>Feature sequence001 810 49 gene locus_tag LOCUS_00010 gene rsmH 810 49 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60396 protein_id gnl|my_center|LOCUS_00010 1391 927 gene locus_tag LOCUS_00020 gene mraZ 1391 927 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F36 protein_id gnl|my_center|LOCUS_00020 1799 2071 gene locus_tag LOCUS_00030 1799 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2294 3913 gene locus_tag LOCUS_00040 gene uup 2294 3913 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626143.1 protein_id gnl|my_center|LOCUS_00040 4010 4756 gene locus_tag LOCUS_00050 4010 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5951 4767 gene locus_tag LOCUS_00060 gene alr 5951 4767 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_00060 6193 6687 gene locus_tag LOCUS_00070 6193 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7233 6679 gene locus_tag LOCUS_00080 7233 6679 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8I4 protein_id gnl|my_center|LOCUS_00080 8705 7233 gene locus_tag LOCUS_00090 8705 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11304 8707 gene locus_tag LOCUS_00100 11304 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12574 11426 gene locus_tag LOCUS_00110 12574 11426 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228728.1 protein_id gnl|my_center|LOCUS_00110 12669 15494 gene locus_tag LOCUS_00120 12669 15494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16244 15498 gene locus_tag LOCUS_00130 16244 15498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 19145 16272 gene locus_tag LOCUS_00140 19145 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 19347 23510 gene locus_tag LOCUS_00150 19347 23510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 23615 26959 gene locus_tag LOCUS_00160 23615 26959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 27168 27659 gene locus_tag LOCUS_00170 27168 27659 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902274.1 protein_id gnl|my_center|LOCUS_00170 27919 27665 gene locus_tag LOCUS_00180 27919 27665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 28974 28132 gene locus_tag LOCUS_00190 28974 28132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 29819 28974 gene locus_tag LOCUS_00200 29819 28974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 30751 29840 gene locus_tag LOCUS_00210 30751 29840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 31501 30851 gene locus_tag LOCUS_00220 31501 30851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 31740 33017 gene locus_tag LOCUS_00230 gene wecC 31740 33017 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482531.1 protein_id gnl|my_center|LOCUS_00230 33029 34009 gene locus_tag LOCUS_00240 33029 34009 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403376.1 protein_id gnl|my_center|LOCUS_00240 34013 34990 gene locus_tag LOCUS_00250 gene fcl 34013 34990 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL64 protein_id gnl|my_center|LOCUS_00250 35087 35992 gene locus_tag LOCUS_00260 35087 35992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 35989 36942 gene locus_tag LOCUS_00270 35989 36942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 37035 37316 gene locus_tag LOCUS_00280 37035 37316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 37313 38212 gene locus_tag LOCUS_00290 37313 38212 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_00290 38214 38546 gene locus_tag LOCUS_00300 38214 38546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 39695 38577 gene locus_tag LOCUS_00310 39695 38577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 41371 39692 gene locus_tag LOCUS_00320 41371 39692 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_00320 41661 41530 gene locus_tag LOCUS_00330 41661 41530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 43550 41799 gene locus_tag LOCUS_00340 43550 41799 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932828.1 protein_id gnl|my_center|LOCUS_00340 43822 46956 gene locus_tag LOCUS_00350 43822 46956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 47623 46973 gene locus_tag LOCUS_00360 47623 46973 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869805.1 protein_id gnl|my_center|LOCUS_00360 48582 47635 gene locus_tag LOCUS_00370 48582 47635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00370 48891 48598 gene locus_tag LOCUS_00380 48891 48598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00380 49817 49056 gene locus_tag LOCUS_00390 49817 49056 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119944.1 protein_id gnl|my_center|LOCUS_00390 51018 49879 gene locus_tag LOCUS_00400 gene caiA 51018 49879 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215329.1 protein_id gnl|my_center|LOCUS_00400 52233 51904 gene locus_tag LOCUS_00410 52233 51904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 53589 52696 gene locus_tag LOCUS_00420 53589 52696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 53790 55664 gene locus_tag LOCUS_00430 53790 55664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 55738 56847 gene locus_tag LOCUS_00440 gene speB 55738 56847 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224492.1 protein_id gnl|my_center|LOCUS_00440 56844 57392 gene locus_tag LOCUS_00450 56844 57392 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327748.1 protein_id gnl|my_center|LOCUS_00450 57983 57351 gene locus_tag LOCUS_00460 57983 57351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 57885 58115 gene locus_tag LOCUS_00470 57885 58115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 59423 58161 gene locus_tag LOCUS_00480 59423 58161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 60844 59423 gene locus_tag LOCUS_00490 60844 59423 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681529.1 protein_id gnl|my_center|LOCUS_00490 62150 60897 gene locus_tag LOCUS_00500 62150 60897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 63329 62253 gene locus_tag LOCUS_00510 63329 62253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 64096 63326 gene locus_tag LOCUS_00520 gene ilvE 64096 63326 CDS product putative branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P74921 protein_id gnl|my_center|LOCUS_00520 65738 64110 gene locus_tag LOCUS_00530 65738 64110 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_00530 67308 65836 gene locus_tag LOCUS_00540 gene hflX 67308 65836 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFQ8 protein_id gnl|my_center|LOCUS_00540 67601 69136 gene locus_tag LOCUS_00550 67601 69136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875631.1 protein_id gnl|my_center|LOCUS_00550 70474 69140 gene locus_tag LOCUS_00560 70474 69140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122547.1 protein_id gnl|my_center|LOCUS_00560 72060 70471 gene locus_tag LOCUS_00570 72060 70471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 73311 72166 gene locus_tag LOCUS_00580 73311 72166 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405081.1 protein_id gnl|my_center|LOCUS_00580 74704 73325 gene locus_tag LOCUS_00590 74704 73325 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_00590 74913 75227 gene locus_tag LOCUS_00600 74913 75227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 75391 76404 gene locus_tag LOCUS_00610 75391 76404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 77568 76549 gene locus_tag LOCUS_00620 gene srkA 77568 76549 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AA8 protein_id gnl|my_center|LOCUS_00620 77982 77629 gene locus_tag LOCUS_00630 77982 77629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 78527 78000 gene locus_tag LOCUS_00640 78527 78000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 81893 78774 gene locus_tag LOCUS_00650 81893 78774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 82115 85339 gene locus_tag LOCUS_00660 82115 85339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 86341 85349 gene locus_tag LOCUS_00670 86341 85349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 86477 87877 gene locus_tag LOCUS_00680 gene asnC 86477 87877 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQR5 protein_id gnl|my_center|LOCUS_00680 88407 87925 gene locus_tag LOCUS_00690 88407 87925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 88539 89798 gene locus_tag LOCUS_00700 88539 89798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 89815 91638 gene locus_tag LOCUS_00710 89815 91638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 91713 92639 gene locus_tag LOCUS_00720 gene ilvA 91713 92639 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227667.1 protein_id gnl|my_center|LOCUS_00720 95905 92675 gene locus_tag LOCUS_00730 95905 92675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 97083 98588 gene locus_tag LOCUS_00740 97083 98588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067230.1 protein_id gnl|my_center|LOCUS_00740 98592 101708 gene locus_tag LOCUS_00750 gene dnaE2 98592 101708 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q881T7 protein_id gnl|my_center|LOCUS_00750 102212 101727 gene locus_tag LOCUS_00760 102212 101727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 103629 102928 gene locus_tag LOCUS_00770 103629 102928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 104811 103987 gene locus_tag LOCUS_00780 104811 103987 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_00780 104952 106010 gene locus_tag LOCUS_00790 104952 106010 CDS product hyaluronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705374.1 protein_id gnl|my_center|LOCUS_00790 106543 106007 gene locus_tag LOCUS_00800 106543 106007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 106744 107364 gene locus_tag LOCUS_00810 106744 107364 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_00810 107361 107819 gene locus_tag LOCUS_00820 107361 107819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 110098 107816 gene locus_tag LOCUS_00830 110098 107816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 113900 110298 gene locus_tag LOCUS_00840 113900 110298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 115065 113935 gene locus_tag LOCUS_00850 115065 113935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 117872 115065 gene locus_tag LOCUS_00860 117872 115065 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205537.1 protein_id gnl|my_center|LOCUS_00860 119721 117862 gene locus_tag LOCUS_00870 119721 117862 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539133.1 protein_id gnl|my_center|LOCUS_00870 120335 119718 gene locus_tag LOCUS_00880 120335 119718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262095.1 protein_id gnl|my_center|LOCUS_00880 121097 120609 gene locus_tag LOCUS_00890 gene slyD 121097 120609 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB16 protein_id gnl|my_center|LOCUS_00890 121788 121444 gene locus_tag LOCUS_00900 121788 121444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 121843 122694 gene locus_tag LOCUS_00910 121843 122694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 123373 122747 gene locus_tag LOCUS_00920 123373 122747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 126120 123370 gene locus_tag LOCUS_00930 126120 123370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 127450 126278 gene locus_tag LOCUS_00940 127450 126278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 127546 128103 gene locus_tag LOCUS_00950 127546 128103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 128109 128579 gene locus_tag LOCUS_00960 128109 128579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 128940 128587 gene locus_tag LOCUS_00970 128940 128587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 129441 129043 gene locus_tag LOCUS_00980 129441 129043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 129728 133600 gene locus_tag LOCUS_00990 129728 133600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 134501 133956 gene locus_tag LOCUS_01000 134501 133956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 136129 134690 gene locus_tag LOCUS_01010 136129 134690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_01010 137243 138334 gene locus_tag LOCUS_01020 137243 138334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 139074 138331 gene locus_tag LOCUS_01030 gene trmJ 139074 138331 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8G5 protein_id gnl|my_center|LOCUS_01030 140153 139071 gene locus_tag LOCUS_01040 140153 139071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 140230 141594 gene locus_tag LOCUS_01050 140230 141594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 141663 142694 gene locus_tag LOCUS_01060 141663 142694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 142908 144269 gene locus_tag LOCUS_01070 142908 144269 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039111.1 protein_id gnl|my_center|LOCUS_01070 144504 145292 gene locus_tag LOCUS_01080 gene tatD 144504 145292 CDS product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MTU2 protein_id gnl|my_center|LOCUS_01080 145940 145452 gene locus_tag LOCUS_01090 145940 145452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 146199 147809 gene locus_tag LOCUS_01100 146199 147809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 147806 148876 gene locus_tag LOCUS_01110 147806 148876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 148975 149622 gene locus_tag LOCUS_01120 148975 149622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 149634 150149 gene locus_tag LOCUS_01130 149634 150149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 150198 151739 gene locus_tag LOCUS_01140 150198 151739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 151927 152796 gene locus_tag LOCUS_01150 151927 152796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 153684 152782 gene locus_tag LOCUS_01160 gene ctaA 153684 152782 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H039 protein_id gnl|my_center|LOCUS_01160 153662 153841 gene locus_tag LOCUS_01170 153662 153841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 156464 153906 gene locus_tag LOCUS_01180 156464 153906 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403080.1 protein_id gnl|my_center|LOCUS_01180 156897 159944 gene locus_tag LOCUS_01190 156897 159944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 161595 159952 gene locus_tag LOCUS_01200 161595 159952 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_01200 161815 162192 gene locus_tag LOCUS_01210 161815 162192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 162395 163351 gene locus_tag LOCUS_01220 162395 163351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 165168 163354 gene locus_tag LOCUS_01230 165168 163354 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E250 protein_id gnl|my_center|LOCUS_01230 165239 167950 gene locus_tag LOCUS_01240 165239 167950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 167984 170908 gene locus_tag LOCUS_01250 167984 170908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 172141 170930 gene locus_tag LOCUS_01260 172141 170930 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245819.1 protein_id gnl|my_center|LOCUS_01260 172400 173563 gene locus_tag LOCUS_01270 172400 173563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 176388 173566 gene locus_tag LOCUS_01280 176388 173566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 176637 177755 gene locus_tag LOCUS_01290 176637 177755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 177885 178802 gene locus_tag LOCUS_01300 gene cysD 177885 178802 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_01300 178802 180790 gene locus_tag LOCUS_01310 gene cysNC 178802 180790 CDS product bifunctional enzyme CysN/CysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMW2 protein_id gnl|my_center|LOCUS_01310 180925 182394 gene locus_tag LOCUS_01320 180925 182394 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_01320 184320 182467 gene locus_tag LOCUS_01330 184320 182467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 184645 186405 gene locus_tag LOCUS_01340 184645 186405 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533660.1 protein_id gnl|my_center|LOCUS_01340 186537 186911 gene locus_tag LOCUS_01350 186537 186911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 188419 187055 gene locus_tag LOCUS_01360 188419 187055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 188644 189198 gene locus_tag LOCUS_01370 188644 189198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 189395 190168 gene locus_tag LOCUS_01380 189395 190168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 190311 192446 gene locus_tag LOCUS_01390 190311 192446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 192516 193832 gene locus_tag LOCUS_01400 gene pepP 192516 193832 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_01400 193846 194823 gene locus_tag LOCUS_01410 193846 194823 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703781.1 protein_id gnl|my_center|LOCUS_01410 194820 195809 gene locus_tag LOCUS_01420 194820 195809 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700070.1 protein_id gnl|my_center|LOCUS_01420 196740 195793 gene locus_tag LOCUS_01430 196740 195793 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_01430 198017 196740 gene locus_tag LOCUS_01440 198017 196740 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC96 protein_id gnl|my_center|LOCUS_01440 199078 198014 gene locus_tag LOCUS_01450 gene fni 199078 198014 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ26 protein_id gnl|my_center|LOCUS_01450 199814 199149 gene locus_tag LOCUS_01460 199814 199149 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XTK2 protein_id gnl|my_center|LOCUS_01460 200036 200386 gene locus_tag LOCUS_01470 200036 200386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 200609 200824 gene locus_tag LOCUS_01480 200609 200824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 200828 201037 gene locus_tag LOCUS_01490 200828 201037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 201056 201460 gene locus_tag LOCUS_01500 201056 201460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 201457 202380 gene locus_tag LOCUS_01510 gene prs 201457 202380 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4D0 protein_id gnl|my_center|LOCUS_01510 204109 202763 gene locus_tag LOCUS_01520 204109 202763 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_01520 204517 204113 gene locus_tag LOCUS_01530 204517 204113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 204692 205396 gene locus_tag LOCUS_01540 gene phoB 204692 205396 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_01540 205393 207198 gene locus_tag LOCUS_01550 gene phoR 205393 207198 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_01550 207215 208087 gene locus_tag LOCUS_01560 207215 208087 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_01560 208156 209478 gene locus_tag LOCUS_01570 208156 209478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 209475 209696 gene locus_tag LOCUS_01580 209475 209696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 211417 209711 gene locus_tag LOCUS_01590 211417 209711 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_01590 211512 212189 gene locus_tag LOCUS_01600 211512 212189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 212248 213123 gene locus_tag LOCUS_01610 212248 213123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 213294 213626 gene locus_tag LOCUS_01620 213294 213626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 213698 214204 gene locus_tag LOCUS_01630 213698 214204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 215602 214262 gene locus_tag LOCUS_01640 gene argG 215602 214262 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFW4 protein_id gnl|my_center|LOCUS_01640 215850 217949 gene locus_tag LOCUS_01650 215850 217949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 219876 218203 gene locus_tag LOCUS_01660 219876 218203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056580.1 protein_id gnl|my_center|LOCUS_01660 221089 220109 gene locus_tag LOCUS_01670 221089 220109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 221062 221265 gene locus_tag LOCUS_01680 221062 221265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 221280 222515 gene locus_tag LOCUS_01690 221280 222515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 222621 224360 gene locus_tag LOCUS_01700 222621 224360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539143.1 protein_id gnl|my_center|LOCUS_01700 224459 225880 gene locus_tag LOCUS_01710 224459 225880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 225877 226596 gene locus_tag LOCUS_01720 225877 226596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 >Feature sequence002 2778 1837 gene locus_tag LOCUS_01730 2778 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 6570 2881 gene locus_tag LOCUS_01740 6570 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 8015 6564 gene locus_tag LOCUS_01750 8015 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 11515 8129 gene locus_tag LOCUS_01760 11515 8129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 11969 13105 gene locus_tag LOCUS_01770 11969 13105 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640058.1 protein_id gnl|my_center|LOCUS_01770 14205 13102 gene locus_tag LOCUS_01780 14205 13102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 14385 14582 gene locus_tag LOCUS_01790 14385 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 16119 14530 gene locus_tag LOCUS_01800 gene ggt 16119 14530 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_01800 16193 16885 gene locus_tag LOCUS_01810 gene cobB 16193 16885 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67919 protein_id gnl|my_center|LOCUS_01810 16993 17880 gene locus_tag LOCUS_01820 16993 17880 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289749.1 protein_id gnl|my_center|LOCUS_01820 17926 18498 gene locus_tag LOCUS_01830 17926 18498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 18513 20027 gene locus_tag LOCUS_01840 18513 20027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 20043 21497 gene locus_tag LOCUS_01850 20043 21497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 21494 22681 gene locus_tag LOCUS_01860 21494 22681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 22678 23739 gene locus_tag LOCUS_01870 22678 23739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 23793 24551 gene locus_tag LOCUS_01880 23793 24551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 25626 24559 gene locus_tag LOCUS_01890 gene degP 25626 24559 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_01890 26731 25637 gene locus_tag LOCUS_01900 gene tqsA 26731 25637 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118294.1 protein_id gnl|my_center|LOCUS_01900 27113 27625 gene locus_tag LOCUS_01910 27113 27625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 27749 28984 gene locus_tag LOCUS_01920 27749 28984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 29073 30008 gene locus_tag LOCUS_01930 29073 30008 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9T3 protein_id gnl|my_center|LOCUS_01930 31569 30040 gene locus_tag LOCUS_01940 31569 30040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 33633 31648 gene locus_tag LOCUS_01950 33633 31648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 37261 33710 gene locus_tag LOCUS_01960 37261 33710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 37481 38431 gene locus_tag LOCUS_01970 gene gldA 37481 38431 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_01970 38428 41352 gene locus_tag LOCUS_01980 38428 41352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 41349 42389 gene locus_tag LOCUS_01990 41349 42389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 42401 43429 gene locus_tag LOCUS_02000 gene gluQ 42401 43429 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_02000 43426 44550 gene locus_tag LOCUS_02010 43426 44550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 44909 44535 gene locus_tag LOCUS_02020 44909 44535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 45092 45679 gene locus_tag LOCUS_02030 45092 45679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 47481 45691 gene locus_tag LOCUS_02040 47481 45691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 48854 47736 gene locus_tag LOCUS_02050 48854 47736 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_02050 50093 48870 gene locus_tag LOCUS_02060 50093 48870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 50330 51190 gene locus_tag LOCUS_02070 50330 51190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 51259 52338 gene locus_tag LOCUS_02080 51259 52338 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC70 protein_id gnl|my_center|LOCUS_02080 52335 52751 gene locus_tag LOCUS_02090 52335 52751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 53215 52727 gene locus_tag LOCUS_02100 gene greB 53215 52727 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSG9 protein_id gnl|my_center|LOCUS_02100 53901 53215 gene locus_tag LOCUS_02110 53901 53215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 55627 53912 gene locus_tag LOCUS_02120 55627 53912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 55806 55973 gene locus_tag LOCUS_02130 55806 55973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 56368 58419 gene locus_tag LOCUS_02140 56368 58419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 58744 60639 gene locus_tag LOCUS_02150 58744 60639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 60653 62521 gene locus_tag LOCUS_02160 60653 62521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 62662 63474 gene locus_tag LOCUS_02170 62662 63474 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G02 protein_id gnl|my_center|LOCUS_02170 63635 65134 gene locus_tag LOCUS_02180 63635 65134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 66162 65131 gene locus_tag LOCUS_02190 66162 65131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 66371 67744 gene locus_tag LOCUS_02200 66371 67744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 70005 67741 gene locus_tag LOCUS_02210 70005 67741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 71510 70131 gene locus_tag LOCUS_02220 71510 70131 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_02220 71762 73492 gene locus_tag LOCUS_02230 71762 73492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 74785 73511 gene locus_tag LOCUS_02240 74785 73511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 74958 76160 gene locus_tag LOCUS_02250 74958 76160 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_02250 76153 76926 gene locus_tag LOCUS_02260 76153 76926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 77111 78166 gene locus_tag LOCUS_02270 gene recA 77111 78166 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62215 protein_id gnl|my_center|LOCUS_02270 78357 79805 gene locus_tag LOCUS_02280 78357 79805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 79805 80233 gene locus_tag LOCUS_02290 79805 80233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 81591 80263 gene locus_tag LOCUS_02300 81591 80263 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537450.1 protein_id gnl|my_center|LOCUS_02300 81822 82676 gene locus_tag LOCUS_02310 gene rpsB 81822 82676 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW1 protein_id gnl|my_center|LOCUS_02310 82798 83388 gene locus_tag LOCUS_02320 gene tsf 82798 83388 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61333 protein_id gnl|my_center|LOCUS_02320 83398 84120 gene locus_tag LOCUS_02330 gene pyrH 83398 84120 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R6G5 protein_id gnl|my_center|LOCUS_02330 84239 84796 gene locus_tag LOCUS_02340 gene frr 84239 84796 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185S5 protein_id gnl|my_center|LOCUS_02340 86154 84832 gene locus_tag LOCUS_02350 86154 84832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 86265 86423 gene locus_tag LOCUS_02360 86265 86423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 86658 86996 gene locus_tag LOCUS_02370 86658 86996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 87297 87665 gene locus_tag LOCUS_02380 87297 87665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 88339 88091 gene locus_tag LOCUS_02390 88339 88091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 90494 88620 gene locus_tag LOCUS_02400 90494 88620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 91659 90757 gene locus_tag LOCUS_02410 91659 90757 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221868.1 protein_id gnl|my_center|LOCUS_02410 92420 91830 gene locus_tag LOCUS_02420 92420 91830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 92665 94161 gene locus_tag LOCUS_02430 92665 94161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 94322 96793 gene locus_tag LOCUS_02440 94322 96793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 96793 97710 gene locus_tag LOCUS_02450 gene pilD 96793 97710 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ8 protein_id gnl|my_center|LOCUS_02450 99239 97713 gene locus_tag LOCUS_02460 99239 97713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 99633 99274 gene locus_tag LOCUS_02470 99633 99274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 100681 99887 gene locus_tag LOCUS_02480 gene atpB 100681 99887 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GB2 protein_id gnl|my_center|LOCUS_02480 101054 100674 gene locus_tag LOCUS_02490 101054 100674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 101337 101059 gene locus_tag LOCUS_02500 101337 101059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 102620 101334 gene locus_tag LOCUS_02510 102620 101334 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460175.1 protein_id gnl|my_center|LOCUS_02510 105245 102675 gene locus_tag LOCUS_02520 gene gyrA 105245 102675 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H88 protein_id gnl|my_center|LOCUS_02520 106721 105369 gene locus_tag LOCUS_02530 106721 105369 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257549.1 protein_id gnl|my_center|LOCUS_02530 108375 106981 gene locus_tag LOCUS_02540 108375 106981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 108484 109947 gene locus_tag LOCUS_02550 gene pepA 108484 109947 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67868 protein_id gnl|my_center|LOCUS_02550 110454 109993 gene locus_tag LOCUS_02560 110454 109993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 111721 110480 gene locus_tag LOCUS_02570 111721 110480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 115564 111794 gene locus_tag LOCUS_02580 115564 111794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 117013 115667 gene locus_tag LOCUS_02590 117013 115667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 117095 117736 gene locus_tag LOCUS_02600 117095 117736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 118518 117742 gene locus_tag LOCUS_02610 118518 117742 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_02610 118653 119462 gene locus_tag LOCUS_02620 118653 119462 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030521.1 protein_id gnl|my_center|LOCUS_02620 119459 120370 gene locus_tag LOCUS_02630 119459 120370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 120375 120953 gene locus_tag LOCUS_02640 120375 120953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 120950 122830 gene locus_tag LOCUS_02650 120950 122830 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403633.1 protein_id gnl|my_center|LOCUS_02650 122888 123202 gene locus_tag LOCUS_02660 122888 123202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 123289 125739 gene locus_tag LOCUS_02670 123289 125739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 125792 127030 gene locus_tag LOCUS_02680 125792 127030 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081170.1 protein_id gnl|my_center|LOCUS_02680 127032 128933 gene locus_tag LOCUS_02690 127032 128933 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_02690 128930 130870 gene locus_tag LOCUS_02700 128930 130870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 132029 130878 gene locus_tag LOCUS_02710 132029 130878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 134252 132090 gene locus_tag LOCUS_02720 134252 132090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 135568 134252 gene locus_tag LOCUS_02730 135568 134252 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_02730 136600 135662 gene locus_tag LOCUS_02740 gene wbtF 136600 135662 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_02740 136672 137619 gene locus_tag LOCUS_02750 136672 137619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 138269 137661 gene locus_tag LOCUS_02760 138269 137661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 139655 138318 gene locus_tag LOCUS_02770 139655 138318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 140337 139771 gene locus_tag LOCUS_02780 140337 139771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 141866 140472 gene locus_tag LOCUS_02790 141866 140472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 142896 142273 gene locus_tag LOCUS_02800 142896 142273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 143592 142924 gene locus_tag LOCUS_02810 143592 142924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 144336 143686 gene locus_tag LOCUS_02820 144336 143686 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_02820 144858 144595 gene locus_tag LOCUS_02830 144858 144595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 146213 144858 gene locus_tag LOCUS_02840 146213 144858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 150001 146210 gene locus_tag LOCUS_02850 150001 146210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 152291 149994 gene locus_tag LOCUS_02860 152291 149994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 152992 152300 gene locus_tag LOCUS_02870 152992 152300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 154095 153136 gene locus_tag LOCUS_02880 154095 153136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 154433 154170 gene locus_tag LOCUS_02890 gene rpmA 154433 154170 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGJ4 protein_id gnl|my_center|LOCUS_02890 154775 154461 gene locus_tag LOCUS_02900 gene rplU 154775 154461 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EE0 protein_id gnl|my_center|LOCUS_02900 155999 154953 gene locus_tag LOCUS_02910 gene mtnA 155999 154953 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y8 protein_id gnl|my_center|LOCUS_02910 156356 156165 gene locus_tag LOCUS_02920 156356 156165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 158650 156467 gene locus_tag LOCUS_02930 158650 156467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 159699 158647 gene locus_tag LOCUS_02940 159699 158647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 162050 159834 gene locus_tag LOCUS_02950 162050 159834 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGX9 protein_id gnl|my_center|LOCUS_02950 162454 162335 gene locus_tag LOCUS_02960 162454 162335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 164517 162688 gene locus_tag LOCUS_02970 gene glmS 164517 162688 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GH6 protein_id gnl|my_center|LOCUS_02970 165940 164531 gene locus_tag LOCUS_02980 gene glmU 165940 164531 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GH5 protein_id gnl|my_center|LOCUS_02980 166414 167343 gene locus_tag LOCUS_02990 gene ilvE 166414 167343 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940455.1 protein_id gnl|my_center|LOCUS_02990 167407 168177 gene locus_tag LOCUS_03000 167407 168177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 168794 168228 gene locus_tag LOCUS_03010 168794 168228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 168877 169668 gene locus_tag LOCUS_03020 168877 169668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 170153 169674 gene locus_tag LOCUS_03030 170153 169674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 171253 170150 gene locus_tag LOCUS_03040 171253 170150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 171879 171250 gene locus_tag LOCUS_03050 gene rlmE 171879 171250 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729T9 protein_id gnl|my_center|LOCUS_03050 172583 171978 gene locus_tag LOCUS_03060 172583 171978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 172741 173490 gene locus_tag LOCUS_03070 172741 173490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 173664 175115 gene locus_tag LOCUS_03080 173664 175115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 175253 176374 gene locus_tag LOCUS_03090 175253 176374 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804287.1 protein_id gnl|my_center|LOCUS_03090 177666 176383 gene locus_tag LOCUS_03100 177666 176383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 178186 184443 gene locus_tag LOCUS_03110 178186 184443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 184581 184805 gene locus_tag LOCUS_03120 184581 184805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 184811 188278 gene locus_tag LOCUS_03130 gene recC 184811 188278 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPZ0 protein_id gnl|my_center|LOCUS_03130 188278 191847 gene locus_tag LOCUS_03140 gene recB 188278 191847 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M84 protein_id gnl|my_center|LOCUS_03140 191837 193777 gene locus_tag LOCUS_03150 gene recD 191837 193777 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CR47 protein_id gnl|my_center|LOCUS_03150 193774 194775 gene locus_tag LOCUS_03160 gene rsmC 193774 194775 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2W4 protein_id gnl|my_center|LOCUS_03160 194772 195479 gene locus_tag LOCUS_03170 194772 195479 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL42 protein_id gnl|my_center|LOCUS_03170 195865 195476 gene locus_tag LOCUS_03180 gene apaG 195865 195476 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5R0 protein_id gnl|my_center|LOCUS_03180 197673 195919 gene locus_tag LOCUS_03190 197673 195919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 198185 197736 gene locus_tag LOCUS_03200 198185 197736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 198211 199086 gene locus_tag LOCUS_03210 198211 199086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_03210 199296 200522 gene locus_tag LOCUS_03220 199296 200522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 201748 200552 gene locus_tag LOCUS_03230 201748 200552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 201938 203089 gene locus_tag LOCUS_03240 gene aspC 201938 203089 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56232 protein_id gnl|my_center|LOCUS_03240 203181 203891 gene locus_tag LOCUS_03250 203181 203891 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_03250 203888 205978 gene locus_tag LOCUS_03260 203888 205978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 205978 207318 gene locus_tag LOCUS_03270 205978 207318 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481724.1 protein_id gnl|my_center|LOCUS_03270 207318 208103 gene locus_tag LOCUS_03280 207318 208103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 208100 209533 gene locus_tag LOCUS_03290 208100 209533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 >Feature sequence003 1263 4871 gene locus_tag LOCUS_03300 1263 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 6287 4923 gene locus_tag LOCUS_03310 6287 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 6446 7285 gene locus_tag LOCUS_03320 gene deoD-1 6446 7285 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q839I1 protein_id gnl|my_center|LOCUS_03320 7318 7653 gene locus_tag LOCUS_03330 gene hit 7318 7653 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124235.1 protein_id gnl|my_center|LOCUS_03330 8501 7656 gene locus_tag LOCUS_03340 gene ttcA 8501 7656 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F956 protein_id gnl|my_center|LOCUS_03340 9892 8594 gene locus_tag LOCUS_03350 9892 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 9978 10487 gene locus_tag LOCUS_03360 9978 10487 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_03360 11913 10525 gene locus_tag LOCUS_03370 11913 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 12569 11943 gene locus_tag LOCUS_03380 12569 11943 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119848.1 protein_id gnl|my_center|LOCUS_03380 13385 12648 gene locus_tag LOCUS_03390 13385 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 14194 13424 gene locus_tag LOCUS_03400 14194 13424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 15735 14173 gene locus_tag LOCUS_03410 15735 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 16623 15754 gene locus_tag LOCUS_03420 16623 15754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 17095 17856 gene locus_tag LOCUS_03430 17095 17856 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648699.1 protein_id gnl|my_center|LOCUS_03430 18697 17876 gene locus_tag LOCUS_03440 18697 17876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 19142 20929 gene locus_tag LOCUS_03450 19142 20929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 21007 22515 gene locus_tag LOCUS_03460 21007 22515 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_03460 23157 23954 gene locus_tag LOCUS_03470 23157 23954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 24668 23901 gene locus_tag LOCUS_03480 24668 23901 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_03480 25510 24668 gene locus_tag LOCUS_03490 25510 24668 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_03490 25728 25507 gene locus_tag LOCUS_03500 25728 25507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 27101 25725 gene locus_tag LOCUS_03510 gene xseA 27101 25725 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJR3 protein_id gnl|my_center|LOCUS_03510 27612 27154 gene locus_tag LOCUS_03520 27612 27154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 28223 27612 gene locus_tag LOCUS_03530 28223 27612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 28873 28220 gene locus_tag LOCUS_03540 gene sigE 28873 28220 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGI0 protein_id gnl|my_center|LOCUS_03540 29072 32095 gene locus_tag LOCUS_03550 29072 32095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 32092 33672 gene locus_tag LOCUS_03560 32092 33672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 33669 34667 gene locus_tag LOCUS_03570 gene moxR 33669 34667 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_03570 34670 35554 gene locus_tag LOCUS_03580 34670 35554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_03580 35782 37644 gene locus_tag LOCUS_03590 35782 37644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 38107 37619 gene locus_tag LOCUS_03600 gene folA 38107 37619 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_03600 38971 38177 gene locus_tag LOCUS_03610 gene thyA 38971 38177 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRL3 protein_id gnl|my_center|LOCUS_03610 39843 38968 gene locus_tag LOCUS_03620 gene crt2 39843 38968 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861082.1 protein_id gnl|my_center|LOCUS_03620 39918 40772 gene locus_tag LOCUS_03630 39918 40772 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272323.1 protein_id gnl|my_center|LOCUS_03630 40799 41752 gene locus_tag LOCUS_03640 40799 41752 CDS product putative ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65090 protein_id gnl|my_center|LOCUS_03640 41745 42896 gene locus_tag LOCUS_03650 41745 42896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 42893 44101 gene locus_tag LOCUS_03660 42893 44101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 44101 44538 gene locus_tag LOCUS_03670 44101 44538 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Z8 protein_id gnl|my_center|LOCUS_03670 44538 45530 gene locus_tag LOCUS_03680 gene yceG 44538 45530 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_03680 46477 45536 gene locus_tag LOCUS_03690 gene gshB 46477 45536 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKF1 protein_id gnl|my_center|LOCUS_03690 46570 47181 gene locus_tag LOCUS_03700 46570 47181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 48069 47353 gene locus_tag LOCUS_03710 48069 47353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 49995 48145 gene locus_tag LOCUS_03720 gene uvrC 49995 48145 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747I7 protein_id gnl|my_center|LOCUS_03720 52001 49998 gene locus_tag LOCUS_03730 gene uvrB 52001 49998 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747K3 protein_id gnl|my_center|LOCUS_03730 53491 51998 gene locus_tag LOCUS_03740 gene cysS 53491 51998 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747A2 protein_id gnl|my_center|LOCUS_03740 53695 54948 gene locus_tag LOCUS_03750 53695 54948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 54953 55441 gene locus_tag LOCUS_03760 54953 55441 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770846.1 protein_id gnl|my_center|LOCUS_03760 55444 56355 gene locus_tag LOCUS_03770 55444 56355 CDS product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640062.1 protein_id gnl|my_center|LOCUS_03770 56352 57452 gene locus_tag LOCUS_03780 56352 57452 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031746.1 protein_id gnl|my_center|LOCUS_03780 57461 58255 gene locus_tag LOCUS_03790 gene hisN 57461 58255 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_03790 58388 58963 gene locus_tag LOCUS_03800 58388 58963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 59464 58970 gene locus_tag LOCUS_03810 59464 58970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 59598 60401 gene locus_tag LOCUS_03820 59598 60401 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_03820 60398 61270 gene locus_tag LOCUS_03830 60398 61270 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_03830 61769 61365 gene locus_tag LOCUS_03840 61769 61365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 63227 61794 gene locus_tag LOCUS_03850 gene atpD 63227 61794 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY0 protein_id gnl|my_center|LOCUS_03850 64160 63276 gene locus_tag LOCUS_03860 gene atpG 64160 63276 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY1 protein_id gnl|my_center|LOCUS_03860 65687 64179 gene locus_tag LOCUS_03870 gene atpA 65687 64179 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY2 protein_id gnl|my_center|LOCUS_03870 66262 65717 gene locus_tag LOCUS_03880 gene atpH 66262 65717 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY3 protein_id gnl|my_center|LOCUS_03880 66850 66275 gene locus_tag LOCUS_03890 66850 66275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 67329 66862 gene locus_tag LOCUS_03900 67329 66862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 67543 68475 gene locus_tag LOCUS_03910 67543 68475 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_03910 68535 69185 gene locus_tag LOCUS_03920 68535 69185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404002.1 protein_id gnl|my_center|LOCUS_03920 69182 70786 gene locus_tag LOCUS_03930 69182 70786 CDS product gliding motility ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623945.1 protein_id gnl|my_center|LOCUS_03930 70783 72087 gene locus_tag LOCUS_03940 70783 72087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 72930 72136 gene locus_tag LOCUS_03950 72930 72136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 73590 72931 gene locus_tag LOCUS_03960 73590 72931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 76180 73595 gene locus_tag LOCUS_03970 gene gyrB 76180 73595 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JT76 protein_id gnl|my_center|LOCUS_03970 76827 76375 gene locus_tag LOCUS_03980 76827 76375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 78603 76840 gene locus_tag LOCUS_03990 gene yidC 78603 76840 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXS4 protein_id gnl|my_center|LOCUS_03990 79926 81278 gene locus_tag LOCUS_04000 gene dnaA 79926 81278 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HQ03 protein_id gnl|my_center|LOCUS_04000 81474 82229 gene locus_tag LOCUS_04010 81474 82229 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_04010 82226 83254 gene locus_tag LOCUS_04020 82226 83254 CDS product corrinoid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_04020 83241 84005 gene locus_tag LOCUS_04030 gene fhuC 83241 84005 CDS product iron(3+)-hydroxamate import ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49938 protein_id gnl|my_center|LOCUS_04030 84002 85078 gene locus_tag LOCUS_04040 84002 85078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 86501 85107 gene locus_tag LOCUS_04050 86501 85107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 86689 87039 gene locus_tag LOCUS_04060 86689 87039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 87122 88333 gene locus_tag LOCUS_04070 87122 88333 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071432.1 protein_id gnl|my_center|LOCUS_04070 88330 89178 gene locus_tag LOCUS_04080 88330 89178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 90405 89188 gene locus_tag LOCUS_04090 90405 89188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_04090 92155 90419 gene locus_tag LOCUS_04100 92155 90419 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482641.1 protein_id gnl|my_center|LOCUS_04100 93186 92164 gene locus_tag LOCUS_04110 93186 92164 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143926.1 protein_id gnl|my_center|LOCUS_04110 93985 93266 gene locus_tag LOCUS_04120 93985 93266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 94573 94127 gene locus_tag LOCUS_04130 94573 94127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 94715 96160 gene locus_tag