137.1 protein_id gnl|my_center|LOCUS_51180 9213 10304 gene locus_tag LOCUS_51190 9213 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 11411 10320 gene locus_tag LOCUS_51200 gene mtnA 11411 10320 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X013 protein_id gnl|my_center|LOCUS_51200 12124 11495 gene locus_tag LOCUS_51210 gene ribE 12124 11495 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809002.1 protein_id gnl|my_center|LOCUS_51210 13586 12147 gene locus_tag LOCUS_51220 gene gatB 13586 12147 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61343 protein_id gnl|my_center|LOCUS_51220 15095 13659 gene locus_tag LOCUS_51230 gene gatA 15095 13659 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGY4 protein_id gnl|my_center|LOCUS_51230 15449 15156 gene locus_tag LOCUS_51240 gene gatC 15449 15156 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHS7 protein_id gnl|my_center|LOCUS_51240 15725 16489 gene locus_tag LOCUS_51250 15725 16489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51250 17810 16635 gene locus_tag LOCUS_51260 17810 16635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 19292 18066 gene locus_tag LOCUS_51270 19292 18066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 20809 19304 gene locus_tag LOCUS_51280 20809 19304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 >Feature sequence128 101 1594 gene locus_tag LOCUS_51290 101 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 1557 2402 gene locus_tag LOCUS_51300 1557 2402 CDS product PHP-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_51300 2770 3183 gene locus_tag LOCUS_51310 2770 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 3159 4064 gene locus_tag LOCUS_51320 3159 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 4174 5049 gene locus_tag LOCUS_51330 4174 5049 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941890.1 protein_id gnl|my_center|LOCUS_51330 5155 6810 gene locus_tag LOCUS_51340 5155 6810 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941480.1 protein_id gnl|my_center|LOCUS_51340 7002 7661 gene locus_tag LOCUS_51350 7002 7661 CDS product organic solvent tolerance ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 protein_id gnl|my_center|LOCUS_51350 9124 7790 gene locus_tag LOCUS_51360 9124 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 11266 9191 gene locus_tag LOCUS_51370 11266 9191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 12875 11709 gene locus_tag LOCUS_51380 12875 11709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_51380 14003 12942 gene locus_tag LOCUS_51390 14003 12942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 protein_id gnl|my_center|LOCUS_51390 15342 14086 gene locus_tag LOCUS_51400 15342 14086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 16929 15427 gene locus_tag LOCUS_51410 16929 15427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 19002 17035 gene locus_tag LOCUS_51420 19002 17035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 21404 19575 gene locus_tag LOCUS_51430 gene aspS 21404 19575 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D56 protein_id gnl|my_center|LOCUS_51430 >Feature sequence129 <1 1298 gene locus_tag LOCUS_51440 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001208365.1:gamma-glutamyl carboxylase 1364 3619 gene locus_tag LOCUS_51450 1364 3619 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_51450 7225 3644 gene locus_tag LOCUS_51460 7225 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 7357 8802 gene locus_tag LOCUS_51470 7357 8802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 11760 8881 gene locus_tag LOCUS_51480 11760 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 13093 11894 gene locus_tag LOCUS_51490 13093 11894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 13390 13761 gene locus_tag LOCUS_51500 13390 13761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 14200 13874 gene locus_tag LOCUS_51510 gene fbp 14200 13874 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63J95 protein_id gnl|my_center|LOCUS_51510 14805 14251 gene locus_tag LOCUS_51520 gene folE 14805 14251 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVD0 protein_id gnl|my_center|LOCUS_51520 15479 14907 gene locus_tag LOCUS_51530 15479 14907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 16378 15518 gene locus_tag LOCUS_51540 16378 15518 CDS product aromatic amino acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258653.1 protein_id gnl|my_center|LOCUS_51540 16618 17526 gene locus_tag LOCUS_51550 16618 17526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 17561 18946 gene locus_tag LOCUS_51560 gene kmo 17561 18946 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD3 protein_id gnl|my_center|LOCUS_51560 18936 19592 gene locus_tag LOCUS_51570 18936 19592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105994.1 protein_id gnl|my_center|LOCUS_51570 19656 21305 gene locus_tag LOCUS_51580 19656 21305 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097447.1 protein_id gnl|my_center|LOCUS_51580 >Feature sequence130 1535 78 gene locus_tag LOCUS_51590 1535 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 2033 3139 gene locus_tag LOCUS_51600 2033 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 3725 3144 gene locus_tag LOCUS_51610 3725 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 4391 3891 gene locus_tag LOCUS_51620 4391 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 4729 5043 gene locus_tag LOCUS_51630 4729 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 5190 7451 gene locus_tag LOCUS_51640 5190 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 8273 7479 gene locus_tag LOCUS_51650 gene trpA 8273 7479 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM0 protein_id gnl|my_center|LOCUS_51650 9469 8270 gene locus_tag LOCUS_51660 9469 8270 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867583.1 protein_id gnl|my_center|LOCUS_51660 9949 9497 gene locus_tag LOCUS_51670 9949 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 11956 10226 gene locus_tag LOCUS_51680 11956 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 12220 13161 gene locus_tag LOCUS_51690 12220 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 13158 13997 gene locus_tag LOCUS_51700 13158 13997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 15872 14007 gene locus_tag LOCUS_51710 gene fadD 15872 14007 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_51710 17042 15912 gene locus_tag LOCUS_51720 17042 15912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 17305 16979 gene locus_tag LOCUS_51730 17305 16979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 17702 21499 gene locus_tag LOCUS_51740 17702 21499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 >Feature sequence131 1116 70 gene locus_tag LOCUS_51750 1116 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 1774 1175 gene locus_tag LOCUS_51760 1774 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 3348 1795 gene locus_tag LOCUS_51770 3348 1795 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_51770 3937 3527 gene locus_tag LOCUS_51780 3937 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 4725 4132 gene locus_tag LOCUS_51790 4725 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 6578 4761 gene locus_tag LOCUS_51800 6578 4761 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763446.1 protein_id gnl|my_center|LOCUS_51800 6887 8737 gene locus_tag LOCUS_51810 gene acd 6887 8737 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970940.1 protein_id gnl|my_center|LOCUS_51810 9039 10040 gene locus_tag LOCUS_51820 9039 10040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 12189 10135 gene locus_tag LOCUS_51830 12189 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 13722 12250 gene locus_tag LOCUS_51840 13722 12250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 16283 13866 gene locus_tag LOCUS_51850 16283 13866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 19525 16829 gene locus_tag LOCUS_51860 19525 16829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 >Feature sequence132 75 980 gene locus_tag LOCUS_51870 75 980 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 protein_id gnl|my_center|LOCUS_51870 985 1506 gene locus_tag LOCUS_51880 985 1506 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124477.1 protein_id gnl|my_center|LOCUS_51880 2674 1529 gene locus_tag LOCUS_51890 2674 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 2971 4704 gene locus_tag LOCUS_51900 2971 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 4796 6508 gene locus_tag LOCUS_51910 4796 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 10149 6754 gene locus_tag LOCUS_51920 10149 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 11207 10392 gene locus_tag LOCUS_51930 11207 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 12126 11245 gene locus_tag LOCUS_51940 12126 11245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 12845 12219 gene locus_tag LOCUS_51950 12845 12219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 15212 12960 gene locus_tag LOCUS_51960 15212 12960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 15508 15837 gene locus_tag LOCUS_51970 15508 15837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 15980 17155 gene locus_tag LOCUS_51980 15980 17155 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_51980 17330 20218 gene locus_tag LOCUS_51990 gene gcvP 17330 20218 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 protein_id gnl|my_center|LOCUS_51990 >Feature sequence133 379 1389 gene locus_tag LOCUS_52000 gene adhP 379 1389 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_52000 2444 1398 gene locus_tag LOCUS_52010 2444 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 2688 3800 gene locus_tag LOCUS_52020 gene pfkA 2688 3800 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0R4 protein_id gnl|my_center|LOCUS_52020 4963 3977 gene locus_tag LOCUS_52030 4963 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 6316 4994 gene locus_tag LOCUS_52040 6316 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 7277 6450 gene locus_tag LOCUS_52050 7277 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 9607 7406 gene locus_tag LOCUS_52060 9607 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 9860 10417 gene locus_tag LOCUS_52070 9860 10417 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545477.1 protein_id gnl|my_center|LOCUS_52070 10646 12562 gene locus_tag LOCUS_52080 10646 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 12581 13378 gene locus_tag LOCUS_52090 12581 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 13741 13403 gene locus_tag LOCUS_52100 13741 13403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 14846 13923 gene locus_tag LOCUS_52110 14846 13923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 15136 14843 gene locus_tag LOCUS_52120 15136 14843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 15237 15833 gene locus_tag LOCUS_52130 15237 15833 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406744.1 protein_id gnl|my_center|LOCUS_52130 15889 16794 gene locus_tag LOCUS_52140 15889 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 19086 17086 gene locus_tag LOCUS_52150 19086 17086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 19966 19451 gene locus_tag LOCUS_52160 19966 19451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 >Feature sequence134 1455 712 gene locus_tag LOCUS_52170 1455 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 2414 1467 gene locus_tag LOCUS_52180 2414 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 3374 2430 gene locus_tag LOCUS_52190 3374 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 3637 4572 gene locus_tag LOCUS_52200 3637 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 4759 5532 gene locus_tag LOCUS_52210 4759 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 5619 6650 gene locus_tag LOCUS_52220 5619 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 8632 6668 gene locus_tag LOCUS_52230 gene mcpA 8632 6668 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036903.1 protein_id gnl|my_center|LOCUS_52230 8923 9975 gene locus_tag LOCUS_52240 8923 9975 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143449.1 protein_id gnl|my_center|LOCUS_52240 12031 10154 gene locus_tag LOCUS_52250 12031 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 12591 13742 gene locus_tag LOCUS_52260 12591 13742 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836560.1 protein_id gnl|my_center|LOCUS_52260 14532 13747 gene locus_tag LOCUS_52270 14532 13747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 