LOCUS_04140 94715 96160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 96161 97132 gene locus_tag LOCUS_04150 96161 97132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 98950 97133 gene locus_tag LOCUS_04160 98950 97133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 99748 99149 gene locus_tag LOCUS_04170 99748 99149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 101192 99855 gene locus_tag LOCUS_04180 gene dnaB 101192 99855 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEZ0 protein_id gnl|my_center|LOCUS_04180 101779 101324 gene locus_tag LOCUS_04190 gene rplI 101779 101324 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM4 protein_id gnl|my_center|LOCUS_04190 102039 101791 gene locus_tag LOCUS_04200 102039 101791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 102425 102036 gene locus_tag LOCUS_04210 102425 102036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 104754 102619 gene locus_tag LOCUS_04220 gene hppA1 104754 102619 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_04220 105462 104893 gene locus_tag LOCUS_04230 gene pth 105462 104893 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE6 protein_id gnl|my_center|LOCUS_04230 106137 105529 gene locus_tag LOCUS_04240 gene ctc 106137 105529 CDS product general stress protein CTC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14194 protein_id gnl|my_center|LOCUS_04240 107109 106171 gene locus_tag LOCUS_04250 gene prsA 107109 106171 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE8 protein_id gnl|my_center|LOCUS_04250 107201 107129 gene locus_tag LOCUS_t00010 107201 107129 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 107480 109411 gene locus_tag LOCUS_04260 107480 109411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 109759 109475 gene locus_tag LOCUS_04270 gene hup2 109759 109475 CDS product SPBc2 prophage-derived DNA-binding protein HU 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P68573 protein_id gnl|my_center|LOCUS_04270 110071 109787 gene locus_tag LOCUS_04280 110071 109787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 110927 111112 gene locus_tag LOCUS_04290 110927 111112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 112088 111105 gene locus_tag LOCUS_04300 gene truD 112088 111105 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RSX8 protein_id gnl|my_center|LOCUS_04300 114520 112172 gene locus_tag LOCUS_04310 114520 112172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 114653 115729 gene locus_tag LOCUS_04320 114653 115729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 116531 115698 gene locus_tag LOCUS_04330 116531 115698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 117309 116536 gene locus_tag LOCUS_04340 117309 116536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 119198 117309 gene locus_tag LOCUS_04350 119198 117309 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZU4 protein_id gnl|my_center|LOCUS_04350 121271 119202 gene locus_tag LOCUS_04360 121271 119202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 121832 121359 gene locus_tag LOCUS_04370 gene rlmH 121832 121359 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7U4 protein_id gnl|my_center|LOCUS_04370 122207 121851 gene locus_tag LOCUS_04380 gene rsfS 122207 121851 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Q6 protein_id gnl|my_center|LOCUS_04380 123479 122208 gene locus_tag LOCUS_04390 gene proA 123479 122208 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S354 protein_id gnl|my_center|LOCUS_04390 124803 123601 gene locus_tag LOCUS_04400 124803 123601 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142387.1 protein_id gnl|my_center|LOCUS_04400 125644 124853 gene locus_tag LOCUS_04410 125644 124853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 126245 125658 gene locus_tag LOCUS_04420 126245 125658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 126529 127230 gene locus_tag LOCUS_04430 126529 127230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 128056 127235 gene locus_tag LOCUS_04440 128056 127235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 128271 128681 gene locus_tag LOCUS_04450 128271 128681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 128720 129319 gene locus_tag LOCUS_04460 128720 129319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 130559 129276 gene locus_tag LOCUS_04470 gene rarA 130559 129276 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_04470 131853 130546 gene locus_tag LOCUS_04480 131853 130546 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HY00 protein_id gnl|my_center|LOCUS_04480 132601 131846 gene locus_tag LOCUS_04490 132601 131846 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_04490 133019 134266 gene locus_tag LOCUS_04500 gene rho 133019 134266 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748A7 protein_id gnl|my_center|LOCUS_04500 134404 134667 gene locus_tag LOCUS_04510 gene rpmE2 134404 134667 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CNB9 protein_id gnl|my_center|LOCUS_04510 134682 135752 gene locus_tag LOCUS_04520 gene prfA 134682 135752 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B1 protein_id gnl|my_center|LOCUS_04520 135796 136875 gene locus_tag LOCUS_04530 135796 136875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 137425 138330 gene locus_tag LOCUS_04540 137425 138330 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123806.1 protein_id gnl|my_center|LOCUS_04540 138450 142220 gene locus_tag LOCUS_04550 138450 142220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 143324 142188 gene locus_tag LOCUS_04560 gene proB 143324 142188 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Q3 protein_id gnl|my_center|LOCUS_04560 144655 145833 gene locus_tag LOCUS_04570 gene metK 144655 145833 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61946 protein_id gnl|my_center|LOCUS_04570 145830 147392 gene locus_tag LOCUS_04580 gene ahcY 145830 147392 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZM1 protein_id gnl|my_center|LOCUS_04580 148755 147472 gene locus_tag LOCUS_04590 gene murA 148755 147472 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W71 protein_id gnl|my_center|LOCUS_04590 149844 148759 gene locus_tag LOCUS_04600 gene recF 149844 148759 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H90 protein_id gnl|my_center|LOCUS_04600 150962 149850 gene locus_tag LOCUS_04610 gene dnaN 150962 149850 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H91 protein_id gnl|my_center|LOCUS_04610 151366 152382 gene locus_tag LOCUS_04620 gene pyrD 151366 152382 CDS product dihydroorotate dehydrogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405098.1 protein_id gnl|my_center|LOCUS_04620 152607 154085 gene locus_tag LOCUS_04630 152607 154085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 154086 155579 gene locus_tag LOCUS_04640 gene dacC 154086 155579 CDS product D-alanyl-D-alanine carboxypeptidase DacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39844 protein_id gnl|my_center|LOCUS_04640 155655 156485 gene locus_tag LOCUS_04650 155655 156485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 156652 157872 gene locus_tag LOCUS_04660 156652 157872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 158522 157875 gene locus_tag LOCUS_04670 158522 157875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 159823 158528 gene locus_tag LOCUS_04680 gene hisS 159823 158528 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UZ20 protein_id gnl|my_center|LOCUS_04680 161085 159853 gene locus_tag LOCUS_04690 161085 159853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 162355 161168 gene locus_tag LOCUS_04700 gene argJ 162355 161168 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62061 protein_id gnl|my_center|LOCUS_04700 165240 162352 gene locus_tag LOCUS_04710 gene secA 165240 162352 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLX5 protein_id gnl|my_center|LOCUS_04710 165985 165410 gene locus_tag LOCUS_04720 165985 165410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987119.1 protein_id gnl|my_center|LOCUS_04720 166755 165976 gene locus_tag LOCUS_04730 166755 165976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 167668 167024 gene locus_tag LOCUS_04740 gene tal 167668 167024 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748M4 protein_id gnl|my_center|LOCUS_04740 167840 168793 gene locus_tag LOCUS_04750 167840 168793 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_04750 170162 168810 gene locus_tag LOCUS_04760 gene ugd 170162 168810 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_04760 170405 171592 gene locus_tag LOCUS_04770 170405 171592 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFP2 protein_id gnl|my_center|LOCUS_04770 171661 172446 gene locus_tag LOCUS_04780 171661 172446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 172449 174758 gene locus_tag LOCUS_04790 172449 174758 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976405.1 protein_id gnl|my_center|LOCUS_04790 174797 175687 gene locus_tag LOCUS_04800 174797 175687 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_04800 175684 176262 gene locus_tag LOCUS_04810 175684 176262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 176395 178608 gene locus_tag LOCUS_04820 176395 178608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 178605 179039 gene locus_tag LOCUS_04830 178605 179039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 180058 179036 gene locus_tag LOCUS_04840 gene mutY 180058 179036 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_04840 180744 180106 gene locus_tag LOCUS_04850 180744 180106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 180839 181993 gene locus_tag LOCUS_04860 180839 181993 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_04860 181997 182965 gene locus_tag LOCUS_04870 181997 182965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 182980 183567 gene locus_tag LOCUS_04880 182980 183567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 183592 186648 gene locus_tag LOCUS_04890 183592 186648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 187398 186718 gene locus_tag LOCUS_04900 187398 186718 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_04900 187514 187972 gene locus_tag LOCUS_04910 187514 187972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence004 2657 1425 gene locus_tag LOCUS_04920 gene moeA1 2657 1425 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_04920 4425 2662 gene locus_tag LOCUS_04930 4425 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 4883 4491 gene locus_tag LOCUS_04940 4883 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 5811 4894 gene locus_tag LOCUS_04950 5811 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 6554 5808 gene locus_tag LOCUS_04960 6554 5808 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_04960 7869 6541 gene locus_tag LOCUS_04970 7869 6541 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937602.1 protein_id gnl|my_center|LOCUS_04970 8177 9832 gene locus_tag LOCUS_04980 8177 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 10215 9856 gene locus_tag LOCUS_04990 10215 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 12171 10285 gene locus_tag LOCUS_05000 12171 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 13043 12207 gene locus_tag LOCUS_05010 13043 12207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 13462 13040 gene locus_tag LOCUS_05020 13462 13040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 14368 13559 gene locus_tag LOCUS_05030 14368 13559 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_05030 15588 15091 gene locus_tag LOCUS_05040 15588 15091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 17024 15708 gene locus_tag LOCUS_05050 17024 15708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 18167 17028 gene locus_tag LOCUS_05060 18167 17028 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK7 protein_id gnl|my_center|LOCUS_05060 18689 18991 gene locus_tag LOCUS_05070 18689 18991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 19107 19472 gene locus_tag LOCUS_05080 19107 19472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 19475 20083 gene locus_tag LOCUS_05090 19475 20083 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 protein_id gnl|my_center|LOCUS_05090 22552 20132 gene locus_tag LOCUS_05100 gene priA 22552 20132 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819T9 protein_id gnl|my_center|LOCUS_05100 23216 22545 gene locus_tag LOCUS_05110 23216 22545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 25216 23285 gene locus_tag LOCUS_05120 25216 23285 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H3 protein_id gnl|my_center|LOCUS_05120 27597 25213 gene locus_tag LOCUS_05130 27597 25213 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H4 protein_id gnl|my_center|LOCUS_05130 27769 29202 gene locus_tag LOCUS_05140 27769 29202 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943972.1 protein_id gnl|my_center|LOCUS_05140 29918 29223 gene locus_tag LOCUS_05150 gene rpe 29918 29223 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z3 protein_id gnl|my_center|LOCUS_05150 31272 29950 gene locus_tag LOCUS_05160 gene rsmB 31272 29950 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z4 protein_id gnl|my_center|LOCUS_05160 32210 31269 gene locus_tag LOCUS_05170 gene fmt 32210 31269 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_05170 32737 32213 gene locus_tag LOCUS_05180 gene def1 32737 32213 CDS product peptide deformylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVU3 protein_id gnl|my_center|LOCUS_05180 34577 32754 gene locus_tag LOCUS_05190 34577 32754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 34821 34600 gene locus_tag LOCUS_05200 34821 34600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 34820 35590 gene locus_tag LOCUS_05210 34820 35590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 36198 35653 gene locus_tag LOCUS_05220 36198 35653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 37338 36706 gene locus_tag LOCUS_05230 37338 36706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 38809 37889 gene locus_tag LOCUS_05240 38809 37889 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP3 protein_id gnl|my_center|LOCUS_05240 38948 39475 gene locus_tag LOCUS_05250 38948 39475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 40196 39558 gene locus_tag LOCUS_05260 40196 39558 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_05260 40609 40289 gene locus_tag LOCUS_05270 40609 40289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 40937 40602 gene locus_tag LOCUS_05280 40937 40602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 41127 42128 gene locus_tag LOCUS_05290 41127 42128 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_05290 42194 42793 gene locus_tag LOCUS_05300 42194 42793 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51266 protein_id gnl|my_center|LOCUS_05300 42927 43535 gene locus_tag LOCUS_05310 42927 43535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 43658 44374 gene locus_tag LOCUS_05320 43658 44374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 46165 44381 gene locus_tag LOCUS_05330 46165 44381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 46285 47949 gene locus_tag LOCUS_05340 46285 47949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 48018 48812 gene locus_tag LOCUS_05350 48018 48812 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_05350 48823 50301 gene locus_tag LOCUS_05360 gene glpK2 48823 50301 CDS product glycerol kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1E4 protein_id gnl|my_center|LOCUS_05360 51492 50407 gene locus_tag LOCUS_05370 51492 50407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 52431 51577 gene locus_tag LOCUS_05380 gene trx 52431 51577 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037752.1 protein_id gnl|my_center|LOCUS_05380 52707 53759 gene locus_tag LOCUS_05390 52707 53759 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500869.1 protein_id gnl|my_center|LOCUS_05390 54383 53808 gene locus_tag LOCUS_05400 gene pdxT 54383 53808 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYU3 protein_id gnl|my_center|LOCUS_05400 55264 54383 gene locus_tag LOCUS_05410 gene pdxS 55264 54383 CDS product pyridoxal 5'-phosphate synthase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMJ0 protein_id gnl|my_center|LOCUS_05410 55489 58038 gene locus_tag LOCUS_05420 55489 58038 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_05420 58031 58903 gene locus_tag LOCUS_05430 58031 58903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_05430 58906 60384 gene locus_tag LOCUS_05440 58906 60384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 60401 61075 gene locus_tag LOCUS_05450 gene nth 60401 61075 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_05450 61810 61079 gene locus_tag LOCUS_05460 61810 61079 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948549.1 protein_id gnl|my_center|LOCUS_05460 63246 61825 gene locus_tag LOCUS_05470 63246 61825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 63819 63430 gene locus_tag LOCUS_05480 63819 63430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 65643 63967 gene locus_tag LOCUS_05490 gene gatA 65643 63967 CDS product glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727400.1 protein_id gnl|my_center|LOCUS_05490 65888 65640 gene locus_tag LOCUS_05500 65888 65640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 69289 65894 gene locus_tag LOCUS_05510 gene icmF 69289 65894 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_05510 69751 70422 gene locus_tag LOCUS_05520 69751 70422 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_05520 70419 73811 gene locus_tag LOCUS_05530 70419 73811 CDS product molybdopterin oxidoreductase iron-sulfur-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404834.1 protein_id gnl|my_center|LOCUS_05530 73820 75223 gene locus_tag LOCUS_05540 73820 75223 CDS product polysulfide reductase chain C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_05540 75216 75752 gene locus_tag LOCUS_05550 75216 75752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_05550 75756 76691 gene locus_tag LOCUS_05560 75756 76691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 76701 77903 gene locus_tag LOCUS_05570 76701 77903 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404830.1 protein_id gnl|my_center|LOCUS_05570 77919 78770 gene locus_tag LOCUS_05580 77919 78770 CDS product photosynthetic protein synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885550.1 protein_id gnl|my_center|LOCUS_05580 78823 79557 gene locus_tag LOCUS_05590 78823 79557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 80405 79575 gene locus_tag LOCUS_05600 80405 79575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 80638 82755 gene locus_tag LOCUS_05610 80638 82755 CDS product tungsten formylmethanofuran dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403352.1 protein_id gnl|my_center|LOCUS_05610 85460 82800 gene locus_tag LOCUS_05620 85460 82800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 85794 86567 gene locus_tag LOCUS_05630 85794 86567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 86564 87313 gene locus_tag LOCUS_05640 86564 87313 CDS product sugar nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858404.1 protein_id gnl|my_center|LOCUS_05640 87374 88933 gene locus_tag LOCUS_05650 87374 88933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 88936 89943 gene locus_tag LOCUS_05660 gene dusA 88936 89943 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAJ0 protein_id gnl|my_center|LOCUS_05660 90214 89918 gene locus_tag LOCUS_05670 90214 89918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231597.2 protein_id gnl|my_center|LOCUS_05670 91121 90225 gene locus_tag LOCUS_05680 gene cysM 91121 90225 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32DD3 protein_id gnl|my_center|LOCUS_05680 91346 91921 gene locus_tag LOCUS_05690 91346 91921 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E2 protein_id gnl|my_center|LOCUS_05690 92461 92922 gene locus_tag LOCUS_05700 92461 92922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 93622 92963 gene locus_tag LOCUS_05710 gene ppaX 93622 92963 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HBC8 protein_id gnl|my_center|LOCUS_05710 95108 93624 gene locus_tag LOCUS_05720 95108 93624 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_05720 98845 95135 gene locus_tag LOCUS_05730 98845 95135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 99186 98968 gene locus_tag LOCUS_05740 gene infA 99186 98968 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61688 protein_id gnl|my_center|LOCUS_05740 99717 99367 gene locus_tag LOCUS_05750 99717 99367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 100870 99707 gene locus_tag LOCUS_05760 100870 99707 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_05760 101087 101977 gene locus_tag LOCUS_05770 101087 101977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 103229 102015 gene locus_tag LOCUS_05780 103229 102015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403758.1 protein_id gnl|my_center|LOCUS_05780 103615 103244 gene locus_tag LOCUS_05790 103615 103244 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_05790 105640 103655 gene locus_tag LOCUS_05800 105640 103655 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404701.1 protein_id gnl|my_center|LOCUS_05800 106677 105637 gene locus_tag LOCUS_05810 106677 105637 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_05810 106968 107687 gene locus_tag LOCUS_05820 106968 107687 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_05820 107713 108195 gene locus_tag LOCUS_05830 107713 108195 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555939.1 protein_id gnl|my_center|LOCUS_05830 108192 109013 gene locus_tag LOCUS_05840 108192 109013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 109014 110372 gene locus_tag LOCUS_05850 gene tolB 109014 110372 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H67 protein_id gnl|my_center|LOCUS_05850 110390 111100 gene locus_tag LOCUS_05860 110390 111100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 111178 111933 gene locus_tag LOCUS_05870 gene pssA 111178 111933 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957377.1 protein_id gnl|my_center|LOCUS_05870 112084 112638 gene locus_tag LOCUS_05880 112084 112638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942243.1 protein_id gnl|my_center|LOCUS_05880 112893 113975 gene locus_tag LOCUS_05890 gene plsX 112893 113975 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS2 protein_id gnl|my_center|LOCUS_05890 114138 114383 gene locus_tag LOCUS_05900 gene acpP 114138 114383 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43709 protein_id gnl|my_center|LOCUS_05900 114429 115694 gene locus_tag LOCUS_05910 114429 115694 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHD3 protein_id gnl|my_center|LOCUS_05910 115691 116137 gene locus_tag LOCUS_05920 115691 116137 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015889.1 protein_id gnl|my_center|LOCUS_05920 116143 116628 gene locus_tag LOCUS_05930 gene nrdR 116143 116628 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI6 protein_id gnl|my_center|LOCUS_05930 116625 117740 gene locus_tag LOCUS_05940 gene ribD 116625 117740 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI5 protein_id gnl|my_center|LOCUS_05940 117927 119099 gene locus_tag LOCUS_05950 gene ribA 117927 119099 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI3 protein_id gnl|my_center|LOCUS_05950 119096 119584 gene locus_tag LOCUS_05960 gene ribH 119096 119584 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX5 protein_id gnl|my_center|LOCUS_05960 119581 120090 gene locus_tag LOCUS_05970 119581 120090 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_05970 120093 120488 gene locus_tag LOCUS_05980 120093 120488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 120495 121088 gene locus_tag LOCUS_05990 120495 121088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 121767 121069 gene locus_tag LOCUS_06000 121767 121069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 125168 121998 gene locus_tag LOCUS_06010 gene ileS 125168 121998 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73JB2 protein_id gnl|my_center|LOCUS_06010 125472 126272 gene locus_tag LOCUS_06020 125472 126272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 126473 126970 gene locus_tag LOCUS_06030 126473 126970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 127008 128222 gene locus_tag LOCUS_06040 gene iscS 127008 128222 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SN1 protein_id gnl|my_center|LOCUS_06040 128241 128627 gene locus_tag LOCUS_06050 gene iscU 128241 128627 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ33 protein_id gnl|my_center|LOCUS_06050 128654 128977 gene locus_tag LOCUS_06060 gene iscA 128654 128977 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44672 protein_id gnl|my_center|LOCUS_06060 129046 129642 gene locus_tag LOCUS_06070 gene hscB 129046 129642 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ35 protein_id gnl|my_center|LOCUS_06070 129669 131531 gene locus_tag LOCUS_06080 gene hscA 129669 131531 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Z7 protein_id gnl|my_center|LOCUS_06080 131534 131746 gene locus_tag LOCUS_06090 131534 131746 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523621.1 protein_id gnl|my_center|LOCUS_06090 132319 131930 gene locus_tag LOCUS_06100 132319 131930 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030572.1 protein_id gnl|my_center|LOCUS_06100 132534 134741 gene locus_tag LOCUS_06110 132534 134741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120805.1 protein_id gnl|my_center|LOCUS_06110 134805 135026 gene locus_tag LOCUS_06120 134805 135026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 136485 135037 gene locus_tag LOCUS_06130 136485 135037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 137400 136570 gene locus_tag LOCUS_06140 137400 136570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 140087 137916 gene locus_tag LOCUS_06150 140087 137916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 142783 140234 gene locus_tag LOCUS_06160 142783 140234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 143073 143825 gene locus_tag LOCUS_06170 143073 143825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 143975 144721 gene locus_tag LOCUS_06180 143975 144721 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731593.1 protein_id gnl|my_center|LOCUS_06180 146286 144745 gene locus_tag LOCUS_06190 146286 144745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 147548 146382 gene locus_tag LOCUS_06200 147548 146382 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249340.1 protein_id gnl|my_center|LOCUS_06200 147791 147549 gene locus_tag LOCUS_06210 147791 147549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 150710 147837 gene locus_tag LOCUS_06220 gene gcvP 150710 147837 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 protein_id gnl|my_center|LOCUS_06220 152321 150834 gene locus_tag LOCUS_06230 152321 150834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 153105 152332 gene locus_tag LOCUS_06240 153105 152332 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545987.1 protein_id gnl|my_center|LOCUS_06240 153245 154612 gene locus_tag LOCUS_06250 gene trkA 153245 154612 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_06250 154613 156184 gene locus_tag LOCUS_06260 154613 156184 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_06260 156997 156155 gene locus_tag LOCUS_06270 156997 156155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 157145 156939 gene locus_tag LOCUS_06280 157145 156939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 157533 157102 gene locus_tag LOCUS_06290 gene rnhA 157533 157102 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU6 protein_id gnl|my_center|LOCUS_06290 157927 158115 gene locus_tag LOCUS_06300 157927 158115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 158441 158172 gene locus_tag LOCUS_06310 158441 158172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 159035 158595 gene locus_tag LOCUS_06320 159035 158595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 158973 159746 gene locus_tag LOCUS_06330 158973 159746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 159857 167473 gene locus_tag LOCUS_06340 159857 167473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 171132 167470 gene locus_tag LOCUS_06350 gene metH 171132 167470 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817311.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence005 5399 3963 gene locus_tag LOCUS_06360 5399 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 6198 5527 gene locus_tag LOCUS_06370 6198 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 7658 6252 gene locus_tag LOCUS_06380 7658 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_06380 10018 7658 gene locus_tag LOCUS_06390 10018 7658 CDS product filamin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121212.1 protein_id gnl|my_center|LOCUS_06390 10649 11572 gene locus_tag LOCUS_06400 10649 11572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 11611 12156 gene locus_tag LOCUS_06410 11611 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 12153 13391 gene locus_tag LOCUS_06420 12153 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 13489 13585 gene locus_tag LOCUS_t00020 13489 13585 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 13778 14371 gene locus_tag LOCUS_06430 13778 14371 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211977.1 protein_id gnl|my_center|LOCUS_06430 15104 14379 gene locus_tag LOCUS_06440 15104 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 15275 15661 gene locus_tag LOCUS_06450 15275 15661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 17137 15692 gene locus_tag LOCUS_06460 17137 15692 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_06460 17315 18283 gene locus_tag LOCUS_06470 17315 18283 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_06470 18411 18812 gene locus_tag LOCUS_06480 18411 18812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 19923 18823 gene locus_tag LOCUS_06490 19923 18823 CDS product dihydropyrimidine dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_06490 20305 23583 gene locus_tag LOCUS_06500 20305 23583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 23684 24445 gene locus_tag LOCUS_06510 23684 24445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 24565 25119 gene locus_tag LOCUS_06520 gene lspA 24565 25119 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Y0 protein_id gnl|my_center|LOCUS_06520 25148 26110 gene locus_tag LOCUS_06530 gene lgt 25148 26110 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66627 protein_id gnl|my_center|LOCUS_06530 26422 26832 gene locus_tag LOCUS_06540 26422 26832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 27876 27055 gene locus_tag LOCUS_06550 27876 27055 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530170.1 protein_id gnl|my_center|LOCUS_06550 28137 28415 gene locus_tag LOCUS_06560 gene rpmB 28137 28415 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XZ3 protein_id gnl|my_center|LOCUS_06560 28751 28533 gene locus_tag LOCUS_06570 28751 28533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 30083 28809 gene locus_tag LOCUS_06580 30083 28809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 31008 32324 gene locus_tag LOCUS_06590 31008 32324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 32450 33319 gene locus_tag LOCUS_06600 32450 33319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 33394 35145 gene locus_tag LOCUS_06610 33394 35145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 35145 36101 gene locus_tag LOCUS_06620 35145 36101 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 protein_id gnl|my_center|LOCUS_06620 38795 36159 gene locus_tag LOCUS_06630 38795 36159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 40134 38956 gene locus_tag LOCUS_06640 40134 38956 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_06640 40910 40131 gene locus_tag LOCUS_06650 40910 40131 CDS product creatinine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228731.1 protein_id gnl|my_center|LOCUS_06650 42477 40903 gene locus_tag LOCUS_06660 gene badA 42477 40903 CDS product benzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228732.1 protein_id gnl|my_center|LOCUS_06660 42647 44053 gene locus_tag LOCUS_06670 42647 44053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 45022 44063 gene locus_tag LOCUS_06680 45022 44063 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836560.1 protein_id gnl|my_center|LOCUS_06680 46334 45033 gene locus_tag LOCUS_06690 46334 45033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 47865 46405 gene locus_tag LOCUS_06700 47865 46405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 49129 47852 gene locus_tag LOCUS_06710 49129 47852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 50730 49126 gene locus_tag LOCUS_06720 50730 49126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 52528 50672 gene locus_tag LOCUS_06730 52528 50672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 52704 53228 gene locus_tag LOCUS_06740 52704 53228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 53394 54050 gene locus_tag LOCUS_06750 53394 54050 CDS product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489819.1 protein_id gnl|my_center|LOCUS_06750 54154 55437 gene locus_tag LOCUS_06760 54154 55437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_06760 55470 57143 gene locus_tag LOCUS_06770 55470 57143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 58208 57036 gene locus_tag LOCUS_06780 58208 57036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 59067 58291 gene locus_tag LOCUS_06790 gene coaX 59067 58291 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BU2 protein_id gnl|my_center|LOCUS_06790 59787 59068 gene locus_tag LOCUS_06800 gene birA 59787 59068 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KP6 protein_id gnl|my_center|LOCUS_06800 60740 59781 gene locus_tag LOCUS_06810 60740 59781 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918606.1 protein_id gnl|my_center|LOCUS_06810 61756 60770 gene locus_tag LOCUS_06820 61756 60770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 62000 65992 gene locus_tag LOCUS_06830 62000 65992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 66235 66029 gene locus_tag LOCUS_06840 66235 66029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 67131 66238 gene locus_tag LOCUS_06850 67131 66238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 67391 67846 gene locus_tag LOCUS_06860 67391 67846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 68318 67833 gene locus_tag LOCUS_06870 gene sixA 68318 67833 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121948.1 protein_id gnl|my_center|LOCUS_06870 68532 69365 gene locus_tag LOCUS_06880 68532 69365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 69386 70393 gene locus_tag LOCUS_06890 69386 70393 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706102.1 protein_id gnl|my_center|LOCUS_06890 70409 72301 gene locus_tag LOCUS_06900 70409 72301 CDS product TRAP transporter subunit DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682335.1 protein_id gnl|my_center|LOCUS_06900 72316 72663 gene locus_tag LOCUS_06910 gene arsC-1 72316 72663 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIW3 protein_id gnl|my_center|LOCUS_06910 73860 72658 gene locus_tag LOCUS_06920 73860 72658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 74590 73907 gene locus_tag LOCUS_06930 74590 73907 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_06930 74951 74583 gene locus_tag LOCUS_06940 74951 74583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 75044 75946 gene locus_tag LOCUS_06950 75044 75946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 77009 75960 gene locus_tag LOCUS_06960 77009 75960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 77358 77029 gene locus_tag LOCUS_06970 77358 77029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704337.1 protein_id gnl|my_center|LOCUS_06970 77331 77540 gene locus_tag LOCUS_06980 77331 77540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 77537 78406 gene locus_tag LOCUS_06990 77537 78406 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228419.1 protein_id gnl|my_center|LOCUS_06990 78407 79738 gene locus_tag LOCUS_07000 78407 79738 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_07000 80639 79746 gene locus_tag LOCUS_07010 80639 79746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 81362 80649 gene locus_tag LOCUS_07020 81362 80649 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_07020 81618 83570 gene locus_tag LOCUS_07030 gene acsA 81618 83570 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_07030 83770 84507 gene locus_tag LOCUS_07040 83770 84507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 84663 86213 gene locus_tag LOCUS_07050 gene rny 84663 86213 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E27 protein_id gnl|my_center|LOCUS_07050 89796 86233 gene locus_tag LOCUS_07060 89796 86233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 92135 89793 gene locus_tag LOCUS_07070 92135 89793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 92931 92242 gene locus_tag LOCUS_07080 92931 92242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 94958 93522 gene locus_tag LOCUS_07090 94958 93522 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_07090 94845 95165 gene locus_tag LOCUS_07100 94845 95165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 95171 95548 gene locus_tag LOCUS_07110 95171 95548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 95651 97837 gene locus_tag LOCUS_07120 95651 97837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 98239 98433 gene locus_tag LOCUS_07130 98239 98433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 98771 98511 gene locus_tag LOCUS_07140 98771 98511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 99356 99126 gene locus_tag LOCUS_07150 99356 99126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 99683 99522 gene locus_tag LOCUS_07160 99683 99522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 100577 99900 gene locus_tag LOCUS_07170 100577 99900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 101210 100902 gene locus_tag LOCUS_07180 101210 100902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 101248 101553 gene locus_tag LOCUS_07190 101248 101553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 103010 101550 gene locus_tag LOCUS_07200 103010 101550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 103492 103013 gene locus_tag LOCUS_07210 103492 103013 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972483.1 protein_id gnl|my_center|LOCUS_07210 104892 103498 gene locus_tag LOCUS_07220 104892 103498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 105176 104889 gene locus_tag LOCUS_07230 105176 104889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 106480 105422 gene locus_tag LOCUS_07240 106480 105422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 106591 107349 gene locus_tag LOCUS_07250 gene uppS 106591 107349 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E0 protein_id gnl|my_center|LOCUS_07250 107352 108818 gene locus_tag LOCUS_07260 107352 108818 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919838.1 protein_id gnl|my_center|LOCUS_07260 108815 110026 gene locus_tag LOCUS_07270 108815 110026 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919839.1 protein_id gnl|my_center|LOCUS_07270 110154 111287 gene locus_tag LOCUS_07280 110154 111287 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCG7 protein_id gnl|my_center|LOCUS_07280 111302 112033 gene locus_tag LOCUS_07290 111302 112033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 112061 114703 gene locus_tag LOCUS_07300 112061 114703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 114676 115509 gene locus_tag LOCUS_07310 114676 115509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 116954 115506 gene locus_tag LOCUS_07320 116954 115506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 117162 117929 gene locus_tag LOCUS_07330 117162 117929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 118752 117943 gene locus_tag LOCUS_07340 118752 117943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 119153 120781 gene locus_tag LOCUS_07350 gene oppA 119153 120781 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_07350 121308 120862 gene locus_tag LOCUS_07360 121308 120862 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265982.1 protein_id gnl|my_center|LOCUS_07360 121758 121411 gene locus_tag LOCUS_07370 121758 121411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 124071 123280 gene locus_tag LOCUS_07380 124071 123280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 124721 124068 gene locus_tag LOCUS_07390 124721 124068 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MF13 protein_id gnl|my_center|LOCUS_07390 124966 126069 gene locus_tag LOCUS_07400 124966 126069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 126172 127980 gene locus_tag LOCUS_07410 gene argS 126172 127980 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P28 protein_id gnl|my_center|LOCUS_07410 127989 128846 gene locus_tag LOCUS_07420 127989 128846 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122511.1 protein_id gnl|my_center|LOCUS_07420 129100 128894 gene locus_tag LOCUS_07430 129100 128894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 131648 129312 gene locus_tag LOCUS_07440 131648 129312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 131883 133805 gene locus_tag LOCUS_07450 131883 133805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_07450 134121 134855 gene locus_tag LOCUS_07460 134121 134855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 134852 136297 gene locus_tag LOCUS_07470 134852 136297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 136306 137991 gene locus_tag LOCUS_07480 136306 137991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 138111 139283 gene locus_tag LOCUS_07490 138111 139283 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110496.1 protein_id gnl|my_center|LOCUS_07490 139276 140667 gene locus_tag LOCUS_07500 139276 140667 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_07500 140664 141542 gene locus_tag LOCUS_07510 140664 141542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 141847 141557 gene locus_tag LOCUS_07520 141847 141557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 142317 143720 gene locus_tag LOCUS_07530 142317 143720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 145622 143742 gene locus_tag LOCUS_07540 145622 143742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 146149 145631 gene locus_tag LOCUS_07550 146149 145631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 146253 146966 gene locus_tag LOCUS_07560 146253 146966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 147073 147966 gene locus_tag LOCUS_07570 147073 147966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 148034 149026 gene locus_tag LOCUS_07580 148034 149026 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040372.1 protein_id gnl|my_center|LOCUS_07580 149023 149997 gene locus_tag LOCUS_07590 149023 149997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 149994 151856 gene locus_tag LOCUS_07600 149994 151856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 152141 152557 gene locus_tag LOCUS_07610 152141 152557 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228953.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence006 <1 1271 gene locus_tag LOCUS_07620 <1 1271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2WF06:peptidylprolyl isomerase 2472 1303 gene locus_tag LOCUS_07630 2472 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 4226 2472 gene locus_tag LOCUS_07640 4226 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 6359 4440 gene locus_tag LOCUS_07650 6359 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 6753 6367 gene locus_tag LOCUS_07660 6753 6367 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546622.1 protein_id gnl|my_center|LOCUS_07660 7958 6750 gene locus_tag LOCUS_07670 7958 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 8680 8045 gene locus_tag LOCUS_07680 8680 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 9454 8684 gene locus_tag LOCUS_07690 9454 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 9688 10179 gene locus_tag LOCUS_07700 9688 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 10242 11090 gene locus_tag LOCUS_07710 10242 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 11241 13997 gene locus_tag LOCUS_07720 11241 13997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 15406 14255 gene locus_tag LOCUS_07730 15406 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 17253 15550 gene locus_tag LOCUS_07740 17253 15550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 17752 17333 gene locus_tag LOCUS_07750 17752 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 18584 17799 gene locus_tag LOCUS_07760 gene lpxC 18584 17799 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A728 protein_id gnl|my_center|LOCUS_07760 18705 19511 gene locus_tag LOCUS_07770 18705 19511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 19508 20047 gene locus_tag LOCUS_07780 19508 20047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 20931 20044 gene locus_tag LOCUS_07790 20931 20044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 21450 21091 gene locus_tag LOCUS_07800 21450 21091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 21733 21533 gene locus_tag LOCUS_07810 21733 21533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 21925 22920 gene locus_tag LOCUS_07820 21925 22920 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_07820 22925 23809 gene locus_tag LOCUS_07830 22925 23809 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_07830 23806 24924 gene locus_tag LOCUS_07840 23806 24924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 24921 25979 gene locus_tag LOCUS_07850 24921 25979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_07850 25979 27040 gene locus_tag LOCUS_07860 gene batB 25979 27040 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_07860 27037 28608 gene locus_tag LOCUS_07870 27037 28608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 28618 30414 gene locus_tag LOCUS_07880 28618 30414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 30411 31181 gene locus_tag LOCUS_07890 30411 31181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 33730 31202 gene locus_tag LOCUS_07900 33730 31202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 34267 36306 gene locus_tag LOCUS_07910 34267 36306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 37402 36299 gene locus_tag LOCUS_07920 37402 36299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 37833 37402 gene locus_tag LOCUS_07930 37833 37402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 38393 41464 gene locus_tag LOCUS_07940 gene putA 38393 41464 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q725V6 protein_id gnl|my_center|LOCUS_07940 41701 42489 gene locus_tag LOCUS_07950 41701 42489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 42662 44194 gene locus_tag LOCUS_07960 gene ggt 42662 44194 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_07960 45179 44232 gene locus_tag LOCUS_07970 gene glk 45179 44232 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI98 protein_id gnl|my_center|LOCUS_07970 45157 45321 gene locus_tag LOCUS_07980 45157 45321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 46108 45311 gene locus_tag LOCUS_07990 46108 45311 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944061.1 protein_id gnl|my_center|LOCUS_07990 46245 48659 gene locus_tag LOCUS_08000 gene leuS 46245 48659 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCE2 protein_id gnl|my_center|LOCUS_08000 50081 48696 gene locus_tag LOCUS_08010 gene hutF 50081 48696 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197961.1 protein_id gnl|my_center|LOCUS_08010 50154 50918 gene locus_tag LOCUS_08020 50154 50918 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_08020 50915 51328 gene locus_tag LOCUS_08030 50915 51328 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088816.1 protein_id gnl|my_center|LOCUS_08030 51325 52125 gene locus_tag LOCUS_08040 51325 52125 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973042.1 protein_id gnl|my_center|LOCUS_08040 52122 53312 gene locus_tag LOCUS_08050 52122 53312 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086221.1 protein_id gnl|my_center|LOCUS_08050 54211 53336 gene locus_tag LOCUS_08060 54211 53336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 56776 54332 gene locus_tag LOCUS_08070 56776 54332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 57121 57708 gene locus_tag LOCUS_08080 57121 57708 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_08080 57748 59442 gene locus_tag LOCUS_08090 57748 59442 CDS product putative aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705270.1 protein_id gnl|my_center|LOCUS_08090 59451 61415 gene locus_tag LOCUS_08100 59451 61415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 61529 62134 gene locus_tag LOCUS_08110 61529 62134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 62278 63138 gene locus_tag LOCUS_08120 62278 63138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 63197 63721 gene locus_tag LOCUS_08130 63197 63721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 63874 64941 gene locus_tag LOCUS_08140 63874 64941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 64951 65532 gene locus_tag LOCUS_08150 64951 65532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 65533 65796 gene locus_tag LOCUS_08160 65533 65796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 65847 68090 gene locus_tag LOCUS_08170 65847 68090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 68279 69484 gene locus_tag LOCUS_08180 68279 69484 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_08180 69496 71631 gene locus_tag LOCUS_08190 69496 71631 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_08190 72807 71632 gene locus_tag LOCUS_08200 72807 71632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 72931 75075 gene locus_tag LOCUS_08210 gene recD2 72931 75075 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DN4 protein_id gnl|my_center|LOCUS_08210 75072 76193 gene locus_tag LOCUS_08220 75072 76193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 76190 77608 gene locus_tag LOCUS_08230 76190 77608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 78608 77655 gene locus_tag LOCUS_08240 78608 77655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 79073 78612 gene locus_tag LOCUS_08250 gene fur 79073 78612 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_08250 79290 80273 gene locus_tag LOCUS_08260 gene hemB 79290 80273 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_08260 80281 81393 gene locus_tag LOCUS_08270 80281 81393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 81386 82300 gene locus_tag LOCUS_08280 81386 82300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 83183 82239 gene locus_tag LOCUS_08290 83183 82239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 85162 83183 gene locus_tag LOCUS_08300 85162 83183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 86360 85167 gene locus_tag LOCUS_08310 86360 85167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 87166 86357 gene locus_tag LOCUS_08320 87166 86357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 88737 87166 gene locus_tag LOCUS_08330 88737 87166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 89767 88727 gene locus_tag LOCUS_08340 89767 88727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 91824 89923 gene locus_tag LOCUS_08350 91824 89923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 92260 92463 gene locus_tag LOCUS_08360 92260 92463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 92490 93176 gene locus_tag LOCUS_08370 92490 93176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 93243 94862 gene locus_tag LOCUS_08380 93243 94862 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_08380 96655 94859 gene locus_tag LOCUS_08390 96655 94859 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_08390 96747 97289 gene locus_tag LOCUS_08400 96747 97289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 97893 97324 gene locus_tag LOCUS_08410 97893 97324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 99182 98004 gene locus_tag LOCUS_08420 99182 98004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 99282 99860 gene locus_tag LOCUS_08430 99282 99860 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_08430 100355 99999 gene locus_tag LOCUS_08440 100355 99999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 100422 101084 gene locus_tag LOCUS_08450 100422 101084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 102224 101091 gene locus_tag LOCUS_08460 102224 101091 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_08460 102493 102236 gene locus_tag LOCUS_08470 102493 102236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 103817 102603 gene locus_tag LOCUS_08480 gene aspC2 103817 102603 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_08480 104025 104591 gene locus_tag LOCUS_08490 104025 104591 CDS product pyrrolidone-carboxylate peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868563.1 protein_id gnl|my_center|LOCUS_08490 105788 104601 gene locus_tag LOCUS_08500 105788 104601 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943270.1 protein_id gnl|my_center|LOCUS_08500 106888 105950 gene locus_tag LOCUS_08510 gene trxB 106888 105950 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3B3 protein_id gnl|my_center|LOCUS_08510 107256 107104 gene locus_tag LOCUS_08520 107256 107104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 107249 108415 gene locus_tag LOCUS_08530 gene bme6 107249 108415 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 protein_id gnl|my_center|LOCUS_08530 108412 109275 gene locus_tag LOCUS_08540 gene fmt 108412 109275 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B42 protein_id gnl|my_center|LOCUS_08540 109683 109402 gene locus_tag LOCUS_08550 109683 109402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 109992 110720 gene locus_tag LOCUS_08560 109992 110720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 110776 112575 gene locus_tag LOCUS_08570 110776 112575 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404643.1 protein_id gnl|my_center|LOCUS_08570 112606 113556 gene locus_tag LOCUS_08580 112606 113556 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122317.1 protein_id gnl|my_center|LOCUS_08580 113553 114782 gene locus_tag LOCUS_08590 113553 114782 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_08590 115870 114779 gene locus_tag LOCUS_08600 115870 114779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 115971 117596 gene locus_tag LOCUS_08610 gene pntA 115971 117596 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707241.1 protein_id gnl|my_center|LOCUS_08610 117609 119144 gene locus_tag LOCUS_08620 gene pntB 117609 119144 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN46 protein_id gnl|my_center|LOCUS_08620 >Feature sequence007 476 291 gene locus_tag LOCUS_08630 476 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 745 1728 gene locus_tag LOCUS_08640 745 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 1815 2753 gene locus_tag LOCUS_08650 1815 2753 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLZ4 protein_id gnl|my_center|LOCUS_08650 2758 3237 gene locus_tag LOCUS_08660 2758 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582786.1 protein_id gnl|my_center|LOCUS_08660 3365 3760 gene locus_tag LOCUS_08670 gene msrB 3365 3760 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC6 protein_id gnl|my_center|LOCUS_08670 3874 4929 gene locus_tag LOCUS_08680 3874 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 4977 5777 gene locus_tag LOCUS_08690 4977 5777 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120450.1 protein_id gnl|my_center|LOCUS_08690 6324 5782 gene locus_tag LOCUS_08700 6324 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377703.1 protein_id gnl|my_center|LOCUS_08700 6725 7879 gene locus_tag LOCUS_08710 gene apeB 6725 7879 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW15 protein_id gnl|my_center|LOCUS_08710 8220 7996 gene locus_tag LOCUS_08720 8220 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 8308 9411 gene locus_tag LOCUS_08730 8308 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 10622 9435 gene locus_tag LOCUS_08740 gene thiI 10622 9435 CDS product putative tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM06 protein_id gnl|my_center|LOCUS_08740 11767 10637 gene locus_tag LOCUS_08750 gene iscS 11767 10637 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B843 protein_id gnl|my_center|LOCUS_08750 11889 13019 gene locus_tag LOCUS_08760 11889 13019 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817047.1 protein_id gnl|my_center|LOCUS_08760 13035 13238 gene locus_tag LOCUS_08770 13035 13238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 13309 13968 gene locus_tag LOCUS_08780 13309 13968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 14070 15911 gene locus_tag LOCUS_08790 gene dnaK 14070 15911 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_08790 15987 17105 gene locus_tag LOCUS_08800 gene dnaJ 15987 17105 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_08800 17102 17890 gene locus_tag LOCUS_08810 17102 17890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255317.1 protein_id gnl|my_center|LOCUS_08810 19316 17892 gene locus_tag LOCUS_08820 19316 17892 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090834.1 protein_id gnl|my_center|LOCUS_08820 19362 19553 gene locus_tag LOCUS_08830 19362 19553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 20462 19482 gene locus_tag LOCUS_08840 20462 19482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_08840 20653 23256 gene locus_tag LOCUS_08850 gene topA 20653 23256 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR4 protein_id gnl|my_center|LOCUS_08850 24855 23218 gene locus_tag LOCUS_08860 24855 23218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 26813 24924 gene locus_tag LOCUS_08870 26813 24924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 28059 26800 gene locus_tag LOCUS_08880 28059 26800 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_08880 29090 28059 gene locus_tag LOCUS_08890 29090 28059 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_08890 30010 29093 gene locus_tag LOCUS_08900 gene thiL 30010 29093 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D224 protein_id gnl|my_center|LOCUS_08900 31293 30016 gene locus_tag LOCUS_08910 31293 30016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 32012 31290 gene locus_tag LOCUS_08920 32012 31290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 32165 32527 gene locus_tag LOCUS_08930 32165 32527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 32528 33835 gene locus_tag LOCUS_08940 32528 33835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 34347 33916 gene locus_tag LOCUS_08950 34347 33916 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_08950 34616 34344 gene locus_tag LOCUS_08960 34616 34344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 34716 35327 gene locus_tag LOCUS_08970 34716 35327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 35885 35334 gene locus_tag LOCUS_08980 35885 35334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 protein_id gnl|my_center|LOCUS_08980 36246 37643 gene locus_tag LOCUS_08990 gene norM 36246 37643 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783536.1 protein_id gnl|my_center|LOCUS_08990 39816 37609 gene locus_tag LOCUS_09000 39816 37609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 39853 41031 gene locus_tag LOCUS_09010 39853 41031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_09010 41152 41736 gene locus_tag LOCUS_09020 41152 41736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 41733 43253 gene locus_tag LOCUS_09030 41733 43253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 43668 43904 gene locus_tag LOCUS_09040 43668 43904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 45125 44238 gene locus_tag LOCUS_09050 45125 44238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 45385 45825 gene locus_tag LOCUS_09060 45385 45825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 46107 47666 gene locus_tag LOCUS_09070 gene nifA 46107 47666 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_09070 48064 48762 gene locus_tag LOCUS_09080 48064 48762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 48847 49668 gene locus_tag LOCUS_09090 48847 49668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 49720 50973 gene locus_tag LOCUS_09100 49720 50973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 53362 50957 gene locus_tag LOCUS_09110 53362 50957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 55107 53506 gene locus_tag LOCUS_09120 55107 53506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 55790 55104 gene locus_tag LOCUS_09130 gene macB 55790 55104 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNB9 protein_id gnl|my_center|LOCUS_09130 55911 56432 gene locus_tag LOCUS_09140 55911 56432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 56451 57473 gene locus_tag LOCUS_09150 56451 57473 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_09150 57487 58371 gene locus_tag LOCUS_09160 57487 58371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 58368 59093 gene locus_tag LOCUS_09170 58368 59093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_09170 59090 59833 gene locus_tag LOCUS_09180 59090 59833 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_09180 59830 60576 gene locus_tag LOCUS_09190 gene ycf63 59830 60576 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057285.1 protein_id gnl|my_center|LOCUS_09190 60573 61316 gene locus_tag LOCUS_09200 60573 61316 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_09200 61317 62348 gene locus_tag LOCUS_09210 61317 62348 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941594.1 protein_id gnl|my_center|LOCUS_09210 62385 63059 gene locus_tag LOCUS_09220 62385 63059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 64263 63061 gene locus_tag LOCUS_09230 64263 63061 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889312.1 protein_id gnl|my_center|LOCUS_09230 64807 64265 gene locus_tag LOCUS_09240 64807 64265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 65282 64980 gene locus_tag LOCUS_09250 65282 64980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 67135 65318 gene locus_tag LOCUS_09260 gene typA 67135 65318 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 protein_id gnl|my_center|LOCUS_09260 68121 67315 gene locus_tag LOCUS_09270 68121 67315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 68474 68172 gene locus_tag LOCUS_09280 68474 68172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 68728 69528 gene locus_tag LOCUS_09290 68728 69528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 69550 71292 gene locus_tag LOCUS_09300 69550 71292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 72155 71289 gene locus_tag LOCUS_09310 gene hpx 72155 71289 CDS product non-Heme haloperoxidase Hpx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950845.1 protein_id gnl|my_center|LOCUS_09310 72751 72152 gene locus_tag LOCUS_09320 72751 72152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 73337 72759 gene locus_tag LOCUS_09330 gene pyrE 73337 72759 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN6 protein_id gnl|my_center|LOCUS_09330 73798 73334 gene locus_tag LOCUS_09340 73798 73334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 74115 73801 gene locus_tag LOCUS_09350 74115 73801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 74481 74161 gene locus_tag LOCUS_09360 74481 74161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 75142 74624 gene locus_tag LOCUS_09370 75142 74624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 75244 78126 gene locus_tag LOCUS_09380 75244 78126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 79615 78173 gene locus_tag LOCUS_09390 79615 78173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 79728 82253 gene locus_tag LOCUS_09400 79728 82253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 82304 84124 gene locus_tag LOCUS_09410 82304 84124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 86686 84185 gene locus_tag LOCUS_09420 86686 84185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 89109 86695 gene locus_tag LOCUS_09430 gene mutSB 89109 86695 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94545 protein_id gnl|my_center|LOCUS_09430 89432 89893 gene locus_tag LOCUS_09440 89432 89893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 90096 92891 gene locus_tag LOCUS_09450 90096 92891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 93767 92916 gene locus_tag LOCUS_09460 93767 92916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 93956 94405 gene locus_tag LOCUS_09470 93956 94405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 94402 95058 gene locus_tag LOCUS_09480 94402 95058 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_09480 95055 95489 gene locus_tag LOCUS_09490 95055 95489 CDS product biopolymer transporter ExbD/TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870252.1 protein_id gnl|my_center|LOCUS_09490 95683 96045 gene locus_tag LOCUS_09500 95683 96045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 96126 98246 gene locus_tag LOCUS_09510 96126 98246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 98271 99584 gene locus_tag LOCUS_09520 98271 99584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_09520 103118 99588 gene locus_tag LOCUS_09530 103118 99588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 105256 103130 gene locus_tag LOCUS_09540 105256 103130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 105374 106285 gene locus_tag LOCUS_09550 gene hslO 105374 106285 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747B9 protein_id gnl|my_center|LOCUS_09550 106285 107061 gene locus_tag LOCUS_09560 106285 107061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 107347 107063 gene locus_tag LOCUS_09570 107347 107063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703275.1 protein_id gnl|my_center|LOCUS_09570 107476 110595 gene locus_tag LOCUS_09580 107476 110595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 110610 113636 gene locus_tag LOCUS_09590 110610 113636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence008 306 2105 gene locus_tag LOCUS_09600 306 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 2109 3338 gene locus_tag LOCUS_09610 2109 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3830 3357 gene locus_tag LOCUS_09620 3830 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 4138 5445 gene locus_tag LOCUS_09630 4138 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 5580 10202 gene locus_tag LOCUS_09640 5580 10202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 11073 10177 gene locus_tag LOCUS_09650 11073 10177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 12545 11478 gene locus_tag LOCUS_09660 gene kdtA 12545 11478 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038436.1 protein_id gnl|my_center|LOCUS_09660 14374 12551 gene locus_tag LOCUS_09670 14374 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 16047 14371 gene locus_tag LOCUS_09680 16047 14371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 16274 16996 gene locus_tag LOCUS_09690 16274 16996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 16993 18507 gene locus_tag LOCUS_09700 16993 18507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 18725 20593 gene locus_tag LOCUS_09710 18725 20593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 21024 21647 gene locus_tag LOCUS_09720 21024 21647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 22124 21666 gene locus_tag LOCUS_09730 22124 21666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 22173 24488 gene locus_tag LOCUS_09740 22173 24488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404473.1 protein_id gnl|my_center|LOCUS_09740 24571 25056 gene locus_tag LOCUS_09750 24571 25056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 35056 25061 gene locus_tag LOCUS_09760 35056 25061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 35263 37851 gene locus_tag LOCUS_09770 35263 37851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 37848 38696 gene locus_tag LOCUS_09780 37848 38696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 38698 39435 gene locus_tag LOCUS_09790 gene rsmE 38698 39435 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G06 protein_id gnl|my_center|LOCUS_09790 39570 40439 gene locus_tag LOCUS_09800 39570 40439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 40498 41436 gene locus_tag LOCUS_09810 gene ctaB 40498 41436 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIL7 protein_id gnl|my_center|LOCUS_09810 43138 41756 gene locus_tag LOCUS_09820 43138 41756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 44635 43232 gene locus_tag LOCUS_09830 44635 43232 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_09830 44687 47638 gene locus_tag LOCUS_09840 44687 47638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403195.1 protein_id gnl|my_center|LOCUS_09840 48303 47635 gene locus_tag LOCUS_09850 48303 47635 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_09850 48655 48314 gene locus_tag LOCUS_09860 48655 48314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 49130 48657 gene locus_tag LOCUS_09870 49130 48657 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_09870 49457 50377 gene locus_tag LOCUS_09880 49457 50377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 50374 51807 gene locus_tag LOCUS_09890 gene fabG 50374 51807 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 protein_id gnl|my_center|LOCUS_09890 51819 53114 gene locus_tag LOCUS_09900 51819 53114 CDS product putative acetyl-CoA C-acyltransferase (thiolase) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701746.1 protein_id gnl|my_center|LOCUS_09900 53147 54562 gene locus_tag LOCUS_09910 53147 54562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 54559 56100 gene locus_tag LOCUS_09920 54559 56100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 56756 56103 gene locus_tag LOCUS_09930 gene tpm 56756 56103 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAT3 protein_id gnl|my_center|LOCUS_09930 58814 56904 gene locus_tag LOCUS_09940 gene dnaK 58814 56904 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TER2 protein_id gnl|my_center|LOCUS_09940 59464 59060 gene locus_tag LOCUS_09950 59464 59060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 60324 59464 gene locus_tag LOCUS_09960 60324 59464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 61967 60324 gene locus_tag LOCUS_09970 gene lnt 61967 60324 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCC4 protein_id gnl|my_center|LOCUS_09970 62930 61974 gene locus_tag LOCUS_09980 62930 61974 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_09980 63001 63177 gene locus_tag LOCUS_09990 63001 63177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 63288 63986 gene locus_tag LOCUS_10000 63288 63986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 65427 64384 gene locus_tag LOCUS_10010 gene xerC 65427 64384 CDS product recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964483.1 protein_id gnl|my_center|LOCUS_10010 66923 65511 gene locus_tag LOCUS_10020 gene fliC 66923 65511 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV0 protein_id gnl|my_center|LOCUS_10020 67536 67270 gene locus_tag LOCUS_10030 67536 67270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 68839 67895 gene locus_tag LOCUS_10040 68839 67895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 70155 69184 gene locus_tag LOCUS_10050 gene xerC 70155 69184 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQY6 protein_id gnl|my_center|LOCUS_10050 71699 70278 gene locus_tag LOCUS_10060 gene fliC 71699 70278 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV0 protein_id gnl|my_center|LOCUS_10060 72233 72586 gene locus_tag LOCUS_10070 72233 72586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 75238 72611 gene locus_tag LOCUS_10080 gene alaS 75238 72611 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 protein_id gnl|my_center|LOCUS_10080 75216 75389 gene locus_tag LOCUS_10090 75216 75389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 75356 75799 gene locus_tag LOCUS_10100 75356 75799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 75796 76218 gene locus_tag LOCUS_10110 75796 76218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 76215 76661 gene locus_tag LOCUS_10120 76215 76661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 77494 76667 gene locus_tag LOCUS_10130 77494 76667 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_10130 79131 77491 gene locus_tag LOCUS_10140 79131 77491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 80318 79128 gene locus_tag LOCUS_10150 80318 79128 CDS product maltose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082383.1 protein_id gnl|my_center|LOCUS_10150 81373 80315 gene locus_tag LOCUS_10160 81373 80315 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066534.1 protein_id gnl|my_center|LOCUS_10160 82687 82238 gene locus_tag LOCUS_10170 gene dtd 82687 82238 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZI9 protein_id gnl|my_center|LOCUS_10170 82798 83361 gene locus_tag LOCUS_10180 82798 83361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 86013 83371 gene locus_tag LOCUS_10190 86013 83371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 86223 87083 gene locus_tag LOCUS_10200 86223 87083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 87067 89337 gene locus_tag LOCUS_10210 87067 89337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 89334 90704 gene locus_tag LOCUS_10220 89334 90704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 90846 91358 gene locus_tag LOCUS_10230 90846 91358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 91358 92800 gene locus_tag LOCUS_10240 91358 92800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 93438 92788 gene locus_tag LOCUS_10250 93438 92788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 94527 93526 gene locus_tag LOCUS_10260 94527 93526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 94789 95751 gene locus_tag LOCUS_10270 94789 95751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 97706 95796 gene locus_tag LOCUS_10280 gene uup 97706 95796 CDS product heme ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence009 970 2601 gene locus_tag LOCUS_10290 970 2601 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804345.1 protein_id gnl|my_center|LOCUS_10290 2806 2558 gene locus_tag LOCUS_10300 2806 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 3941 2853 gene locus_tag LOCUS_10310 3941 2853 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHD2 protein_id gnl|my_center|LOCUS_10310 5286 3997 gene locus_tag LOCUS_10320 gene nqrF 5286 3997 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_10320 5919 5302 gene locus_tag LOCUS_10330 gene nqrE 5919 5302 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FWW6 protein_id gnl|my_center|LOCUS_10330 6531 5923 gene locus_tag LOCUS_10340 gene nqrD 6531 5923 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA9 protein_id gnl|my_center|LOCUS_10340 7316 6531 gene locus_tag LOCUS_10350 gene nqrC 7316 6531 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_10350 8550 7306 gene locus_tag LOCUS_10360 gene nqrB 8550 7306 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_10360 9917 8550 gene locus_tag LOCUS_10370 gene nqrA 9917 8550 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FP52 protein_id gnl|my_center|LOCUS_10370 10473 10889 gene locus_tag LOCUS_10380 10473 10889 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767887.1 protein_id gnl|my_center|LOCUS_10380 10925 12733 gene locus_tag LOCUS_10390 10925 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 12914 14599 gene locus_tag LOCUS_10400 12914 14599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 14734 15783 gene locus_tag LOCUS_10410 14734 15783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 19902 15946 gene locus_tag LOCUS_10420 19902 15946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 21052 19922 gene locus_tag LOCUS_10430 21052 19922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 23784 21358 gene locus_tag LOCUS_10440 23784 21358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 24093 24006 gene locus_tag LOCUS_t00030 24093 24006 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24722 24240 gene locus_tag LOCUS_10450 24722 24240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 25489 24722 gene locus_tag LOCUS_10460 gene tpiA 25489 24722 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27876 protein_id gnl|my_center|LOCUS_10460 26697 25486 gene locus_tag LOCUS_10470 gene pgk 26697 25486 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYC0 protein_id gnl|my_center|LOCUS_10470 27708 26701 gene locus_tag LOCUS_10480 gene gap 27708 26701 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI31 protein_id gnl|my_center|LOCUS_10480 27868 29664 gene locus_tag LOCUS_10490 27868 29664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 29661 30005 gene locus_tag LOCUS_10500 29661 30005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 31178 30090 gene locus_tag LOCUS_10510 31178 30090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 31730 32500 gene locus_tag LOCUS_10520 31730 32500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 32534 33805 gene locus_tag LOCUS_10530 32534 33805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 34400 33771 gene locus_tag LOCUS_10540 34400 33771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 34978 34397 gene locus_tag LOCUS_10550 34978 34397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 36116 34992 gene locus_tag LOCUS_10560 36116 34992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 37027 36113 gene locus_tag LOCUS_10570 37027 36113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 37240 38427 gene locus_tag LOCUS_10580 37240 38427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_10580 38945 38424 gene locus_tag LOCUS_10590 38945 38424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 39981 38953 gene locus_tag LOCUS_10600 gene argC 39981 38953 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q9 protein_id gnl|my_center|LOCUS_10600 40386 39988 gene locus_tag LOCUS_10610 gene rpsI 40386 39988 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY3 protein_id gnl|my_center|LOCUS_10610 40978 40529 gene locus_tag LOCUS_10620 gene rplM 40978 40529 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPK3 protein_id gnl|my_center|LOCUS_10620 41224 42318 gene locus_tag LOCUS_10630 41224 42318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 42906 42325 gene locus_tag LOCUS_10640 42906 42325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 43086 44483 gene locus_tag LOCUS_10650 43086 44483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 44480 46237 gene locus_tag LOCUS_10660 gene menD 44480 46237 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HC26 protein_id gnl|my_center|LOCUS_10660 46234 47133 gene locus_tag LOCUS_10670 gene menA 46234 47133 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBE2 protein_id gnl|my_center|LOCUS_10670 47130 48140 gene locus_tag LOCUS_10680 47130 48140 CDS product hydrophobic dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q834W6 protein_id gnl|my_center|LOCUS_10680 48137 49927 gene locus_tag LOCUS_10690 48137 49927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 49920 51011 gene locus_tag LOCUS_10700 gene cel 49920 51011 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175409.1 protein_id gnl|my_center|LOCUS_10700 51017 52003 gene locus_tag LOCUS_10710 gene aroF 51017 52003 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYH8 protein_id gnl|my_center|LOCUS_10710 52000 52704 gene locus_tag LOCUS_10720 gene ubiE 52000 52704 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU2 protein_id gnl|my_center|LOCUS_10720 53706 54746 gene locus_tag LOCUS_10730 53706 54746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 56366 54921 gene locus_tag LOCUS_10740 gene fliC 56366 54921 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV0 protein_id gnl|my_center|LOCUS_10740 58551 57058 gene locus_tag LOCUS_10750 58551 57058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_10750 59500 58625 gene locus_tag LOCUS_10760 59500 58625 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_10760 61050 59596 gene locus_tag LOCUS_10770 61050 59596 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_10770 62010 61594 gene locus_tag LOCUS_10780 62010 61594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 62077 63129 gene locus_tag LOCUS_10790 62077 63129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_10790 63177 63671 gene locus_tag LOCUS_10800 63177 63671 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124198.1 protein_id gnl|my_center|LOCUS_10800 63902 65899 gene locus_tag LOCUS_10810 63902 65899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 66624 65944 gene locus_tag LOCUS_10820 66624 65944 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_10820 68332 66851 gene locus_tag LOCUS_10830 68332 66851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 68932 68579 gene locus_tag LOCUS_10840 68932 68579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 69043 70356 gene locus_tag LOCUS_10850 gene pip 69043 70356 CDS product proline iminopeptidase Pip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072953.1 protein_id gnl|my_center|LOCUS_10850 70368 70631 gene locus_tag LOCUS_10860 70368 70631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 71251 70658 gene locus_tag LOCUS_10870 71251 70658 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIN6 protein_id gnl|my_center|LOCUS_10870 71601 72539 gene locus_tag LOCUS_10880 71601 72539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 73820 72576 gene locus_tag LOCUS_10890 73820 72576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 73977 75293 gene locus_tag LOCUS_10900 73977 75293 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_10900 75430 75966 gene locus_tag LOCUS_10910 75430 75966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 75963 76913 gene locus_tag LOCUS_10920 75963 76913 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_10920 77697 76921 gene locus_tag LOCUS_10930 77697 76921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 79819 77942 gene locus_tag LOCUS_10940 gene gsiA 79819 77942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_10940 81114 79831 gene locus_tag LOCUS_10950 81114 79831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 82563 81124 gene locus_tag LOCUS_10960 82563 81124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 84591 82573 gene locus_tag LOCUS_10970 84591 82573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 86954 84741 gene locus_tag LOCUS_10980 86954 84741 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121777.1 protein_id gnl|my_center|LOCUS_10980 87436 87185 gene locus_tag LOCUS_10990 87436 87185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 87317 88267 gene locus_tag LOCUS_11000 87317 88267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228113.1 protein_id gnl|my_center|LOCUS_11000 88525 91749 gene locus_tag LOCUS_11010 88525 91749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence010 2252 642 gene locus_tag LOCUS_11020 2252 642 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945966.1 protein_id gnl|my_center|LOCUS_11020 2628 2789 gene locus_tag LOCUS_11030 2628 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 3746 3111 gene locus_tag LOCUS_11040 3746 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 4006 4500 gene locus_tag LOCUS_11050 4006 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4713 6335 gene locus_tag LOCUS_11060 4713 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 6447 10583 gene locus_tag LOCUS_11070 6447 10583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 10744 11202 gene locus_tag LOCUS_11080 10744 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 11278 11811 gene locus_tag LOCUS_11090 11278 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 12223 11891 gene locus_tag LOCUS_11100 12223 11891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 15027 12523 gene locus_tag LOCUS_11110 15027 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 15884 15369 gene locus_tag LOCUS_11120 15884 15369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 16048 17238 gene locus_tag LOCUS_11130 16048 17238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 17460 18086 gene locus_tag LOCUS_11140 17460 18086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 18083 18967 gene locus_tag LOCUS_11150 18083 18967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 19522 19055 gene locus_tag LOCUS_11160 19522 19055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 19827 20435 gene locus_tag LOCUS_11170 gene ribC 19827 20435 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072298.1 protein_id gnl|my_center|LOCUS_11170 20521 20973 gene locus_tag LOCUS_11180 20521 20973 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_11180 21071 22075 gene locus_tag LOCUS_11190 21071 22075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 22041 22238 gene locus_tag LOCUS_11200 22041 22238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 22222 25401 gene locus_tag LOCUS_11210 22222 25401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 25461 26666 gene locus_tag LOCUS_11220 25461 26666 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968121.1 protein_id gnl|my_center|LOCUS_11220 26659 28239 gene locus_tag LOCUS_11230 26659 28239 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_11230 28236 29744 gene locus_tag LOCUS_11240 28236 29744 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846891.1 protein_id gnl|my_center|LOCUS_11240 29842 30075 gene locus_tag LOCUS_11250 29842 30075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 30756 30133 gene locus_tag LOCUS_11260 30756 30133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 32190 30766 gene locus_tag LOCUS_11270 32190 30766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 32513 32349 gene locus_tag LOCUS_11280 32513 32349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 33885 33550 gene locus_tag LOCUS_11290 33885 33550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 33820 35013 gene locus_tag LOCUS_11300 33820 35013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 35127 35450 gene locus_tag LOCUS_11310 35127 35450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 35642 37771 gene locus_tag LOCUS_11320 35642 37771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 37957 39624 gene locus_tag LOCUS_11330 37957 39624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 39741 40901 gene locus_tag LOCUS_11340 gene sbcD 39741 40901 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB8 protein_id gnl|my_center|LOCUS_11340 40898 43975 gene locus_tag LOCUS_11350 gene sbcC 40898 43975 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB9 protein_id gnl|my_center|LOCUS_11350 45575 43977 gene locus_tag LOCUS_11360 45575 43977 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 protein_id gnl|my_center|LOCUS_11360 45735 46856 gene locus_tag LOCUS_11370 45735 46856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 48466 46853 gene locus_tag LOCUS_11380 48466 46853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 48788 52513 gene locus_tag LOCUS_11390 48788 52513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 52610 54142 gene locus_tag LOCUS_11400 52610 54142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 54212 55171 gene locus_tag LOCUS_11410 54212 55171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 55172 55855 gene locus_tag LOCUS_11420 55172 55855 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331306.1 protein_id gnl|my_center|LOCUS_11420 56073 56969 gene locus_tag LOCUS_11430 56073 56969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 57201 57746 gene locus_tag LOCUS_11440 57201 57746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 57736 58221 gene locus_tag LOCUS_11450 57736 58221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 59894 58239 gene locus_tag LOCUS_11460 59894 58239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226998.1 protein_id gnl|my_center|LOCUS_11460 60889 59951 gene locus_tag LOCUS_11470 60889 59951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 62097 60886 gene locus_tag LOCUS_11480 62097 60886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 62254 63315 gene locus_tag LOCUS_11490 62254 63315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 65085 63265 gene locus_tag LOCUS_11500 65085 63265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 65219 65986 gene locus_tag LOCUS_11510 gene surE 65219 65986 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH6 protein_id gnl|my_center|LOCUS_11510 66697 65990 gene locus_tag LOCUS_11520 66697 65990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 67047 66694 gene locus_tag LOCUS_11530 67047 66694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 67372 68538 gene locus_tag LOCUS_11540 gene atuD 67372 68538 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_11540 68624 69865 gene locus_tag LOCUS_11550 68624 69865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 71332 69878 gene locus_tag LOCUS_11560 71332 69878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 71593 71997 gene locus_tag LOCUS_11570 71593 71997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 72256 74853 gene locus_tag LOCUS_11580 72256 74853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 75070 76518 gene locus_tag LOCUS_11590 75070 76518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 77115 76843 gene locus_tag LOCUS_11600 77115 76843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 77448 78890 gene locus_tag LOCUS_11610 77448 78890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 79626 78928 gene locus_tag LOCUS_11620 79626 78928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 79840 80733 gene locus_tag LOCUS_11630 79840 80733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 81307 80699 gene locus_tag LOCUS_11640 81307 80699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 82992 81307 gene locus_tag LOCUS_11650 82992 81307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 89349 83089 gene locus_tag LOCUS_11660 89349 83089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 90203 89424 gene locus_tag LOCUS_11670 gene apaH 90203 89424 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRF6 protein_id gnl|my_center|LOCUS_11670 >Feature sequence011 2248 92 gene locus_tag LOCUS_11680 gene relA 2248 92 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_11680 2927 2337 gene locus_tag LOCUS_11690 gene gmk 2927 2337 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TA9 protein_id gnl|my_center|LOCUS_11690 3827 2931 gene locus_tag LOCUS_11700 3827 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416240.1 protein_id gnl|my_center|LOCUS_11700 4146 3883 gene locus_tag LOCUS_11710 4146 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 6794 4239 gene locus_tag LOCUS_11720 6794 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 8385 6889 gene locus_tag LOCUS_11730 8385 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 8559 10154 gene locus_tag LOCUS_11740 8559 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 10882 10151 gene locus_tag LOCUS_11750 10882 10151 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_11750 13945 11045 gene locus_tag LOCUS_11760 13945 11045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 14234 14306 gene locus_tag LOCUS_t00040 14234 14306 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14329 14401 gene locus_tag LOCUS_t00050 14329 14401 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 15089 14451 gene locus_tag LOCUS_11770 15089 14451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 15430 15936 gene locus_tag LOCUS_11780 15430 15936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 16950 15925 gene locus_tag LOCUS_11790 16950 15925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 17554 17081 gene locus_tag LOCUS_11800 17554 17081 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966123.1 protein_id gnl|my_center|LOCUS_11800 17970 17551 gene locus_tag LOCUS_11810 17970 17551 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941534.1 protein_id gnl|my_center|LOCUS_11810 18244 17963 gene locus_tag LOCUS_11820 18244 17963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 19574 18255 gene locus_tag LOCUS_11830 19574 18255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 21302 19587 gene locus_tag LOCUS_11840 21302 19587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 21733 21305 gene locus_tag LOCUS_11850 21733 21305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 21831 22415 gene locus_tag LOCUS_11860 21831 22415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 23150 22416 gene locus_tag LOCUS_11870 23150 22416 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256704.1 protein_id gnl|my_center|LOCUS_11870 23771 23163 gene locus_tag LOCUS_11880 gene gph 23771 23163 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8H3 protein_id gnl|my_center|LOCUS_11880 23893 25440 gene locus_tag LOCUS_11890 gene hutH 23893 25440 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCB3 protein_id gnl|my_center|LOCUS_11890 25433 26689 gene locus_tag LOCUS_11900 gene hutI 25433 26689 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU91 protein_id gnl|my_center|LOCUS_11900 27314 26706 gene locus_tag LOCUS_11910 27314 26706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 28768 27299 gene locus_tag LOCUS_11920 gene yjeF 28768 27299 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C72 protein_id gnl|my_center|LOCUS_11920 29234 28857 gene locus_tag LOCUS_11930 29234 28857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 29946 29212 gene locus_tag LOCUS_11940 gene pdxJ 29946 29212 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYK5 protein_id gnl|my_center|LOCUS_11940 31315 29951 gene locus_tag LOCUS_11950 gene glmM 31315 29951 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C70 protein_id gnl|my_center|LOCUS_11950 32399 31368 gene locus_tag LOCUS_11960 32399 31368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 33277 32396 gene locus_tag LOCUS_11970 33277 32396 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_11970 34068 33280 gene locus_tag LOCUS_11980 gene folP 34068 33280 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV49 protein_id gnl|my_center|LOCUS_11980 36132 34210 gene locus_tag LOCUS_11990 gene ftsH-2 36132 34210 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C66 protein_id gnl|my_center|LOCUS_11990 36928 36338 gene locus_tag LOCUS_12000 36928 36338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 37340 37582 gene locus_tag LOCUS_12010 37340 37582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 38349 37714 gene locus_tag LOCUS_12020 38349 37714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 38700 40025 gene locus_tag LOCUS_12030 38700 40025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 40301 40128 gene locus_tag LOCUS_12040 40301 40128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 40506 40769 gene locus_tag LOCUS_12050 gene grxC 40506 40769 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 protein_id gnl|my_center|LOCUS_12050 40993 45036 gene locus_tag LOCUS_12060 40993 45036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 46635 45205 gene locus_tag LOCUS_12070 46635 45205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 46841 47266 gene locus_tag LOCUS_12080 46841 47266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 50201 47292 gene locus_tag LOCUS_12090 50201 47292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 50947 50222 gene locus_tag LOCUS_12100 50947 50222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 51270 52157 gene locus_tag LOCUS_12110 51270 52157 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_12110 52154 53125 gene locus_tag LOCUS_12120 52154 53125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 54034 53126 gene locus_tag LOCUS_12130 54034 53126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123872.1 protein_id gnl|my_center|LOCUS_12130 58635 54037 gene locus_tag LOCUS_12140 58635 54037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 59551 58610 gene locus_tag LOCUS_12150 59551 58610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 60367 59846 gene locus_tag LOCUS_12160 60367 59846 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545060.1 protein_id gnl|my_center|LOCUS_12160 61074 60364 gene locus_tag LOCUS_12170 gene proC 61074 60364 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V92 protein_id gnl|my_center|LOCUS_12170 62755 61193 gene locus_tag LOCUS_12180 62755 61193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 63829 62957 gene locus_tag LOCUS_12190 gene mtnP 63829 62957 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E52 protein_id gnl|my_center|LOCUS_12190 64901 63840 gene locus_tag LOCUS_12200 gene rlmN 64901 63840 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E53 protein_id gnl|my_center|LOCUS_12200 65359 64931 gene locus_tag LOCUS_12210 gene ndk 65359 64931 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65539 protein_id gnl|my_center|LOCUS_12210 66408 65539 gene locus_tag LOCUS_12220 gene sucD 66408 65539 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEY0 protein_id gnl|my_center|LOCUS_12220 67589 66420 gene locus_tag LOCUS_12230 gene sucC 67589 66420 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEX9 protein_id gnl|my_center|LOCUS_12230 67839 69737 gene locus_tag LOCUS_12240 67839 69737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 69789 70532 gene locus_tag LOCUS_12250 69789 70532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 70957 70559 gene locus_tag LOCUS_12260 70957 70559 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714149.1 protein_id gnl|my_center|LOCUS_12260 71695 71078 gene locus_tag LOCUS_12270 71695 71078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 71664 72392 gene locus_tag LOCUS_12280 71664 72392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 72394 74949 gene locus_tag LOCUS_12290 72394 74949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 77110 75041 gene locus_tag LOCUS_12300 gene fusA2 77110 75041 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73NV3 protein_id gnl|my_center|LOCUS_12300 77406 78293 gene locus_tag LOCUS_12310 gene rsgA 77406 78293 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ79 protein_id gnl|my_center|LOCUS_12310 78303 79052 gene locus_tag LOCUS_12320 78303 79052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 79049 81889 gene locus_tag LOCUS_12330 79049 81889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 85686 81886 gene locus_tag LOCUS_12340 85686 81886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 86218 85706 gene locus_tag LOCUS_12350 86218 85706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 