14833 15864 gene locus_tag LOCUS_52280 14833 15864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 16003 16737 gene locus_tag LOCUS_52290 16003 16737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 16787 17512 gene locus_tag LOCUS_52300 16787 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 17573 18307 gene locus_tag LOCUS_52310 17573 18307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 19703 18387 gene locus_tag LOCUS_52320 gene hmgA 19703 18387 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M930 protein_id gnl|my_center|LOCUS_52320 20188 19997 gene locus_tag LOCUS_52330 20188 19997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 >Feature sequence135 1258 275 gene locus_tag LOCUS_52340 1258 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 2224 1421 gene locus_tag LOCUS_52350 gene hmuV 2224 1421 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKQ4 protein_id gnl|my_center|LOCUS_52350 3285 2221 gene locus_tag LOCUS_52360 gene hemU 3285 2221 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175607.1 protein_id gnl|my_center|LOCUS_52360 4348 3290 gene locus_tag LOCUS_52370 4348 3290 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249816.1 protein_id gnl|my_center|LOCUS_52370 4504 5721 gene locus_tag LOCUS_52380 4504 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 7254 5725 gene locus_tag LOCUS_52390 gene hflX 7254 5725 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFQ8 protein_id gnl|my_center|LOCUS_52390 9313 7424 gene locus_tag LOCUS_52400 9313 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 9551 10411 gene locus_tag LOCUS_52410 9551 10411 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524880.1 protein_id gnl|my_center|LOCUS_52410 10513 11256 gene locus_tag LOCUS_52420 10513 11256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 12604 11870 gene locus_tag LOCUS_52430 12604 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938748.1 protein_id gnl|my_center|LOCUS_52430 12985 12912 gene locus_tag LOCUS_t00740 12985 12912 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14980 13199 gene locus_tag LOCUS_52440 gene rpoD 14980 13199 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B8 protein_id gnl|my_center|LOCUS_52440 17050 15185 gene locus_tag LOCUS_52450 17050 15185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 18229 17234 gene locus_tag LOCUS_52460 18229 17234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 18408 19511 gene locus_tag LOCUS_52470 18408 19511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 >Feature sequence136 572 141 gene locus_tag LOCUS_52480 572 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 1619 579 gene locus_tag LOCUS_52490 gene holA 1619 579 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_52490 2037 1597 gene locus_tag LOCUS_52500 2037 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 2355 3440 gene locus_tag LOCUS_52510 2355 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 3661 3930 gene locus_tag LOCUS_52520 gene rpsT 3661 3930 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AZ3 protein_id gnl|my_center|LOCUS_52520 4341 4138 gene locus_tag LOCUS_52530 4341 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 4326 6299 gene locus_tag LOCUS_52540 gene ftsH-1 4326 6299 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG41 protein_id gnl|my_center|LOCUS_52540 6296 7141 gene locus_tag LOCUS_52550 6296 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 7241 7609 gene locus_tag LOCUS_52560 7241 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 10070 7737 gene locus_tag LOCUS_52570 10070 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 10026 10358 gene locus_tag LOCUS_52580 10026 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 10580 10885 gene locus_tag LOCUS_52590 gene yhbY 10580 10885 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941918.1 protein_id gnl|my_center|LOCUS_52590 11072 11707 gene locus_tag LOCUS_52600 gene yrdC 11072 11707 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_52600 12170 11808 gene locus_tag LOCUS_52610 12170 11808 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085073.1 protein_id gnl|my_center|LOCUS_52610 14333 12300 gene locus_tag LOCUS_52620 14333 12300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 16093 14543 gene locus_tag LOCUS_52630 16093 14543 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390732.1 protein_id gnl|my_center|LOCUS_52630 17331 16090 gene locus_tag LOCUS_52640 17331 16090 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_52640 18505 17366 gene locus_tag LOCUS_52650 gene crtC 18505 17366 CDS product hydroxyneurosporene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F723 protein_id gnl|my_center|LOCUS_52650 >Feature sequence137 866 36 gene locus_tag LOCUS_52660 gene dpnIIB 866 36 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H7D2 protein_id gnl|my_center|LOCUS_52660 1331 2512 gene locus_tag LOCUS_52670 1331 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 2778 4646 gene locus_tag LOCUS_52680 2778 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 4888 7077 gene locus_tag LOCUS_52690 4888 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 8649 7099 gene locus_tag LOCUS_52700 gene degP 8649 7099 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_52700 9237 11906 gene locus_tag LOCUS_52710 gene mutS2 9237 11906 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHS6 protein_id gnl|my_center|LOCUS_52710 13550 12054 gene locus_tag LOCUS_52720 13550 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 15120 13543 gene locus_tag LOCUS_52730 15120 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 17219 15261 gene locus_tag LOCUS_52740 17219 15261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 18649 17237 gene locus_tag LOCUS_52750 18649 17237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 >Feature sequence138 2432 27 gene locus_tag LOCUS_52760 2432 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 3120 2578 gene locus_tag LOCUS_52770 3120 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 3119 3310 gene locus_tag LOCUS_52780 3119 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 4574 3255 gene locus_tag LOCUS_52790 4574 3255 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405015.1 protein_id gnl|my_center|LOCUS_52790 5364 4576 gene locus_tag LOCUS_52800 5364 4576 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938841.1 protein_id gnl|my_center|LOCUS_52800 6075 5467 gene locus_tag LOCUS_52810 6075 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 6322 7782 gene locus_tag LOCUS_52820 6322 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 10064 7785 gene locus_tag LOCUS_52830 10064 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089325.1 protein_id gnl|my_center|LOCUS_52830 10261 12312 gene locus_tag LOCUS_52840 10261 12312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 12406 14529 gene locus_tag LOCUS_52850 12406 14529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 14726 14499 gene locus_tag LOCUS_52860 14726 14499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 14954 15973 gene locus_tag LOCUS_52870 14954 15973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 16060 17448 gene locus_tag LOCUS_52880 16060 17448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 17445 18350 gene locus_tag LOCUS_52890 17445 18350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 >Feature sequence139 109 2325 gene locus_tag LOCUS_52900 109 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 2322 2684 gene locus_tag LOCUS_52910 2322 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 3756 2695 gene locus_tag LOCUS_52920 3756 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 4055 3753 gene locus_tag LOCUS_52930 4055 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 4550 4086 gene locus_tag LOCUS_52940 4550 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 4815 5651 gene locus_tag LOCUS_52950 4815 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 5721 7085 gene locus_tag LOCUS_52960 5721 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 9303 7126 gene locus_tag LOCUS_52970 9303 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 9481 11970 gene locus_tag LOCUS_52980 9481 11970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 12027 13073 gene locus_tag LOCUS_52990 12027 13073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 13070 14365 gene locus_tag LOCUS_53000 13070 14365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 16359 14389 gene locus_tag LOCUS_53010 gene atuF 16359 14389 CDS product geranyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_53010 18049 16430 gene locus_tag LOCUS_53020 gene atuC 18049 16430 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_53020 >Feature sequence140 1422 673 gene locus_tag LOCUS_53030 1422 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 2588 1521 gene locus_tag LOCUS_53040 2588 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 3552 2608 gene locus_tag LOCUS_53050 3552 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 4253 3549 gene locus_tag LOCUS_53060 4253 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 5155 4385 gene locus_tag LOCUS_53070 5155 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 5465 6343 gene locus_tag LOCUS_53080 gene murI 5465 6343 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748S8 protein_id gnl|my_center|LOCUS_53080 6407 7159 gene locus_tag LOCUS_53090 6407 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 7985 7161 gene locus_tag LOCUS_53100 7985 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 8510 9238 gene locus_tag LOCUS_53110 gene mtnC 8510 9238 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7L5 protein_id gnl|my_center|LOCUS_53110 10458 9259 gene locus_tag LOCUS_53120 10458 9259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 10919 12559 gene locus_tag LOCUS_53130 10919 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 12800 13606 gene locus_tag LOCUS_53140 12800 13606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 17920 13757 gene locus_tag LOCUS_53150 gene rpoC 17920 13757 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7EPD8 protein_id gnl|my_center|LOCUS_53150 >Feature sequence141 3475 14 gene locus_tag LOCUS_53160 3475 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 3994 4605 gene locus_tag LOCUS_53170 gene ppa 3994 4605 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B8Z8 protein_id gnl|my_center|LOCUS_53170 4731 8192 gene locus_tag LOCUS_53180 4731 8192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 8319 11363 gene locus_tag LOCUS_53190 8319 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 11442 12869 gene locus_tag LOCUS_53200 11442 12869 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405487.1 protein_id gnl|my_center|LOCUS_53200 13183 12974 gene locus_tag LOCUS_53210 13183 12974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 13528 14280 gene locus_tag LOCUS_53220 13528 14280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 15114 14296 gene locus_tag LOCUS_53230 15114 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 15251 16207 gene locus_tag LOCUS_53240 15251 16207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 16204 16938 gene locus_tag LOCUS_53250 gene dltE 16204 16938 CDS product putative oxidoreductase DltE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39577 protein_id gnl|my_center|LOCUS_53250 17307 17954 gene locus_tag LOCUS_53260 17307 17954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 >Feature sequence142 1534 128 gene locus_tag LOCUS_53270 1534 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 2920 1634 gene locus_tag LOCUS_53280 gene hisD 2920 1634 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66976 protein_id gnl|my_center|LOCUS_53280 4259 2997 gene locus_tag LOCUS_53290 4259 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 5030 4266 gene locus_tag LOCUS_53300 gene hisF 5030 4266 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66567 protein_id gnl|my_center|LOCUS_53300 5674 5042 gene locus_tag LOCUS_53310 gene hisH 5674 5042 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JTW1 protein_id gnl|my_center|LOCUS_53310 6258 5671 gene locus_tag LOCUS_53320 gene hisB 6258 5671 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A1 protein_id gnl|my_center|LOCUS_53320 8003 6255 gene locus_tag LOCUS_53330 8003 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 8933 8046 gene locus_tag LOCUS_53340 gene hisG 8933 8046 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_53340 9271 12054 gene locus_tag LOCUS_53350 9271 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 