86443 87270 gene locus_tag LOCUS_12360 86443 87270 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_12360 87273 88475 gene locus_tag LOCUS_12370 87273 88475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470532.1 protein_id gnl|my_center|LOCUS_12370 88791 88492 gene locus_tag LOCUS_12380 88791 88492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence012 <1 1554 gene locus_tag LOCUS_12390 <1 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87FC9:tRNA(Met) cytidine acetyltransferase TmcA 1647 2699 gene locus_tag LOCUS_12400 1647 2699 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_12400 2731 3741 gene locus_tag LOCUS_12410 2731 3741 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933606.1 protein_id gnl|my_center|LOCUS_12410 3833 4399 gene locus_tag LOCUS_12420 3833 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 4407 5540 gene locus_tag LOCUS_12430 4407 5540 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968467.1 protein_id gnl|my_center|LOCUS_12430 5658 7355 gene locus_tag LOCUS_12440 5658 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 7798 7352 gene locus_tag LOCUS_12450 7798 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 9017 7791 gene locus_tag LOCUS_12460 9017 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 9138 11954 gene locus_tag LOCUS_12470 9138 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 12615 12079 gene locus_tag LOCUS_12480 12615 12079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 14560 12632 gene locus_tag LOCUS_12490 14560 12632 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_12490 14822 15721 gene locus_tag LOCUS_12500 gene rnhC 14822 15721 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6J1 protein_id gnl|my_center|LOCUS_12500 16996 15725 gene locus_tag LOCUS_12510 16996 15725 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066917.1 protein_id gnl|my_center|LOCUS_12510 17110 17967 gene locus_tag LOCUS_12520 17110 17967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 17964 18893 gene locus_tag LOCUS_12530 17964 18893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 19138 19890 gene locus_tag LOCUS_12540 19138 19890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 20345 19893 gene locus_tag LOCUS_12550 20345 19893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 21722 20364 gene locus_tag LOCUS_12560 21722 20364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 22592 21813 gene locus_tag LOCUS_12570 gene fabI 22592 21813 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJX9 protein_id gnl|my_center|LOCUS_12570 25157 22644 gene locus_tag LOCUS_12580 25157 22644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 25346 27601 gene locus_tag LOCUS_12590 gene maeB 25346 27601 CDS product bifunctional malic enzyme oxidoreductase/phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_12590 27620 29527 gene locus_tag LOCUS_12600 gene ligA 27620 29527 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N602 protein_id gnl|my_center|LOCUS_12600 30223 29537 gene locus_tag LOCUS_12610 30223 29537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 30445 31593 gene locus_tag LOCUS_12620 30445 31593 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858082.1 protein_id gnl|my_center|LOCUS_12620 31771 33606 gene locus_tag LOCUS_12630 31771 33606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 33766 34551 gene locus_tag LOCUS_12640 33766 34551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 34563 35576 gene locus_tag LOCUS_12650 34563 35576 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943187.1 protein_id gnl|my_center|LOCUS_12650 35681 36712 gene locus_tag LOCUS_12660 35681 36712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 36724 38067 gene locus_tag LOCUS_12670 gene trmFO 36724 38067 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A44 protein_id gnl|my_center|LOCUS_12670 38183 39118 gene locus_tag LOCUS_12680 gene xerC 38183 39118 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW0 protein_id gnl|my_center|LOCUS_12680 39232 39789 gene locus_tag LOCUS_12690 gene hslV 39232 39789 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61478 protein_id gnl|my_center|LOCUS_12690 39816 41231 gene locus_tag LOCUS_12700 gene hslU 39816 41231 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG00 protein_id gnl|my_center|LOCUS_12700 41329 42219 gene locus_tag LOCUS_12710 gene argB 41329 42219 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GU4 protein_id gnl|my_center|LOCUS_12710 42219 42749 gene locus_tag LOCUS_12720 42219 42749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 42746 43960 gene locus_tag LOCUS_12730 gene argD 42746 43960 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN66 protein_id gnl|my_center|LOCUS_12730 43960 44877 gene locus_tag LOCUS_12740 gene argF 43960 44877 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GU2 protein_id gnl|my_center|LOCUS_12740 47503 44879 gene locus_tag LOCUS_12750 47503 44879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 47859 49280 gene locus_tag LOCUS_12760 47859 49280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 49298 51115 gene locus_tag LOCUS_12770 gene dnaK 49298 51115 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_12770 51121 52239 gene locus_tag LOCUS_12780 51121 52239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 53339 52248 gene locus_tag LOCUS_12790 53339 52248 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405365.1 protein_id gnl|my_center|LOCUS_12790 53925 53326 gene locus_tag LOCUS_12800 gene coaE 53925 53326 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FU2 protein_id gnl|my_center|LOCUS_12800 54535 55458 gene locus_tag LOCUS_12810 54535 55458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 55455 56330 gene locus_tag LOCUS_12820 55455 56330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 56331 56921 gene locus_tag LOCUS_12830 gene engB 56331 56921 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748I9 protein_id gnl|my_center|LOCUS_12830 56923 57378 gene locus_tag LOCUS_12840 gene rimI 56923 57378 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BF8 protein_id gnl|my_center|LOCUS_12840 60197 57357 gene locus_tag LOCUS_12850 60197 57357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 61240 60206 gene locus_tag LOCUS_12860 61240 60206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 63576 61237 gene locus_tag LOCUS_12870 63576 61237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 68265 63670 gene locus_tag LOCUS_12880 68265 63670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 68891 68430 gene locus_tag LOCUS_12890 68891 68430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 69734 68898 gene locus_tag LOCUS_12900 69734 68898 CDS product 3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730907.1 protein_id gnl|my_center|LOCUS_12900 70931 69825 gene locus_tag LOCUS_12910 70931 69825 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_12910 71809 72135 gene locus_tag LOCUS_12920 71809 72135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 72789 72172 gene locus_tag LOCUS_12930 72789 72172 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404017.1 protein_id gnl|my_center|LOCUS_12930 76250 72798 gene locus_tag LOCUS_12940 76250 72798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 76588 76394 gene locus_tag LOCUS_12950 76588 76394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 76815 77438 gene locus_tag LOCUS_12960 76815 77438 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_12960 77499 78080 gene locus_tag LOCUS_12970 gene efp 77499 78080 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88WN1 protein_id gnl|my_center|LOCUS_12970 79587 78124 gene locus_tag LOCUS_12980 79587 78124 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562056.1 protein_id gnl|my_center|LOCUS_12980 79798 81114 gene locus_tag LOCUS_12990 79798 81114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 81191 82999 gene locus_tag LOCUS_13000 gene aspS 81191 82999 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817X8 protein_id gnl|my_center|LOCUS_13000 83186 83037 gene locus_tag LOCUS_13010 83186 83037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 85406 83304 gene locus_tag LOCUS_13020 85406 83304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 87373 85403 gene locus_tag LOCUS_13030 87373 85403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence013 969 178 gene locus_tag LOCUS_13040 969 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1046 1348 gene locus_tag LOCUS_13050 1046 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 2298 1345 gene locus_tag LOCUS_13060 gene dnaJ 2298 1345 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_13060 2450 3532 gene locus_tag LOCUS_13070 gene bkdA1 2450 3532 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709485.1 protein_id gnl|my_center|LOCUS_13070 3529 4611 gene locus_tag LOCUS_13080 gene aroC 3529 4611 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9N4 protein_id gnl|my_center|LOCUS_13080 6043 4646 gene locus_tag LOCUS_13090 6043 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 7094 6114 gene locus_tag LOCUS_13100 gene nadA 7094 6114 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP65 protein_id gnl|my_center|LOCUS_13100 7959 7105 gene locus_tag LOCUS_13110 7959 7105 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_13110 8783 8001 gene locus_tag LOCUS_13120 8783 8001 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481578.1 protein_id gnl|my_center|LOCUS_13120 9156 8788 gene locus_tag LOCUS_13130 9156 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 9217 9741 gene locus_tag LOCUS_13140 9217 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 9738 11567 gene locus_tag LOCUS_13150 9738 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 12753 11551 gene locus_tag LOCUS_13160 12753 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 13622 14638 gene locus_tag LOCUS_13170 gene plsX 13622 14638 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Y4 protein_id gnl|my_center|LOCUS_13170 14691 15728 gene locus_tag LOCUS_13180 14691 15728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 17160 16852 gene locus_tag LOCUS_13190 17160 16852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 17180 17365 gene locus_tag LOCUS_13200 17180 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 17972 18136 gene locus_tag LOCUS_13210 17972 18136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 18176 18418 gene locus_tag LOCUS_13220 18176 18418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 18440 18718 gene locus_tag LOCUS_13230 18440 18718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 18752 19036 gene locus_tag LOCUS_13240 18752 19036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 19091 19357 gene locus_tag LOCUS_13250 19091 19357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 20229 19870 gene locus_tag LOCUS_13260 20229 19870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 20519 20761 gene locus_tag LOCUS_13270 20519 20761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 21231 20818 gene locus_tag LOCUS_13280 21231 20818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 21758 21967 gene locus_tag LOCUS_13290 21758 21967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 21906 22670 gene locus_tag LOCUS_13300 21906 22670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 22676 23479 gene locus_tag LOCUS_13310 22676 23479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 24252 23881 gene locus_tag LOCUS_13320 24252 23881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 24578 24994 gene locus_tag LOCUS_13330 24578 24994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 25361 25840 gene locus_tag LOCUS_13340 25361 25840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 26811 28343 gene locus_tag LOCUS_13350 26811 28343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 28346 29143 gene locus_tag LOCUS_13360 gene lpxH 28346 29143 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_13360 30522 29182 gene locus_tag LOCUS_13370 gene der 30522 29182 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX4 protein_id gnl|my_center|LOCUS_13370 31442 30519 gene locus_tag LOCUS_13380 gene era 31442 30519 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX3 protein_id gnl|my_center|LOCUS_13380 31751 32794 gene locus_tag LOCUS_13390 31751 32794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 32910 33428 gene locus_tag LOCUS_13400 32910 33428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 34158 33430 gene locus_tag LOCUS_13410 34158 33430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 35258 34155 gene locus_tag LOCUS_13420 gene mnmA 35258 34155 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A22 protein_id gnl|my_center|LOCUS_13420 36385 35267 gene locus_tag LOCUS_13430 gene nifS-2 36385 35267 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_13430 37602 36385 gene locus_tag LOCUS_13440 37602 36385 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257960.1 protein_id gnl|my_center|LOCUS_13440 38843 37599 gene locus_tag LOCUS_13450 38843 37599 CDS product polynucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861564.1 protein_id gnl|my_center|LOCUS_13450 39613 38996 gene locus_tag LOCUS_13460 39613 38996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 41205 40366 gene locus_tag LOCUS_13470 gene waaM 41205 40366 CDS product lipid A lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948625.1 protein_id gnl|my_center|LOCUS_13470 42245 41235 gene locus_tag LOCUS_13480 gene lpxK 42245 41235 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9Z2 protein_id gnl|my_center|LOCUS_13480 43877 42315 gene locus_tag LOCUS_13490 gene rpoD 43877 42315 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B8 protein_id gnl|my_center|LOCUS_13490 44789 44103 gene locus_tag LOCUS_13500 44789 44103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 46482 44782 gene locus_tag LOCUS_13510 46482 44782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887032.1 protein_id gnl|my_center|LOCUS_13510 46574 46395 gene locus_tag LOCUS_13520 46574 46395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 47205 46576 gene locus_tag LOCUS_13530 47205 46576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 50408 47229 gene locus_tag LOCUS_13540 50408 47229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 51602 50430 gene locus_tag LOCUS_13550 51602 50430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 52743 51610 gene locus_tag LOCUS_13560 52743 51610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 53504 52758 gene locus_tag LOCUS_13570 53504 52758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 54349 53501 gene locus_tag LOCUS_13580 54349 53501 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_13580 55232 54342 gene locus_tag LOCUS_13590 55232 54342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13590 56092 55229 gene locus_tag LOCUS_13600 56092 55229 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_13600 57062 56085 gene locus_tag LOCUS_13610 57062 56085 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385656.1 protein_id gnl|my_center|LOCUS_13610 58603 57059 gene locus_tag LOCUS_13620 58603 57059 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_13620 60135 58615 gene locus_tag LOCUS_13630 60135 58615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 61955 60150 gene locus_tag LOCUS_13640 61955 60150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 62296 61955 gene locus_tag LOCUS_13650 62296 61955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 62851 62390 gene locus_tag LOCUS_13660 62851 62390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 65207 62961 gene locus_tag LOCUS_13670 65207 62961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 65341 67329 gene locus_tag LOCUS_13680 65341 67329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 67326 70238 gene locus_tag LOCUS_13690 67326 70238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 70387 72141 gene locus_tag LOCUS_13700 70387 72141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 72281 72991 gene locus_tag LOCUS_13710 72281 72991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 73082 73008 gene locus_tag LOCUS_t00060 73082 73008 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 73629 73114 gene locus_tag LOCUS_13720 gene apt 73629 73114 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183I0 protein_id gnl|my_center|LOCUS_13720 74360 73677 gene locus_tag LOCUS_13730 74360 73677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 75157 74399 gene locus_tag LOCUS_13740 gene surE 75157 74399 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG98 protein_id gnl|my_center|LOCUS_13740 75298 75224 gene locus_tag LOCUS_t00070 75298 75224 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 75646 75353 gene locus_tag LOCUS_13750 gene ihfA-1 75646 75353 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ8 protein_id gnl|my_center|LOCUS_13750 76100 75747 gene locus_tag LOCUS_13760 gene rplT 76100 75747 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D01 protein_id gnl|my_center|LOCUS_13760 76381 76184 gene locus_tag LOCUS_13770 gene rpmI 76381 76184 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66283 protein_id gnl|my_center|LOCUS_13770 76520 76446 gene locus_tag LOCUS_t00080 76520 76446 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 76731 77165 gene locus_tag LOCUS_13780 76731 77165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 78084 80441 gene locus_tag LOCUS_13790 78084 80441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 80438 80968 gene locus_tag LOCUS_13800 80438 80968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 82103 80988 gene locus_tag LOCUS_13810 82103 80988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 83053 82211 gene locus_tag LOCUS_13820 83053 82211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence014 644 3340 gene locus_tag LOCUS_13830 644 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 3343 5064 gene locus_tag LOCUS_13840 gene gspE 3343 5064 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 protein_id gnl|my_center|LOCUS_13840 5080 6306 gene locus_tag LOCUS_13850 gene pilC 5080 6306 CDS product pilus biosynthesis protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_13850 6326 6766 gene locus_tag LOCUS_13860 gene gspG 6326 6766 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880232.1 protein_id gnl|my_center|LOCUS_13860 6783 7424 gene locus_tag LOCUS_13870 6783 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 7421 8059 gene locus_tag LOCUS_13880 7421 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 8140 8784 gene locus_tag LOCUS_13890 8140 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 8781 10142 gene locus_tag LOCUS_13900 8781 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 10142 11734 gene locus_tag LOCUS_13910 10142 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 11744 12355 gene locus_tag LOCUS_13920 11744 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 12355 14136 gene locus_tag LOCUS_13930 12355 14136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 16896 14356 gene locus_tag LOCUS_13940 16896 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 17085 16912 gene locus_tag LOCUS_13950 17085 16912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 17413 17075 gene locus_tag LOCUS_13960 17413 17075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 18090 17434 gene locus_tag LOCUS_13970 gene ccmC 18090 17434 CDS product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_13970 18788 18087 gene locus_tag LOCUS_13980 18788 18087 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_13980 19501 18785 gene locus_tag LOCUS_13990 19501 18785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_13990 20769 19498 gene locus_tag LOCUS_14000 20769 19498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 21161 20766 gene locus_tag LOCUS_14010 21161 20766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 23335 21164 gene locus_tag LOCUS_14020 23335 21164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 23797 23354 gene locus_tag LOCUS_14030 gene ccmE 23797 23354 CDS product cytochrome C biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938350.1 protein_id gnl|my_center|LOCUS_14030 24995 23934 gene locus_tag LOCUS_14040 gene moaA 24995 23934 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDF6 protein_id gnl|my_center|LOCUS_14040 30760 24992 gene locus_tag LOCUS_14050 30760 24992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 30981 30772 gene locus_tag LOCUS_14060 30981 30772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 31869 31132 gene locus_tag LOCUS_14070 31869 31132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 31893 32339 gene locus_tag LOCUS_14080 31893 32339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 35294 32403 gene locus_tag LOCUS_14090 35294 32403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 36021 35569 gene locus_tag LOCUS_14100 gene dut 36021 35569 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61908 protein_id gnl|my_center|LOCUS_14100 38127 36025 gene locus_tag LOCUS_14110 gene pnp 38127 36025 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS9 protein_id gnl|my_center|LOCUS_14110 38630 38361 gene locus_tag LOCUS_14120 gene rpsO 38630 38361 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86655 protein_id gnl|my_center|LOCUS_14120 39684 38761 gene locus_tag LOCUS_14130 gene truB 39684 38761 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVP8 protein_id gnl|my_center|LOCUS_14130 40058 39681 gene locus_tag LOCUS_14140 gene rbfA 40058 39681 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRV5 protein_id gnl|my_center|LOCUS_14140 42816 40081 gene locus_tag LOCUS_14150 gene infB 42816 40081 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT3 protein_id gnl|my_center|LOCUS_14150 43486 42881 gene locus_tag LOCUS_14160 gene ylxRQ 43486 42881 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942232.1 protein_id gnl|my_center|LOCUS_14160 45348 43528 gene locus_tag LOCUS_14170 45348 43528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 45896 45375 gene locus_tag LOCUS_14180 gene rimP 45896 45375 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_14180 46766 46056 gene locus_tag LOCUS_14190 46766 46056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 48365 46878 gene locus_tag LOCUS_14200 48365 46878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 50238 48541 gene locus_tag LOCUS_14210 50238 48541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 50421 51509 gene locus_tag LOCUS_14220 50421 51509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 52923 51511 gene locus_tag LOCUS_14230 gene mpl 52923 51511 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_14230 53183 56107 gene locus_tag LOCUS_14240 gene uvrA 53183 56107 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU9 protein_id gnl|my_center|LOCUS_14240 56920 56033 gene locus_tag LOCUS_14250 56920 56033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 57101 58102 gene locus_tag LOCUS_14260 57101 58102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 58788 58111 gene locus_tag LOCUS_14270 58788 58111 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CSM7 protein_id gnl|my_center|LOCUS_14270 63561 59089 gene locus_tag LOCUS_14280 63561 59089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 65544 63595 gene locus_tag LOCUS_14290 65544 63595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 66226 65657 gene locus_tag LOCUS_14300 66226 65657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 66504 71051 gene locus_tag LOCUS_14310 66504 71051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 71149 73665 gene locus_tag LOCUS_14320 71149 73665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 73893 75020 gene locus_tag LOCUS_14330 gene metX 73893 75020 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8L2 protein_id gnl|my_center|LOCUS_14330 75211 75921 gene locus_tag LOCUS_14340 gene smuG1 75211 75921 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_14340 76139 76723 gene locus_tag LOCUS_14350 76139 76723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 78593 76704 gene locus_tag LOCUS_14360 78593 76704 CDS product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 protein_id gnl|my_center|LOCUS_14360 79372 78590 gene locus_tag LOCUS_14370 79372 78590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 79515 80297 gene locus_tag LOCUS_14380 79515 80297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 82006 80312 gene locus_tag LOCUS_14390 82006 80312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 82980 82003 gene locus_tag LOCUS_14400 82980 82003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 83176 83871 gene locus_tag LOCUS_14410 83176 83871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence015 2976 2551 gene locus_tag LOCUS_14420 2976 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 3383 5158 gene locus_tag LOCUS_14430 3383 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 5360 6547 gene locus_tag LOCUS_14440 gene ncx 5360 6547 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121670.1 protein_id gnl|my_center|LOCUS_14440 7345 9090 gene locus_tag LOCUS_14450 7345 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 9219 10337 gene locus_tag LOCUS_14460 gene yqiG 9219 10337 CDS product putative NADH-dependent flavin oxidoreductase YqiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54524 protein_id gnl|my_center|LOCUS_14460 10427 11248 gene locus_tag LOCUS_14470 gene ttcA1 10427 11248 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NG17 protein_id gnl|my_center|LOCUS_14470 13191 11254 gene locus_tag LOCUS_14480 13191 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 13587 14474 gene locus_tag LOCUS_14490 13587 14474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 14728 14916 gene locus_tag LOCUS_14500 14728 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 15282 15731 gene locus_tag LOCUS_14510 15282 15731 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123244.1 protein_id gnl|my_center|LOCUS_14510 17711 15732 gene locus_tag LOCUS_14520 17711 15732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 17961 19325 gene locus_tag LOCUS_14530 17961 19325 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067187.1 protein_id gnl|my_center|LOCUS_14530 21163 19646 gene locus_tag LOCUS_14540 21163 19646 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZD9 protein_id gnl|my_center|LOCUS_14540 21424 22308 gene locus_tag LOCUS_14550 21424 22308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 23422 22391 gene locus_tag LOCUS_14560 gene hemH 23422 22391 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FA4 protein_id gnl|my_center|LOCUS_14560 23848 24693 gene locus_tag LOCUS_14570 23848 24693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 24852 26321 gene locus_tag LOCUS_14580 24852 26321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 26354 26722 gene locus_tag LOCUS_14590 26354 26722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 26953 26729 gene locus_tag LOCUS_14600 26953 26729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 27051 27836 gene locus_tag LOCUS_14610 27051 27836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 28054 29400 gene locus_tag LOCUS_14620 28054 29400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 30259 29501 gene locus_tag LOCUS_14630 30259 29501 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_14630 30559 31869 gene locus_tag LOCUS_14640 30559 31869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 32712 31888 gene locus_tag LOCUS_14650 32712 31888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 33035 33934 gene locus_tag LOCUS_14660 33035 33934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_14660 34007 36172 gene locus_tag LOCUS_14670 34007 36172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 37349 36207 gene locus_tag LOCUS_14680 gene pfkA 37349 36207 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHQ0 protein_id gnl|my_center|LOCUS_14680 37728 38705 gene locus_tag LOCUS_14690 gene ambD 37728 38705 CDS product protein AmbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113096.1 protein_id gnl|my_center|LOCUS_14690 38823 39803 gene locus_tag LOCUS_14700 38823 39803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 39800 40582 gene locus_tag LOCUS_14710 39800 40582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 41788 40592 gene locus_tag LOCUS_14720 41788 40592 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079684.1 protein_id gnl|my_center|LOCUS_14720 42837 41845 gene locus_tag LOCUS_14730 42837 41845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 43810 42878 gene locus_tag LOCUS_14740 43810 42878 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442783.1 protein_id gnl|my_center|LOCUS_14740 44010 46190 gene locus_tag LOCUS_14750 44010 46190 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466031.1 protein_id gnl|my_center|LOCUS_14750 48791 46200 gene locus_tag LOCUS_14760 48791 46200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 49263 50297 gene locus_tag LOCUS_14770 49263 50297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_14770 51157 50294 gene locus_tag LOCUS_14780 51157 50294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 53769 51157 gene locus_tag LOCUS_14790 53769 51157 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584701.1 protein_id gnl|my_center|LOCUS_14790 56999 54060 gene locus_tag LOCUS_14800 56999 54060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 58070 57393 gene locus_tag LOCUS_14810 58070 57393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 58410 60572 gene locus_tag LOCUS_14820 58410 60572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 60578 62047 gene locus_tag LOCUS_14830 60578 62047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 62096 62776 gene locus_tag LOCUS_14840 gene hlyI 62096 62776 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229810.1 protein_id gnl|my_center|LOCUS_14840 63476 62817 gene locus_tag LOCUS_14850 63476 62817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 67060 63947 gene locus_tag LOCUS_14860 67060 63947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 67326 67159 gene locus_tag LOCUS_14870 67326 67159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 67313 67654 gene locus_tag LOCUS_14880 67313 67654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 67976 68650 gene locus_tag LOCUS_14890 67976 68650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 68705 68977 gene locus_tag LOCUS_14900 68705 68977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 75446 69201 gene locus_tag LOCUS_14910 75446 69201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 75816 76679 gene locus_tag LOCUS_14920 75816 76679 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524880.1 protein_id gnl|my_center|LOCUS_14920 76874 77689 gene locus_tag LOCUS_14930 76874 77689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 <80163 77724 gene locus_tag LOCUS_14940 <80163 77724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087210.1:alpha-2-macroglobulin >Feature sequence016 <1 2138 gene locus_tag LOCUS_14950 <1 2138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404985.1:Na-K-Cl cotransporter 2178 5561 gene locus_tag LOCUS_14960 2178 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 5926 5600 gene locus_tag LOCUS_14970 5926 5600 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG33 protein_id gnl|my_center|LOCUS_14970 6180 5929 gene locus_tag LOCUS_14980 6180 5929 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_14980 6341 7291 gene locus_tag LOCUS_14990 6341 7291 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BQ0 protein_id gnl|my_center|LOCUS_14990 7331 7789 gene locus_tag LOCUS_15000 7331 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640683.1 protein_id gnl|my_center|LOCUS_15000 7854 8081 gene locus_tag LOCUS_15010 7854 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 8525 8094 gene locus_tag LOCUS_15020 8525 8094 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258945.1 protein_id gnl|my_center|LOCUS_15020 8884 8654 gene locus_tag LOCUS_15030 8884 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 9150 10871 gene locus_tag LOCUS_15040 9150 10871 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886676.1 protein_id gnl|my_center|LOCUS_15040 13481 10878 gene locus_tag LOCUS_15050 13481 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 13912 13487 gene locus_tag LOCUS_15060 13912 13487 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531328.1 protein_id gnl|my_center|LOCUS_15060 14049 14852 gene locus_tag LOCUS_15070 14049 14852 CDS product photosystem I assembly BtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257265.1 protein_id gnl|my_center|LOCUS_15070 16657 14849 gene locus_tag LOCUS_15080 16657 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 17482 16742 gene locus_tag LOCUS_15090 17482 16742 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390216.1 protein_id gnl|my_center|LOCUS_15090 22680 17479 gene locus_tag LOCUS_15100 22680 17479 CDS product fused acetyl/propionyl-CoA carboxylase subuit alpha/methylmalonyl-CoA decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226015.1 protein_id gnl|my_center|LOCUS_15100 22989 24386 gene locus_tag LOCUS_15110 22989 24386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 25162 24392 gene locus_tag LOCUS_15120 25162 24392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 25305 26333 gene locus_tag LOCUS_15130 25305 26333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 28789 26471 gene locus_tag LOCUS_15140 28789 26471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 29973 28984 gene locus_tag LOCUS_15150 29973 28984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 30618 30073 gene locus_tag LOCUS_15160 30618 30073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 31553 30963 gene locus_tag LOCUS_15170 31553 30963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 31680 32636 gene locus_tag LOCUS_15180 gene ribF 31680 32636 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D32 protein_id gnl|my_center|LOCUS_15180 32644 33459 gene locus_tag LOCUS_15190 32644 33459 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249220.1 protein_id gnl|my_center|LOCUS_15190 33572 35266 gene locus_tag LOCUS_15200 gene pilB 33572 35266 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_15200 35266 36345 gene locus_tag LOCUS_15210 gene pilT-4 35266 36345 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_15210 36489 37694 gene locus_tag LOCUS_15220 gene pilC 36489 37694 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_15220 37767 39476 gene locus_tag LOCUS_15230 gene pilS 37767 39476 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_15230 39473 40846 gene locus_tag LOCUS_15240 gene pilR 39473 40846 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_15240 41186 41704 gene locus_tag LOCUS_15250 41186 41704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 41962 42516 gene locus_tag LOCUS_15260 41962 42516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 42692 43624 gene locus_tag LOCUS_15270 42692 43624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 43627 44589 gene locus_tag LOCUS_15280 43627 44589 CDS product NDP-sugar dehydratase or epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_15280 45544 44582 gene locus_tag LOCUS_15290 45544 44582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 45708 46697 gene locus_tag LOCUS_15300 45708 46697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144194.1 protein_id gnl|my_center|LOCUS_15300 46694 47479 gene locus_tag LOCUS_15310 46694 47479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 47480 48121 gene locus_tag LOCUS_15320 47480 48121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 48334 48164 gene locus_tag LOCUS_15330 48334 48164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 48275 48937 gene locus_tag LOCUS_15340 48275 48937 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729124.1 protein_id gnl|my_center|LOCUS_15340 48964 50574 gene locus_tag LOCUS_15350 48964 50574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 50575 55197 gene locus_tag LOCUS_15360 50575 55197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 55201 56202 gene locus_tag LOCUS_15370 gene hpnA 55201 56202 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_15370 56290 57633 gene locus_tag LOCUS_15380 56290 57633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 58945 57638 gene locus_tag LOCUS_15390 58945 57638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 60166 59075 gene locus_tag LOCUS_15400 gene dinP 60166 59075 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FZ2 protein_id gnl|my_center|LOCUS_15400 61849 60320 gene locus_tag LOCUS_15410 61849 60320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 64362 62554 gene locus_tag LOCUS_15420 64362 62554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 64586 67357 gene locus_tag LOCUS_15430 64586 67357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 67362 69560 gene locus_tag LOCUS_15440 67362 69560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 <71340 69571 gene locus_tag LOCUS_15450 <71340 69571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404295.1:thioredoxin domain-containing protein >Feature sequence017 2949 5006 gene locus_tag LOCUS_15460 2949 5006 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265665.1 protein_id gnl|my_center|LOCUS_15460 7003 5009 gene locus_tag LOCUS_15470 7003 5009 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404041.1 protein_id gnl|my_center|LOCUS_15470 8115 7093 gene locus_tag LOCUS_15480 8115 7093 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYS1 protein_id gnl|my_center|LOCUS_15480 9557 8139 gene locus_tag LOCUS_15490 gene rpsA 9557 8139 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVL9 protein_id gnl|my_center|LOCUS_15490 9845 11893 gene locus_tag LOCUS_15500 9845 11893 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_15500 11934 13043 gene locus_tag LOCUS_15510 11934 13043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256855.1 protein_id gnl|my_center|LOCUS_15510 13040 14572 gene locus_tag LOCUS_15520 13040 14572 CDS product stage V sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_15520 14774 15550 gene locus_tag LOCUS_15530 14774 15550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 15550 17037 gene locus_tag LOCUS_15540 15550 17037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 17034 17990 gene locus_tag LOCUS_15550 17034 17990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 17983 18801 gene locus_tag LOCUS_15560 gene fdhD 17983 18801 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMW5 protein_id gnl|my_center|LOCUS_15560 19642 18821 gene locus_tag LOCUS_15570 gene rsmA 19642 18821 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7I6 protein_id gnl|my_center|LOCUS_15570 20691 19639 gene locus_tag LOCUS_15580 gene tsaD 20691 19639 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C11 protein_id gnl|my_center|LOCUS_15580 23196 20725 gene locus_tag LOCUS_15590 23196 20725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 25369 23330 gene locus_tag LOCUS_15600 gene rep 25369 23330 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7FK74 protein_id gnl|my_center|LOCUS_15600 25528 26175 gene locus_tag LOCUS_15610 gene fadR 25528 26175 CDS product fatty acid metabolism regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94548 protein_id gnl|my_center|LOCUS_15610 26192 26950 gene locus_tag LOCUS_15620 gene etfB 26192 26950 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118903.1 protein_id gnl|my_center|LOCUS_15620 26971 27942 gene locus_tag LOCUS_15630 gene etfA 26971 27942 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815622.1 protein_id gnl|my_center|LOCUS_15630 27997 28278 gene locus_tag LOCUS_15640 27997 28278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 28516 34233 gene locus_tag LOCUS_15650 28516 34233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 34752 35207 gene locus_tag LOCUS_15660 34752 35207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 35165 36391 gene locus_tag LOCUS_15670 35165 36391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 36391 36828 gene locus_tag LOCUS_15680 36391 36828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 36850 38388 gene locus_tag LOCUS_15690 gene cafA 36850 38388 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_15690 38827 38363 gene locus_tag LOCUS_15700 38827 38363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 39444 38836 gene locus_tag LOCUS_15710 39444 38836 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_15710 42098 39582 gene locus_tag LOCUS_15720 gene mrcA 42098 39582 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_15720 42553 45885 gene locus_tag LOCUS_15730 42553 45885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 45930 47207 gene locus_tag LOCUS_15740 gene serS 45930 47207 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPZ8 protein_id gnl|my_center|LOCUS_15740 47412 47501 gene locus_tag LOCUS_t00090 47412 47501 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 47581 47671 gene locus_tag LOCUS_t00100 47581 47671 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 47678 47752 gene locus_tag LOCUS_t00110 47678 47752 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 47805 48323 gene locus_tag LOCUS_15750 gene tadA 47805 48323 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H28 protein_id gnl|my_center|LOCUS_15750 48292 48380 gene locus_tag LOCUS_t00120 48292 48380 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 48416 48504 gene locus_tag LOCUS_t00130 48416 48504 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 48667 50967 gene locus_tag LOCUS_15760 48667 50967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 50986 51309 gene locus_tag LOCUS_15770 50986 51309 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9U8 protein_id gnl|my_center|LOCUS_15770 51312 51905 gene locus_tag LOCUS_15780 gene recR 51312 51905 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y3X7 protein_id gnl|my_center|LOCUS_15780 51985 52458 gene locus_tag LOCUS_15790 gene mglB 51985 52458 CDS product dynein regulation protein LC7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_15790 52471 53058 gene locus_tag LOCUS_15800 gene mglA 52471 53058 CDS product cell polarity determinant GTPase MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_15800 53062 53919 gene locus_tag LOCUS_15810 53062 53919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 53981 54442 gene locus_tag LOCUS_15820 53981 54442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 54573 55457 gene locus_tag LOCUS_15830 54573 55457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 55585 57465 gene locus_tag LOCUS_15840 55585 57465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 57458 58963 gene locus_tag LOCUS_15850 57458 58963 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940959.1 protein_id gnl|my_center|LOCUS_15850 58964 59596 gene locus_tag LOCUS_15860 58964 59596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 59910 59593 gene locus_tag LOCUS_15870 59910 59593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 60341 60087 gene locus_tag LOCUS_15880 60341 60087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 60491 63379 gene locus_tag LOCUS_15890 60491 63379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 63493 63419 gene locus_tag LOCUS_t00140 63493 63419 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 63668 63595 gene locus_tag LOCUS_t00150 63668 63595 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 66177 63760 gene locus_tag LOCUS_15900 gene lon-2 66177 63760 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C84 protein_id gnl|my_center|LOCUS_15900 67575 66322 gene locus_tag LOCUS_15910 gene clpX 67575 66322 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C83 protein_id gnl|my_center|LOCUS_15910 68218 67592 gene locus_tag LOCUS_15920 gene clpP 68218 67592 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA83 protein_id gnl|my_center|LOCUS_15920 69584 68268 gene locus_tag LOCUS_15930 gene tig 69584 68268 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C81 protein_id gnl|my_center|LOCUS_15930 69807 69725 gene locus_tag LOCUS_t00160 69807 69725 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 70062 69989 gene locus_tag LOCUS_t00170 70062 69989 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 70142 70068 gene locus_tag LOCUS_t00180 70142 70068 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 70244 70169 gene locus_tag LOCUS_t00190 70244 70169 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence018 49 180 gene locus_tag LOCUS_15940 49 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 193 393 gene locus_tag LOCUS_15950 193 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 390 1961 gene locus_tag LOCUS_15960 390 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2327 2145 gene locus_tag LOCUS_15970 2327 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2569 2982 gene locus_tag LOCUS_15980 2569 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 3181 3774 gene locus_tag LOCUS_15990 3181 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 3877 4053 gene locus_tag LOCUS_16000 3877 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 4125 4697 gene locus_tag LOCUS_16010 4125 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 4927 5856 gene locus_tag LOCUS_16020 4927 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 5853 7142 gene locus_tag LOCUS_16030 5853 7142 CDS product FAD-linked oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_16030 7202 8335 gene locus_tag LOCUS_16040 7202 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 8347 8619 gene locus_tag LOCUS_16050 8347 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 8772 8996 gene locus_tag LOCUS_16060 8772 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 10964 9060 gene locus_tag LOCUS_16070 10964 9060 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089867.1 protein_id gnl|my_center|LOCUS_16070 12958 11159 gene locus_tag LOCUS_16080 12958 11159 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_16080 14257 13253 gene locus_tag LOCUS_16090 14257 13253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 14325 14570 gene locus_tag LOCUS_16100 14325 14570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 15418 15221 gene locus_tag LOCUS_16110 15418 15221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 17330 15699 gene locus_tag LOCUS_16120 17330 15699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 18220 17405 gene locus_tag LOCUS_16130 18220 17405 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029144.1 protein_id gnl|my_center|LOCUS_16130 19471 18275 gene locus_tag LOCUS_16140 gene galK 19471 18275 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M60 protein_id gnl|my_center|LOCUS_16140 20508 19468 gene locus_tag LOCUS_16150 20508 19468 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CKY1 protein_id gnl|my_center|LOCUS_16150 21522 20512 gene locus_tag LOCUS_16160 gene galE 21522 20512 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55180 protein_id gnl|my_center|LOCUS_16160 22921 21566 gene locus_tag LOCUS_16170 22921 21566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 25755 22918 gene locus_tag LOCUS_16180 25755 22918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 27791 25815 gene locus_tag LOCUS_16190 27791 25815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 28047 29423 gene locus_tag LOCUS_16200 gene glgC 28047 29423 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SMC1 protein_id gnl|my_center|LOCUS_16200 29439 30887 gene locus_tag LOCUS_16210 gene glgA 29439 30887 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KR43 protein_id gnl|my_center|LOCUS_16210 30968 32098 gene locus_tag LOCUS_16220 30968 32098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 32331 32720 gene locus_tag LOCUS_16230 32331 32720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 33835 32753 gene locus_tag LOCUS_16240 33835 32753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 34368 35465 gene locus_tag LOCUS_16250 34368 35465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 36149 35490 gene locus_tag LOCUS_16260 36149 35490 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289497.1 protein_id gnl|my_center|LOCUS_16260 36309 36782 gene locus_tag LOCUS_16270 36309 36782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 37331 36828 gene locus_tag LOCUS_16280 37331 36828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 41160 37345 gene locus_tag LOCUS_16290 41160 37345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 41336 41692 gene locus_tag LOCUS_16300 41336 41692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 41802 42509 gene locus_tag LOCUS_16310 41802 42509 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_16310 42515 43951 gene locus_tag LOCUS_16320 42515 43951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141303.1 protein_id gnl|my_center|LOCUS_16320 43953 45368 gene locus_tag LOCUS_16330 43953 45368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143099.1 protein_id gnl|my_center|LOCUS_16330 46075 45374 gene locus_tag LOCUS_16340 46075 45374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 46278 47624 gene locus_tag LOCUS_16350 46278 47624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 47693 48211 gene locus_tag LOCUS_16360 47693 48211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 49067 48243 gene locus_tag LOCUS_16370 49067 48243 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RE68 protein_id gnl|my_center|LOCUS_16370 50511 49198 gene locus_tag LOCUS_16380 50511 49198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 50643 52517 gene locus_tag LOCUS_16390 50643 52517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 52740 54074 gene locus_tag LOCUS_16400 52740 54074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 54166 55542 gene locus_tag LOCUS_16410 54166 55542 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_16410 55947 55636 gene locus_tag LOCUS_16420 55947 55636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 56143 56325 gene locus_tag LOCUS_16430 56143 56325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 56497 57012 gene locus_tag LOCUS_16440 56497 57012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 57072 57755 gene locus_tag LOCUS_16450 57072 57755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 57866 59908 gene locus_tag LOCUS_16460 57866 59908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 60035 60979 gene locus_tag LOCUS_16470 60035 60979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 62379 61036 gene locus_tag LOCUS_16480 gene adcK4 62379 61036 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_16480 62551 64176 gene locus_tag LOCUS_16490 62551 64176 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 protein_id gnl|my_center|LOCUS_16490 64630 64211 gene locus_tag LOCUS_16500 64630 64211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 66311 64620 gene locus_tag LOCUS_16510 66311 64620 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407380.1 protein_id gnl|my_center|LOCUS_16510 68019 66322 gene locus_tag LOCUS_16520 gene cstA 68019 66322 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67304 protein_id gnl|my_center|LOCUS_16520 >Feature sequence019 1792 485 gene locus_tag LOCUS_16530 1792 485 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9M6 protein_id gnl|my_center|LOCUS_16530 2737 1808 gene locus_tag LOCUS_16540 gene lipA 2737 1808 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHM6 protein_id gnl|my_center|LOCUS_16540 3408 2734 gene locus_tag LOCUS_16550 gene lipB 3408 2734 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKF8 protein_id gnl|my_center|LOCUS_16550 4728 3412 gene locus_tag LOCUS_16560 4728 3412 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCB7 protein_id gnl|my_center|LOCUS_16560 5742 4759 gene locus_tag LOCUS_16570 5742 4759 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_16570 7161 5758 gene locus_tag LOCUS_16580 7161 5758 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEM2 protein_id gnl|my_center|LOCUS_16580 7420 8220 gene locus_tag LOCUS_16590 gene dnaQ_1 7420 8220 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_224610.1 protein_id gnl|my_center|LOCUS_16590 8226 8690 gene locus_tag LOCUS_16600 8226 8690 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED72 protein_id gnl|my_center|LOCUS_16600 10208 8706 gene locus_tag LOCUS_16610 10208 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 10858 10283 gene locus_tag LOCUS_16620 gene def 10858 10283 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93LE9 protein_id gnl|my_center|LOCUS_16620 11508 10873 gene locus_tag LOCUS_16630 gene mtnB 11508 10873 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819E6 protein_id gnl|my_center|LOCUS_16630 12067 11579 gene locus_tag LOCUS_16640 12067 11579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 12828 12070 gene locus_tag LOCUS_16650 12828 12070 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256673.1 protein_id gnl|my_center|LOCUS_16650 14719 12986 gene locus_tag LOCUS_16660 14719 12986 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_16660 17015 14730 gene locus_tag LOCUS_16670 17015 14730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 17113 18147 gene locus_tag LOCUS_16680 17113 18147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 20416 18152 gene locus_tag LOCUS_16690 20416 18152 CDS product salicylyl-CoA 5-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230093.1 protein_id gnl|my_center|LOCUS_16690 21467 20463 gene locus_tag LOCUS_16700 21467 20463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 21845 22444 gene locus_tag LOCUS_16710 21845 22444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 25112 22458 gene locus_tag LOCUS_16720 25112 22458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 25624 25238 gene locus_tag LOCUS_16730 25624 25238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 26052 25621 gene locus_tag LOCUS_16740 26052 25621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 27918 26089 gene locus_tag LOCUS_16750 27918 26089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 29747 27918 gene locus_tag LOCUS_16760 29747 27918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 31020 29872 gene locus_tag LOCUS_16770 31020 29872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 32220 31084 gene locus_tag LOCUS_16780 32220 31084 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_16780 33127 32213 gene locus_tag LOCUS_16790 gene ftsX 33127 32213 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CA0 protein_id gnl|my_center|LOCUS_16790 33651 33124 gene locus_tag LOCUS_16800 gene ftsE 33651 33124 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_16800 33592 33801 gene locus_tag LOCUS_16810 33592 33801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 34066 33854 gene locus_tag LOCUS_16820 34066 33854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 34915 34073 gene locus_tag LOCUS_16830 gene murI 34915 34073 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748S8 protein_id gnl|my_center|LOCUS_16830 37123 35057 gene locus_tag LOCUS_16840 37123 35057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 37346 40903 gene locus_tag LOCUS_16850 gene mfd 37346 40903 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H75 protein_id gnl|my_center|LOCUS_16850 40900 41940 gene locus_tag LOCUS_16860 40900 41940 CDS product putative parvulin-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40415 protein_id gnl|my_center|LOCUS_16860 41940 42899 gene locus_tag LOCUS_16870 41940 42899 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE7 protein_id gnl|my_center|LOCUS_16870 42983 44359 gene locus_tag LOCUS_16880 42983 44359 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_16880 44690 45742 gene locus_tag LOCUS_16890 gene pilM 44690 45742 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_16890 45739 46413 gene locus_tag LOCUS_16900 gene pilN 45739 46413 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_16900 46447 47064 gene locus_tag LOCUS_16910 46447 47064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 47061 47669 gene locus_tag LOCUS_16920 47061 47669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 47726 52198 gene locus_tag LOCUS_16930 47726 52198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 52240 52734 gene locus_tag LOCUS_16940 gene aroK 52240 52734 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BL5 protein_id gnl|my_center|LOCUS_16940 52731 53834 gene locus_tag LOCUS_16950 gene aroB 52731 53834 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2D3 protein_id gnl|my_center|LOCUS_16950 53831 54676 gene locus_tag LOCUS_16960 53831 54676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 54652 55104 gene locus_tag LOCUS_16970 54652 55104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 55115 55549 gene locus_tag LOCUS_16980 gene aroQ 55115 55549 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ7 protein_id gnl|my_center|LOCUS_16980 55558 56118 gene locus_tag LOCUS_16990 gene efp 55558 56118 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI92 protein_id gnl|my_center|LOCUS_16990 56236 58281 gene locus_tag LOCUS_17000 56236 58281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 58339 58411 gene locus_tag LOCUS_t00200 58339 58411 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 58922 58638 gene locus_tag LOCUS_17010 58922 58638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 59208 59897 gene locus_tag LOCUS_17020 gene queC 59208 59897 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSY8 protein_id gnl|my_center|LOCUS_17020 59899 60543 gene locus_tag LOCUS_17030 gene queE 59899 60543 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9F0 protein_id gnl|my_center|LOCUS_17030 60540 61682 gene locus_tag LOCUS_17040 60540 61682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 61867 62793 gene locus_tag LOCUS_17050 61867 62793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 63005 64276 gene locus_tag LOCUS_17060 63005 64276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 66036 64561 gene locus_tag LOCUS_17070 66036 64561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 66251 67159 gene locus_tag LOCUS_17080 66251 67159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 67983 68240 gene locus_tag LOCUS_17090 67983 68240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence020 905 2131 gene locus_tag LOCUS_17100 905 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 2143 4338 gene locus_tag LOCUS_17110 2143 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 4338 6839 gene locus_tag LOCUS_17120 4338 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 6955 8385 gene locus_tag LOCUS_17130 6955 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 8466 10157 gene locus_tag LOCUS_17140 gene cysJ 8466 10157 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32214 protein_id gnl|my_center|LOCUS_17140 11657 10170 gene locus_tag LOCUS_17150 11657 10170 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808822.1 protein_id gnl|my_center|LOCUS_17150 13057 11735 gene locus_tag LOCUS_17160 13057 11735 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_17160 14559 13054 gene locus_tag LOCUS_17170 14559 13054 CDS product peptidase U62 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_17170 15015 14572 gene locus_tag LOCUS_17180 15015 14572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221985.1 protein_id gnl|my_center|LOCUS_17180 15282 15776 gene locus_tag LOCUS_17190 15282 15776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 19232 15789 gene locus_tag LOCUS_17200 19232 15789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 19424 20263 gene locus_tag LOCUS_17210 19424 20263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 20269 21663 gene locus_tag LOCUS_17220 20269 21663 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121061.1 protein_id gnl|my_center|LOCUS_17220 21685 23172 gene locus_tag LOCUS_17230 gene ppx 21685 23172 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZN70 protein_id gnl|my_center|LOCUS_17230 23606 23169 gene locus_tag LOCUS_17240 gene fabZ 23606 23169 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIM2 protein_id gnl|my_center|LOCUS_17240 23929 24357 gene locus_tag LOCUS_17250 gene dksA 23929 24357 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG2 protein_id gnl|my_center|LOCUS_17250 24369 27041 gene locus_tag LOCUS_17260 24369 27041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 27198 28208 gene locus_tag LOCUS_17270 27198 28208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 29408 28221 gene locus_tag LOCUS_17280 29408 28221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 29554 31668 gene locus_tag LOCUS_17290 gene ppk 29554 31668 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S646 protein_id gnl|my_center|LOCUS_17290 31715 33247 gene locus_tag LOCUS_17300 31715 33247 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_17300 33882 33244 gene locus_tag LOCUS_17310 33882 33244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769634.1 protein_id gnl|my_center|LOCUS_17310 34062 34964 gene locus_tag LOCUS_17320 gene add 34062 34964 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q839J4 protein_id gnl|my_center|LOCUS_17320 34980 35315 gene locus_tag LOCUS_17330 34980 35315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 35338 36747 gene locus_tag LOCUS_17340 35338 36747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 36805 38661 gene locus_tag LOCUS_17350 36805 38661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 38900 40945 gene locus_tag LOCUS_17360 38900 40945 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766152.1 protein_id gnl|my_center|LOCUS_17360 41545 42981 gene locus_tag LOCUS_17370 41545 42981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 42988 44421 gene locus_tag LOCUS_17380 42988 44421 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203595.1 protein_id gnl|my_center|LOCUS_17380 45449 44457 gene locus_tag LOCUS_17390 45449 44457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 45617 47818 gene locus_tag LOCUS_17400 45617 47818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 49861 47825 gene locus_tag LOCUS_17410 49861 47825 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921515.1 protein_id gnl|my_center|LOCUS_17410 50585 50157 gene locus_tag LOCUS_17420 50585 50157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 50811 51035 gene locus_tag LOCUS_17430 50811 51035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 51932 52594 gene locus_tag LOCUS_17440 51932 52594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 53806 52652 gene locus_tag LOCUS_17450 gene leuB 53806 52652 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089061.1 protein_id gnl|my_center|LOCUS_17450 55663 54269 gene locus_tag LOCUS_17460 55663 54269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 56223 56396 gene locus_tag LOCUS_17470 56223 56396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 56409 56939 gene locus_tag LOCUS_17480 56409 56939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 56939 57373 gene locus_tag LOCUS_17490 56939 57373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 57373 57852 gene locus_tag LOCUS_17500 57373 57852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 57849 58781 gene locus_tag LOCUS_17510 57849 58781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 58787 60226 gene locus_tag LOCUS_17520 58787 60226 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337067.1 protein_id gnl|my_center|LOCUS_17520 60247 61308 gene locus_tag LOCUS_17530 60247 61308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 61308 62612 gene locus_tag LOCUS_17540 61308 62612 CDS product type II/IV secretion system-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537977.1 protein_id gnl|my_center|LOCUS_17540 62612 63538 gene locus_tag LOCUS_17550 gene tadB 62612 63538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118231.1 protein_id gnl|my_center|LOCUS_17550 63538 64458 gene locus_tag LOCUS_17560 63538 64458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 64451 65233 gene locus_tag LOCUS_17570 64451 65233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 65230 65538 gene locus_tag LOCUS_17580 65230 65538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 65538 66917 gene locus_tag LOCUS_17590 65538 66917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence021 661 3831 gene locus_tag LOCUS_17600 661 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 4866 4309 gene locus_tag LOCUS_17610 4866 4309 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_17610 9287 4866 gene locus_tag LOCUS_17620 9287 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 9378 11168 gene locus_tag LOCUS_17630 9378 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 11269 14115 gene locus_tag LOCUS_17640 11269 14115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 14431 14144 gene locus_tag LOCUS_17650 14431 14144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 15437 14622 gene locus_tag LOCUS_17660 15437 14622 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RE15 protein_id gnl|my_center|LOCUS_17660 15605 16798 gene locus_tag LOCUS_17670 gene kbl 15605 16798 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F40 protein_id gnl|my_center|LOCUS_17670 16795 17820 gene locus_tag LOCUS_17680 gene tdh 16795 17820 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQV6 protein_id gnl|my_center|LOCUS_17680 20236 17852 gene locus_tag LOCUS_17690 gene pheT 20236 17852 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6L0 protein_id gnl|my_center|LOCUS_17690 21270 20242 gene locus_tag LOCUS_17700 gene pheS 21270 20242 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYR3 protein_id gnl|my_center|LOCUS_17700 23666 21498 gene locus_tag LOCUS_17710 23666 21498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 23604 24215 gene locus_tag LOCUS_17720 23604 24215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 24706 25773 gene locus_tag LOCUS_17730 24706 25773 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_17730 25782 27362 gene locus_tag LOCUS_17740 25782 27362 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729220.1 protein_id gnl|my_center|LOCUS_17740 27349 28386 gene locus_tag LOCUS_17750 27349 28386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057332.1 protein_id gnl|my_center|LOCUS_17750 29142 28492 gene locus_tag LOCUS_17760 gene sigD 29142 28492 CDS product RNA polymerase sigma-D factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P10726 protein_id gnl|my_center|LOCUS_17760 30003 29455 gene locus_tag LOCUS_17770 30003 29455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 31640 32053 gene locus_tag LOCUS_17780 31640 32053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 33008 32256 gene locus_tag LOCUS_17790 33008 32256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 34836 33031 gene locus_tag LOCUS_17800 gene pknA 34836 33031 CDS product serine/threonine-protein kinases PknA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NU97 protein_id gnl|my_center|LOCUS_17800 36129 34966 gene locus_tag LOCUS_17810 gene tgt 36129 34966 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183P1 protein_id gnl|my_center|LOCUS_17810 37133 36120 gene locus_tag LOCUS_17820 gene queA 37133 36120 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X2 protein_id gnl|my_center|LOCUS_17820 37698 37231 gene locus_tag LOCUS_17830 37698 37231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 40682 37743 gene locus_tag LOCUS_17840 gene valS 40682 37743 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBS5 protein_id gnl|my_center|LOCUS_17840 41060 40905 gene locus_tag LOCUS_17850 41060 40905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 41315 42706 gene locus_tag LOCUS_17860 gene fumC 41315 42706 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4J3 protein_id gnl|my_center|LOCUS_17860 43107 43928 gene locus_tag LOCUS_17870 43107 43928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 43879 44058 gene locus_tag LOCUS_17880 43879 44058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 44273 46615 gene locus_tag LOCUS_17890 44273 46615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 48009 46696 gene locus_tag LOCUS_17900 48009 46696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 48257 47913 gene locus_tag LOCUS_17910 48257 47913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 50592 48865 gene locus_tag LOCUS_17920 50592 48865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 50803 51819 gene locus_tag LOCUS_17930 gene trpS-2 50803 51819 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN23 protein_id gnl|my_center|LOCUS_17930 52259 53710 gene locus_tag LOCUS_17940 52259 53710 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277664.1 protein_id gnl|my_center|LOCUS_17940 55104 53731 gene locus_tag LOCUS_17950 55104 53731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 55808 55284 gene locus_tag LOCUS_17960 55808 55284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225144.1 protein_id gnl|my_center|LOCUS_17960 56075 55923 gene locus_tag LOCUS_17970 56075 55923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 56175 57140 gene locus_tag LOCUS_17980 56175 57140 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643797.1 protein_id gnl|my_center|LOCUS_17980 57755 57153 gene locus_tag LOCUS_17990 57755 57153 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_17990 57973 59631 gene locus_tag LOCUS_18000 57973 59631 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482837.1 protein_id gnl|my_center|LOCUS_18000 59850 61628 gene locus_tag LOCUS_18010 59850 61628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 61751 62683 gene locus_tag LOCUS_18020 61751 62683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_18020 62830 63768 gene locus_tag LOCUS_18030 62830 63768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 63884 65278 gene locus_tag LOCUS_18040 63884 65278 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence022 667 275 gene locus_tag LOCUS_18050 667 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 962 1189 gene locus_tag LOCUS_18060 962 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1988 1332 gene locus_tag LOCUS_18070 1988 1332 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_18070 2694 1990 gene locus_tag LOCUS_18080 gene scoA 2694 1990 CDS product putative succinyl-CoA:3-ketoacid coenzyme A transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42315 protein_id gnl|my_center|LOCUS_18080 2836 3444 gene locus_tag LOCUS_18090 2836 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 3444 3860 gene locus_tag LOCUS_18100 3444 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 3853 4680 gene locus_tag LOCUS_18110 3853 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 4677 5939 gene locus_tag LOCUS_18120 4677 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 5932 6552 gene locus_tag LOCUS_18130 5932 6552 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_18130 8221 6581 gene locus_tag LOCUS_18140 gene pckA 8221 6581 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBF9 protein_id gnl|my_center|LOCUS_18140 8408 9169 gene locus_tag LOCUS_18150 gene trmH 8408 9169 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S465 protein_id gnl|my_center|LOCUS_18150 9929 9153 gene locus_tag LOCUS_18160 gene ttcA 9929 9153 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CP2 protein_id gnl|my_center|LOCUS_18160 10458 9949 gene locus_tag LOCUS_18170 10458 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 11276 10455 gene locus_tag LOCUS_18180 11276 10455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 11488 12951 gene locus_tag LOCUS_18190 gene prfC 11488 12951 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX60 protein_id gnl|my_center|LOCUS_18190 12954 13229 gene locus_tag LOCUS_18200 12954 13229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 14805 13252 gene locus_tag LOCUS_18210 gene mviN-1 14805 13252 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938470.1 protein_id gnl|my_center|LOCUS_18210 15476 14802 gene locus_tag LOCUS_18220 15476 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 15726 17420 gene locus_tag LOCUS_18230 15726 17420 CDS product ubiquinone biosynthesis protein UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_18230 18398 17439 gene locus_tag LOCUS_18240 18398 17439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 20353 18515 gene locus_tag LOCUS_18250 gene metF-2 20353 18515 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_18250 21727 20402 gene locus_tag LOCUS_18260 21727 20402 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103336.1 protein_id gnl|my_center|LOCUS_18260 22740 21724 gene locus_tag LOCUS_18270 22740 21724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 25314 23995 gene locus_tag LOCUS_18280 25314 23995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 25592 26281 gene locus_tag LOCUS_18290 25592 26281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 26278 26829 gene locus_tag LOCUS_18300 26278 26829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 26826 28052 gene locus_tag LOCUS_18310 26826 28052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 28049 28729 gene locus_tag LOCUS_18320 28049 28729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 28726 31182 gene locus_tag LOCUS_18330 28726 31182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 31281 32513 gene locus_tag LOCUS_18340 31281 32513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 33540 32521 gene locus_tag LOCUS_18350 33540 32521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 34457 33594 gene locus_tag LOCUS_18360 34457 33594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 37155 34600 gene locus_tag LOCUS_18370 37155 34600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 37279 38421 gene locus_tag LOCUS_18380 37279 38421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 38412 40676 gene locus_tag LOCUS_18390 38412 40676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 42342 40693 gene locus_tag LOCUS_18400 42342 40693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 42479 43153 gene locus_tag LOCUS_18410 42479 43153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 44199 43264 gene locus_tag LOCUS_18420 44199 43264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 44804 44196 gene locus_tag LOCUS_18430 gene plsY 44804 44196 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI04 protein_id gnl|my_center|LOCUS_18430 46027 44801 gene locus_tag LOCUS_18440 46027 44801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 46283 47152 gene locus_tag LOCUS_18450 gene nadC 46283 47152 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_18450 47145 48476 gene locus_tag LOCUS_18460 47145 48476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 49329 48505 gene locus_tag LOCUS_18470 49329 48505 CDS product adenine nucleotide alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_18470 49735 49322 gene locus_tag LOCUS_18480 49735 49322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 50212 49745 gene locus_tag LOCUS_18490 gene iscR-1 50212 49745 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941202.1 protein_id gnl|my_center|LOCUS_18490 51937 50243 gene locus_tag LOCUS_18500 51937 50243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 52661 52089 gene locus_tag LOCUS_18510 52661 52089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 53088 52708 gene locus_tag LOCUS_18520 53088 52708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 53621 53442 gene locus_tag LOCUS_18530 53621 53442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 54271 54516 gene locus_tag LOCUS_18540 54271 54516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 54608 54781 gene locus_tag LOCUS_18550 54608 54781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 54907 55710 gene locus_tag LOCUS_18560 54907 55710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 57273 55699 gene locus_tag LOCUS_18570 57273 55699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 57359 57682 gene locus_tag LOCUS_18580 57359 57682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 57968 58462 gene locus_tag LOCUS_18590 57968 58462 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_18590 58675 59022 gene locus_tag LOCUS_18600 58675 59022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 59019 60098 gene locus_tag LOCUS_18610 59019 60098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 60505 60930 gene locus_tag LOCUS_18620 60505 60930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 60927 61754 gene locus_tag LOCUS_18630 60927 61754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 62557 61751 gene locus_tag LOCUS_18640 gene truA1 62557 61751 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CJ2 protein_id gnl|my_center|LOCUS_18640 63272 62562 gene locus_tag LOCUS_18650 63272 62562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 64330 63269 gene locus_tag LOCUS_18660 64330 63269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 65540 64527 gene locus_tag LOCUS_18670 gene asd 65540 64527 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHE3 protein_id gnl|my_center|LOCUS_18670 >Feature sequence023 959 642 gene locus_tag LOCUS_18680 959 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 2891 1041 gene locus_tag LOCUS_18690 2891 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 2973 3596 gene locus_tag LOCUS_18700 2973 3596 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084056.1 protein_id gnl|my_center|LOCUS_18700 4120 3593 gene locus_tag LOCUS_18710 4120 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 4425 5582 gene locus_tag LOCUS_18720 4425 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 5582 6499 gene locus_tag LOCUS_18730 5582 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 6512 7162 gene locus_tag LOCUS_18740 6512 7162 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_18740 7177 7578 gene locus_tag LOCUS_18750 7177 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 7586 8236 gene locus_tag LOCUS_18760 7586 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 8667 9407 gene locus_tag LOCUS_18770 8667 9407 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MB9 protein_id gnl|my_center|LOCUS_18770 9474 11093 gene locus_tag LOCUS_18780 9474 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 11210 12673 gene locus_tag LOCUS_18790 11210 12673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 14983 12698 gene locus_tag LOCUS_18800 14983 12698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 15452 16018 gene locus_tag LOCUS_18810 15452 16018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 16015 17520 gene locus_tag LOCUS_18820 16015 17520 CDS product putative GMC-type oxidoreductase y4nJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55582 protein_id gnl|my_center|LOCUS_18820 17718 18500 gene locus_tag LOCUS_18830 gene flgF 17718 18500 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F0 protein_id gnl|my_center|LOCUS_18830 18516 19301 gene locus_tag LOCUS_18840 gene flgG 18516 19301 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F1 protein_id gnl|my_center|LOCUS_18840 19304 20245 gene locus_tag LOCUS_18850 19304 20245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 20247 20951 gene locus_tag LOCUS_18860 gene flgH 20247 20951 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F4 protein_id gnl|my_center|LOCUS_18860 20963 22060 gene locus_tag LOCUS_18870 gene flgI 20963 22060 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EQ3 protein_id gnl|my_center|LOCUS_18870 22060 22860 gene locus_tag LOCUS_18880 22060 22860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 23053 23355 gene locus_tag LOCUS_18890 23053 23355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 23453 23965 gene locus_tag LOCUS_18900 23453 23965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 23953 25380 gene locus_tag LOCUS_18910 gene flgK 23953 25380 CDS product flagellar hook-associated protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F9 protein_id gnl|my_center|LOCUS_18910 25394 26281 gene locus_tag LOCUS_18920 gene flgL 25394 26281 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943668.1 protein_id gnl|my_center|LOCUS_18920 26399 26662 gene locus_tag LOCUS_18930 gene csrA 26399 26662 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY93 protein_id gnl|my_center|LOCUS_18930 26652 27140 gene locus_tag LOCUS_18940 gene fliW 26652 27140 CDS product flagellar assembly factor FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9F0 protein_id gnl|my_center|LOCUS_18940 27143 30172 gene locus_tag LOCUS_18950 27143 30172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 30169 30987 gene locus_tag LOCUS_18960 30169 30987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 31211 31687 gene locus_tag LOCUS_18970 31211 31687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 31684 32046 gene locus_tag LOCUS_18980 31684 32046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 34329 32074 gene locus_tag LOCUS_18990 34329 32074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 36435 34993 gene locus_tag LOCUS_19000 gene fliC 36435 34993 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV0 protein_id gnl|my_center|LOCUS_19000 37582 37118 gene locus_tag LOCUS_19010 37582 37118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 39092 37650 gene locus_tag LOCUS_19020 gene fliC 39092 37650 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV0 protein_id gnl|my_center|LOCUS_19020 41107 39773 gene locus_tag LOCUS_19030 gene fliC 41107 39773 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV0 protein_id gnl|my_center|LOCUS_19030 43789 42368 gene locus_tag LOCUS_19040 gene fliC 43789 42368 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV0 protein_id gnl|my_center|LOCUS_19040 46018 46206 gene locus_tag LOCUS_19050 46018 46206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 48310 46880 gene locus_tag LOCUS_19060 gene fliC 48310 46880 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV0 protein_id gnl|my_center|LOCUS_19060 49218 50228 gene locus_tag LOCUS_19070 49218 50228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 50776 52221 gene locus_tag LOCUS_19080 50776 52221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 52499 52320 gene locus_tag LOCUS_19090 52499 52320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 53955 52621 gene locus_tag LOCUS_19100 53955 52621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 54685 54005 gene locus_tag LOCUS_19110 54685 54005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 54745 56124 gene locus_tag LOCUS_19120 gene murC 54745 56124 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPG8 protein_id gnl|my_center|LOCUS_19120 56121 57443 gene locus_tag LOCUS_19130 gene murD 56121 57443 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S530 protein_id gnl|my_center|LOCUS_19130 57672 57457 gene locus_tag LOCUS_19140 57672 57457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 59042 57684 gene locus_tag LOCUS_19150 59042 57684 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_19150 59680 59147 gene locus_tag LOCUS_19160 59680 59147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 60693 59680 gene locus_tag LOCUS_19170 gene ruvB 60693 59680 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61532 protein_id gnl|my_center|LOCUS_19170 61315 60734 gene locus_tag LOCUS_19180 gene ruvA 61315 60734 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E87 protein_id gnl|my_center|LOCUS_19180 61893 61312 gene locus_tag LOCUS_19190 gene ruvC 61893 61312 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E88 protein_id gnl|my_center|LOCUS_19190 62310 62987 gene locus_tag LOCUS_19200 62310 62987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 62987 63457 gene locus_tag LOCUS_19210 gene exbD3 62987 63457 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence024 466 1308 gene locus_tag LOCUS_19220 466 1308 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_19220 1302 1880 gene locus_tag LOCUS_19230 gene folE 1302 1880 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HL44 protein_id gnl|my_center|LOCUS_19230 1891 2211 gene locus_tag LOCUS_19240 1891 2211 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_19240 2367 3557 gene locus_tag LOCUS_19250 2367 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057105.1 protein_id gnl|my_center|LOCUS_19250 3720 4331 gene locus_tag LOCUS_19260 3720 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 4451 5767 gene locus_tag LOCUS_19270 4451 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706417.1 protein_id gnl|my_center|LOCUS_19270 5799 6344 gene locus_tag LOCUS_19280 5799 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 6678 7574 gene locus_tag LOCUS_19290 gene prfB 6678 7574 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AS3 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19290 7715 9190 gene locus_tag LOCUS_19300 gene lysS 7715 9190 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT0 protein_id gnl|my_center|LOCUS_19300 9344 10780 gene locus_tag LOCUS_19310 gene lolE 9344 10780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_19310 10777 11475 gene locus_tag LOCUS_19320 gene lolD 10777 11475 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEV5 protein_id gnl|my_center|LOCUS_19320 11472 13781 gene locus_tag LOCUS_19330 gene yaeT 11472 13781 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT3 protein_id gnl|my_center|LOCUS_19330 13791 14327 gene locus_tag LOCUS_19340 13791 14327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 14346 15323 gene locus_tag LOCUS_19350 gene lpxD 14346 15323 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBR0 protein_id gnl|my_center|LOCUS_19350 15320 16108 gene locus_tag LOCUS_19360 gene lpxA 15320 16108 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T24 protein_id gnl|my_center|LOCUS_19360 16237 16560 gene locus_tag LOCUS_19370 16237 16560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 16751 18832 gene locus_tag LOCUS_19380 gene pnp 16751 18832 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV59 protein_id gnl|my_center|LOCUS_19380 19311 18820 gene locus_tag LOCUS_19390 19311 18820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 19490 19416 gene locus_tag LOCUS_t00210 19490 19416 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 19681 19481 gene locus_tag LOCUS_19400 19681 19481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 19697 20467 gene locus_tag LOCUS_19410 19697 20467 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898866.1 protein_id gnl|my_center|LOCUS_19410 21440 20493 gene locus_tag LOCUS_19420 21440 20493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 21642 21445 gene locus_tag LOCUS_19430 21642 21445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 21662 22159 gene locus_tag LOCUS_19440 21662 22159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 22229 22555 gene locus_tag LOCUS_19450 22229 22555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 22598 22981 gene locus_tag LOCUS_19460 22598 22981 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015949.1 protein_id gnl|my_center|LOCUS_19460 24094 22997 gene locus_tag LOCUS_19470 24094 22997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 24295 26706 gene locus_tag LOCUS_19480 24295 26706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 27209 26709 gene locus_tag LOCUS_19490 27209 26709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 30600 28354 gene locus_tag LOCUS_19500 30600 28354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 30864 31598 gene locus_tag LOCUS_19510 30864 31598 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172504.1 protein_id gnl|my_center|LOCUS_19510 32050 31607 gene locus_tag LOCUS_19520 32050 31607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 32157 32477 gene locus_tag LOCUS_19530 32157 32477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 33321 32569 gene locus_tag LOCUS_19540 gene fliA 33321 32569 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_19540 34132 33329 gene locus_tag LOCUS_19550 34132 33329 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726C3 protein_id gnl|my_center|LOCUS_19550 34716 34093 gene locus_tag LOCUS_19560 34716 34093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 36365 34719 gene locus_tag LOCUS_19570 36365 34719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 38766 36589 gene locus_tag LOCUS_19580 gene flhA 38766 36589 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_19580 39884 38763 gene locus_tag LOCUS_19590 39884 38763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19590 40721 39918 gene locus_tag LOCUS_19600 40721 39918 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKD3 protein_id gnl|my_center|LOCUS_19600 41003 40728 gene locus_tag LOCUS_19610 gene fliQ 41003 40728 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35535 protein_id gnl|my_center|LOCUS_19610 41788 41000 gene locus_tag LOCUS_19620 gene fliP 41788 41000 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V8D2 protein_id gnl|my_center|LOCUS_19620 43160 41793 gene locus_tag LOCUS_19630 43160 41793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 43524 43249 gene locus_tag LOCUS_19640 43524 43249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 44664 43594 gene locus_tag LOCUS_19650 gene fliM 44664 43594 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_19650 45264 44686 gene locus_tag LOCUS_19660 45264 44686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 47130 45829 gene locus_tag LOCUS_19670 gene flgE 47130 45829 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G30 protein_id gnl|my_center|LOCUS_19670 47645 47244 gene locus_tag LOCUS_19680 47645 47244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 48298 47645 gene locus_tag LOCUS_19690 gene flgD 48298 47645 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885A1 protein_id gnl|my_center|LOCUS_19690 49882 48317 gene locus_tag LOCUS_19700 49882 48317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 50612 49947 gene locus_tag LOCUS_19710 50612 49947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 51952 50609 gene locus_tag LOCUS_19720 gene fliI 51952 50609 CDS product flagellum-specific ATP synthase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941081.1 protein_id gnl|my_center|LOCUS_19720 52715 51945 gene locus_tag LOCUS_19730 52715 51945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 53737 52742 gene locus_tag LOCUS_19740 gene fliG 53737 52742 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8FA11 protein_id gnl|my_center|LOCUS_19740 55456 53765 gene locus_tag LOCUS_19750 gene fliF 55456 53765 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI49 protein_id gnl|my_center|LOCUS_19750 55809 55477 gene locus_tag LOCUS_19760 55809 55477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 56255 55812 gene locus_tag LOCUS_19770 gene flgC 56255 55812 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI47 protein_id gnl|my_center|LOCUS_19770 56656 56255 gene locus_tag LOCUS_19780 gene flgB 56656 56255 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G42 protein_id gnl|my_center|LOCUS_19780 59285 56904 gene locus_tag LOCUS_19790 59285 56904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 60379 59390 gene locus_tag LOCUS_19800 60379 59390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 60330 60491 gene locus_tag LOCUS_19810 60330 60491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 60478 61236 gene locus_tag LOCUS_19820 gene dapF 60478 61236 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL43 protein_id gnl|my_center|LOCUS_19820 61965 61288 gene locus_tag LOCUS_19830 gene rplC 61965 61288 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIF5 protein_id gnl|my_center|LOCUS_19830 >Feature sequence025 786 499 gene locus_tag LOCUS_19840 786 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1404 865 gene locus_tag LOCUS_19850 1404 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1630 1439 gene locus_tag LOCUS_19860 1630 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1871 1623 gene locus_tag LOCUS_19870 1871 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2520 1882 gene locus_tag LOCUS_19880 2520 1882 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479123.1 protein_id gnl|my_center|LOCUS_19880 4214 2520 gene locus_tag LOCUS_19890 4214 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118597.1 protein_id gnl|my_center|LOCUS_19890 4458 5207 gene locus_tag LOCUS_19900 4458 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 6770 5103 gene locus_tag LOCUS_19910 6770 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 6914 7690 gene locus_tag LOCUS_19920 6914 7690 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_19920 7792 9168 gene locus_tag LOCUS_19930 7792 9168 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_19930 10631 9213 gene locus_tag LOCUS_19940 10631 9213 CDS product benzoyl-CoA oxygenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_19940 12296 10632 gene locus_tag LOCUS_19950 12296 10632 CDS product benzoyl-CoA-dihydrodiol lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083900.1 protein_id gnl|my_center|LOCUS_19950 12441 13199 gene locus_tag LOCUS_19960 gene aroK 12441 13199 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VG9 protein_id gnl|my_center|LOCUS_19960 13221 14120 gene locus_tag LOCUS_19970 13221 14120 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF0 protein_id gnl|my_center|LOCUS_19970 14191 15792 gene locus_tag LOCUS_19980 14191 15792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 15789 16733 gene locus_tag LOCUS_19990 gene gpsA 15789 16733 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RR76 protein_id gnl|my_center|LOCUS_19990 16780 19095 gene locus_tag LOCUS_20000 16780 19095 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_20000 19281 20369 gene locus_tag LOCUS_20010 19281 20369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 20403 20984 gene locus_tag LOCUS_20020 20403 20984 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_20020 21089 23515 gene locus_tag LOCUS_20030 gene lon 21089 23515 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2J0 protein_id gnl|my_center|LOCUS_20030 25245 23533 gene locus_tag LOCUS_20040 25245 23533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 25515 27098 gene locus_tag LOCUS_20050 25515 27098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 27111 27884 gene locus_tag LOCUS_20060 27111 27884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 28120 29820 gene locus_tag LOCUS_20070 gene proS 28120 29820 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D59 protein_id gnl|my_center|LOCUS_20070 29817 30503 gene locus_tag LOCUS_20080 gene pyrF 29817 30503 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK39 protein_id gnl|my_center|LOCUS_20080 30503 31246 gene locus_tag LOCUS_20090 gene rlmB 30503 31246 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG60 protein_id gnl|my_center|LOCUS_20090 31400 31473 gene locus_tag LOCUS_t00220 31400 31473 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31539 31623 gene locus_tag LOCUS_t00230 31539 31623 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 31653 31726 gene locus_tag LOCUS_t00240 31653 31726 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 31770 31842 gene locus_tag LOCUS_t00250 31770 31842 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31918 33099 gene locus_tag LOCUS_20100 gene tuf-2 31918 33099 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_953913.1 protein_id gnl|my_center|LOCUS_20100 33393 33466 gene locus_tag LOCUS_t00260 33393 33466 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 33538 33921 gene locus_tag LOCUS_20110 33538 33921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 33974 34504 gene locus_tag LOCUS_20120 gene nusG 33974 34504 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y1 protein_id gnl|my_center|LOCUS_20120 34540 34965 gene locus_tag LOCUS_20130 gene rplK 34540 34965 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CE5 protein_id gnl|my_center|LOCUS_20130 35037 35747 gene locus_tag LOCUS_20140 gene rplA 35037 35747 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y3 protein_id gnl|my_center|LOCUS_20140 35934 36452 gene locus_tag LOCUS_20150 gene rplJ 35934 36452 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QH9 protein_id gnl|my_center|LOCUS_20150 36512 36898 gene locus_tag LOCUS_20160 gene rplL 36512 36898 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A466 protein_id gnl|my_center|LOCUS_20160 37064 41233 gene locus_tag LOCUS_20170 gene rpoB 37064 41233 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y6 protein_id gnl|my_center|LOCUS_20170 41256 45413 gene locus_tag LOCUS_20180 gene rpoC 41256 45413 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7EPD8 protein_id gnl|my_center|LOCUS_20180 45781 45593 gene locus_tag LOCUS_20190 45781 45593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 45876 46250 gene locus_tag LOCUS_20200 gene rpsL 45876 46250 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5Y0 protein_id gnl|my_center|LOCUS_20200 46263 46733 gene locus_tag LOCUS_20210 gene rpsG 46263 46733 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5E1 protein_id gnl|my_center|LOCUS_20210 46768 48855 gene locus_tag LOCUS_20220 gene fusA2 46768 48855 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_20220 48946 49257 gene locus_tag LOCUS_20230 gene rpsJ 48946 49257 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z0 protein_id gnl|my_center|LOCUS_20230 49271 49891 gene locus_tag LOCUS_20240 gene rplD 49271 49891 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61063 protein_id gnl|my_center|LOCUS_20240 49888 50217 gene locus_tag LOCUS_20250 gene rplW 49888 50217 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z1 protein_id gnl|my_center|LOCUS_20250 50224 51054 gene locus_tag LOCUS_20260 gene rplB 50224 51054 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60401 protein_id gnl|my_center|LOCUS_20260 51066 51344 gene locus_tag LOCUS_20270 gene rpsS 51066 51344 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CRG4 protein_id gnl|my_center|LOCUS_20270 51351 51677 gene locus_tag LOCUS_20280 gene rplV 51351 51677 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z3 protein_id gnl|my_center|LOCUS_20280 51687 52343 gene locus_tag LOCUS_20290 gene rpsC 51687 52343 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z4 protein_id gnl|my_center|LOCUS_20290 52359 52769 gene locus_tag LOCUS_20300 gene rplP 52359 52769 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM5 protein_id gnl|my_center|LOCUS_20300 52766 52978 gene locus_tag LOCUS_20310 gene rpmC 52766 52978 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK61 protein_id gnl|my_center|LOCUS_20310 52996 53265 gene locus_tag LOCUS_20320 gene rpsQ 52996 53265 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z7 protein_id gnl|my_center|LOCUS_20320 53309 53677 gene locus_tag LOCUS_20330 gene rplN 53309 53677 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH0 protein_id gnl|my_center|LOCUS_20330 53711 54085 gene locus_tag LOCUS_20340 gene rplX 53711 54085 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH77 protein_id gnl|my_center|LOCUS_20340 54082 54642 gene locus_tag LOCUS_20350 gene rplE 54082 54642 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z9 protein_id gnl|my_center|LOCUS_20350 54733 55131 gene locus_tag LOCUS_20360 gene rpsH 54733 55131 