12190 12936 gene locus_tag LOCUS_53360 12190 12936 CDS product metallophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_53360 13946 13101 gene locus_tag LOCUS_53370 gene bamD 13946 13101 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBE4 protein_id gnl|my_center|LOCUS_53370 14279 15148 gene locus_tag LOCUS_53380 14279 15148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 15285 16211 gene locus_tag LOCUS_53390 15285 16211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 16431 16841 gene locus_tag LOCUS_53400 16431 16841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 >Feature sequence143 82 1302 gene locus_tag LOCUS_53410 82 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 1414 1683 gene locus_tag LOCUS_53420 1414 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 1910 3481 gene locus_tag LOCUS_53430 1910 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 3522 6413 gene locus_tag LOCUS_53440 3522 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 6413 7183 gene locus_tag LOCUS_53450 6413 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 7816 8280 gene locus_tag LOCUS_53460 7816 8280 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224731.1 protein_id gnl|my_center|LOCUS_53460 8492 10726 gene locus_tag LOCUS_53470 8492 10726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 11716 10814 gene locus_tag LOCUS_53480 11716 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 12456 11908 gene locus_tag LOCUS_53490 12456 11908 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930581.1 protein_id gnl|my_center|LOCUS_53490 12733 13344 gene locus_tag LOCUS_53500 12733 13344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 13382 14230 gene locus_tag LOCUS_53510 13382 14230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 15619 14237 gene locus_tag LOCUS_53520 15619 14237 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040212.1 protein_id gnl|my_center|LOCUS_53520 16359 15739 gene locus_tag LOCUS_53530 16359 15739 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_53530 17137 16364 gene locus_tag LOCUS_53540 17137 16364 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930002.1 protein_id gnl|my_center|LOCUS_53540 <17991 17130 gene locus_tag LOCUS_53550 <17991 17130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009314634.1:aminodeoxychorismate synthase component I >Feature sequence144 2861 144 gene locus_tag LOCUS_53560 2861 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 3028 3912 gene locus_tag LOCUS_53570 3028 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 3953 4834 gene locus_tag LOCUS_53580 3953 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 4818 5477 gene locus_tag LOCUS_53590 4818 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 5584 8112 gene locus_tag LOCUS_53600 gene phr 5584 8112 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122223.1 protein_id gnl|my_center|LOCUS_53600 8638 8123 gene locus_tag LOCUS_53610 8638 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143103.1 protein_id gnl|my_center|LOCUS_53610 8933 11164 gene locus_tag LOCUS_53620 8933 11164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 11330 14035 gene locus_tag LOCUS_53630 11330 14035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 14061 14477 gene locus_tag LOCUS_53640 14061 14477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 15456 14485 gene locus_tag LOCUS_53650 15456 14485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 15642 15995 gene locus_tag LOCUS_53660 15642 15995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 16192 16383 gene locus_tag LOCUS_53670 16192 16383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 16471 16980 gene locus_tag LOCUS_53680 16471 16980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114565.1 protein_id gnl|my_center|LOCUS_53680 17046 17819 gene locus_tag LOCUS_53690 17046 17819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53690 >Feature sequence145 977 72 gene locus_tag LOCUS_53700 977 72 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902764.1 protein_id gnl|my_center|LOCUS_53700 1136 2878 gene locus_tag LOCUS_53710 1136 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53710 4357 2882 gene locus_tag LOCUS_53720 4357 2882 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532354.1 protein_id gnl|my_center|LOCUS_53720 5790 4363 gene locus_tag LOCUS_53730 5790 4363 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958525.1 protein_id gnl|my_center|LOCUS_53730 6410 5952 gene locus_tag LOCUS_53740 6410 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 6824 7756 gene locus_tag LOCUS_53750 6824 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 7780 8946 gene locus_tag LOCUS_53760 7780 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53760 9798 9181 gene locus_tag LOCUS_53770 9798 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 10801 9875 gene locus_tag LOCUS_53780 10801 9875 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_53780 10945 11718 gene locus_tag LOCUS_53790 10945 11718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 11711 13711 gene locus_tag LOCUS_53800 11711 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 13842 14459 gene locus_tag LOCUS_53810 13842 14459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 14459 15208 gene locus_tag LOCUS_53820 14459 15208 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245137.1 protein_id gnl|my_center|LOCUS_53820 16249 15251 gene locus_tag LOCUS_53830 16249 15251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 >Feature sequence146 193 714 gene locus_tag LOCUS_53840 193 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 2217 895 gene locus_tag LOCUS_53850 2217 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 3346 2387 gene locus_tag LOCUS_53860 3346 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 4241 3525 gene locus_tag LOCUS_53870 4241 3525 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120197.1 protein_id gnl|my_center|LOCUS_53870 4373 4741 gene locus_tag LOCUS_53880 4373 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 5055 6134 gene locus_tag LOCUS_53890 5055 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 6141 7643 gene locus_tag LOCUS_53900 6141 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 7640 8461 gene locus_tag LOCUS_53910 7640 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 8458 9735 gene locus_tag LOCUS_53920 8458 9735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 10930 9743 gene locus_tag LOCUS_53930 10930 9743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 11822 11097 gene locus_tag LOCUS_53940 11822 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 12080 13399 gene locus_tag LOCUS_53950 12080 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 14057 13422 gene locus_tag LOCUS_53960 14057 13422 CDS product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103689.1 protein_id gnl|my_center|LOCUS_53960 14212 15123 gene locus_tag LOCUS_53970 14212 15123 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704700.1 protein_id gnl|my_center|LOCUS_53970 15217 15501 gene locus_tag LOCUS_53980 15217 15501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 <16722 15566 gene locus_tag LOCUS_53990 <16722 15566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941974.1:acetoacetate metabolism regulatory protein AtoC >Feature sequence147 1576 104 gene locus_tag LOCUS_54000 1576 104 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931874.1 protein_id gnl|my_center|LOCUS_54000 2273 1725 gene locus_tag LOCUS_54010 2273 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 2437 3921 gene locus_tag LOCUS_54020 2437 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 4021 5610 gene locus_tag LOCUS_54030 gene rtcR 4021 5610 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122266.1 protein_id gnl|my_center|LOCUS_54030 5607 6527 gene locus_tag LOCUS_54040 5607 6527 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227777.1 protein_id gnl|my_center|LOCUS_54040 6560 7120 gene locus_tag LOCUS_54050 6560 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 7294 7932 gene locus_tag LOCUS_54060 7294 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 9294 7942 gene locus_tag LOCUS_54070 9294 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 9768 9433 gene locus_tag LOCUS_54080 9768 9433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 9676 10359 gene locus_tag LOCUS_54090 9676 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 11233 10349 gene locus_tag LOCUS_54100 11233 10349 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6K1 protein_id gnl|my_center|LOCUS_54100 11988 11230 gene locus_tag LOCUS_54110 11988 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 12082 13110 gene locus_tag LOCUS_54120 12082 13110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 15303 13114 gene locus_tag LOCUS_54130 15303 13114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 15386 15952 gene locus_tag LOCUS_54140 15386 15952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 >Feature sequence148 1940 2581 gene locus_tag LOCUS_54150 1940 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 2690 3490 gene locus_tag LOCUS_54160 2690 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 4176 3649 gene locus_tag LOCUS_54170 4176 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422870.1 protein_id gnl|my_center|LOCUS_54170 5610 4180 gene locus_tag LOCUS_54180 gene purF 5610 4180 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN7 protein_id gnl|my_center|LOCUS_54180 6572 5742 gene locus_tag LOCUS_54190 6572 5742 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_54190 7388 6576 gene locus_tag LOCUS_54200 7388 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 9196 7490 gene locus_tag LOCUS_54210 9196 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54210 9660 11786 gene locus_tag LOCUS_54220 9660 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462072.1 protein_id gnl|my_center|LOCUS_54220 12395 11874 gene locus_tag LOCUS_54230 12395 11874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 12726 13982 gene locus_tag LOCUS_54240 gene glyA 12726 13982 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJR6 protein_id gnl|my_center|LOCUS_54240 14082 14831 gene locus_tag LOCUS_54250 14082 14831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941676.1 protein_id gnl|my_center|LOCUS_54250 14870 15532 gene locus_tag LOCUS_54260 14870 15532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 >Feature sequence149 329 1246 gene locus_tag LOCUS_54270 329 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 1427 2086 gene locus_tag LOCUS_54280 gene msrA 1427 2086 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W59 protein_id gnl|my_center|LOCUS_54280 2355 3845 gene locus_tag LOCUS_54290 2355 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 3928 4236 gene locus_tag LOCUS_54300 3928 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 4258 5442 gene locus_tag LOCUS_54310 4258 5442 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228926.1 protein_id gnl|my_center|LOCUS_54310 5533 6942 gene locus_tag LOCUS_54320 5533 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 6958 7929 gene locus_tag LOCUS_54330 6958 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 7955 8794 gene locus_tag LOCUS_54340 7955 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 9812 8868 gene locus_tag LOCUS_54350 9812 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 12273 9928 gene locus_tag LOCUS_54360 12273 9928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 14345 12276 gene locus_tag LOCUS_54370 14345 12276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 14584 15999 gene locus_tag LOCUS_54380 14584 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 >Feature sequence150 171 1046 gene locus_tag LOCUS_54390 171 1046 CDS product PPK2 family polyphosphate--nucleotide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789758.1 protein_id gnl|my_center|LOCUS_54390 1602 1051 gene locus_tag LOCUS_54400 1602 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 3007 1682 gene locus_tag LOCUS_54410 3007 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 3281 4357 gene locus_tag LOCUS_54420 3281 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 5653 4361 gene locus_tag LOCUS_54430 5653 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 6289 5684 gene locus_tag LOCUS_54440 gene cysC 6289 5684 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB13 protein_id gnl|my_center|LOCUS_54440 7084 6323 gene locus_tag LOCUS_54450 7084 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 8081 7134 gene locus_tag LOCUS_54460 