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A1 protein_id gnl|my_center|LOCUS_20360 55156 55695 gene locus_tag LOCUS_20370 gene rplF 55156 55695 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A2 protein_id gnl|my_center|LOCUS_20370 55710 56087 gene locus_tag LOCUS_20380 gene rplR 55710 56087 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYX3 protein_id gnl|my_center|LOCUS_20380 56240 56749 gene locus_tag LOCUS_20390 gene rpsE 56240 56749 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR4 protein_id gnl|my_center|LOCUS_20390 56770 56955 gene locus_tag LOCUS_20400 gene rpmD 56770 56955 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SZ5 protein_id gnl|my_center|LOCUS_20400 56960 57412 gene locus_tag LOCUS_20410 gene rplO 56960 57412 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A6 protein_id gnl|my_center|LOCUS_20410 57425 58750 gene locus_tag LOCUS_20420 gene secY 57425 58750 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A7 protein_id gnl|my_center|LOCUS_20420 58932 59300 gene locus_tag LOCUS_20430 gene rpsM 58932 59300 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B0 protein_id gnl|my_center|LOCUS_20430 59316 59705 gene locus_tag LOCUS_20440 gene rpsK 59316 59705 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY3 protein_id gnl|my_center|LOCUS_20440 59910 60971 gene locus_tag LOCUS_20450 gene rpoA 59910 60971 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B3 protein_id gnl|my_center|LOCUS_20450 >Feature sequence026 2118 835 gene locus_tag LOCUS_20460 2118 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2867 2112 gene locus_tag LOCUS_20470 gene hisF 2867 2112 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66567 protein_id gnl|my_center|LOCUS_20470 3469 2861 gene locus_tag LOCUS_20480 gene hisH 3469 2861 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81G04 protein_id gnl|my_center|LOCUS_20480 4062 3469 gene locus_tag LOCUS_20490 gene hisB 4062 3469 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A1 protein_id gnl|my_center|LOCUS_20490 5777 4059 gene locus_tag LOCUS_20500 5777 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 6653 5787 gene locus_tag LOCUS_20510 gene hisG 6653 5787 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_20510 7202 9793 gene locus_tag LOCUS_20520 7202 9793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 10082 11809 gene locus_tag LOCUS_20530 10082 11809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 11806 12996 gene locus_tag LOCUS_20540 11806 12996 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977660.1 protein_id gnl|my_center|LOCUS_20540 13058 14737 gene locus_tag LOCUS_20550 13058 14737 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706882.1 protein_id gnl|my_center|LOCUS_20550 14738 15718 gene locus_tag LOCUS_20560 14738 15718 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776034.1 protein_id gnl|my_center|LOCUS_20560 15715 16665 gene locus_tag LOCUS_20570 15715 16665 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230098.1 protein_id gnl|my_center|LOCUS_20570 16662 17468 gene locus_tag LOCUS_20580 16662 17468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263096.1 protein_id gnl|my_center|LOCUS_20580 17465 18277 gene locus_tag LOCUS_20590 17465 18277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 18321 19688 gene locus_tag LOCUS_20600 gene bglB 18321 19688 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D8I7 protein_id gnl|my_center|LOCUS_20600 19689 22766 gene locus_tag LOCUS_20610 19689 22766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 22763 23323 gene locus_tag LOCUS_20620 22763 23323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 23320 23943 gene locus_tag LOCUS_20630 23320 23943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 23940 25859 gene locus_tag LOCUS_20640 23940 25859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 26352 26537 gene locus_tag LOCUS_20650 26352 26537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 26528 28870 gene locus_tag LOCUS_20660 26528 28870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 29517 29065 gene locus_tag LOCUS_20670 29517 29065 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_20670 30035 30487 gene locus_tag LOCUS_20680 30035 30487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 30484 31098 gene locus_tag LOCUS_20690 30484 31098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_20690 31622 31275 gene locus_tag LOCUS_20700 31622 31275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 32520 33800 gene locus_tag LOCUS_20710 32520 33800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 protein_id gnl|my_center|LOCUS_20710 33940 34227 gene locus_tag LOCUS_20720 33940 34227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 34385 35008 gene locus_tag LOCUS_20730 34385 35008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 35275 35778 gene locus_tag LOCUS_20740 35275 35778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 36079 35873 gene locus_tag LOCUS_20750 36079 35873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 36539 36036 gene locus_tag LOCUS_20760 36539 36036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 37127 38263 gene locus_tag LOCUS_20770 37127 38263 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124033.1 protein_id gnl|my_center|LOCUS_20770 38257 38481 gene locus_tag LOCUS_20780 38257 38481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 38850 39284 gene locus_tag LOCUS_20790 38850 39284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 39294 40115 gene locus_tag LOCUS_20800 39294 40115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 40611 40249 gene locus_tag LOCUS_20810 40611 40249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 40967 40608 gene locus_tag LOCUS_20820 40967 40608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 41617 40976 gene locus_tag LOCUS_20830 41617 40976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 42043 41762 gene locus_tag LOCUS_20840 42043 41762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272202.1 protein_id gnl|my_center|LOCUS_20840 42610 43350 gene locus_tag LOCUS_20850 42610 43350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 45015 43687 gene locus_tag LOCUS_20860 45015 43687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 46296 45070 gene locus_tag LOCUS_20870 46296 45070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 47345 46407 gene locus_tag LOCUS_20880 47345 46407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 47907 49022 gene locus_tag LOCUS_20890 47907 49022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_20890 49019 51730 gene locus_tag LOCUS_20900 49019 51730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 52209 52850 gene locus_tag LOCUS_20910 52209 52850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 53570 52857 gene locus_tag LOCUS_20920 53570 52857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 54285 53824 gene locus_tag LOCUS_20930 54285 53824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 54551 54312 gene locus_tag LOCUS_20940 54551 54312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 56442 55834 gene locus_tag LOCUS_20950 56442 55834 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021989.1 protein_id gnl|my_center|LOCUS_20950 56505 57902 gene locus_tag LOCUS_20960 56505 57902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence027 466 1101 gene locus_tag LOCUS_20970 466 1101 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_20970 1494 1117 gene locus_tag LOCUS_20980 1494 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 3032 1503 gene locus_tag LOCUS_20990 gene yngE 3032 1503 CDS product putative carboxylase YngE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31825 protein_id gnl|my_center|LOCUS_20990 3804 3034 gene locus_tag LOCUS_21000 gene yngF 3804 3034 CDS product putative enoyl-CoA hydratase/isomerase YngF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34893 protein_id gnl|my_center|LOCUS_21000 4859 3942 gene locus_tag LOCUS_21010 gene yngG 4859 3942 CDS product hydroxymethylglutaryl-CoA lyase YngG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34873 protein_id gnl|my_center|LOCUS_21010 5280 4882 gene locus_tag LOCUS_21020 5280 4882 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_21020 6416 5280 gene locus_tag LOCUS_21030 6416 5280 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_21030 7215 6436 gene locus_tag LOCUS_21040 gene crt 7215 6436 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52046 protein_id gnl|my_center|LOCUS_21040 8083 7226 gene locus_tag LOCUS_21050 8083 7226 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390827.1 protein_id gnl|my_center|LOCUS_21050 9269 8088 gene locus_tag LOCUS_21060 gene phbA 9269 8088 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_21060 9370 11259 gene locus_tag LOCUS_21070 9370 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 11604 11266 gene locus_tag LOCUS_21080 11604 11266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 12509 11601 gene locus_tag LOCUS_21090 12509 11601 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_21090 16525 12506 gene locus_tag LOCUS_21100 16525 12506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 16853 18154 gene locus_tag LOCUS_21110 16853 18154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 18214 18927 gene locus_tag LOCUS_21120 18214 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 19430 18924 gene locus_tag LOCUS_21130 gene infC 19430 18924 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CC22 protein_id gnl|my_center|LOCUS_21130 19673 21280 gene locus_tag LOCUS_21140 19673 21280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 21596 23038 gene locus_tag LOCUS_21150 21596 23038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 23164 23463 gene locus_tag LOCUS_21160 23164 23463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 23504 25063 gene locus_tag LOCUS_21170 23504 25063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 25060 27228 gene locus_tag LOCUS_21180 25060 27228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 27225 29024 gene locus_tag LOCUS_21190 27225 29024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 30968 29031 gene locus_tag LOCUS_21200 30968 29031 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_21200 33101 31134 gene locus_tag LOCUS_21210 33101 31134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 34385 33381 gene locus_tag LOCUS_21220 34385 33381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 35722 34451 gene locus_tag LOCUS_21230 gene pcnA 35722 34451 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051791.1 protein_id gnl|my_center|LOCUS_21230 36174 35842 gene locus_tag LOCUS_21240 36174 35842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 36408 39596 gene locus_tag LOCUS_21250 36408 39596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 39665 41569 gene locus_tag LOCUS_21260 39665 41569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 41569 42873 gene locus_tag LOCUS_21270 41569 42873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 42923 43597 gene locus_tag LOCUS_21280 gene dck 42923 43597 CDS product deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403716.1 protein_id gnl|my_center|LOCUS_21280 45628 43625 gene locus_tag LOCUS_21290 gene rnr 45628 43625 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D34 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21290 45978 47348 gene locus_tag LOCUS_21300 45978 47348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 47439 47512 gene locus_tag LOCUS_t00270 47439 47512 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 47652 48203 gene locus_tag LOCUS_21310 47652 48203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 48220 52563 gene locus_tag LOCUS_21320 48220 52563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 53019 52792 gene locus_tag LOCUS_21330 53019 52792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 53655 53161 gene locus_tag LOCUS_21340 53655 53161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence028 15 254 gene locus_tag LOCUS_21350 15 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 251 874 gene locus_tag LOCUS_21360 251 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 1298 1128 gene locus_tag LOCUS_21370 1298 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 1531 2778 gene locus_tag LOCUS_21380 1531 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2771 4519 gene locus_tag LOCUS_21390 2771 4519 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_21390 4558 6681 gene locus_tag LOCUS_21400 4558 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 7085 6669 gene locus_tag LOCUS_21410 7085 6669 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337309.1 protein_id gnl|my_center|LOCUS_21410 9203 7098 gene locus_tag LOCUS_21420 gene metG 9203 7098 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A3 protein_id gnl|my_center|LOCUS_21420 9430 12144 gene locus_tag LOCUS_21430 9430 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 12141 14390 gene locus_tag LOCUS_21440 12141 14390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 15540 14407 gene locus_tag LOCUS_21450 15540 14407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 15846 17741 gene locus_tag LOCUS_21460 15846 17741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 18463 17738 gene locus_tag LOCUS_21470 18463 17738 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Z9 protein_id gnl|my_center|LOCUS_21470 20135 18558 gene locus_tag LOCUS_21480 20135 18558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 20809 20204 gene locus_tag LOCUS_21490 20809 20204 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401571.1 protein_id gnl|my_center|LOCUS_21490 21652 20897 gene locus_tag LOCUS_21500 21652 20897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 23153 21642 gene locus_tag LOCUS_21510 23153 21642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 23235 23558 gene locus_tag LOCUS_21520 23235 23558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 24186 24686 gene locus_tag LOCUS_21530 24186 24686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 26484 24823 gene locus_tag LOCUS_21540 26484 24823 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_21540 27009 26623 gene locus_tag LOCUS_21550 27009 26623 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CV51 protein_id gnl|my_center|LOCUS_21550 27407 27021 gene locus_tag LOCUS_21560 27407 27021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 27974 27453 gene locus_tag LOCUS_21570 27974 27453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 28953 27982 gene locus_tag LOCUS_21580 28953 27982 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392130.1 protein_id gnl|my_center|LOCUS_21580 30043 28940 gene locus_tag LOCUS_21590 30043 28940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 31923 30040 gene locus_tag LOCUS_21600 31923 30040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 32067 32540 gene locus_tag LOCUS_21610 32067 32540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 32537 33028 gene locus_tag LOCUS_21620 32537 33028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 33921 33034 gene locus_tag LOCUS_21630 33921 33034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 35961 33970 gene locus_tag LOCUS_21640 35961 33970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 37086 36052 gene locus_tag LOCUS_21650 37086 36052 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_21650 37826 37083 gene locus_tag LOCUS_21660 gene ywqE 37826 37083 CDS product tyrosine-protein phosphatase YwqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96717 protein_id gnl|my_center|LOCUS_21660 37898 38269 gene locus_tag LOCUS_21670 37898 38269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 38311 38383 gene locus_tag LOCUS_t00280 38311 38383 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 38576 40090 gene locus_tag LOCUS_21680 gene comM 38576 40090 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_21680 40098 41204 gene locus_tag LOCUS_21690 gene recA 40098 41204 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MH0 protein_id gnl|my_center|LOCUS_21690 41678 41217 gene locus_tag LOCUS_21700 41678 41217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 42033 42611 gene locus_tag LOCUS_21710 42033 42611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 45691 42608 gene locus_tag LOCUS_21720 45691 42608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 49951 45824 gene locus_tag LOCUS_21730 49951 45824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence029 3 2600 gene locus_tag LOCUS_21740 3 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2597 3883 gene locus_tag LOCUS_21750 2597 3883 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674820.1 protein_id gnl|my_center|LOCUS_21750 3876 5267 gene locus_tag LOCUS_21760 3876 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 5383 6207 gene locus_tag LOCUS_21770 5383 6207 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142937.1 protein_id gnl|my_center|LOCUS_21770 6481 8499 gene locus_tag LOCUS_21780 gene nadE 6481 8499 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964368.1 protein_id gnl|my_center|LOCUS_21780 8496 8912 gene locus_tag LOCUS_21790 8496 8912 CDS product glyoxalase/bleomycin resistance protein/dioxygenase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204789.1 protein_id gnl|my_center|LOCUS_21790 9553 8909 gene locus_tag LOCUS_21800 9553 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 9844 12117 gene locus_tag LOCUS_21810 9844 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 12126 12905 gene locus_tag LOCUS_21820 12126 12905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 18050 12954 gene locus_tag LOCUS_21830 18050 12954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 18497 18075 gene locus_tag LOCUS_21840 18497 18075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 21547 18494 gene locus_tag LOCUS_21850 21547 18494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 21837 22112 gene locus_tag LOCUS_21860 21837 22112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 23043 25310 gene locus_tag LOCUS_21870 23043 25310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 25317 25748 gene locus_tag LOCUS_21880 25317 25748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 25745 26377 gene locus_tag LOCUS_21890 25745 26377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 26481 26711 gene locus_tag LOCUS_21900 26481 26711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 26920 27645 gene locus_tag LOCUS_21910 26920 27645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 29064 27607 gene locus_tag LOCUS_21920 29064 27607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 29471 29061 gene locus_tag LOCUS_21930 29471 29061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 32162 29565 gene locus_tag LOCUS_21940 32162 29565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 33410 32172 gene locus_tag LOCUS_21950 33410 32172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 34606 33410 gene locus_tag LOCUS_21960 gene paaJ 34606 33410 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390637.1 protein_id gnl|my_center|LOCUS_21960 35341 34754 gene locus_tag LOCUS_21970 35341 34754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 36745 35855 gene locus_tag LOCUS_21980 36745 35855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 37299 36742 gene locus_tag LOCUS_21990 37299 36742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 37455 38165 gene locus_tag LOCUS_22000 37455 38165 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173744.1 protein_id gnl|my_center|LOCUS_22000 38169 39317 gene locus_tag LOCUS_22010 38169 39317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 39890 39330 gene locus_tag LOCUS_22020 39890 39330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 40009 40809 gene locus_tag LOCUS_22030 gene pecR 40009 40809 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_22030 40845 44540 gene locus_tag LOCUS_22040 40845 44540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 44537 44884 gene locus_tag LOCUS_22050 44537 44884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 45765 44893 gene locus_tag LOCUS_22060 45765 44893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 46035 46691 gene locus_tag LOCUS_22070 46035 46691 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_22070 46692 47354 gene locus_tag LOCUS_22080 46692 47354 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142810.1 protein_id gnl|my_center|LOCUS_22080 48628 47360 gene locus_tag LOCUS_22090 gene guaD 48628 47360 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207678.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence030 1639 926 gene locus_tag LOCUS_22100 1639 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 1806 1991 gene locus_tag LOCUS_22110 1806 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2005 2541 gene locus_tag LOCUS_22120 2005 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 2550 3110 gene locus_tag LOCUS_22130 2550 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 4118 3258 gene locus_tag LOCUS_22140 4118 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 4470 4240 gene locus_tag LOCUS_22150 4470 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 4543 4857 gene locus_tag LOCUS_22160 4543 4857 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367954.1 protein_id gnl|my_center|LOCUS_22160 8328 4942 gene locus_tag LOCUS_22170 8328 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 8556 9329 gene locus_tag LOCUS_22180 8556 9329 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887476.1 protein_id gnl|my_center|LOCUS_22180 12822 9388 gene locus_tag LOCUS_22190 12822 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 14303 13149 gene locus_tag LOCUS_22200 14303 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 14971 14375 gene locus_tag LOCUS_22210 14971 14375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 16556 15123 gene locus_tag LOCUS_22220 16556 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 16925 18760 gene locus_tag LOCUS_22230 gene deaD-1 16925 18760 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KET5 protein_id gnl|my_center|LOCUS_22230 18983 20722 gene locus_tag LOCUS_22240 18983 20722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 21696 20752 gene locus_tag LOCUS_22250 21696 20752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 24655 21791 gene locus_tag LOCUS_22260 24655 21791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 25007 25606 gene locus_tag LOCUS_22270 25007 25606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 25870 27720 gene locus_tag LOCUS_22280 25870 27720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 27822 28613 gene locus_tag LOCUS_22290 27822 28613 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065332.1 protein_id gnl|my_center|LOCUS_22290 28610 29296 gene locus_tag LOCUS_22300 28610 29296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 29293 31395 gene locus_tag LOCUS_22310 29293 31395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 31413 32624 gene locus_tag LOCUS_22320 31413 32624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 34443 32773 gene locus_tag LOCUS_22330 34443 32773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 35076 37022 gene locus_tag LOCUS_22340 gene thrS 35076 37022 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 protein_id gnl|my_center|LOCUS_22340 37202 37639 gene locus_tag LOCUS_22350 37202 37639 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624159.1 protein_id gnl|my_center|LOCUS_22350 37896 39356 gene locus_tag LOCUS_22360 37896 39356 CDS product xanthine dehydrogenase, N-terminal subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_296359.1 protein_id gnl|my_center|LOCUS_22360 39356 41683 gene locus_tag LOCUS_22370 39356 41683 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974005.1 protein_id gnl|my_center|LOCUS_22370 41676 42524 gene locus_tag LOCUS_22380 41676 42524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 42712 48354 gene locus_tag LOCUS_22390 42712 48354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 48829 48455 gene locus_tag LOCUS_22400 48829 48455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence031 3065 2586 gene locus_tag LOCUS_22410 gene greA 3065 2586 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H1V7 protein_id gnl|my_center|LOCUS_22410 6309 3085 gene locus_tag LOCUS_22420 gene carB 6309 3085 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP0 protein_id gnl|my_center|LOCUS_22420 7468 6356 gene locus_tag LOCUS_22430 7468 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 8439 7468 gene locus_tag LOCUS_22440 gene lipA 8439 7468 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNA3 protein_id gnl|my_center|LOCUS_22440 8544 8795 gene locus_tag LOCUS_22450 8544 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 8802 8990 gene locus_tag LOCUS_22460 8802 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 9645 8995 gene locus_tag LOCUS_22470 9645 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 9844 11364 gene locus_tag LOCUS_22480 9844 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 12494 11361 gene locus_tag LOCUS_22490 12494 11361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 12589 13170 gene locus_tag LOCUS_22500 12589 13170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 13205 15517 gene locus_tag LOCUS_22510 13205 15517 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_22510 15914 15519 gene locus_tag LOCUS_22520 15914 15519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 16081 18165 gene locus_tag LOCUS_22530 16081 18165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 18186 19049 gene locus_tag LOCUS_22540 18186 19049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 19062 20906 gene locus_tag LOCUS_22550 19062 20906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 21042 22118 gene locus_tag LOCUS_22560 21042 22118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 24207 22285 gene locus_tag LOCUS_22570 24207 22285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 24418 26604 gene locus_tag LOCUS_22580 24418 26604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 26671 27450 gene locus_tag LOCUS_22590 26671 27450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 27460 28011 gene locus_tag LOCUS_22600 27460 28011 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_22600 29989 28013 gene locus_tag LOCUS_22610 29989 28013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 30120 32129 gene locus_tag LOCUS_22620 30120 32129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 33109 32144 gene locus_tag LOCUS_22630 33109 32144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 33477 33322 gene locus_tag LOCUS_22640 33477 33322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 33539 34852 gene locus_tag LOCUS_22650 33539 34852 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943971.1 protein_id gnl|my_center|LOCUS_22650 35543 34869 gene locus_tag LOCUS_22660 35543 34869 CDS product molybdenum cofactor biosynthesis protein D/E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_22660 36013 35561 gene locus_tag LOCUS_22670 36013 35561 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYB0 protein_id gnl|my_center|LOCUS_22670 37191 36010 gene locus_tag LOCUS_22680 37191 36010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 38327 37182 gene locus_tag LOCUS_22690 gene carA 38327 37182 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP3 protein_id gnl|my_center|LOCUS_22690 39656 38343 gene locus_tag LOCUS_22700 gene pyrC 39656 38343 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0H8 protein_id gnl|my_center|LOCUS_22700 40540 39653 gene locus_tag LOCUS_22710 gene pyrB 40540 39653 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP5 protein_id gnl|my_center|LOCUS_22710 41141 40563 gene locus_tag LOCUS_22720 gene pyrR 41141 40563 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SK65 protein_id gnl|my_center|LOCUS_22720 42080 41163 gene locus_tag LOCUS_22730 42080 41163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 44051 42255 gene locus_tag LOCUS_22740 gene lepA 44051 42255 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E76 protein_id gnl|my_center|LOCUS_22740 44263 44799 gene locus_tag LOCUS_22750 44263 44799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 45887 44820 gene locus_tag LOCUS_22760 45887 44820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 46951 45965 gene locus_tag LOCUS_22770 46951 45965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence032 926 3451 gene locus_tag LOCUS_22780 926 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 3849 4163 gene locus_tag LOCUS_22790 3849 4163 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMH9 protein_id gnl|my_center|LOCUS_22790 4174 4680 gene locus_tag LOCUS_22800 4174 4680 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_22800 4677 5441 gene locus_tag LOCUS_22810 4677 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 6455 5448 gene locus_tag LOCUS_22820 6455 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 7772 6507 gene locus_tag LOCUS_22830 7772 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 9909 7792 gene locus_tag LOCUS_22840 9909 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 protein_id gnl|my_center|LOCUS_22840 11314 10028 gene locus_tag LOCUS_22850 11314 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 11438 12082 gene locus_tag LOCUS_22860 11438 12082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 12986 12063 gene locus_tag LOCUS_22870 12986 12063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 14293 12986 gene locus_tag LOCUS_22880 14293 12986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 15519 14290 gene locus_tag LOCUS_22890 15519 14290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 17073 15679 gene locus_tag LOCUS_22900 gene atoE 17073 15679 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_22900 17578 18522 gene locus_tag LOCUS_22910 gene hemF 17578 18522 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_22910 19287 18499 gene locus_tag LOCUS_22920 19287 18499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 19682 20620 gene locus_tag LOCUS_22930 gene selD 19682 20620 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ4 protein_id gnl|my_center|LOCUS_22930 21978 20638 gene locus_tag LOCUS_22940 gene selA 21978 20638 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIF3 protein_id gnl|my_center|LOCUS_22940 23791 21971 gene locus_tag LOCUS_22950 gene selB 23791 21971 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_22950 26008 23795 gene locus_tag LOCUS_22960 26008 23795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 26910 26005 gene locus_tag LOCUS_22970 26910 26005 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_22970 27650 26898 gene locus_tag LOCUS_22980 27650 26898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 27794 28918 gene locus_tag LOCUS_22990 27794 28918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 29183 32053 gene locus_tag LOCUS_23000 29183 32053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 32053 32994 gene locus_tag LOCUS_23010 32053 32994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 32991 37049 gene locus_tag LOCUS_23020 32991 37049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 37118 38035 gene locus_tag LOCUS_23030 37118 38035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 38056 38670 gene locus_tag LOCUS_23040 38056 38670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 40376 38676 gene locus_tag LOCUS_23050 40376 38676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 41236 40373 gene locus_tag LOCUS_23060 41236 40373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 42761 41313 gene locus_tag LOCUS_23070 42761 41313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 43180 42758 gene locus_tag LOCUS_23080 43180 42758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 43536 43790 gene locus_tag LOCUS_23090 43536 43790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 43787 44086 gene locus_tag LOCUS_23100 43787 44086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence033 702 229 gene locus_tag LOCUS_23110 702 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 873 1742 gene locus_tag LOCUS_23120 873 1742 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_23120 1732 2571 gene locus_tag LOCUS_23130 1732 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2564 3565 gene locus_tag LOCUS_23140 2564 3565 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392828.1 protein_id gnl|my_center|LOCUS_23140 3562 4266 gene locus_tag LOCUS_23150 3562 4266 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933740.1 protein_id gnl|my_center|LOCUS_23150 4494 9674 gene locus_tag LOCUS_23160 4494 9674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 10580 9705 gene locus_tag LOCUS_23170 gene kynA 10580 9705 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81CK2 protein_id gnl|my_center|LOCUS_23170 11365 10577 gene locus_tag LOCUS_23180 11365 10577 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_23180 12315 11362 gene locus_tag LOCUS_23190 12315 11362 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267430.1 protein_id gnl|my_center|LOCUS_23190 13339 12317 gene locus_tag LOCUS_23200 13339 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069660.1 protein_id gnl|my_center|LOCUS_23200 13467 14171 gene locus_tag LOCUS_23210 13467 14171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 16086 14158 gene locus_tag LOCUS_23220 16086 14158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 22938 16240 gene locus_tag LOCUS_23230 22938 16240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 23584 23093 gene locus_tag LOCUS_23240 23584 23093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 24101 31591 gene locus_tag LOCUS_23250 24101 31591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 31793 32752 gene locus_tag LOCUS_23260 31793 32752 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969244.1 protein_id gnl|my_center|LOCUS_23260 35250 32806 gene locus_tag LOCUS_23270 35250 32806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 35565 36161 gene locus_tag LOCUS_23280 35565 36161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090877.1 protein_id gnl|my_center|LOCUS_23280 36148 36489 gene locus_tag LOCUS_23290 36148 36489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 36553 36939 gene locus_tag LOCUS_23300 36553 36939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 37074 37814 gene locus_tag LOCUS_23310 37074 37814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 40407 37849 gene locus_tag LOCUS_23320 40407 37849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 40637 41653 gene locus_tag LOCUS_23330 40637 41653 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095359.1 protein_id gnl|my_center|LOCUS_23330 43929 41665 gene locus_tag LOCUS_23340 43929 41665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence034 1498 302 gene locus_tag LOCUS_23350 1498 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 3735 1504 gene locus_tag LOCUS_23360 3735 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 3900 4490 gene locus_tag LOCUS_23370 3900 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 5224 4499 gene locus_tag LOCUS_23380 5224 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 5324 5521 gene locus_tag LOCUS_23390 5324 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 5484 7136 gene locus_tag LOCUS_23400 5484 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 8011 7145 gene locus_tag LOCUS_23410 8011 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 9651 8008 gene locus_tag LOCUS_23420 gene ffh 9651 8008 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV8 protein_id gnl|my_center|LOCUS_23420 9920 11503 gene locus_tag LOCUS_23430 gene dnaK 9920 11503 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_23430 11500 12498 gene locus_tag LOCUS_23440 11500 12498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 12509 13321 gene locus_tag LOCUS_23450 gene cdsA 12509 13321 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_23450 13516 14970 gene locus_tag LOCUS_23460 13516 14970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 14981 15697 gene locus_tag LOCUS_23470 gene yeaZ 14981 15697 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942558.1 protein_id gnl|my_center|LOCUS_23470 15697 16230 gene locus_tag LOCUS_23480 15697 16230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 16290 17288 gene locus_tag LOCUS_23490 gene gpsA 16290 17288 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61740 protein_id gnl|my_center|LOCUS_23490 17285 17896 gene locus_tag LOCUS_23500 17285 17896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 17893 18750 gene locus_tag LOCUS_23510 gene prmC 17893 18750 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT2 protein_id gnl|my_center|LOCUS_23510 19106 18756 gene locus_tag LOCUS_23520 19106 18756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 19615 19112 gene locus_tag LOCUS_23530 19615 19112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 20676 19813 gene locus_tag LOCUS_23540 gene panC 20676 19813 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CG7 protein_id gnl|my_center|LOCUS_23540 21511 20711 gene locus_tag LOCUS_23550 gene panB 21511 20711 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729A6 protein_id gnl|my_center|LOCUS_23550 21729 22127 gene locus_tag LOCUS_23560 21729 22127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 22654 22896 gene locus_tag LOCUS_23570 22654 22896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 22960 23289 gene locus_tag LOCUS_23580 22960 23289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 23425 23646 gene locus_tag LOCUS_23590 23425 23646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 23972 23715 gene locus_tag LOCUS_23600 23972 23715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 27223 25073 gene locus_tag LOCUS_23610 27223 25073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 27617 28117 gene locus_tag LOCUS_23620 27617 28117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 28114 28467 gene locus_tag LOCUS_23630 28114 28467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 28682 29455 gene locus_tag LOCUS_23640 28682 29455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 29537 30694 gene locus_tag LOCUS_23650 29537 30694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 31476 30709 gene locus_tag LOCUS_23660 31476 30709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 31527 33374 gene locus_tag LOCUS_23670 31527 33374 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460521.1 protein_id gnl|my_center|LOCUS_23670 34684 33377 gene locus_tag LOCUS_23680 34684 33377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 35724 34684 gene locus_tag LOCUS_23690 35724 34684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 36012 36677 gene locus_tag LOCUS_23700 36012 36677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 36683 37324 gene locus_tag LOCUS_23710 36683 37324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939730.1 protein_id gnl|my_center|LOCUS_23710 37324 38424 gene locus_tag LOCUS_23720 gene manC 37324 38424 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_23720 38424 39815 gene locus_tag LOCUS_23730 38424 39815 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937988.1 protein_id gnl|my_center|LOCUS_23730 39812 40624 gene locus_tag LOCUS_23740 gene prpC 39812 40624 CDS product protein phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34779 protein_id gnl|my_center|LOCUS_23740 40759 41823 gene locus_tag LOCUS_23750 40759 41823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence035 4152 1606 gene locus_tag LOCUS_23760 4152 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 4386 4964 gene locus_tag LOCUS_23770 4386 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 5284 5514 gene locus_tag LOCUS_23780 5284 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 5460 6263 gene locus_tag LOCUS_23790 5460 6263 CDS product beta-Ig-H3/fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405131.1 protein_id gnl|my_center|LOCUS_23790 7011 6376 gene locus_tag LOCUS_23800 7011 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 7394 7080 gene locus_tag LOCUS_23810 7394 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 7641 8429 gene locus_tag LOCUS_23820 7641 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 8591 10978 gene locus_tag LOCUS_23830 8591 10978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 12568 11339 gene locus_tag LOCUS_23840 12568 11339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 13777 12809 gene locus_tag LOCUS_23850 13777 12809 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 protein_id gnl|my_center|LOCUS_23850 15152 13812 gene locus_tag LOCUS_23860 15152 13812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 15346 17394 gene locus_tag LOCUS_23870 15346 17394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 18913 17411 gene locus_tag LOCUS_23880 gene phr 18913 17411 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_23880 19804 18962 gene locus_tag LOCUS_23890 19804 18962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 20208 20798 gene locus_tag LOCUS_23900 20208 20798 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJK9 protein_id gnl|my_center|LOCUS_23900 20900 21880 gene locus_tag LOCUS_23910 20900 21880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705026.1 protein_id gnl|my_center|LOCUS_23910 23099 21882 gene locus_tag LOCUS_23920 23099 21882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 24248 23658 gene locus_tag LOCUS_23930 24248 23658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 25308 24283 gene locus_tag LOCUS_23940 25308 24283 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896752.1 protein_id gnl|my_center|LOCUS_23940 26300 25587 gene locus_tag LOCUS_23950 26300 25587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 27679 26381 gene locus_tag LOCUS_23960 27679 26381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 29447 27684 gene locus_tag LOCUS_23970 29447 27684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 29700 29437 gene locus_tag LOCUS_23980 29700 29437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 30275 29697 gene locus_tag LOCUS_23990 30275 29697 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031817.1 protein_id gnl|my_center|LOCUS_23990 31339 30275 gene locus_tag LOCUS_24000 gene pks11 31339 30275 CDS product alpha-pyrone synthesis polyketide synthase-like Pks11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPF3 protein_id gnl|my_center|LOCUS_24000 32310 31570 gene locus_tag LOCUS_24010 gene ubiG 32310 31570 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q820B5 protein_id gnl|my_center|LOCUS_24010 32776 32339 gene locus_tag LOCUS_24020 32776 32339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 33668 34456 gene locus_tag LOCUS_24030 33668 34456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 34453 34944 gene locus_tag LOCUS_24040 34453 34944 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_24040 35708 34941 gene locus_tag LOCUS_24050 35708 34941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 35952 39035 gene locus_tag LOCUS_24060 35952 39035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence036 202 1371 gene locus_tag LOCUS_24070 202 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 1810 1448 gene locus_tag LOCUS_tm00010 1810 1448 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2345 1887 gene locus_tag LOCUS_24080 gene smpB 2345 1887 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1S9 protein_id gnl|my_center|LOCUS_24080 3603 2815 gene locus_tag LOCUS_24090 3603 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 3710 3636 gene locus_tag LOCUS_t00290 3710 3636 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5471 3744 gene locus_tag LOCUS_24100 gene rpoD 5471 3744 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B8 protein_id gnl|my_center|LOCUS_24100 7421 5472 gene locus_tag LOCUS_24110 7421 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 8430 7519 gene locus_tag LOCUS_24120 8430 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 9575 8592 gene locus_tag LOCUS_24130 9575 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 9692 11890 gene locus_tag LOCUS_24140 9692 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 11960 12232 gene locus_tag LOCUS_24150 11960 12232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 13002 12247 gene locus_tag LOCUS_24160 13002 12247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 13889 13065 gene locus_tag LOCUS_24170 13889 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 14002 14655 gene locus_tag LOCUS_24180 14002 14655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405394.1 protein_id gnl|my_center|LOCUS_24180 15515 14664 gene locus_tag LOCUS_24190 15515 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 15791 16540 gene locus_tag LOCUS_24200 gene pssA 15791 16540 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q48269 protein_id gnl|my_center|LOCUS_24200 16590 17417 gene locus_tag LOCUS_24210 16590 17417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 17522 18520 gene locus_tag LOCUS_24220 17522 18520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 18898 18524 gene locus_tag LOCUS_24230 18898 18524 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 protein_id gnl|my_center|LOCUS_24230 21822 18895 gene locus_tag LOCUS_24240 21822 18895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 22117 22512 gene locus_tag LOCUS_24250 22117 22512 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546622.1 protein_id gnl|my_center|LOCUS_24250 23841 22522 gene locus_tag LOCUS_24260 23841 22522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 25272 23899 gene locus_tag LOCUS_24270 25272 23899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 25733 27586 gene locus_tag LOCUS_24280 gene comEC 25733 27586 CDS product ComE operon protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39695 protein_id gnl|my_center|LOCUS_24280 27972 27583 gene locus_tag LOCUS_24290 27972 27583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 28781 27972 gene locus_tag LOCUS_24300 28781 27972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 28843 30951 gene locus_tag LOCUS_24310 28843 30951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 35128 30962 gene locus_tag LOCUS_24320 35128 30962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence037 2 502 gene locus_tag LOCUS_24330 2 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 1209 1733 gene locus_tag LOCUS_24340 1209 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2467 1793 gene locus_tag LOCUS_24350 gene lon 2467 1793 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327343.1 protein_id gnl|my_center|LOCUS_24350 3053 2538 gene locus_tag LOCUS_24360 3053 2538 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454132.1 protein_id gnl|my_center|LOCUS_24360 3155 5098 gene locus_tag LOCUS_24370 gene htpG 3155 5098 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64412 protein_id gnl|my_center|LOCUS_24370 5402 7078 gene locus_tag LOCUS_24380 gene asnB 5402 7078 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_24380 7351 8013 gene locus_tag LOCUS_24390 7351 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 8010 8603 gene locus_tag LOCUS_24400 8010 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 9370 8612 gene locus_tag LOCUS_24410 9370 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 9708 11975 gene locus_tag LOCUS_24420 9708 11975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 12204 12680 gene locus_tag LOCUS_24430 12204 12680 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118368.1 protein_id gnl|my_center|LOCUS_24430 12680 12958 gene locus_tag LOCUS_24440 12680 12958 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_24440 12955 13326 gene locus_tag LOCUS_24450 12955 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 13310 14032 gene locus_tag LOCUS_24460 13310 14032 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_24460 14029 14463 gene locus_tag LOCUS_24470 14029 14463 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 protein_id gnl|my_center|LOCUS_24470 14460 14858 gene locus_tag LOCUS_24480 14460 14858 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_24480 14855 16384 gene locus_tag LOCUS_24490 14855 16384 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_24490 16381 17913 gene locus_tag LOCUS_24500 16381 17913 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_24500 17918 18178 gene locus_tag LOCUS_24510 17918 18178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 18171 19949 gene locus_tag LOCUS_24520 18171 19949 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_24520 19991 22147 gene locus_tag LOCUS_24530 19991 22147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 22410 23516 gene locus_tag LOCUS_24540 22410 23516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 23629 24003 gene locus_tag LOCUS_24550 23629 24003 CDS product DUF962 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206200.1 protein_id gnl|my_center|LOCUS_24550 24140 26752 gene locus_tag LOCUS_24560 24140 26752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 26877 27611 gene locus_tag LOCUS_24570 26877 27611 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729133.1 protein_id gnl|my_center|LOCUS_24570 27710 28195 gene locus_tag LOCUS_24580 27710 28195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 28269 31064 gene locus_tag LOCUS_24590 28269 31064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 31178 31657 gene locus_tag LOCUS_24600 31178 31657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 33201 31681 gene locus_tag LOCUS_24610 33201 31681 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_24610 33317 35779 gene locus_tag LOCUS_24620 33317 35779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 >Feature sequence038 1519 917 gene locus_tag LOCUS_24630 1519 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 1979 1773 gene locus_tag LOCUS_24640 1979 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2428 4896 gene locus_tag LOCUS_24650 2428 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 5244 5807 gene locus_tag LOCUS_24660 5244 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 6948 6625 gene locus_tag LOCUS_24670 6948 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 6874 7158 gene locus_tag LOCUS_24680 6874 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 7489 7232 gene locus_tag LOCUS_24690 7489 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24690 7608 9836 gene locus_tag LOCUS_24700 7608 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 10339 10007 gene locus_tag LOCUS_24710 10339 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 10594 11787 gene locus_tag LOCUS_24720 10594 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 12421 12585 gene locus_tag LOCUS_24730 12421 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 12610 13083 gene locus_tag LOCUS_24740 12610 13083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24740 13092 13964 gene locus_tag LOCUS_24750 13092 13964 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889219.1 protein_id gnl|my_center|LOCUS_24750 14399 15391 gene locus_tag LOCUS_24760 14399 15391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 15745 15548 gene locus_tag LOCUS_24770 15745 15548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 15880 17073 gene locus_tag LOCUS_24780 15880 17073 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_24780 17827 17213 gene locus_tag LOCUS_24790 17827 17213 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532149.1 protein_id gnl|my_center|LOCUS_24790 19344 18181 gene locus_tag LOCUS_24800 19344 18181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 20443 19355 gene locus_tag LOCUS_24810 gene ychF 20443 19355 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC60 protein_id gnl|my_center|LOCUS_24810 20555 21484 gene locus_tag LOCUS_24820 gene yihG 20555 21484 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262892.1 protein_id gnl|my_center|LOCUS_24820 22160 21504 gene locus_tag LOCUS_24830 22160 21504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 25749 22117 gene locus_tag LOCUS_24840 25749 22117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 26911 25760 gene locus_tag LOCUS_24850 26911 25760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 29044 27020 gene locus_tag LOCUS_24860 29044 27020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 29146 31011 gene locus_tag LOCUS_24870 29146 31011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 31008 31598 gene locus_tag LOCUS_24880 31008 31598 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388397.1 protein_id gnl|my_center|LOCUS_24880 31600 32463 gene locus_tag LOCUS_24890 31600 32463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 32670 33797 gene locus_tag LOCUS_24900 gene cya 32670 33797 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312850.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence039 805 1449 gene locus_tag LOCUS_24910 805 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 1600 2391 gene locus_tag LOCUS_24920 gene lpqC 1600 2391 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_24920 2809 2471 gene locus_tag LOCUS_24930 2809 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 4842 2899 gene locus_tag LOCUS_24940 4842 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 4983 8639 gene locus_tag LOCUS_24950 4983 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 10241 8703 gene locus_tag LOCUS_24960 10241 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 10795 13014 gene locus_tag LOCUS_24970 10795 13014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 13682 13185 gene locus_tag LOCUS_24980 13682 13185 CDS product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970954.1 protein_id gnl|my_center|LOCUS_24980 14683 13805 gene locus_tag LOCUS_24990 gene oxyR 14683 13805 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_24990 14819 17059 gene locus_tag LOCUS_25000 gene katG2 14819 17059 CDS product catalase-peroxidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIV5 protein_id gnl|my_center|LOCUS_25000 17393 17725 gene locus_tag LOCUS_25010 17393 17725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 18112 18561 gene locus_tag LOCUS_25020 18112 18561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403019.1 protein_id gnl|my_center|LOCUS_25020 19071 18700 gene locus_tag LOCUS_25030 19071 18700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 19750 19337 gene locus_tag LOCUS_25040 19750 19337 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268644.1 protein_id gnl|my_center|LOCUS_25040 20017 20517 gene locus_tag LOCUS_25050 20017 20517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 20670 21284 gene locus_tag LOCUS_25060 20670 21284 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902661.1 protein_id gnl|my_center|LOCUS_25060 21431 22144 gene locus_tag LOCUS_25070 21431 22144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 22610 22203 gene locus_tag LOCUS_25080 22610 22203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 22899 23852 gene locus_tag LOCUS_25090 22899 23852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 24373 23960 gene locus_tag LOCUS_25100 24373 23960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 24694 25023 gene locus_tag LOCUS_25110 24694 25023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 25631 27436 gene locus_tag LOCUS_25120 25631 27436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 28416 27463 gene locus_tag LOCUS_25130 28416 27463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 29224 28574 gene locus_tag LOCUS_25140 29224 28574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 29722 29396 gene locus_tag LOCUS_25150 29722 29396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 30062 30760 gene locus_tag LOCUS_25160 gene ubiG 30062 30760 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN9 protein_id gnl|my_center|LOCUS_25160 30876 32921 gene locus_tag LOCUS_25170 30876 32921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence040 1496 423 gene locus_tag LOCUS_25180 gene serC 1496 423 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80862 protein_id gnl|my_center|LOCUS_25180 1680 2642 gene locus_tag LOCUS_25190 1680 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2639 4015 gene locus_tag LOCUS_25200 gene hemY 2639 4015 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_25200 4070 6082 gene locus_tag LOCUS_25210 gene hutU 4070 6082 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_25210 6130 6516 gene locus_tag LOCUS_25220 gene crcB 6130 6516 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFC8 protein_id gnl|my_center|LOCUS_25220 6579 7604 gene locus_tag LOCUS_25230 6579 7604 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUT6 protein_id gnl|my_center|LOCUS_25230 7772 11473 gene locus_tag LOCUS_25240 7772 11473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 11566 12534 gene locus_tag LOCUS_25250 11566 12534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 12802 15534 gene locus_tag LOCUS_25260 12802 15534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 15723 17867 gene locus_tag LOCUS_25270 15723 17867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 18817 17873 gene locus_tag LOCUS_25280 18817 17873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 19828 18830 gene locus_tag LOCUS_25290 19828 18830 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644533.1 protein_id gnl|my_center|LOCUS_25290 20685 19825 gene locus_tag LOCUS_25300 gene prmA 20685 19825 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XY24 protein_id gnl|my_center|LOCUS_25300 21689 20673 gene locus_tag LOCUS_25310 21689 20673 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640401.1 protein_id gnl|my_center|LOCUS_25310 25069 21749 gene locus_tag LOCUS_25320 25069 21749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 28562 25056 gene locus_tag LOCUS_25330 28562 25056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 28672 29319 gene locus_tag LOCUS_25340 28672 29319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 29342 30700 gene locus_tag LOCUS_25350 gene radA 29342 30700 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG1 protein_id gnl|my_center|LOCUS_25350 31353 30718 gene locus_tag LOCUS_25360 31353 30718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 32252 31350 gene locus_tag LOCUS_25370 32252 31350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence041 211 570 gene locus_tag LOCUS_25380 211 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 572 3202 gene locus_tag LOCUS_25390 572 3202 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403520.1 protein_id gnl|my_center|LOCUS_25390 3202 4254 gene locus_tag LOCUS_25400 3202 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 4355 4633 gene locus_tag LOCUS_25410 4355 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 4693 5238 gene locus_tag LOCUS_25420 4693 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 5235 6425 gene locus_tag LOCUS_25430 5235 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 6804 7937 gene locus_tag LOCUS_25440 6804 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 7918 8229 gene locus_tag LOCUS_25450 7918 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 9941 8268 gene locus_tag LOCUS_25460 9941 8268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 10298 10023 gene locus_tag LOCUS_25470 10298 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 10536 11840 gene locus_tag LOCUS_25480 10536 11840 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941480.1 protein_id gnl|my_center|LOCUS_25480 11853 12629 gene locus_tag LOCUS_25490 11853 12629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 13494 12745 gene locus_tag LOCUS_25500 13494 12745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 15249 13516 gene locus_tag LOCUS_25510 15249 13516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 16615 15404 gene locus_tag LOCUS_25520 16615 15404 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888800.1 protein_id gnl|my_center|LOCUS_25520 17235 16594 gene locus_tag LOCUS_25530 17235 16594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 17313 18740 gene locus_tag LOCUS_25540 gene pyk 17313 18740 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80885 protein_id gnl|my_center|LOCUS_25540 18798 19193 gene locus_tag LOCUS_25550 18798 19193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 19198 19521 gene locus_tag LOCUS_25560 19198 19521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 19518 20438 gene locus_tag LOCUS_25570 19518 20438 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_25570 20435 22057 gene locus_tag LOCUS_25580 20435 22057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 22386 23723 gene locus_tag LOCUS_25590 22386 23723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 23727 24026 gene locus_tag LOCUS_25600 23727 24026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 24107 26779 gene locus_tag LOCUS_25610 gene mutS 24107 26779 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61667 protein_id gnl|my_center|LOCUS_25610 26776 27699 gene locus_tag LOCUS_25620 gene xerD 26776 27699 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ6 protein_id gnl|my_center|LOCUS_25620 27701 28330 gene locus_tag LOCUS_25630 27701 28330 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372459.1 protein_id gnl|my_center|LOCUS_25630 28327 29196 gene locus_tag LOCUS_25640 gene scpA 28327 29196 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C43 protein_id gnl|my_center|LOCUS_25640 29949 29233 gene locus_tag LOCUS_25650 29949 29233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 32131 29933 gene locus_tag LOCUS_25660 32131 29933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence042 305 1465 gene locus_tag LOCUS_25670 305 1465 CDS product conjugal transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_25670 1484 2347 gene locus_tag LOCUS_25680 1484 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2404 3408 gene locus_tag LOCUS_25690 gene map 2404 3408 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKR2 protein_id gnl|my_center|LOCUS_25690 4010 3411 gene locus_tag LOCUS_25700 4010 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 4591 4007 gene locus_tag LOCUS_25710 4591 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 5732 4731 gene locus_tag LOCUS_25720 gene fbp 5732 4731 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AZ9 protein_id gnl|my_center|LOCUS_25720 5890 6870 gene locus_tag LOCUS_25730 5890 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 7545 6874 gene locus_tag LOCUS_25740 gene cysH 7545 6874 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5G4 protein_id gnl|my_center|LOCUS_25740 8688 7675 gene locus_tag LOCUS_25750 8688 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 8795 9130 gene locus_tag LOCUS_25760 8795 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 10247 9132 gene locus_tag LOCUS_25770 10247 9132 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272452.1 protein_id gnl|my_center|LOCUS_25770 10586 10254 gene locus_tag LOCUS_25780 10586 10254 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DK3 protein_id gnl|my_center|LOCUS_25780 11432 10692 gene locus_tag LOCUS_25790 11432 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 12303 11545 gene locus_tag LOCUS_25800 12303 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 12459 13706 gene locus_tag LOCUS_25810 12459 13706 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085418.1 protein_id gnl|my_center|LOCUS_25810 14688 13981 gene locus_tag LOCUS_25820 14688 13981 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_25820 14813 15457 gene locus_tag LOCUS_25830 14813 15457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 15847 15464 gene locus_tag LOCUS_25840 15847 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 16147 17301 gene locus_tag LOCUS_25850 16147 17301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 17302 22104 gene locus_tag LOCUS_25860 17302 22104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 22141 22563 gene locus_tag LOCUS_25870 22141 22563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23205 protein_id gnl|my_center|LOCUS_25870 22655 23476 gene locus_tag LOCUS_25880 gene uppP 22655 23476 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5P8 protein_id gnl|my_center|LOCUS_25880 24597 23512 gene locus_tag LOCUS_25890 24597 23512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 24734 25927 gene locus_tag LOCUS_25900 24734 25927 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809440.1 protein_id gnl|my_center|LOCUS_25900 26089 26877 gene locus_tag LOCUS_25910 26089 26877 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 protein_id gnl|my_center|LOCUS_25910 26874 28706 gene locus_tag LOCUS_25920 26874 28706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 28716 29429 gene locus_tag LOCUS_25930 28716 29429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 29414 30142 gene locus_tag LOCUS_25940 29414 30142 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706513.1 protein_id gnl|my_center|LOCUS_25940 30836 30144 gene locus_tag LOCUS_25950 gene aat 30836 30144 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC5 protein_id gnl|my_center|LOCUS_25950 >Feature sequence043 1923 1396 gene locus_tag LOCUS_25960 1923 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 3107 1920 gene locus_tag LOCUS_25970 3107 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 3803 3120 gene locus_tag LOCUS_25980 3803 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 4007 5254 gene locus_tag LOCUS_25990 gene glyA 4007 5254 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJR6 protein_id gnl|my_center|LOCUS_25990 5563 5288 gene locus_tag LOCUS_26000 5563 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 6472 7746 gene locus_tag LOCUS_26010 6472 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26010 7743 8762 gene locus_tag LOCUS_26020 7743 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 8746 9507 gene locus_tag LOCUS_26030 8746 9507 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_26030 10286 9510 gene locus_tag LOCUS_26040 10286 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 10592 11401 gene locus_tag LOCUS_26050 gene dapD 10592 11401 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_26050 11466 12299 gene locus_tag LOCUS_26060 11466 12299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 13011 12322 gene locus_tag LOCUS_26070 13011 12322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 13060 13941 gene locus_tag LOCUS_26080 gene btpA 13060 13941 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142640.1 protein_id gnl|my_center|LOCUS_26080 14510 13953 gene locus_tag LOCUS_26090 14510 13953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 14732 15895 gene locus_tag LOCUS_26100 14732 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 16300 15911 gene locus_tag LOCUS_26110 gene gcvH 16300 15911 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH47 protein_id gnl|my_center|LOCUS_26110 17421 16330 gene locus_tag LOCUS_26120 17421 16330 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_26120 18295 17432 gene locus_tag LOCUS_26130 gene folD 18295 17432 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAJ9 protein_id gnl|my_center|LOCUS_26130 19679 18393 gene locus_tag LOCUS_26140 19679 18393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 23415 19747 gene locus_tag LOCUS_26150 23415 19747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 24336 23419 gene locus_tag LOCUS_26160 24336 23419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 25314 24337 gene locus_tag LOCUS_26170 25314 24337 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_26170 25937 25311 gene locus_tag LOCUS_26180 25937 25311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 26649 26146 gene locus_tag LOCUS_26190 26649 26146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 27344 26646 gene locus_tag LOCUS_26200 27344 26646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 27615 28715 gene locus_tag LOCUS_26210 27615 28715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 31038 28609 gene locus_tag LOCUS_26220 31038 28609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence044 186 470 gene locus_tag LOCUS_26230 186 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 467 1921 gene locus_tag LOCUS_26240 467 1921 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_26240 2659 3138 gene locus_tag LOCUS_26250 2659 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 3135 4556 gene locus_tag LOCUS_26260 gene ibeB 3135 4556 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123112.1 protein_id gnl|my_center|LOCUS_26260 4553 5752 gene locus_tag LOCUS_26270 4553 5752 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_26270 5752 8946 gene locus_tag LOCUS_26280 gene czcA 5752 8946 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_26280 10472 8943 gene locus_tag LOCUS_26290 10472 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 11386 10733 gene locus_tag LOCUS_26300 11386 10733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 12714 11737 gene locus_tag LOCUS_26310 12714 11737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 12819 13484 gene locus_tag LOCUS_26320 12819 13484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 13465 13935 gene locus_tag LOCUS_26330 gene arsC 13465 13935 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880408.1 protein_id gnl|my_center|LOCUS_26330 13947 15227 gene locus_tag LOCUS_26340 gene aspB 13947 15227 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DTM1 protein_id gnl|my_center|LOCUS_26340 15276 16520 gene locus_tag LOCUS_26350 15276 16520 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230167.1 protein_id gnl|my_center|LOCUS_26350 17678 16563 gene locus_tag LOCUS_26360 17678 16563 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_26360 17799 19055 gene locus_tag LOCUS_26370 17799 19055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 19760 19104 gene locus_tag LOCUS_26380 gene gph 19760 19104 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035829.1 protein_id gnl|my_center|LOCUS_26380 20149 19757 gene locus_tag LOCUS_26390 20149 19757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 20291 20881 gene locus_tag LOCUS_26400 20291 20881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 21930 20926 gene locus_tag LOCUS_26410 21930 20926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 23493 22096 gene locus_tag LOCUS_26420 23493 22096 CDS product MucD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_26420 24969 23653 gene locus_tag LOCUS_26430 24969 23653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 <30348 25008 gene locus_tag LOCUS_26440 <30348 25008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061383.1:beta-Ig-H3/fasciclin >Feature sequence045 480 1388 gene locus_tag LOCUS_26450 gene psd 480 1388 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFM0 protein_id gnl|my_center|LOCUS_26450 1576 2229 gene locus_tag LOCUS_26460 1576 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 2216 4030 gene locus_tag LOCUS_26470 2216 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 4218 4739 gene locus_tag LOCUS_26480 4218 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 4903 6348 gene locus_tag LOCUS_26490 4903 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537795.1 protein_id gnl|my_center|LOCUS_26490 6351 7742 gene locus_tag LOCUS_26500 6351 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 7850 8458 gene locus_tag LOCUS_26510 7850 8458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 9019 8483 gene locus_tag LOCUS_26520 9019 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 9349 10227 gene locus_tag LOCUS_26530 9349 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 10412 10194 gene locus_tag LOCUS_26540 10412 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 11716 10361 gene locus_tag LOCUS_26550 11716 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 12637 13662 gene locus_tag LOCUS_26560 12637 13662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 13659 14648 gene locus_tag LOCUS_26570 gene crtB 13659 14648 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54905 protein_id gnl|my_center|LOCUS_26570 14645 16348 gene locus_tag LOCUS_26580 gene pds 14645 16348 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140869.1 protein_id gnl|my_center|LOCUS_26580 16345 17412 gene locus_tag LOCUS_26590 16345 17412 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_26590 17416 18360 gene locus_tag LOCUS_26600 17416 18360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404936.1 protein_id gnl|my_center|LOCUS_26600 18968 19762 gene locus_tag LOCUS_26610 18968 19762 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404249.1 protein_id gnl|my_center|LOCUS_26610 19759 19995 gene locus_tag LOCUS_26620 19759 19995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 21364 20786 gene locus_tag LOCUS_26630 21364 20786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 24310 21614 gene locus_tag LOCUS_26640 24310 21614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 25001 24450 gene locus_tag LOCUS_26650 25001 24450 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942967.1 protein_id gnl|my_center|LOCUS_26650 25723 26409 gene locus_tag LOCUS_26660 25723 26409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 26622 28535 gene locus_tag LOCUS_26670 26622 28535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence046 311 1585 gene locus_tag LOCUS_26680 311 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 3212 1692 gene locus_tag LOCUS_26690 3212 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 3379 4248 gene locus_tag LOCUS_26700 3379 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 5557 4217 gene locus_tag LOCUS_26710 5557 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119155.1 protein_id gnl|my_center|LOCUS_26710 7434 5554 gene locus_tag LOCUS_26720 7434 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 7908 7624 gene locus_tag LOCUS_26730 7908 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 8455 10914 gene locus_tag LOCUS_26740 8455 10914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 11182 10958 gene locus_tag LOCUS_26750 11182 10958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 11282 12187 gene locus_tag LOCUS_26760 11282 12187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 12306 13376 gene locus_tag LOCUS_26770 12306 13376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 13429 14397 gene locus_tag LOCUS_26780 13429 14397 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065126.1 protein_id gnl|my_center|LOCUS_26780 14641 14417 gene locus_tag LOCUS_26790 14641 14417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 14839 16938 gene locus_tag LOCUS_26800 14839 16938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 17143 17919 gene locus_tag LOCUS_26810 17143 17919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 19158 17980 gene locus_tag LOCUS_26820 19158 17980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 19874 19245 gene locus_tag LOCUS_26830 19874 19245 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820119.1 protein_id gnl|my_center|LOCUS_26830 19985 20716 gene locus_tag LOCUS_26840 19985 20716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 21214 20732 gene locus_tag LOCUS_26850 21214 20732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 22094 21192 gene locus_tag LOCUS_26860 22094 21192 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902327.1 protein_id gnl|my_center|LOCUS_26860 22582 22286 gene locus_tag LOCUS_26870 22582 22286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 23240 22818 gene locus_tag LOCUS_26880 23240 22818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 protein_id gnl|my_center|LOCUS_26880 24649 23282 gene locus_tag LOCUS_26890 24649 23282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 24946 25659 gene locus_tag LOCUS_26900 gene cysZ 24946 25659 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHL6 protein_id gnl|my_center|LOCUS_26900 26680 25682 gene locus_tag LOCUS_26910 26680 25682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 27072 26716 gene locus_tag LOCUS_26920 27072 26716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 27327 27118 gene locus_tag LOCUS_26930 27327 27118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 27564 27328 gene locus_tag LOCUS_26940 27564 27328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 28005 27685 gene locus_tag LOCUS_26950 28005 27685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 >Feature sequence047 1622 1131 gene locus_tag LOCUS_26960 1622 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 3826 1622 gene locus_tag LOCUS_26970 gene mrcA 3826 1622 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_26970 4240 4545 gene locus_tag LOCUS_26980 gene rpsN 4240 4545 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE8 protein_id gnl|my_center|LOCUS_26980 4821 6011 gene locus_tag LOCUS_26990 4821 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 6008 8212 gene locus_tag LOCUS_27000 6008 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 8305 9360 gene locus_tag LOCUS_27010 8305 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 9409 9798 gene locus_tag LOCUS_27020 9409 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 9791 11425 gene locus_tag LOCUS_27030 9791 11425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 11422 14481 gene locus_tag LOCUS_27040 11422 14481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 14478 14933 gene locus_tag LOCUS_27050 14478 14933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 15147 14968 gene locus_tag LOCUS_27060 15147 14968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 15078 15509 gene locus_tag LOCUS_27070 15078 15509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 15570 16016 gene locus_tag LOCUS_27080 15570 16016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 18977 16077 gene locus_tag LOCUS_27090 gene purL 18977 16077 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJT4 protein_id gnl|my_center|LOCUS_27090 20520 18988 gene locus_tag LOCUS_27100 gene purH 20520 18988 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU9 protein_id gnl|my_center|LOCUS_27100 21614 20571 gene locus_tag LOCUS_27110 gene purM 21614 20571 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUJ2 protein_id gnl|my_center|LOCUS_27110 22217 21732 gene locus_tag LOCUS_27120 gene purE 22217 21732 CDS product phosphoribosylaminoimidazole carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73PV9 protein_id gnl|my_center|LOCUS_27120 23188 22220 gene locus_tag LOCUS_27130 gene purC 23188 22220 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73PW0 protein_id gnl|my_center|LOCUS_27130 24594 23188 gene locus_tag LOCUS_27140 gene purB 24594 23188 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BJ9 protein_id gnl|my_center|LOCUS_27140 25886 24591 gene locus_tag LOCUS_27150 gene purA 25886 24591 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG43 protein_id gnl|my_center|LOCUS_27150 26716 25928 gene locus_tag LOCUS_27160 gene purQ 26716 25928 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG61 protein_id gnl|my_center|LOCUS_27160 26921 28201 gene locus_tag LOCUS_27170 gene purD 26921 28201 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VR8 protein_id gnl|my_center|LOCUS_27170 28198 28806 gene locus_tag LOCUS_27180 gene purN 28198 28806 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73LG7 protein_id gnl|my_center|LOCUS_27180 >Feature sequence048 1021 2598 gene locus_tag LOCUS_27190 1021 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 2722 3663 gene locus_tag LOCUS_27200 2722 3663 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_27200 3660 5210 gene locus_tag LOCUS_27210 3660 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 5519 7225 gene locus_tag LOCUS_27220 5519 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 7633 8793 gene locus_tag LOCUS_27230 7633 8793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 9643 8822 gene locus_tag LOCUS_27240 9643 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 9883 10155 gene locus_tag LOCUS_27250 9883 10155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 10327 12033 gene locus_tag LOCUS_27260 10327 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 12040 12873 gene locus_tag LOCUS_27270 12040 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_27270 14159 12870 gene locus_tag LOCUS_27280 14159 12870 CDS product putative metabolite transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71369 protein_id gnl|my_center|LOCUS_27280 14415 14975 gene locus_tag LOCUS_27290 14415 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 16762 14933 gene locus_tag LOCUS_27300 16762 14933 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250525.1 protein_id gnl|my_center|LOCUS_27300 16810 17580 gene locus_tag LOCUS_27310 16810 17580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 17721 18287 gene locus_tag LOCUS_27320 17721 18287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 21241 18356 gene locus_tag LOCUS_27330 21241 18356 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_27330 21483 24902 gene locus_tag LOCUS_27340 21483 24902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 25639 24908 gene locus_tag LOCUS_27350 25639 24908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 26577 25732 gene locus_tag LOCUS_27360 26577 25732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence049 3095 537 gene locus_tag LOCUS_27370 3095 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 5179 3458 gene locus_tag LOCUS_27380 5179 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 6573 5527 gene locus_tag LOCUS_27390 6573 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 6948 7772 gene locus_tag LOCUS_27400 6948 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 8561 7821 gene locus_tag LOCUS_27410 8561 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 9881 8643 gene locus_tag LOCUS_27420 9881 8643 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_27420 10079 10621 gene locus_tag LOCUS_27430 10079 10621 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224228.1 protein_id gnl|my_center|LOCUS_27430 10716 11621 gene locus_tag LOCUS_27440 gene dhmA 10716 11621 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3S9 protein_id gnl|my_center|LOCUS_27440 12696 11749 gene locus_tag LOCUS_27450 12696 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 13863 12973 gene locus_tag LOCUS_27460 13863 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 15499 14234 gene locus_tag LOCUS_27470 15499 14234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 16830 15856 gene locus_tag LOCUS_27480 16830 15856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 17927 17049 gene locus_tag LOCUS_27490 17927 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 18155 19861 gene locus_tag LOCUS_27500 18155 19861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 21446 19878 gene locus_tag LOCUS_27510 21446 19878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 23308 21743 gene locus_tag LOCUS_27520 23308 21743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 23586 24146 gene locus_tag LOCUS_27530 23586 24146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 26632 24347 gene locus_tag LOCUS_27540 26632 24347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence050 3577 251 gene locus_tag LOCUS_27550 3577 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 5653 3959 gene locus_tag LOCUS_27560 5653 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125671.1 protein_id gnl|my_center|LOCUS_27560 6712 6371 gene locus_tag LOCUS_27570 6712 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 10472 7050 gene locus_tag LOCUS_27580 10472 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 11208 10708 gene locus_tag LOCUS_27590 11208 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 11948 14278 gene locus_tag LOCUS_27600 11948 14278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 15016 15483 gene locus_tag LOCUS_27610 15016 15483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 16928 16038 gene locus_tag LOCUS_27620 16928 16038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 17540 17178 gene locus_tag LOCUS_27630 17540 17178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 17733 18644 gene locus_tag LOCUS_27640 17733 18644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 19029 20267 gene locus_tag LOCUS_27650 19029 20267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 21505 20330 gene locus_tag LOCUS_27660 21505 20330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 21832 26391 gene locus_tag LOCUS_27670 21832 26391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 27124 26915 gene locus_tag LOCUS_27680 27124 26915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence051 493 2235 gene locus_tag LOCUS_27690 493 2235 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726H6 protein_id gnl|my_center|LOCUS_27690 2284 2784 gene locus_tag LOCUS_27700 2284 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 3628 2867 gene locus_tag LOCUS_27710 3628 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 4635 3805 gene locus_tag LOCUS_27720 gene kdsA 4635 3805 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ9 protein_id gnl|my_center|LOCUS_27720 5366 4632 gene locus_tag LOCUS_27730 gene kdsB 5366 4632 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9Y9 protein_id gnl|my_center|LOCUS_27730 5634 5389 gene locus_tag LOCUS_27740 5634 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 6240 5644 gene locus_tag LOCUS_27750 6240 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 7468 6293 gene locus_tag LOCUS_27760 7468 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 8060 7485 gene locus_tag LOCUS_27770 gene coxC 8060 7485 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940895.1 protein_id gnl|my_center|LOCUS_27770 9824 8076 gene locus_tag LOCUS_27780 gene ctaD 9824 8076 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_27780 10625 9825 gene locus_tag LOCUS_27790 gene coxM 10625 9825 CDS product alternative cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P98053 protein_id gnl|my_center|LOCUS_27790 11487 10759 gene locus_tag LOCUS_27800 11487 10759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 12127 11663 gene locus_tag LOCUS_27810 12127 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 13420 12416 gene locus_tag LOCUS_27820 gene cdh 13420 12416 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035475.1 protein_id gnl|my_center|LOCUS_27820 15069 13417 gene locus_tag LOCUS_27830 15069 13417 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635613.2 protein_id gnl|my_center|LOCUS_27830 15848 15066 gene locus_tag LOCUS_27840 gene oleB 15848 15066 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_27840 16957 15941 gene locus_tag LOCUS_27850 gene fabH 16957 15941 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035468.1 protein_id gnl|my_center|LOCUS_27850 17164 18228 gene locus_tag LOCUS_27860 17164 18228 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057211.1 protein_id gnl|my_center|LOCUS_27860 19637 18225 gene locus_tag LOCUS_27870 19637 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence052 2 1549 gene locus_tag LOCUS_27880 2 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 2219 4918 gene locus_tag LOCUS_27890 2219 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 4918 9522 gene locus_tag LOCUS_27900 4918 9522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 10786 9557 gene locus_tag LOCUS_27910 10786 9557 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_27910 13123 11051 gene locus_tag LOCUS_27920 13123 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 13320 13090 gene locus_tag LOCUS_27930 13320 13090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 13538 13738 gene locus_tag LOCUS_27940 13538 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 15547 13751 gene locus_tag LOCUS_27950 15547 13751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 17221 15767 gene locus_tag LOCUS_27960 gene cyaA4 17221 15767 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946864.1 protein_id gnl|my_center|LOCUS_27960 18005 18424 gene locus_tag LOCUS_27970 18005 18424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 20018 21313 gene locus_tag LOCUS_27980 20018 21313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 21460 22545 gene locus_tag LOCUS_27990 21460 22545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 22902 23894 gene locus_tag LOCUS_28000 22902 23894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 25197 23935 gene locus_tag LOCUS_28010 25197 23935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 >Feature sequence053 132 467 gene locus_tag LOCUS_28020 132 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 997 464 gene locus_tag LOCUS_28030 997 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 1491 1051 gene locus_tag LOCUS_28040 1491 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 1594 1842 gene locus_tag LOCUS_28050 1594 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 2096 1929 gene locus_tag LOCUS_28060 2096 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 3390 2569 gene locus_tag LOCUS_28070 3390 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 4277 3387 gene locus_tag LOCUS_28080 4277 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 5049 4291 gene locus_tag LOCUS_28090 5049 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123408.1 protein_id gnl|my_center|LOCUS_28090 8514 5053 gene locus_tag LOCUS_28100 8514 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 12483 8527 gene locus_tag LOCUS_28110 12483 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 12802 14208 gene locus_tag LOCUS_28120 12802 14208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 14212 15786 gene locus_tag LOCUS_28130 14212 15786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 15783 16541 gene locus_tag LOCUS_28140 15783 16541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 16552 17967 gene locus_tag LOCUS_28150 16552 17967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 18056 20080 gene locus_tag LOCUS_28160 18056 20080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 22035 20137 gene locus_tag LOCUS_28170 22035 20137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 24514 22334 gene locus_tag LOCUS_28180 24514 22334 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084346.1 protein_id gnl|my_center|LOCUS_28180 24980 24504 gene locus_tag LOCUS_28190 24980 24504 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072948.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence054 2664 1315 gene locus_tag LOCUS_28200 gene fliC 2664 1315 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72151 protein_id gnl|my_center|LOCUS_28200 3892 3005 gene locus_tag LOCUS_28210 3892 3005 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257278.1 protein_id gnl|my_center|LOCUS_28210 4747 3896 gene locus_tag LOCUS_28220 4747 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 5679 4897 gene locus_tag LOCUS_28230 5679 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 6612 5725 gene locus_tag LOCUS_28240 6612 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 9395 6759 gene locus_tag LOCUS_28250 9395 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 9631 9368 gene locus_tag LOCUS_28260 9631 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 11794 9887 gene locus_tag LOCUS_28270 11794 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 13001 12168 gene locus_tag LOCUS_28280 13001 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 13161 13640 gene locus_tag LOCUS_28290 13161 13640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 13651 14652 gene locus_tag LOCUS_28300 gene holA 13651 14652 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687654.1 protein_id gnl|my_center|LOCUS_28300 14983 14714 gene locus_tag LOCUS_28310 gene rpsT 14983 14714 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDA3 protein_id gnl|my_center|LOCUS_28310 16621 15131 gene locus_tag LOCUS_28320 16621 15131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 16953 17579 gene locus_tag LOCUS_28330 16953 17579 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_28330 17661 17948 gene locus_tag LOCUS_28340 gene eutK 17661 17948 CDS product carboxysome shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423991.1 protein_id gnl|my_center|LOCUS_28340 17959 18255 gene locus_tag LOCUS_28350 gene ccmL 17959 18255 CDS product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_28350 18284 19690 gene locus_tag LOCUS_28360 18284 19690 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 protein_id gnl|my_center|LOCUS_28360 19740 20297 gene locus_tag LOCUS_28370 19740 20297 CDS product propanediol utilization: polyhedral bodies pduT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815271.1 protein_id gnl|my_center|LOCUS_28370 21141 20317 gene locus_tag LOCUS_28380 21141 20317 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405305.1 protein_id gnl|my_center|LOCUS_28380 21912 21145 gene locus_tag LOCUS_28390 gene pomB 21912 21145 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937942.1 protein_id gnl|my_center|LOCUS_28390 22700 21933 gene locus_tag LOCUS_28400 gene motA-1 22700 21933 CDS product chemotaxis protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_28400 24172 22946 gene locus_tag LOCUS_28410 24172 22946 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE7 protein_id gnl|my_center|LOCUS_28410 >Feature sequence055 5763 5584 gene locus_tag LOCUS_28420 5763 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 6072 7724 gene locus_tag LOCUS_28430 6072 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 9706 7808 gene locus_tag LOCUS_28440 9706 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 9938 10861 gene locus_tag LOCUS_28450 9938 10861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 10858 11619 gene locus_tag LOCUS_28460 10858 11619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 11793 13001 gene locus_tag LOCUS_28470 11793 13001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 13317 15560 gene locus_tag LOCUS_28480 13317 15560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 15763 17166 gene locus_tag LOCUS_28490 15763 17166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 18125 17490 gene locus_tag LOCUS_28500 18125 17490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 19890 18301 gene locus_tag LOCUS_28510 19890 18301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 20056 21711 gene locus_tag LOCUS_28520 20056 21711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 21756 23168 gene locus_tag LOCUS_28530 21756 23168 CDS product alginate regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_28530 >Feature sequence056 2858 243 gene locus_tag LOCUS_28540 gene clpB 2858 243 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF1 protein_id gnl|my_center|LOCUS_28540 3022 3684 gene locus_tag LOCUS_28550 gene msrA 3022 3684 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6C7 protein_id gnl|my_center|LOCUS_28550 4226 3702 gene locus_tag LOCUS_28560 4226 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 4332 5186 gene locus_tag LOCUS_28570 4332 5186 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_28570 7261 5183 gene locus_tag LOCUS_28580 gene ptrB 7261 5183 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_28580 8144 7533 gene locus_tag LOCUS_28590 8144 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 9151 8141 gene locus_tag LOCUS_28600 9151 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 9258 11390 gene locus_tag LOCUS_28610 9258 11390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 11384 11929 gene locus_tag LOCUS_28620 11384 11929 CDS product methyltransferase small inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_28620 11942 12427 gene locus_tag LOCUS_28630 gene coaD 11942 12427 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BV2 protein_id gnl|my_center|LOCUS_28630 12525 13070 gene locus_tag LOCUS_28640 12525 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 13067 14710 gene locus_tag LOCUS_28650 13067 14710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 15867 14725 gene locus_tag LOCUS_28660 15867 14725 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889105.1 protein_id gnl|my_center|LOCUS_28660 18236 15870 gene locus_tag LOCUS_28670 18236 15870 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272544.1 protein_id gnl|my_center|LOCUS_28670 18316 19956 gene locus_tag LOCUS_28680 18316 19956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 20270 20455 gene locus_tag LOCUS_28690 20270 20455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 20681 21229 gene locus_tag LOCUS_28700 20681 21229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 21242 21952 gene locus_tag LOCUS_28710 21242 21952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence057 2236 407 gene locus_tag LOCUS_28720 2236 407 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904125.1 protein_id gnl|my_center|LOCUS_28720 2680 3081 gene locus_tag LOCUS_28730 2680 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 protein_id gnl|my_center|LOCUS_28730 3243 3860 gene locus_tag LOCUS_28740 3243 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 4499 3870 gene locus_tag LOCUS_28750 4499 3870 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105355.1 protein_id gnl|my_center|LOCUS_28750 5987 4521 gene locus_tag LOCUS_28760 5987 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 7393 5984 gene locus_tag LOCUS_28770 7393 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 8690 7623 gene locus_tag LOCUS_28780 gene ccpR 8690 7623 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538117.1 protein_id gnl|my_center|LOCUS_28780 9324 8716 gene locus_tag LOCUS_28790 9324 8716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 9562 10416 gene locus_tag LOCUS_28800 9562 10416 CDS product metallo-mystery pair system four-Cys motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538118.1 protein_id gnl|my_center|LOCUS_28800 10530 11612 gene locus_tag LOCUS_28810 gene mauG 10530 11612 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_28810 11609 11851 gene locus_tag LOCUS_28820 11609 11851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 11940 12764 gene locus_tag LOCUS_28830 11940 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 14474 12768 gene locus_tag LOCUS_28840 14474 12768 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120974.1 protein_id gnl|my_center|LOCUS_28840 14617 16785 gene locus_tag LOCUS_28850 14617 16785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 16935 17633 gene locus_tag LOCUS_28860 gene aqpZ 16935 17633 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHU2 protein_id gnl|my_center|LOCUS_28860 17968 17663 gene locus_tag LOCUS_28870 17968 17663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 18176 18940 gene locus_tag LOCUS_28880 18176 18940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 19635 19075 gene locus_tag LOCUS_28890 19635 19075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 20832 20002 gene locus_tag LOCUS_28900 20832 20002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 22117 20987 gene locus_tag LOCUS_28910 22117 20987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence058 