8081 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 9013 8078 gene locus_tag LOCUS_54470 9013 8078 CDS product UDP-glucose 4-epimerase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_54470 10257 9010 gene locus_tag LOCUS_54480 10257 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 11456 10284 gene locus_tag LOCUS_54490 11456 10284 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_54490 13641 11599 gene locus_tag LOCUS_54500 13641 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 15387 13711 gene locus_tag LOCUS_54510 15387 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 >Feature sequence151 613 89 gene locus_tag LOCUS_54520 613 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 2179 770 gene locus_tag LOCUS_54530 gene pilR 2179 770 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_54530 4011 2176 gene locus_tag LOCUS_54540 gene pilS 4011 2176 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_54540 5305 4082 gene locus_tag LOCUS_54550 gene pilC 5305 4082 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_54550 6564 5437 gene locus_tag LOCUS_54560 gene pilT-4 6564 5437 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_54560 8414 6693 gene locus_tag LOCUS_54570 gene pilB 8414 6693 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_54570 8782 9735 gene locus_tag LOCUS_54580 8782 9735 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 protein_id gnl|my_center|LOCUS_54580 9732 10583 gene locus_tag LOCUS_54590 9732 10583 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8E2 protein_id gnl|my_center|LOCUS_54590 10596 10811 gene locus_tag LOCUS_54600 10596 10811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 10958 11395 gene locus_tag LOCUS_54610 10958 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 11659 12537 gene locus_tag LOCUS_54620 gene rluB 11659 12537 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB4 protein_id gnl|my_center|LOCUS_54620 13594 12635 gene locus_tag LOCUS_54630 gene xerD 13594 12635 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE77 protein_id gnl|my_center|LOCUS_54630 <15916 13591 gene locus_tag LOCUS_54640 <15916 13591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C55:bifunctional uridylyltransferase/uridylyl-removing enzyme >Feature sequence152 1044 97 gene locus_tag LOCUS_54650 gene gpsA 1044 97 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAF3 protein_id gnl|my_center|LOCUS_54650 2237 1044 gene locus_tag LOCUS_54660 2237 1044 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59806 protein_id gnl|my_center|LOCUS_54660 2538 3329 gene locus_tag LOCUS_54670 2538 3329 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141462.1 protein_id gnl|my_center|LOCUS_54670 4122 3304 gene locus_tag LOCUS_54680 4122 3304 CDS product TIGR00268 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_54680 4358 4119 gene locus_tag LOCUS_54690 4358 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 6249 4492 gene locus_tag LOCUS_54700 6249 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 8230 6278 gene locus_tag LOCUS_54710 8230 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 8905 8450 gene locus_tag LOCUS_54720 8905 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 10300 8999 gene locus_tag LOCUS_54730 10300 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54730 11039 10434 gene locus_tag LOCUS_54740 11039 10434 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_54740 11618 11223 gene locus_tag LOCUS_54750 11618 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 13268 11709 gene locus_tag LOCUS_54760 13268 11709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54760 13792 13265 gene locus_tag LOCUS_54770 13792 13265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 15519 13951 gene locus_tag LOCUS_54780 15519 13951 CDS product L-beta-lysine 5,6-aminomutase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX7 protein_id gnl|my_center|LOCUS_54780 >Feature sequence153 406 795 gene locus_tag LOCUS_54790 406 795 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMM4 protein_id gnl|my_center|LOCUS_54790 1490 867 gene locus_tag LOCUS_54800 1490 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 2011 1487 gene locus_tag LOCUS_54810 2011 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 2714 2151 gene locus_tag LOCUS_54820 2714 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 2932 3477 gene locus_tag LOCUS_54830 2932 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 3802 4545 gene locus_tag LOCUS_54840 3802 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 7355 4581 gene locus_tag LOCUS_54850 7355 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 8250 7585 gene locus_tag LOCUS_54860 8250 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 8737 9255 gene locus_tag LOCUS_54870 8737 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 9530 10045 gene locus_tag LOCUS_54880 9530 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 11058 10159 gene locus_tag LOCUS_54890 11058 10159 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_54890 11214 12497 gene locus_tag LOCUS_54900 gene nhaA2 11214 12497 CDS product Na(+)/H(+) antiporter NhaA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNN2 protein_id gnl|my_center|LOCUS_54900 13473 12637 gene locus_tag LOCUS_54910 13473 12637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 14432 13896 gene locus_tag LOCUS_54920 14432 13896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 15231 14572 gene locus_tag LOCUS_54930 15231 14572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 15517 15269 gene locus_tag LOCUS_54940 15517 15269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 >Feature sequence154 964 107 gene locus_tag LOCUS_54950 964 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 1791 1030 gene locus_tag LOCUS_54960 1791 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 1999 2625 gene locus_tag LOCUS_54970 1999 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 6496 2765 gene locus_tag LOCUS_54980 6496 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 6799 7608 gene locus_tag LOCUS_54990 6799 7608 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022003.1 protein_id gnl|my_center|LOCUS_54990 8253 7627 gene locus_tag LOCUS_55000 8253 7627 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957327.1 protein_id gnl|my_center|LOCUS_55000 8500 10560 gene locus_tag LOCUS_55010 8500 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 11521 10547 gene locus_tag LOCUS_55020 11521 10547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 12920 11652 gene locus_tag LOCUS_55030 12920 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 13252 12917 gene locus_tag LOCUS_55040 13252 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 13341 13757 gene locus_tag LOCUS_55050 13341 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 15442 13730 gene locus_tag LOCUS_55060 15442 13730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 >Feature sequence155 137 2101 gene locus_tag LOCUS_55070 137 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 2091 2927 gene locus_tag LOCUS_55080 2091 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 3210 3779 gene locus_tag LOCUS_55090 3210 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065742.1 protein_id gnl|my_center|LOCUS_55090 6542 3912 gene locus_tag LOCUS_55100 6542 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 9892 6566 gene locus_tag LOCUS_55110 9892 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 10972 9920 gene locus_tag LOCUS_55120 10972 9920 CDS product aerotolerance protein BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_55120 12435 10972 gene locus_tag LOCUS_55130 12435 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 13434 12559 gene locus_tag LOCUS_55140 13434 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405285.1 protein_id gnl|my_center|LOCUS_55140 14304 13462 gene locus_tag LOCUS_55150 14304 13462 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_55150 15449 14460 gene locus_tag LOCUS_55160 15449 14460 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_55160 >Feature sequence156 30 1883 gene locus_tag LOCUS_55170 30 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 1883 4252 gene locus_tag LOCUS_55180 1883 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 4311 5294 gene locus_tag LOCUS_55190 4311 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_55190 5475 6194 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcgaacccttcctcgatttggagaggactgaaac 6550 6242 gene locus_tag LOCUS_55200 6550 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 6985 6686 gene locus_tag LOCUS_55210 6985 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 8192 7092 gene locus_tag LOCUS_55220 8192 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 9982 8228 gene locus_tag LOCUS_55230 9982 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 10572 10165 gene locus_tag LOCUS_55240 10572 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 10776 11552 gene locus_tag LOCUS_55250 10776 11552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 11687 12748 gene locus_tag LOCUS_55260 gene cas1 11687 12748 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFZ6 protein_id gnl|my_center|LOCUS_55260 12761 13057 gene locus_tag LOCUS_55270 12761 13057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 13057 13716 gene locus_tag LOCUS_55280 13057 13716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 14439 14923 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgctgacccttcctcgatttggagaggactgaaa >Feature sequence157 1883 93 gene locus_tag LOCUS_55290 1883 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 2478 1906 gene locus_tag LOCUS_55300 2478 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 3472 2456 gene locus_tag LOCUS_55310 3472 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 3745 4635 gene locus_tag LOCUS_55320 3745 4635 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704522.1 protein_id gnl|my_center|LOCUS_55320 4639 6054 gene locus_tag LOCUS_55330 4639 6054 CDS product carotenoid cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 protein_id gnl|my_center|LOCUS_55330 6080 7270 gene locus_tag LOCUS_55340 gene fadA 6080 7270 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_55340 7313 7450 gene locus_tag LOCUS_55350 7313 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 7468 8265 gene locus_tag LOCUS_55360 7468 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 8600 8271 gene locus_tag LOCUS_55370 8600 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977125.1 protein_id gnl|my_center|LOCUS_55370 10211 8892 gene locus_tag LOCUS_55380 10211 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 10894 10211 gene locus_tag LOCUS_55390 10894 10211 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709525.1 protein_id gnl|my_center|LOCUS_55390 11817 10987 gene locus_tag LOCUS_55400 11817 10987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 12125 14674 gene locus_tag LOCUS_55410 12125 14674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 >Feature sequence158 705 1304 gene locus_tag LOCUS_55420 705 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 4070 1383 gene locus_tag LOCUS_55430 4070 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 6897 4126 gene locus_tag LOCUS_55440 6897 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 7187 8185 gene locus_tag LOCUS_55450 7187 8185 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_55450 8263 9096 gene locus_tag LOCUS_55460 gene dapD 8263 9096 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933909.1 protein_id gnl|my_center|LOCUS_55460 9093 10250 gene locus_tag LOCUS_55470 gene aspB 9093 10250 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HL11 protein_id gnl|my_center|LOCUS_55470 10412 11524 gene locus_tag LOCUS_55480 10412 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55480 11573 12607 gene locus_tag LOCUS_55490 11573 12607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 12604 13335 gene locus_tag LOCUS_55500 12604 13335 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947243.1 protein_id gnl|my_center|LOCUS_55500 14036 13332 gene locus_tag LOCUS_55510 14036 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55510 14787 14062 gene locus_tag LOCUS_55520 14787 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55520 >Feature sequence159 166 1707 gene locus_tag LOCUS_55530 166 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 1972 2889 gene locus_tag LOCUS_55540 1972 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 2996 3817 gene locus_tag LOCUS_55550 2996 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 4682 4122 gene locus_tag LOCUS_55560 4682 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 6312 5284 gene locus_tag LOCUS_55570 6312 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 6571 7923 gene locus_tag LOCUS_55580 6571 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 7920 10598 gene locus_tag LOCUS_55590 7920 10598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 10667 11287 gene locus_tag LOCUS_55600 10667 11287 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222130.1 protein_id gnl|my_center|LOCUS_55600 11309 11815 gene locus_tag LOCUS_55610 11309 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55610 11902 12717 gene locus_tag LOCUS_55620 11902 12717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 13356 12727 gene locus_tag LOCUS_55630 13356 12727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 14516 13380 gene locus_tag LOCUS_55640 14516 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 >Feature sequence160 717 70 gene locus_tag LOCUS_55650 717 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 844 1719 gene locus_tag LOCUS_55660 844 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55660 2190 1732 gene locus_tag LOCUS_55670 2190 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 3337 2240 gene locus_tag LOCUS_55680 3337 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 3576 4490 gene locus_tag LOCUS_55690 3576 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 4477 7416 gene locus_tag LOCUS_55700 4477 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 7584 9581 gene locus_tag LOCUS_55710 gene prc 7584 9581 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_55710 9822 11153 gene locus_tag LOCUS_55720 9822 11153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 11716 11180 gene locus_tag LOCUS_55730 11716 11180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 12438 11740 gene locus_tag LOCUS_55740 12438 11740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 >Feature sequence161 454 2448 gene locus_tag LOCUS_55750 454 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 2523 3365 gene locus_tag LOCUS_55760 2523 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 3941 3369 gene locus_tag LOCUS_55770 3941 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 4123 5634 gene locus_tag LOCUS_55780 4123 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 9081 5653 gene locus_tag LOCUS_55790 9081 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 10110 9448 gene locus_tag LOCUS_55800 10110 9448 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027567.1 protein_id gnl|my_center|LOCUS_55800 10547 11644 gene locus_tag LOCUS_55810 10547 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 11811 13076 gene locus_tag LOCUS_55820 11811 13076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 13221 13853 gene locus_tag LOCUS_55830 13221 13853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 13856 14248 gene locus_tag LOCUS_55840 13856 14248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 >Feature sequence162 700 71 gene locus_tag LOCUS_55850 gene pgsA 700 71 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_55850 1479 697 gene locus_tag LOCUS_55860 1479 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 3126 1540 gene locus_tag LOCUS_55870 3126 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 4182 3136 gene locus_tag LOCUS_55880 4182 3136 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_55880 5584 4154 gene locus_tag LOCUS_55890 5584 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 7464 5581 gene locus_tag LOCUS_55900 7464 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 10980 7507 gene locus_tag LOCUS_55910 10980 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 11127 12662 gene locus_tag LOCUS_55920 11127 12662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 13560 12781 gene locus_tag LOCUS_55930 13560 12781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55930 >Feature sequence163 520 2118 gene locus_tag LOCUS_55940 520 2118 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKY7 protein_id gnl|my_center|LOCUS_55940 2266 3552 gene locus_tag LOCUS_55950 2266 3552 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_55950 4104 5933 gene locus_tag LOCUS_55960 4104 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 6793 6029 gene locus_tag LOCUS_55970 6793 6029 CDS product putative enoyl-coa hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704585.1 protein_id gnl|my_center|LOCUS_55970 7856 6831 gene locus_tag LOCUS_55980 gene pdxA 7856 6831 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5H0 protein_id gnl|my_center|LOCUS_55980 9679 7913 gene locus_tag LOCUS_55990 9679 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 10551 9811 gene locus_tag LOCUS_56000 10551 9811 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809037.1 protein_id gnl|my_center|LOCUS_56000 10684 11040 gene locus_tag LOCUS_56010 10684 11040 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393857.1 protein_id gnl|my_center|LOCUS_56010 11322 12344 gene locus_tag LOCUS_56020 11322 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 12395 14047 gene locus_tag LOCUS_56030 12395 14047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 >Feature sequence164 1834 704 gene locus_tag LOCUS_56040 1834 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 5523 1837 gene locus_tag LOCUS_56050 gene metH 5523 1837 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262613.1 protein_id gnl|my_center|LOCUS_56050 5882 6358 gene locus_tag LOCUS_56060 5882 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 6355 7299 gene locus_tag LOCUS_56070 6355 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 8593 7538 gene locus_tag LOCUS_56080 8593 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 9044 8760 gene locus_tag LOCUS_56090 9044 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56090 9358 13266 gene locus_tag LOCUS_56100 9358 13266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 13701 13276 gene locus_tag LOCUS_56110 13701 13276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 >Feature sequence165 1638 505 gene locus_tag LOCUS_56120 1638 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56120 1856 2803 gene locus_tag LOCUS_56130 gene wbtF 1856 2803 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_56130 3669 2794 gene locus_tag LOCUS_56140 gene rbfD 3669 2794 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664667.1 protein_id gnl|my_center|LOCUS_56140 3782 4339 gene locus_tag LOCUS_56150 3782 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56150 4815 4642 gene locus_tag LOCUS_56160 4815 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 4789 8139 gene locus_tag LOCUS_56170 4789 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56170 8132 10843 gene locus_tag LOCUS_56180 8132 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 11087 11602 gene locus_tag LOCUS_56190 11087 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 11599 13233 gene locus_tag LOCUS_56200 11599 13233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 >Feature sequence166 515 2803 gene locus_tag LOCUS_56210 515 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 2920 4632 gene locus_tag LOCUS_56220 2920 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 4644 6014 gene locus_tag LOCUS_56230 4644 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 6943 6023 gene locus_tag LOCUS_56240 6943 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56240 7163 8014 gene locus_tag LOCUS_56250 7163 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56250 8660 8019 gene locus_tag LOCUS_56260 8660 8019 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990008.1 protein_id gnl|my_center|LOCUS_56260 9721 8855 gene locus_tag LOCUS_56270 9721 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 11066 9774 gene locus_tag LOCUS_56280 11066 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 11866 11216 gene locus_tag LOCUS_56290 11866 11216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 12233 12949 gene locus_tag LOCUS_56300 12233 12949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 >Feature sequence167 <1 595 gene locus_tag LOCUS_56310 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8NU86:UPF0721 transmembrane protein 658 1080 gene locus_tag LOCUS_56320 658 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038901.1 protein_id gnl|my_center|LOCUS_56320 1138 2049 gene locus_tag LOCUS_56330 1138 2049 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640607.1 protein_id gnl|my_center|LOCUS_56330 2829 2131 gene locus_tag LOCUS_56340 2829 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56340 3014 4000 gene locus_tag LOCUS_56350 3014 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56350 4353 4138 gene locus_tag LOCUS_56360 4353 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933349.1 protein_id gnl|my_center|LOCUS_56360 5360 4443 gene locus_tag LOCUS_56370 5360 4443 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640607.1 protein_id gnl|my_center|LOCUS_56370 6437 5835 gene locus_tag LOCUS_56380 6437 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 7110 6751 gene locus_tag LOCUS_56390 7110 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56390 8808 7186 gene locus_tag LOCUS_56400 8808 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 9878 8805 gene locus_tag LOCUS_56410 9878 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_56410 11754 9886 gene locus_tag LOCUS_56420 11754 9886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 12883 12008 gene locus_tag LOCUS_56430 12883 12008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947383.1 protein_id gnl|my_center|LOCUS_56430 >Feature sequence168 132 1301 gene locus_tag LOCUS_56440 132 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064316.1 protein_id gnl|my_center|LOCUS_56440 1548 1324 gene locus_tag LOCUS_56450 1548 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 1856 3070 gene locus_tag LOCUS_56460 1856 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 3074 4006 gene locus_tag LOCUS_56470 3074 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 4811 4104 gene locus_tag LOCUS_56480 4811 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56480 5708 4920 gene locus_tag LOCUS_56490 5708 4920 CDS product short-chain dehydrogenase/reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103227.1 protein_id gnl|my_center|LOCUS_56490 6109 5705 gene locus_tag LOCUS_56500 6109 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942959.1 protein_id gnl|my_center|LOCUS_56500 7113 6214 gene locus_tag LOCUS_56510 7113 6214 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537711.1 protein_id gnl|my_center|LOCUS_56510 7235 8218 gene locus_tag LOCUS_56520 7235 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086717.1 protein_id gnl|my_center|LOCUS_56520 9934 8135 gene locus_tag LOCUS_56530 9934 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 10257 11129 gene locus_tag LOCUS_56540 10257 11129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 11192 12190 gene locus_tag LOCUS_56550 11192 12190 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967060.1 protein_id gnl|my_center|LOCUS_56550 12373 12900 gene locus_tag LOCUS_56560 12373 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 >Feature sequence169 875 1909 gene locus_tag LOCUS_56570 875 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 3505 1925 gene locus_tag LOCUS_56580 3505 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 3795 4286 gene locus_tag LOCUS_56590 3795 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 4541 6718 gene locus_tag LOCUS_56600 gene katG 4541 6718 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRK1 protein_id gnl|my_center|LOCUS_56600 6943 7749 gene locus_tag LOCUS_56610 6943 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56610 8800 7826 gene locus_tag LOCUS_56620 8800 7826 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065910.1 protein_id gnl|my_center|LOCUS_56620 11814 8947 gene locus_tag LOCUS_56630 11814 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56630 12195 12764 gene locus_tag LOCUS_56640 12195 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 >Feature sequence170 1959 2330 gene locus_tag LOCUS_56650 1959 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 2484 5141 gene locus_tag LOCUS_56660 2484 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 5809 7161 gene locus_tag LOCUS_56670 5809 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 7220 8164 gene locus_tag LOCUS_56680 7220 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 8561 9142 gene locus_tag LOCUS_56690 8561 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 9506 10009 gene locus_tag LOCUS_56700 9506 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56700 10163 10804 gene locus_tag LOCUS_56710 10163 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 11654 11421 gene locus_tag LOCUS_56720 11654 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 12058 11837 gene locus_tag LOCUS_56730 12058 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 12325 12059 gene locus_tag LOCUS_56740 12325 12059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 >Feature sequence171 585 1259 gene locus_tag LOCUS_56750 585 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 1279 2400 gene locus_tag LOCUS_56760 1279 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 2551 3408 gene locus_tag LOCUS_56770 gene tesB 2551 3408 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706717.1 protein_id gnl|my_center|LOCUS_56770 3888 4700 gene locus_tag LOCUS_56780 3888 4700 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106363.1 protein_id gnl|my_center|LOCUS_56780 5646 5278 gene locus_tag LOCUS_56790 5646 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003656109.1 protein_id gnl|my_center|LOCUS_56790 6199 6945 gene locus_tag LOCUS_56800 6199 6945 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287466.1 protein_id gnl|my_center|LOCUS_56800 7242 7604 gene locus_tag LOCUS_56810 7242 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 7818 8294 gene locus_tag LOCUS_56820 7818 8294 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759738.1 protein_id gnl|my_center|LOCUS_56820 8291 8929 gene locus_tag LOCUS_56830 8291 8929 CDS product NADH-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_56830 10887 9022 gene locus_tag LOCUS_56840 gene cstA 10887 9022 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_56840 11163 11255 gene locus_tag LOCUS_t00750 11163 11255 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 12470 11790 gene locus_tag LOCUS_56850 12470 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 >Feature sequence172 1162 47 gene locus_tag LOCUS_56860 1162 47 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336821.1 protein_id gnl|my_center|LOCUS_56860 2562 1162 gene locus_tag LOCUS_56870 2562 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_56870 3809 2649 gene locus_tag LOCUS_56880 3809 2649 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881030.1 protein_id gnl|my_center|LOCUS_56880 4718 4056 gene locus_tag LOCUS_56890 4718 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 5413 4790 gene locus_tag LOCUS_56900 5413 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 5851 7011 gene locus_tag LOCUS_56910 5851 7011 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224399.1 protein_id gnl|my_center|LOCUS_56910 9366 7024 gene locus_tag LOCUS_56920 gene nicT 9366 7024 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_56920 10067 9339 gene locus_tag LOCUS_56930 10067 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 10965 10135 gene locus_tag LOCUS_56940 10965 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56940 11152 12111 gene locus_tag LOCUS_56950 11152 12111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 >Feature sequence173 1278 100 gene locus_tag LOCUS_56960 1278 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 2548 1334 gene locus_tag LOCUS_56970 2548 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 4089 2557 gene locus_tag LOCUS_56980 4089 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_56980 4479 5219 gene locus_tag LOCUS_56990 4479 5219 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190866.1 protein_id gnl|my_center|LOCUS_56990 5219 7333 gene locus_tag LOCUS_57000 5219 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57000 7333 8685 gene locus_tag LOCUS_57010 7333 8685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669609.1 protein_id gnl|my_center|LOCUS_57010 8823 9602 gene locus_tag LOCUS_57020 8823 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 9617 10471 gene locus_tag LOCUS_57030 9617 10471 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976892.1 protein_id gnl|my_center|LOCUS_57030 10468 11268 gene locus_tag LOCUS_57040 10468 11268 CDS product 3-oxoadipate enol-lactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405393.1 protein_id gnl|my_center|LOCUS_57040 >Feature sequence174 869 63 gene locus_tag LOCUS_57050 869 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 1911 907 gene locus_tag LOCUS_57060 1911 907 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTA8 protein_id gnl|my_center|LOCUS_57060 3567 2110 gene locus_tag LOCUS_57070 3567 2110 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147251.1 protein_id gnl|my_center|LOCUS_57070 3899 5548 gene locus_tag LOCUS_57080 3899 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 5785 7605 gene locus_tag LOCUS_57090 5785 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 7687 8781 gene locus_tag LOCUS_57100 7687 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 8778 9803 gene locus_tag LOCUS_57110 8778 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57110 9899 11338 gene locus_tag LOCUS_57120 9899 11338 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688389.1 protein_id gnl|my_center|LOCUS_57120 >Feature sequence175 567 1559 gene locus_tag LOCUS_57130 567 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57130 1656 2702 gene locus_tag LOCUS_57140 1656 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57140 3183 2677 gene locus_tag LOCUS_57150 3183 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57150 4825 3425 gene locus_tag LOCUS_57160 4825 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 5445 4987 gene locus_tag LOCUS_57170 5445 4987 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382331.1 protein_id gnl|my_center|LOCUS_57170 6212 5442 gene locus_tag LOCUS_57180 6212 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 7573 6224 gene locus_tag LOCUS_57190 7573 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57190 8331 10370 gene locus_tag LOCUS_57200 gene fadH 8331 10370 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530263.1 protein_id gnl|my_center|LOCUS_57200 10476 11504 gene locus_tag LOCUS_57210 10476 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_57210 >Feature sequence176 396 803 gene locus_tag LOCUS_57220 396 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 800 1777 gene locus_tag LOCUS_57230 800 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 1996 3096 gene locus_tag LOCUS_57240 1996 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 3329 3174 gene locus_tag LOCUS_57250 3329 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57250 3315 4745 gene locus_tag LOCUS_57260 3315 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 4758 7886 gene locus_tag LOCUS_57270 4758 7886 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_57270 7883 8350 gene locus_tag LOCUS_57280 7883 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 8523 9746 gene locus_tag LOCUS_57290 8523 9746 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940860.1 protein_id gnl|my_center|LOCUS_57290 9898 11019 gene locus_tag LOCUS_57300 gene mauG 9898 11019 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_57300 >Feature sequence177 4882 1664 gene locus_tag LOCUS_57310 4882 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083688.1 protein_id gnl|my_center|LOCUS_57310 7919 4875 gene locus_tag LOCUS_57320 7919 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57320 8708 7923 gene locus_tag LOCUS_57330 8708 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 10885 8705 gene locus_tag LOCUS_57340 10885 8705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57340 >Feature sequence178 95 430 gene locus_tag LOCUS_57350 95 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 619 350 gene locus_tag LOCUS_57360 619 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 807 616 gene locus_tag LOCUS_57370 807 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57370 2698 953 gene locus_tag LOCUS_57380 2698 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 4338 2695 gene locus_tag LOCUS_57390 4338 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57390 4490 6094 gene locus_tag LOCUS_57400 4490 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 6091 6768 gene locus_tag LOCUS_57410 6091 6768 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918411.1 protein_id gnl|my_center|LOCUS_57410 9495 6784 gene locus_tag LOCUS_57420 9495 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 >Feature sequence179 1978 3939 gene locus_tag LOCUS_57430 1978 3939 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510922.1 protein_id gnl|my_center|LOCUS_57430 3926 5230 gene locus_tag LOCUS_57440 3926 5230 CDS product NDP-sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250182.1 protein_id gnl|my_center|LOCUS_57440 5227 6537 gene locus_tag LOCUS_57450 5227 6537 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_57450 6545 7405 gene locus_tag LOCUS_57460 6545 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57460 7968 7510 gene locus_tag LOCUS_57470 7968 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 9644 8319 gene locus_tag LOCUS_57480 gene pyn 9644 8319 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356165.1 protein_id gnl|my_center|LOCUS_57480 >Feature sequence180 2 196 gene locus_tag LOCUS_57490 2 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57490 920 438 gene locus_tag LOCUS_57500 920 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57500 1394 993 gene locus_tag LOCUS_57510 1394 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 2545 2087 gene locus_tag LOCUS_57520 2545 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 2855 3253 gene locus_tag LOCUS_57530 2855 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 3256 3693 gene locus_tag LOCUS_57540 3256 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 3708 4058 gene locus_tag LOCUS_57550 3708 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 4055 4297 gene locus_tag LOCUS_57560 4055 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 4290 4595 gene locus_tag LOCUS_57570 4290 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 5708 4773 gene locus_tag LOCUS_57580 5708 4773 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533270.1 protein_id gnl|my_center|LOCUS_57580 6692 7180 gene locus_tag LOCUS_57590 6692 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57590 8281 7250 gene locus_tag LOCUS_57600 8281 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57600 9852 8278 gene locus_tag LOCUS_57610 9852 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57610 10228 10932 gene locus_tag LOCUS_57620 10228 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 >Feature sequence181 4489 1523 gene locus_tag LOCUS_57630 4489 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57630 5538 4561 gene locus_tag LOCUS_57640 5538 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57640 5901 6470 gene locus_tag LOCUS_57650 5901 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57650 6502 8748 gene locus_tag LOCUS_57660 6502 8748 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_57660 8886 9329 gene locus_tag LOCUS_57670 8886 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57670 9355 10551 gene locus_tag LOCUS_57680 9355 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57680 >Feature sequence182 1144 896 gene locus_tag LOCUS_57690 1144 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57690 1103 2581 gene locus_tag LOCUS_57700 1103 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 2698 4824 gene locus_tag LOCUS_57710 2698 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 5159 5863 gene locus_tag LOCUS_57720 5159 5863 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRQ0 protein_id gnl|my_center|LOCUS_57720 8689 5891 gene locus_tag LOCUS_57730 8689 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 9218 9988 gene locus_tag LOCUS_57740 9218 9988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 >Feature sequence183 862 554 gene locus_tag LOCUS_57750 862 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57750 1236 934 gene locus_tag LOCUS_57760 1236 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 1574 1329 gene locus_tag LOCUS_57770 1574 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 2192 1770 gene locus_tag LOCUS_57780 2192 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 2611 2144 gene locus_tag LOCUS_57790 2611 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 3154 2726 gene locus_tag LOCUS_57800 3154 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 5810 3288 gene locus_tag LOCUS_57810 5810 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57810 7097 5913 gene locus_tag LOCUS_57820 7097 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 8360 7107 gene locus_tag LOCUS_57830 8360 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57830 <10035 8430 gene locus_tag LOCUS_57840 <10035 8430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289343.1:ATPase AAA >Feature sequence184 1434 133 gene locus_tag LOCUS_57850 1434 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 2545 1421 gene locus_tag LOCUS_57860 2545 1421 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_57860 2691 3509 gene locus_tag LOCUS_57870 2691 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 4761 3511 gene locus_tag LOCUS_57880 4761 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57880 5582 4920 gene locus_tag LOCUS_57890 5582 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 5856 9437 gene locus_tag LOCUS_57900 5856 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57900 >Feature sequence185 519 160 gene locus_tag LOCUS_57910 519 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57910 657 1088 gene locus_tag LOCUS_57920 657 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57920 1741 1028 gene locus_tag LOCUS_57930 gene yfcG 1741 1028 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071741.1 protein_id gnl|my_center|LOCUS_57930 1835 3190 gene locus_tag LOCUS_57940 1835 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57940 3204 3920 gene locus_tag LOCUS_57950 3204 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 5574 3931 gene locus_tag LOCUS_57960 5574 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 6135 5602 gene locus_tag LOCUS_57970 6135 5602 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED72 protein_id gnl|my_center|LOCUS_57970 7912 6239 gene locus_tag LOCUS_57980 7912 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 9106 8162 gene locus_tag LOCUS_57990 9106 8162 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_57990 >Feature sequence186 261 872 gene locus_tag LOCUS_58000 261 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 1444 6147 gene locus_tag LOCUS_58010 1444 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 6149 8125 gene locus_tag LOCUS_58020 6149 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 >Feature sequence187 832 122 gene locus_tag LOCUS_58030 832 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58030 2572 1061 gene locus_tag LOCUS_58040 2572 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58040 2744 3748 gene locus_tag LOCUS_58050 2744 3748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_58050 3745 4485 gene locus_tag LOCUS_58060 3745 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 4524 6338 gene locus_tag LOCUS_58070 4524 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58070 6335 7402 gene locus_tag LOCUS_58080 6335 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 8052 7405 gene locus_tag LOCUS_58090 gene rpoE 8052 7405 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S89 protein_id gnl|my_center|LOCUS_58090 8442 8173 gene locus_tag LOCUS_58100 8442 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 8411 9043 gene locus_tag LOCUS_58110 gene rpoE 8411 9043 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225377.1 protein_id gnl|my_center|LOCUS_58110 9049 9321 gene locus_tag LOCUS_58120 9049 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58120 >Feature sequence188 1058 81 gene locus_tag LOCUS_58130 1058 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58130 1344 3284 gene locus_tag LOCUS_58140 1344 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58140 5334 3415 gene locus_tag LOCUS_58150 5334 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58150 5621 6751 gene locus_tag LOCUS_58160 gene acoA 5621 6751 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4N0 protein_id gnl|my_center|LOCUS_58160 6884 7867 gene locus_tag LOCUS_58170 gene acoB 6884 7867 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_58170 7960 9285 gene locus_tag LOCUS_58180 7960 9285 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S152 protein_id gnl|my_center|LOCUS_58180 >Feature sequence189 1459 110 gene locus_tag LOCUS_58190 1459 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 1677 2351 gene locus_tag LOCUS_58200 1677 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58200 2373 3152 gene locus_tag LOCUS_58210 2373 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58210 4509 3187 gene locus_tag LOCUS_58220 4509 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58220 4781 6451 gene locus_tag LOCUS_58230 4781 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 7303 6485 gene locus_tag LOCUS_58240 7303 6485 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080741.1 protein_id gnl|my_center|LOCUS_58240 7491 9230 gene locus_tag LOCUS_58250 7491 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 >Feature sequence190 4979 1320 gene locus_tag LOCUS_58260 4979 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58260 6205 5105 gene locus_tag LOCUS_58270 6205 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58270 6405 7874 gene locus_tag LOCUS_58280 gene phr 6405 7874 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_58280 9053 7881 gene locus_tag LOCUS_58290 9053 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 >Feature sequence191 1282 86 gene locus_tag LOCUS_58300 1282 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58300 1762 2022 gene locus_tag LOCUS_58310 1762 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58310 2275 3570 gene locus_tag LOCUS_58320 2275 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 3591 4820 gene locus_tag LOCUS_58330 3591 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58330 4938 6653 gene locus_tag LOCUS_58340 4938 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 6655 7989 gene locus_tag LOCUS_58350 6655 7989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_58350 7989 8936 gene locus_tag LOCUS_58360 7989 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 >Feature sequence192 166 1224 gene locus_tag LOCUS_58370 166 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58370 1258 2706 gene locus_tag LOCUS_58380 1258 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 3610 2714 gene locus_tag LOCUS_58390 3610 2714 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066929.1 protein_id gnl|my_center|LOCUS_58390 3768 4265 gene locus_tag LOCUS_58400 3768 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58400 5569 4433 gene locus_tag LOCUS_58410 5569 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58410 6379 5675 gene locus_tag LOCUS_58420 6379 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 6459 7412 gene locus_tag LOCUS_58430 6459 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 7550 7936 gene locus_tag LOCUS_58440 7550 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58440 8787 8011 gene locus_tag LOCUS_58450 gene cobB 8787 8011 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIH7 protein_id gnl|my_center|LOCUS_58450 >Feature sequence193 108 701 gene locus_tag LOCUS_58460 gene hslV 108 701 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3Q4 protein_id gnl|my_center|LOCUS_58460 688 2094 gene locus_tag LOCUS_58470 gene hslU 688 2094 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYZ2 protein_id gnl|my_center|LOCUS_58470 2138 3367 gene locus_tag LOCUS_58480 gene argD 2138 3367 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG65 protein_id gnl|my_center|LOCUS_58480 3686 4963 gene locus_tag LOCUS_58490 3686 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58490 5038 6843 gene locus_tag LOCUS_58500 gene dnaK 5038 6843 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_58500 >Feature sequence194 1730 24 gene locus_tag LOCUS_58510 1730 24 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460381.1 protein_id gnl|my_center|LOCUS_58510 2477 2121 gene locus_tag LOCUS_58520 2477 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 2909 5773 gene locus_tag LOCUS_58530 2909 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 5902 6429 gene locus_tag LOCUS_58540 5902 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58540 6555 7664 gene locus_tag LOCUS_58550 6555 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 7664 8356 gene locus_tag LOCUS_58560 gene hisG 7664 8356 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81G07 protein_id gnl|my_center|LOCUS_58560 9042 8374 gene locus_tag LOCUS_58570 9042 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58570 >Feature sequence195 1615 74 gene locus_tag LOCUS_58580 1615 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58580 2084 3700 gene locus_tag LOCUS_58590 2084 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 3863 4381 gene locus_tag LOCUS_58600 3863 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58600 6292 4412 gene locus_tag LOCUS_58610 6292 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58610 >Feature sequence196 1851 328 gene locus_tag LOCUS_58620 1851 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58620 3173 4249 gene locus_tag LOCUS_58630 3173 4249 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_58630 4276 5139 gene locus_tag LOCUS_58640 4276 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 5143 6207 gene locus_tag LOCUS_58650 5143 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 6287 7837 gene locus_tag LOCUS_58660 6287 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 7961 8848 gene locus_tag LOCUS_58670 7961 8848 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_58670 >Feature sequence197 183 830 gene locus_tag LOCUS_58680 gene queE 183 830 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBX3 protein_id gnl|my_center|LOCUS_58680 857 1762 gene locus_tag LOCUS_58690 857 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58690 3927 1759 gene locus_tag LOCUS_58700 3927 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 4850 4074 gene locus_tag LOCUS_58710 4850 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58710 5701 4847 gene locus_tag LOCUS_58720 5701 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 7780 5822 gene locus_tag LOCUS_58730 7780 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 8116 7832 gene locus_tag LOCUS_58740 8116 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 >Feature sequence198 1122 88 gene locus_tag LOCUS_58750 gene rtcA 1122 88 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46849 protein_id gnl|my_center|LOCUS_58750 1837 1223 gene locus_tag LOCUS_58760 1837 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58760 2133 3113 gene locus_tag LOCUS_58770 2133 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 3110 3706 gene locus_tag LOCUS_58780 3110 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 3714 5186 gene locus_tag LOCUS_58790 3714 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58790 5560 5195 gene locus_tag LOCUS_58800 5560 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 5778 7796 gene locus_tag LOCUS_58810 5778 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58810 >Feature sequence199 2831 324 gene locus_tag LOCUS_58820 gene lon-2 2831 324 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C84 protein_id gnl|my_center|LOCUS_58820 4193 2952 gene locus_tag LOCUS_58830 gene clpX 4193 2952 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C83 protein_id gnl|my_center|LOCUS_58830 5122 4418 gene locus_tag LOCUS_58840 gene clpP 5122 4418 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY6 protein_id gnl|my_center|LOCUS_58840 6592 5243 gene locus_tag LOCUS_58850 gene tig 6592 5243 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C81 protein_id gnl|my_center|LOCUS_58850 7118 7044 gene locus_tag LOCUS_t00760 7118 7044 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7250 7176 gene locus_tag LOCUS_t00770 7250 7176 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7425 7351 gene locus_tag LOCUS_t00780 7425 7351 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7558 7484 gene locus_tag LOCUS_t00790 7558 7484 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence200 332 2368 gene locus_tag LOCUS_58860 332 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58860 2491 4473 gene locus_tag LOCUS_58870 2491 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58870 4610 5218 gene locus_tag LOCUS_58880 4610 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 6156 7106 gene locus_tag LOCUS_58890 6156 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 >Feature sequence201 299 700 gene locus_tag LOCUS_58900 299 700 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535495.1 protein_id gnl|my_center|LOCUS_58900 866 2143 gene locus_tag LOCUS_58910 866 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 2825 2151 gene locus_tag LOCUS_58920 2825 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 3899 2958 gene locus_tag LOCUS_58930 3899 2958 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229150.1 protein_id gnl|my_center|LOCUS_58930 4683 3934 gene locus_tag LOCUS_58940 4683 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 5049 4783 gene locus_tag LOCUS_58950 5049 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58950 5213 5710 gene locus_tag LOCUS_58960 gene recX 5213 5710 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWP2 protein_id gnl|my_center|LOCUS_58960 7063 5870 gene locus_tag LOCUS_58970 7063 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 7315 7776 gene locus_tag LOCUS_58980 7315 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 >Feature sequence202 333 82 gene locus_tag LOCUS_58990 333 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58990 1437 538 gene locus_tag LOCUS_59000 1437 538 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942084.1 protein_id gnl|my_center|LOCUS_59000 3858 1663 gene locus_tag LOCUS_59010 3858 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 4874 3939 gene locus_tag LOCUS_59020 4874 3939 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388253.1 protein_id gnl|my_center|LOCUS_59020 6468 4927 gene locus_tag LOCUS_59030 gene crtI 6468 4927 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_59030 7426 6656 gene locus_tag LOCUS_59040 gene crtO 7426 6656 CDS product beta-carotene ketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141726.1 protein_id gnl|my_center|LOCUS_59040 >Feature sequence203 <1 2162 gene locus_tag LOCUS_59050 <1 2162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RSQ7:glutamate-ammonia-ligase adenylyltransferase 2247 3890 gene locus_tag LOCUS_59060 2247 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59060 4188 5108 gene locus_tag LOCUS_59070 gene ilvE 4188 5108 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_59070 5212 6285 gene locus_tag LOCUS_59080 5212 6285 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763387.1 protein_id gnl|my_center|LOCUS_59080 6407 7336 gene locus_tag LOCUS_59090 6407 7336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 >Feature sequence204 >Feature sequence205 928 110 gene locus_tag LOCUS_59100 928 110 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704080.1 protein_id gnl|my_center|LOCUS_59100 1740 973 gene locus_tag LOCUS_59110 1740 973 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SC0 protein_id gnl|my_center|LOCUS_59110 1904 2179 gene locus_tag LOCUS_59120 1904 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 3929 2247 gene locus_tag LOCUS_59130 3929 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 4361 4050 gene locus_tag LOCUS_59140 4361 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59140 4558 5742 gene locus_tag LOCUS_59150 4558 5742 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815362.1 protein_id gnl|my_center|LOCUS_59150 6451 5807 gene locus_tag LOCUS_59160 6451 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 >Feature sequence206 1141 2352 gene locus_tag LOCUS_59170 1141 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59170 2406 5948 gene locus_tag LOCUS_59180 2406 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59180 >Feature sequence207 705 1541 gene locus_tag LOCUS_59190 705 1541 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026122.1 protein_id gnl|my_center|LOCUS_59190 4591 1703 gene locus_tag LOCUS_59200 gene polA 4591 1703 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260947.1 protein_id gnl|my_center|LOCUS_59200 4878 5429 gene locus_tag LOCUS_59210 4878 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 5533 5937 gene locus_tag LOCUS_59220 gene yqjT 5533 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54557 protein_id gnl|my_center|LOCUS_59220 6816 6106 gene locus_tag LOCUS_59230 6816 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 >Feature sequence208 2144 3244 gene locus_tag LOCUS_59240 2144 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59240 4470 3415 gene locus_tag LOCUS_59250 4470 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59250 6569 4596 gene locus_tag LOCUS_59260 6569 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 >Feature sequence209 6454 1400 gene locus_tag LOCUS_59270 6454 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 >Feature sequence210 1223 198 gene locus_tag LOCUS_59280 1223 198 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707778.1 protein_id gnl|my_center|LOCUS_59280 3172 1472 gene locus_tag LOCUS_59290 3172 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 4008 3319 gene locus_tag LOCUS_59300 4008 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59300 4034 5689 gene locus_tag LOCUS_59310 gene mhpA 4034 5689 CDS product 3-(3-hydroxyphenyl)propionate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225551.1 protein_id gnl|my_center|LOCUS_59310 >Feature sequence211 998 240 gene locus_tag LOCUS_59320 998 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59320 3818 1002 gene locus_tag LOCUS_59330 3818 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59330 5897 3954 gene locus_tag LOCUS_59340 5897 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 >Feature sequence212 1134 166 gene locus_tag LOCUS_59350 1134 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59350 1674 2393 gene locus_tag LOCUS_59360 1674 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59360 2489 2851 gene locus_tag LOCUS_59370 2489 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59370 3593 3000 gene locus_tag LOCUS_59380 3593 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59380 4070 5833 gene locus_tag LOCUS_59390 4070 5833 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917969.1 protein_id gnl|my_center|LOCUS_59390 >Feature sequence213 577 59 gene locus_tag LOCUS_59400 577 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59400 1261 683 gene locus_tag LOCUS_59410 1261 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 1496 1888 gene locus_tag LOCUS_59420 1496 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 1892 2716 gene locus_tag LOCUS_59430 1892 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59430 2818 4407 gene locus_tag LOCUS_59440 2818 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59440 4494 5741 gene locus_tag LOCUS_59450 4494 5741 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566866.1 protein_id gnl|my_center|LOCUS_59450 >Feature sequence214 <1 1147 gene locus_tag LOCUS_59460 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001700790.1:putative serine/threonine-protein kinase PknA 2516 1239 gene locus_tag LOCUS_59470 2516 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59470 3048 2602 gene locus_tag LOCUS_59480 3048 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 >Feature sequence215 180 854 gene locus_tag LOCUS_59490 180 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 1088 1471 gene locus_tag LOCUS_59500 1088 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59500 1591 3174 gene locus_tag LOCUS_59510 1591 3174 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530218.1 protein_id gnl|my_center|LOCUS_59510 4728 3373 gene locus_tag LOCUS_59520 4728 3373 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_59520 5129 4725 gene locus_tag LOCUS_59530 5129 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 5094 5273 gene locus_tag LOCUS_59540 5094 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59540 >Feature sequence216 297 2072 gene locus_tag LOCUS_59550 297 2072 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_59550 2370 3812 gene locus_tag LOCUS_59560 2370 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 3951 5003 gene locus_tag LOCUS_59570 3951 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59570 >Feature sequence217 522 142 gene locus_tag LOCUS_59580 522 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 2144 648 gene locus_tag LOCUS_59590 2144 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59590 3436 2243 gene locus_tag LOCUS_59600 3436 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 3912 4742 gene locus_tag LOCUS_59610 3912 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59610 >Feature sequence218 1198 65 gene locus_tag LOCUS_59620 gene hisC2 1198 65 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57004 protein_id gnl|my_center|LOCUS_59620 1569 2570 gene locus_tag LOCUS_59630 gene cdh 1569 2570 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035475.1 protein_id gnl|my_center|LOCUS_59630 2909 3769 gene locus_tag LOCUS_59640 2909 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 3933 4598 gene locus_tag LOCUS_59650 3933 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 >Feature sequence219 2243 72 gene locus_tag LOCUS_59660 2243 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59660 3810 2623 gene locus_tag LOCUS_59670 3810 2623 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223974.1 protein_id gnl|my_center|LOCUS_59670 4202 4582 gene locus_tag LOCUS_59680 4202 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59680 >Feature sequence220 82 2031 gene locus_tag LOCUS_59690 82 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 >Feature sequence221 551 1546 gene locus_tag LOCUS_59700 551 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59700 1724 2518 gene locus_tag LOCUS_59710 1724 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 3489 2545 gene locus_tag LOCUS_59720 3489 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 3945 3607 gene locus_tag LOCUS_59730 3945 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59730 >Feature sequence222 499 1464 gene locus_tag LOCUS_59740 499 1464 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_59740 1461 2636 gene locus_tag LOCUS_59750 1461 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 2633 3556 gene locus_tag LOCUS_59760 2633 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59760 >Feature sequence223 <1 829 gene locus_tag LOCUS_59770 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940902.1:DNA methyltransferase 2048 852 gene locus_tag LOCUS_59780 2048 852 CDS product aminotransferase V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_59780 3736 2045 gene locus_tag LOCUS_59790 3736 2045 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_59790 >Feature sequence224 640 1404 gene locus_tag LOCUS_59800 640 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59800 1605 3107 gene locus_tag LOCUS_59810 1605 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59810 >Feature sequence225 732 64 gene locus_tag LOCUS_59820 732 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59820 2928 973 gene locus_tag LOCUS_59830 2928 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 >Feature sequence226 348 836 gene locus_tag LOCUS_59840 348 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 910 1731 gene locus_tag LOCUS_59850 910 1731 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767607.1 protein_id gnl|my_center|LOCUS_59850 <3077 1738 gene locus_tag LOCUS_59860 <3077 1738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963606.1:type I deoxyribonuclease HsdR >Feature sequence227 1900 215 gene locus_tag LOCUS_59870 1900 215 CDS product putative aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705270.1 protein_id gnl|my_center|LOCUS_59870 2355 2969 gene locus_tag LOCUS_59880 2355 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59880 >Feature sequence228 >Feature sequence229 265 1728 gene locus_tag LOCUS_59890 265 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59890 1918 2232 gene locus_tag LOCUS_59900 1918 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59900 2245 2829 gene locus_tag LOCUS_59910 2245 2829 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_59910 >Feature sequence230 >Feature sequence231 >Feature sequence232 173 1363 gene locus_tag LOCUS_59920 173 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 1383 2153 gene locus_tag LOCUS_59930 1383 2153 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142000.1 protein_id gnl|my_center|LOCUS_59930 >Feature sequence233 1909 311 gene locus_tag LOCUS_59940 1909 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 >Feature sequence234 612 1658 gene locus_tag LOCUS_59950 612 1658 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BQ0 protein_id gnl|my_center|LOCUS_59950 >Feature sequence235 330 1718 gene locus_tag LOCUS_59960 330 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59960 >Feature sequence236