463 1353 gene locus_tag LOCUS_28920 463 1353 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268943.1 protein_id gnl|my_center|LOCUS_28920 2718 1342 gene locus_tag LOCUS_28930 2718 1342 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804864.1 protein_id gnl|my_center|LOCUS_28930 4276 2762 gene locus_tag LOCUS_28940 4276 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 6017 4515 gene locus_tag LOCUS_28950 6017 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 6904 6122 gene locus_tag LOCUS_28960 6904 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 7106 7630 gene locus_tag LOCUS_28970 7106 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 7801 11319 gene locus_tag LOCUS_28980 7801 11319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 11376 12359 gene locus_tag LOCUS_28990 11376 12359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 12429 14885 gene locus_tag LOCUS_29000 12429 14885 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_29000 14982 15734 gene locus_tag LOCUS_29010 14982 15734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 16528 15731 gene locus_tag LOCUS_29020 16528 15731 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104598.1 protein_id gnl|my_center|LOCUS_29020 18321 16528 gene locus_tag LOCUS_29030 18321 16528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 21578 18363 gene locus_tag LOCUS_29040 21578 18363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 21938 21735 gene locus_tag LOCUS_29050 21938 21735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence059 5361 6992 gene locus_tag LOCUS_29060 5361 6992 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_29060 7040 8743 gene locus_tag LOCUS_29070 7040 8743 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_29070 9692 8787 gene locus_tag LOCUS_29080 9692 8787 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_29080 10581 9811 gene locus_tag LOCUS_29090 gene mvrA 10581 9811 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971635.1 protein_id gnl|my_center|LOCUS_29090 11742 10783 gene locus_tag LOCUS_29100 gene petH 11742 10783 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125275.1 protein_id gnl|my_center|LOCUS_29100 12152 13285 gene locus_tag LOCUS_29110 12152 13285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 14098 13565 gene locus_tag LOCUS_29120 14098 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 15135 14452 gene locus_tag LOCUS_29130 15135 14452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 15537 16166 gene locus_tag LOCUS_29140 15537 16166 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_29140 17119 16304 gene locus_tag LOCUS_29150 17119 16304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 17331 17101 gene locus_tag LOCUS_29160 17331 17101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 18662 17478 gene locus_tag LOCUS_29170 18662 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 19096 19872 gene locus_tag LOCUS_29180 19096 19872 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_29180 19911 21515 gene locus_tag LOCUS_29190 19911 21515 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_29190 >Feature sequence060 8554 281 gene locus_tag LOCUS_29200 8554 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 9806 8883 gene locus_tag LOCUS_29210 9806 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 11361 9838 gene locus_tag LOCUS_29220 11361 9838 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_29220 12288 11362 gene locus_tag LOCUS_29230 gene hemC 12288 11362 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EP73 protein_id gnl|my_center|LOCUS_29230 13559 12288 gene locus_tag LOCUS_29240 gene hemA 13559 12288 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72C23 protein_id gnl|my_center|LOCUS_29240 14337 13561 gene locus_tag LOCUS_29250 14337 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 14833 14504 gene locus_tag LOCUS_29260 14833 14504 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKP7 protein_id gnl|my_center|LOCUS_29260 15959 14856 gene locus_tag LOCUS_29270 gene rodA 15959 14856 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_29270 17953 15956 gene locus_tag LOCUS_29280 gene mrdA 17953 15956 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_29280 18636 18136 gene locus_tag LOCUS_29290 18636 18136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 19496 18633 gene locus_tag LOCUS_29300 19496 18633 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL21 protein_id gnl|my_center|LOCUS_29300 20533 19496 gene locus_tag LOCUS_29310 gene mreB-1 20533 19496 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_29310 >Feature sequence061 1040 2407 gene locus_tag LOCUS_29320 gene pepC 1040 2407 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714165.1 protein_id gnl|my_center|LOCUS_29320 5363 2472 gene locus_tag LOCUS_29330 5363 2472 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938263.1 protein_id gnl|my_center|LOCUS_29330 6313 5486 gene locus_tag LOCUS_29340 6313 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 6916 7899 gene locus_tag LOCUS_29350 6916 7899 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706476.1 protein_id gnl|my_center|LOCUS_29350 7911 8555 gene locus_tag LOCUS_29360 gene maiA 7911 8555 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071821.1 protein_id gnl|my_center|LOCUS_29360 9016 8552 gene locus_tag LOCUS_29370 9016 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 9103 10185 gene locus_tag LOCUS_29380 9103 10185 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010438666.1 protein_id gnl|my_center|LOCUS_29380 10198 10725 gene locus_tag LOCUS_29390 10198 10725 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 protein_id gnl|my_center|LOCUS_29390 11342 10782 gene locus_tag LOCUS_29400 11342 10782 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQ60 protein_id gnl|my_center|LOCUS_29400 12847 11468 gene locus_tag LOCUS_29410 gene kamA 12847 11468 CDS product L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX4 protein_id gnl|my_center|LOCUS_29410 13268 14143 gene locus_tag LOCUS_29420 13268 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 15047 14205 gene locus_tag LOCUS_29430 15047 14205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 16654 15200 gene locus_tag LOCUS_29440 16654 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 16892 17926 gene locus_tag LOCUS_29450 16892 17926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 18688 18251 gene locus_tag LOCUS_29460 18688 18251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 <20812 19465 gene locus_tag LOCUS_29470 <20812 19465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120368.1:N-acetylgalactosamine-6-sulfatase >Feature sequence062 13853 12240 gene locus_tag LOCUS_29480 13853 12240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 15379 13853 gene locus_tag LOCUS_29490 15379 13853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 15534 17057 gene locus_tag LOCUS_29500 15534 17057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 17062 17766 gene locus_tag LOCUS_29510 17062 17766 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123085.1 protein_id gnl|my_center|LOCUS_29510 17888 19501 gene locus_tag LOCUS_29520 17888 19501 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 protein_id gnl|my_center|LOCUS_29520 >Feature sequence063 2255 3199 gene locus_tag LOCUS_29530 2255 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 3228 6572 gene locus_tag LOCUS_29540 3228 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 6911 6567 gene locus_tag LOCUS_29550 6911 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 7275 9719 gene locus_tag LOCUS_29560 7275 9719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 11670 9763 gene locus_tag LOCUS_29570 11670 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 12959 11895 gene locus_tag LOCUS_29580 12959 11895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 12988 14409 gene locus_tag LOCUS_29590 12988 14409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 14434 15111 gene locus_tag LOCUS_29600 14434 15111 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001900033.1 protein_id gnl|my_center|LOCUS_29600 15314 16366 gene locus_tag LOCUS_29610 15314 16366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 16450 18963 gene locus_tag LOCUS_29620 16450 18963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 >Feature sequence064 497 1426 gene locus_tag LOCUS_29630 497 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 2881 1580 gene locus_tag LOCUS_29640 2881 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 3531 3118 gene locus_tag LOCUS_29650 3531 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 4591 3623 gene locus_tag LOCUS_29660 4591 3623 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405050.1 protein_id gnl|my_center|LOCUS_29660 5470 4739 gene locus_tag LOCUS_29670 5470 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 6690 5557 gene locus_tag LOCUS_29680 6690 5557 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973447.1 protein_id gnl|my_center|LOCUS_29680 6893 6687 gene locus_tag LOCUS_29690 6893 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 7041 7826 gene locus_tag LOCUS_29700 7041 7826 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_29700 7831 9081 gene locus_tag LOCUS_29710 7831 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 9098 11437 gene locus_tag LOCUS_29720 9098 11437 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_29720 13156 11474 gene locus_tag LOCUS_29730 13156 11474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 13416 14030 gene locus_tag LOCUS_29740 13416 14030 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921310.1 protein_id gnl|my_center|LOCUS_29740 15364 14078 gene locus_tag LOCUS_29750 15364 14078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 16628 15681 gene locus_tag LOCUS_29760 16628 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 16693 16956 gene locus_tag LOCUS_29770 16693 16956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 18877 17054 gene locus_tag LOCUS_29780 18877 17054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 19160 19528 gene locus_tag LOCUS_29790 19160 19528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence065 323 1672 gene locus_tag LOCUS_29800 323 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 1844 2101 gene locus_tag LOCUS_29810 gene rpsP 1844 2101 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WU95 protein_id gnl|my_center|LOCUS_29810 2103 2345 gene locus_tag LOCUS_29820 2103 2345 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DU1 protein_id gnl|my_center|LOCUS_29820 2351 2866 gene locus_tag LOCUS_29830 gene rimM 2351 2866 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZK8 protein_id gnl|my_center|LOCUS_29830 2871 3608 gene locus_tag LOCUS_29840 gene trmD 2871 3608 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73PB5 protein_id gnl|my_center|LOCUS_29840 3610 3957 gene locus_tag LOCUS_29850 gene rplS 3610 3957 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I93 protein_id gnl|my_center|LOCUS_29850 4129 4803 gene locus_tag LOCUS_29860 gene rnhB 4129 4803 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_29860 4790 5164 gene locus_tag LOCUS_29870 4790 5164 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF9 protein_id gnl|my_center|LOCUS_29870 5254 5676 gene locus_tag LOCUS_29880 5254 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 5951 7525 gene locus_tag LOCUS_29890 5951 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 7522 10770 gene locus_tag LOCUS_29900 7522 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 10767 11996 gene locus_tag LOCUS_29910 10767 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 12115 12390 gene locus_tag LOCUS_29920 12115 12390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 12426 14210 gene locus_tag LOCUS_29930 12426 14210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 14299 15165 gene locus_tag LOCUS_29940 14299 15165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941827.1 protein_id gnl|my_center|LOCUS_29940 >Feature sequence066 9 381 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccagccggcccttgctcacctt 1058 1942 gene locus_tag LOCUS_29950 1058 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 2185 2997 gene locus_tag LOCUS_29960 gene zupT 2185 2997 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z6 protein_id gnl|my_center|LOCUS_29960 3193 3942 gene locus_tag LOCUS_29970 gene gpmA 3193 3942 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7A1 protein_id gnl|my_center|LOCUS_29970 4694 4299 gene locus_tag LOCUS_29980 4694 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 5408 4941 gene locus_tag LOCUS_29990 5408 4941 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_29990 7197 5695 gene locus_tag LOCUS_30000 7197 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 8342 7197 gene locus_tag LOCUS_30010 8342 7197 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143702.1 protein_id gnl|my_center|LOCUS_30010 9195 8413 gene locus_tag LOCUS_30020 9195 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750466.1 protein_id gnl|my_center|LOCUS_30020 9255 10400 gene locus_tag LOCUS_30030 9255 10400 CDS product teichoic acid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876004.1 protein_id gnl|my_center|LOCUS_30030 11371 10490 gene locus_tag LOCUS_30040 11371 10490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_30040 11757 11371 gene locus_tag LOCUS_30050 11757 11371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 12041 12190 gene locus_tag LOCUS_30060 12041 12190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 12361 14340 gene locus_tag LOCUS_30070 12361 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 14897 14382 gene locus_tag LOCUS_30080 14897 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 15280 15065 gene locus_tag LOCUS_30090 15280 15065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 15310 17184 gene locus_tag LOCUS_30100 15310 17184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence067 2426 1389 gene locus_tag LOCUS_30110 2426 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 2532 4697 gene locus_tag LOCUS_30120 2532 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 4892 5644 gene locus_tag LOCUS_30130 4892 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 5831 9547 gene locus_tag LOCUS_30140 5831 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 9779 11410 gene locus_tag LOCUS_30150 9779 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 11598 12275 gene locus_tag LOCUS_30160 11598 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 12526 13722 gene locus_tag LOCUS_30170 12526 13722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 14002 18453 gene locus_tag LOCUS_30180 14002 18453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 >Feature sequence068 1399 1064 gene locus_tag LOCUS_30190 1399 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 2788 1511 gene locus_tag LOCUS_30200 2788 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 3179 4585 gene locus_tag LOCUS_30210 3179 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 6763 4679 gene locus_tag LOCUS_30220 6763 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 6946 7830 gene locus_tag LOCUS_30230 6946 7830 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039691.1 protein_id gnl|my_center|LOCUS_30230 9515 7854 gene locus_tag LOCUS_30240 9515 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 9675 10055 gene locus_tag LOCUS_30250 9675 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 10557 14033 gene locus_tag LOCUS_30260 10557 14033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 14210 14043 gene locus_tag LOCUS_30270 14210 14043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 14387 15691 gene locus_tag LOCUS_30280 14387 15691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 15718 16617 gene locus_tag LOCUS_30290 15718 16617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 >Feature sequence069 27 1397 gene locus_tag LOCUS_30300 27 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 3378 1540 gene locus_tag LOCUS_30310 3378 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 3894 3643 gene locus_tag LOCUS_30320 3894 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 5373 4048 gene locus_tag LOCUS_30330 5373 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 8711 5370 gene locus_tag LOCUS_30340 8711 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 10648 8708 gene locus_tag LOCUS_30350 10648 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 11451 10660 gene locus_tag LOCUS_30360 11451 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 12816 11521 gene locus_tag LOCUS_30370 12816 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 13167 15335 gene locus_tag LOCUS_30380 13167 15335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 15466 17514 gene locus_tag LOCUS_30390 15466 17514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 >Feature sequence070 588 247 gene locus_tag LOCUS_30400 588 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 832 2508 gene locus_tag LOCUS_30410 832 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 5090 2505 gene locus_tag LOCUS_30420 5090 2505 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_30420 5257 5583 gene locus_tag LOCUS_30430 5257 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 6382 5753 gene locus_tag LOCUS_30440 6382 5753 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_30440 7090 6386 gene locus_tag LOCUS_30450 gene atoD 7090 6386 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_30450 8406 7087 gene locus_tag LOCUS_30460 8406 7087 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 protein_id gnl|my_center|LOCUS_30460 9931 8459 gene locus_tag LOCUS_30470 gene astD1 9931 8459 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAL5 protein_id gnl|my_center|LOCUS_30470 10857 9949 gene locus_tag LOCUS_30480 10857 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 12083 10878 gene locus_tag LOCUS_30490 12083 10878 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911762.1 protein_id gnl|my_center|LOCUS_30490 12242 12700 gene locus_tag LOCUS_30500 12242 12700 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_30500 13319 12687 gene locus_tag LOCUS_30510 13319 12687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 13951 13316 gene locus_tag LOCUS_30520 gene udk 13951 13316 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S561 protein_id gnl|my_center|LOCUS_30520 14112 16736 gene locus_tag LOCUS_30530 14112 16736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 18091 16733 gene locus_tag LOCUS_30540 18091 16733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence071 5952 4888 gene locus_tag LOCUS_30550 5952 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 8881 6224 gene locus_tag LOCUS_30560 8881 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 9052 10185 gene locus_tag LOCUS_30570 9052 10185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 10313 11239 gene locus_tag LOCUS_30580 10313 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 12776 14107 gene locus_tag LOCUS_30590 12776 14107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 14438 16015 gene locus_tag LOCUS_30600 14438 16015 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142253.1 protein_id gnl|my_center|LOCUS_30600 >Feature sequence072 502 2115 gene locus_tag LOCUS_30610 502 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 2202 3338 gene locus_tag LOCUS_30620 2202 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 4450 3464 gene locus_tag LOCUS_30630 4450 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 4747 8241 gene locus_tag LOCUS_30640 4747 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 8506 9459 gene locus_tag LOCUS_30650 8506 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 9598 10137 gene locus_tag LOCUS_30660 9598 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 11299 10211 gene locus_tag LOCUS_30670 11299 10211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 11704 12201 gene locus_tag LOCUS_30680 11704 12201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 12409 13341 gene locus_tag LOCUS_30690 12409 13341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 13768 14286 gene locus_tag LOCUS_30700 13768 14286 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914074.1 protein_id gnl|my_center|LOCUS_30700 14283 15044 gene locus_tag LOCUS_30710 14283 15044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 15041 16582 gene locus_tag LOCUS_30720 15041 16582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 >Feature sequence073 301 582 gene locus_tag LOCUS_30730 301 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 572 2620 gene locus_tag LOCUS_30740 gene ftsI 572 2620 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_30740 2617 4122 gene locus_tag LOCUS_30750 gene murE 2617 4122 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D2 protein_id gnl|my_center|LOCUS_30750 4116 5513 gene locus_tag LOCUS_30760 gene murF 4116 5513 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F27 protein_id gnl|my_center|LOCUS_30760 5518 6657 gene locus_tag LOCUS_30770 gene mraY 5518 6657 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D3 protein_id gnl|my_center|LOCUS_30770 6661 7890 gene locus_tag LOCUS_30780 6661 7890 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_30780 7887 9017 gene locus_tag LOCUS_30790 gene murG 7887 9017 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D6 protein_id gnl|my_center|LOCUS_30790 9014 9949 gene locus_tag LOCUS_30800 gene ddl 9014 9949 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFT1 protein_id gnl|my_center|LOCUS_30800 9942 10808 gene locus_tag LOCUS_30810 9942 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 10808 12034 gene locus_tag LOCUS_30820 gene ftsA 10808 12034 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728V2 protein_id gnl|my_center|LOCUS_30820 12191 13870 gene locus_tag LOCUS_30830 12191 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 14024 14710 gene locus_tag LOCUS_30840 14024 14710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 16144 14741 gene locus_tag LOCUS_30850 gene argH 16144 14741 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 protein_id gnl|my_center|LOCUS_30850 >Feature sequence074 4375 2342 gene locus_tag LOCUS_30860 4375 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 6678 4372 gene locus_tag LOCUS_30870 6678 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 7565 6891 gene locus_tag LOCUS_30880 7565 6891 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392346.1 protein_id gnl|my_center|LOCUS_30880 8199 7993 gene locus_tag LOCUS_30890 8199 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 8563 9324 gene locus_tag LOCUS_30900 gene grpE 8563 9324 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KMX5 protein_id gnl|my_center|LOCUS_30900 9464 10690 gene locus_tag LOCUS_30910 gene tyrS 9464 10690 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I748 protein_id gnl|my_center|LOCUS_30910 10950 11330 gene locus_tag LOCUS_30920 10950 11330 CDS product DOPA 4,5-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738577.1 protein_id gnl|my_center|LOCUS_30920 11652 11314 gene locus_tag LOCUS_30930 11652 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 12681 12256 gene locus_tag LOCUS_30940 gene acpS 12681 12256 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C71 protein_id gnl|my_center|LOCUS_30940 <16841 12678 gene locus_tag LOCUS_30950 <16841 12678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390269.1:type I polyketide synthase >Feature sequence075 804 532 gene locus_tag LOCUS_30960 804 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 1398 886 gene locus_tag LOCUS_30970 1398 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 1477 2970 gene locus_tag LOCUS_30980 1477 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 3158 5299 gene locus_tag LOCUS_30990 3158 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 6292 5345 gene locus_tag LOCUS_31000 6292 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 7620 6289 gene locus_tag LOCUS_31010 7620 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 protein_id gnl|my_center|LOCUS_31010 9233 7620 gene locus_tag LOCUS_31020 9233 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 9193 9405 gene locus_tag LOCUS_31030 9193 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 10262 9690 gene locus_tag LOCUS_31040 10262 9690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 10543 10917 gene locus_tag LOCUS_31050 10543 10917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 11532 11038 gene locus_tag LOCUS_31060 11532 11038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 13146 11551 gene locus_tag LOCUS_31070 gene crtU 13146 11551 CDS product isorenieratene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225919.1 protein_id gnl|my_center|LOCUS_31070 13548 14192 gene locus_tag LOCUS_31080 13548 14192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 14412 15419 gene locus_tag LOCUS_31090 14412 15419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483742.1 protein_id gnl|my_center|LOCUS_31090 >Feature sequence076 2747 753 gene locus_tag LOCUS_31100 2747 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 2878 3351 gene locus_tag LOCUS_31110 2878 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 5700 3373 gene locus_tag LOCUS_31120 5700 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 7246 6077 gene locus_tag LOCUS_31130 7246 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 8525 7803 gene locus_tag LOCUS_31140 gene plsC 8525 7803 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW5 protein_id gnl|my_center|LOCUS_31140 8743 10425 gene locus_tag LOCUS_31150 8743 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 12264 10459 gene locus_tag LOCUS_31160 gene murE 12264 10459 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_31160 13679 12261 gene locus_tag LOCUS_31170 13679 12261 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_31170 >Feature sequence077 1906 2139 gene locus_tag LOCUS_31180 1906 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 2559 3134 gene locus_tag LOCUS_31190 2559 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3259 3957 gene locus_tag LOCUS_31200 3259 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 4655 4005 gene locus_tag LOCUS_31210 4655 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 4786 4867 gene locus_tag LOCUS_t00300 4786 4867 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6712 4949 gene locus_tag LOCUS_31220 6712 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 7702 6719 gene locus_tag LOCUS_31230 7702 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 8426 7818 gene locus_tag LOCUS_31240 8426 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 10246 8930 gene locus_tag LOCUS_31250 10246 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 12945 10243 gene locus_tag LOCUS_31260 12945 10243 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118284.1 protein_id gnl|my_center|LOCUS_31260 13682 12942 gene locus_tag LOCUS_31270 13682 12942 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_31270 13954 14697 gene locus_tag LOCUS_31280 13954 14697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 <16468 14721 gene locus_tag LOCUS_31290 <16468 14721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 >Feature sequence078 3641 2589 gene locus_tag LOCUS_31300 3641 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 5144 3876 gene locus_tag LOCUS_31310 gene clpX 5144 3876 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C83 protein_id gnl|my_center|LOCUS_31310 6337 5192 gene locus_tag LOCUS_31320 6337 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 6794 6507 gene locus_tag LOCUS_31330 gene ihfB 6794 6507 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ94 protein_id gnl|my_center|LOCUS_31330 8618 6849 gene locus_tag LOCUS_31340 gene rpsA 8618 6849 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_31340 8931 8857 gene locus_tag LOCUS_t00310 8931 8857 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10640 9060 gene locus_tag LOCUS_31350 gene nadB 10640 9060 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C48 protein_id gnl|my_center|LOCUS_31350 11273 10644 gene locus_tag LOCUS_31360 gene pgsA 11273 10644 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_31360 12001 11270 gene locus_tag LOCUS_31370 12001 11270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 12210 12136 gene locus_tag LOCUS_t00320 12210 12136 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13053 12262 gene locus_tag LOCUS_31380 13053 12262 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_31380 13334 13068 gene locus_tag LOCUS_31390 13334 13068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 13612 13334 gene locus_tag LOCUS_31400 13612 13334 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016131.1 protein_id gnl|my_center|LOCUS_31400 >Feature sequence079 493 287 gene locus_tag LOCUS_31410 493 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 646 515 gene locus_tag LOCUS_31420 646 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 826 659 gene locus_tag LOCUS_31430 826 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 1186 830 gene locus_tag LOCUS_31440 1186 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 1549 1187 gene locus_tag LOCUS_31450 1549 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 1720 1550 gene locus_tag LOCUS_31460 1720 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 2149 1739 gene locus_tag LOCUS_31470 2149 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 3276 2935 gene locus_tag LOCUS_31480 3276 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 3565 3374 gene locus_tag LOCUS_31490 3565 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31490 3906 5627 gene locus_tag LOCUS_31500 3906 5627 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_31500 5990 8350 gene locus_tag LOCUS_31510 5990 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 8347 9675 gene locus_tag LOCUS_31520 8347 9675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 11058 9955 gene locus_tag LOCUS_31530 11058 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388654.1 protein_id gnl|my_center|LOCUS_31530 11809 11051 gene locus_tag LOCUS_31540 11809 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888845.1 protein_id gnl|my_center|LOCUS_31540 13011 11965 gene locus_tag LOCUS_31550 13011 11965 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266638.1 protein_id gnl|my_center|LOCUS_31550 13961 13008 gene locus_tag LOCUS_31560 13961 13008 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388653.1 protein_id gnl|my_center|LOCUS_31560 15275 14133 gene locus_tag LOCUS_31570 15275 14133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388656.1 protein_id gnl|my_center|LOCUS_31570 15477 15695 gene locus_tag LOCUS_31580 15477 15695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 >Feature sequence080 1091 150 gene locus_tag LOCUS_31590 1091 150 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_31590 1999 1088 gene locus_tag LOCUS_31600 1999 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 3606 1999 gene locus_tag LOCUS_31610 3606 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 3808 4503 gene locus_tag LOCUS_31620 3808 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 4601 8176 gene locus_tag LOCUS_31630 gene smc 4601 8176 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G5EBD4 protein_id gnl|my_center|LOCUS_31630 8190 9518 gene locus_tag LOCUS_31640 gene ftsY 8190 9518 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KM1 protein_id gnl|my_center|LOCUS_31640 9774 10499 gene locus_tag LOCUS_31650 9774 10499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 10500 11312 gene locus_tag LOCUS_31660 10500 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 11371 12741 gene locus_tag LOCUS_31670 11371 12741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 >Feature sequence081 2282 1881 gene locus_tag LOCUS_31680 2282 1881 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014298.1 protein_id gnl|my_center|LOCUS_31680 3673 2486 gene locus_tag LOCUS_31690 3673 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 6887 3831 gene locus_tag LOCUS_31700 6887 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 7524 7096 gene locus_tag LOCUS_31710 7524 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 7847 7539 gene locus_tag LOCUS_31720 7847 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 8226 9245 gene locus_tag LOCUS_31730 8226 9245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 10739 9291 gene locus_tag LOCUS_31740 10739 9291 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403679.1 protein_id gnl|my_center|LOCUS_31740 10954 12024 gene locus_tag LOCUS_31750 10954 12024 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918089.1 protein_id gnl|my_center|LOCUS_31750 13701 12163 gene locus_tag LOCUS_31760 13701 12163 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031501.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence082 1739 1461 gene locus_tag LOCUS_31770 gene ihfB-1 1739 1461 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_31770 3316 2042 gene locus_tag LOCUS_31780 3316 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 3446 4138 gene locus_tag LOCUS_31790 3446 4138 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_31790 4135 4794 gene locus_tag LOCUS_31800 4135 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_31800 4791 5972 gene locus_tag LOCUS_31810 4791 5972 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227872.1 protein_id gnl|my_center|LOCUS_31810 6033 6242 gene locus_tag LOCUS_31820 6033 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 6160 7089 gene locus_tag LOCUS_31830 6160 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 7214 10057 gene locus_tag LOCUS_31840 gene sucA 7214 10057 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326049.1 protein_id gnl|my_center|LOCUS_31840 10058 11362 gene locus_tag LOCUS_31850 gene sucB 10058 11362 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX6 protein_id gnl|my_center|LOCUS_31850 11368 12756 gene locus_tag LOCUS_31860 gene dldH 11368 12756 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVC8 protein_id gnl|my_center|LOCUS_31860 13020 13748 gene locus_tag LOCUS_31870 13020 13748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 >Feature sequence083 2757 757 gene locus_tag LOCUS_31880 2757 757 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726854.1 protein_id gnl|my_center|LOCUS_31880 4386 2776 gene locus_tag LOCUS_31890 4386 2776 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224753.1 protein_id gnl|my_center|LOCUS_31890 5361 4522 gene locus_tag LOCUS_31900 gene rsmI 5361 4522 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCU9 protein_id gnl|my_center|LOCUS_31900 >Feature sequence084 427 999 gene locus_tag LOCUS_31910 427 999 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267672.1 protein_id gnl|my_center|LOCUS_31910 1054 2487 gene locus_tag LOCUS_31920 1054 2487 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_31920 2498 2923 gene locus_tag LOCUS_31930 2498 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 3054 4079 gene locus_tag LOCUS_31940 3054 4079 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_31940 4076 5068 gene locus_tag LOCUS_31950 gene hflC 4076 5068 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV08 protein_id gnl|my_center|LOCUS_31950 5996 5142 gene locus_tag LOCUS_31960 5996 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 6820 6167 gene locus_tag LOCUS_31970 6820 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 8002 6887 gene locus_tag LOCUS_31980 8002 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 10083 8311 gene locus_tag LOCUS_31990 10083 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 10199 10035 gene locus_tag LOCUS_32000 10199 10035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 10366 10962 gene locus_tag LOCUS_32010 10366 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 11420 11088 gene locus_tag LOCUS_32020 11420 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 11482 12384 gene locus_tag LOCUS_32030 11482 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 12394 13113 gene locus_tag LOCUS_32040 12394 13113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 13544 13173 gene locus_tag LOCUS_32050 13544 13173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 >Feature sequence085 453 7 gene locus_tag LOCUS_32060 453 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 1693 761 gene locus_tag LOCUS_32070 1693 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 4757 1821 gene locus_tag LOCUS_32080 4757 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 5115 6506 gene locus_tag LOCUS_32090 gene dbpA 5115 6506 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113273.1 protein_id gnl|my_center|LOCUS_32090 6796 6533 gene locus_tag LOCUS_32100 6796 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 8156 7059 gene locus_tag LOCUS_32110 8156 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 10742 8157 gene locus_tag LOCUS_32120 10742 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 11154 11501 gene locus_tag LOCUS_32130 11154 11501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 11686 12282 gene locus_tag LOCUS_32140 11686 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 >Feature sequence086 2058 3233 gene locus_tag LOCUS_32150 2058 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 3226 4062 gene locus_tag LOCUS_32160 gene menH 3226 4062 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBD4 protein_id gnl|my_center|LOCUS_32160 4082 4618 gene locus_tag LOCUS_32170 4082 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 4746 6191 gene locus_tag LOCUS_32180 4746 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 6278 7291 gene locus_tag LOCUS_32190 6278 7291 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122352.1 protein_id gnl|my_center|LOCUS_32190 9359 7299 gene locus_tag LOCUS_32200 9359 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 9553 12063 gene locus_tag LOCUS_32210 gene hrpB 9553 12063 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_32210 >Feature sequence087 1157 1753 gene locus_tag LOCUS_32220 1157 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 2288 1803 gene locus_tag LOCUS_32230 2288 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 3696 2359 gene locus_tag LOCUS_32240 3696 2359 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_32240 4088 5137 gene locus_tag LOCUS_32250 4088 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 5598 5245 gene locus_tag LOCUS_32260 5598 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 6910 5825 gene locus_tag LOCUS_32270 6910 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 9176 7464 gene locus_tag LOCUS_32280 9176 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 >Feature sequence088 1696 881 gene locus_tag LOCUS_32290 1696 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 2547 1729 gene locus_tag LOCUS_32300 2547 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 4071 2758 gene locus_tag LOCUS_32310 4071 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 6754 4346 gene locus_tag LOCUS_32320 6754 4346 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_32320 8129 6792 gene locus_tag LOCUS_32330 8129 6792 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_32330 9341 8148 gene locus_tag LOCUS_32340 9341 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 9334 9468 gene locus_tag LOCUS_32350 9334 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 10861 9617 gene locus_tag LOCUS_32360 10861 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403607.1 protein_id gnl|my_center|LOCUS_32360 11055 10843 gene locus_tag LOCUS_32370 11055 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 >Feature sequence089 2162 438 gene locus_tag LOCUS_32380 2162 438 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_32380 2848 2288 gene locus_tag LOCUS_32390 2848 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 3199 4134 gene locus_tag LOCUS_32400 3199 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 4440 5111 gene locus_tag LOCUS_32410 4440 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 5442 6545 gene locus_tag LOCUS_32420 5442 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 6677 7351 gene locus_tag LOCUS_32430 6677 7351 CDS product molybdenum ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_32430 7351 8148 gene locus_tag LOCUS_32440 7351 8148 CDS product molybdenum ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_32440 8652 8894 gene locus_tag LOCUS_32450 8652 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 >Feature sequence090 1773 2621 gene locus_tag LOCUS_32460 1773 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 2845 3621 gene locus_tag LOCUS_32470 2845 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 3702 4694 gene locus_tag LOCUS_32480 3702 4694 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 protein_id gnl|my_center|LOCUS_32480 5164 4862 gene locus_tag LOCUS_32490 5164 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 5550 5293 gene locus_tag LOCUS_32500 5550 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 5943 8309 gene locus_tag LOCUS_32510 5943 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 9272 8499 gene locus_tag LOCUS_32520 9272 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 >Feature sequence091 1560 1297 gene locus_tag LOCUS_32530 1560 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 1818 3053 gene locus_tag LOCUS_32540 1818 3053 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021364.1 protein_id gnl|my_center|LOCUS_32540 3356 7348 gene locus_tag LOCUS_32550 3356 7348 CDS product amino acid adenylation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225145.1 protein_id gnl|my_center|LOCUS_32550 8367 7393 gene locus_tag LOCUS_32560 8367 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 9060 8899 gene locus_tag LOCUS_32570 9060 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 >Feature sequence092 1261 56 gene locus_tag LOCUS_32580 1261 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_32580 2411 1308 gene locus_tag LOCUS_32590 2411 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 2686 3303 gene locus_tag LOCUS_32600 gene lexA 2686 3303 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFB0 protein_id gnl|my_center|LOCUS_32600 3978 3418 gene locus_tag LOCUS_32610 3978 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 4587 4877 gene locus_tag LOCUS_32620 gene groS 4587 4877 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C8 protein_id gnl|my_center|LOCUS_32620 4890 6521 gene locus_tag LOCUS_32630 gene groL 4890 6521 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C7 protein_id gnl|my_center|LOCUS_32630 7248 6577 gene locus_tag LOCUS_32640 7248 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 >Feature sequence093 2696 738 gene locus_tag LOCUS_32650 gene glsA 2696 738 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NI86 protein_id gnl|my_center|LOCUS_32650 3879 2830 gene locus_tag LOCUS_32660 gene glnA 3879 2830 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E31 protein_id gnl|my_center|LOCUS_32660 4322 4990 gene locus_tag LOCUS_32670 4322 4990 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_32670 6723 4987 gene locus_tag LOCUS_32680 6723 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 7068 8078 gene locus_tag LOCUS_32690 7068 8078 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYA6 protein_id gnl|my_center|LOCUS_32690 >Feature sequence094 1232 3 gene locus_tag LOCUS_32700 gene serA 1232 3 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036995.1 protein_id gnl|my_center|LOCUS_32700 2005 1496 gene locus_tag LOCUS_32710 2005 1496 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_32710 3099 2002 gene locus_tag LOCUS_32720 3099 2002 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_32720 4403 3198 gene locus_tag LOCUS_32730 4403 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 5681 5007 gene locus_tag LOCUS_32740 gene msrA 5681 5007 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_32740 5835 6923 gene locus_tag LOCUS_32750 5835 6923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 6965 7720 gene locus_tag LOCUS_32760 6965 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942024.1 protein_id gnl|my_center|LOCUS_32760 >Feature sequence095 788 1480 gene locus_tag LOCUS_32770 788 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 2398 1532 gene locus_tag LOCUS_32780 2398 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 2688 3416 gene locus_tag LOCUS_32790 2688 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 3465 3944 gene locus_tag LOCUS_32800 3465 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 4217 5605 gene locus_tag LOCUS_32810 4217 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 5807 7132 gene locus_tag LOCUS_32820 5807 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 7300 7665 gene locus_tag LOCUS_32830 7300 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 <8280 7750 gene locus_tag LOCUS_32840 <8280 7750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B7M0:histidinol dehydrogenase >Feature sequence096 750 1625 gene locus_tag LOCUS_32850 750 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 1644 2219 gene locus_tag LOCUS_32860 gene yneN 1644 2219 CDS product thioredoxin-like protein YneN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31820 protein_id gnl|my_center|LOCUS_32860 2310 3629 gene locus_tag LOCUS_32870 2310 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 3626 4744 gene locus_tag LOCUS_32880 3626 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 4734 5300 gene locus_tag LOCUS_32890 gene chaC 4734 5300 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UM2 protein_id gnl|my_center|LOCUS_32890 5900 5259 gene locus_tag LOCUS_32900 5900 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144231.1 protein_id gnl|my_center|LOCUS_32900 7384 5897 gene locus_tag LOCUS_32910 7384 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 >Feature sequence097 1710 814 gene locus_tag LOCUS_32920 1710 814 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229908.1 protein_id gnl|my_center|LOCUS_32920 4958 1869 gene locus_tag LOCUS_32930 4958 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 6999 5188 gene locus_tag LOCUS_32940 6999 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 >Feature sequence098 462 52 gene locus_tag LOCUS_32950 462 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 786 574 gene locus_tag LOCUS_32960 786 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 830 1018 gene locus_tag LOCUS_32970 830 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 1407 1036 gene locus_tag LOCUS_32980 1407 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 1532 2755 gene locus_tag LOCUS_32990 1532 2755 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_32990 3966 2728 gene locus_tag LOCUS_33000 3966 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 4764 4114 gene locus_tag LOCUS_33010 4764 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 8008 4829 gene locus_tag LOCUS_33020 8008 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 >Feature sequence099 <1 1647 gene locus_tag LOCUS_33030 <1 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S1I9:protein translocase subunit SecD 1658 2833 gene locus_tag LOCUS_33040 1658 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 2880 4610 gene locus_tag LOCUS_33050 gene recJ 2880 4610 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_33050 4900 5586 gene locus_tag LOCUS_33060 4900 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 6205 5588 gene locus_tag LOCUS_33070 6205 5588 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228239.1 protein_id gnl|my_center|LOCUS_33070 6899 6405 gene locus_tag LOCUS_33080 gene resA 6899 6405 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_33080 >Feature sequence100 2233 2961 gene locus_tag LOCUS_33090 2233 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 4182 3010 gene locus_tag LOCUS_33100 4182 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 4339 5238 gene locus_tag LOCUS_33110 4339 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 5366 6673 gene locus_tag LOCUS_33120 5366 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 6704 7072 gene locus_tag LOCUS_33130 gene fdx 6704 7072 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44428 protein_id gnl|my_center|LOCUS_33130 >Feature sequence101 <1 1465 gene locus_tag LOCUS_33140 <1 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117988.1:cytochrome c 1462 2859 gene locus_tag LOCUS_33150 1462 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123475.1 protein_id gnl|my_center|LOCUS_33150 2872 3636 gene locus_tag LOCUS_33160 2872 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 3886 5886 gene locus_tag LOCUS_33170 3886 5886 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691480.1 protein_id gnl|my_center|LOCUS_33170 6054 7130 gene locus_tag LOCUS_33180 6054 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 >Feature sequence102 496 1626 gene locus_tag LOCUS_33190 gene mcr 496 1626 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224352.1 protein_id gnl|my_center|LOCUS_33190 1854 2795 gene locus_tag LOCUS_33200 1854 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 3081 4361 gene locus_tag LOCUS_33210 gene oel1 3081 4361 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070593.1 protein_id gnl|my_center|LOCUS_33210 4468 5079 gene locus_tag LOCUS_33220 4468 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 5120 6064 gene locus_tag LOCUS_33230 5120 6064 CDS product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888311.1 protein_id gnl|my_center|LOCUS_33230 6241 6074 gene locus_tag LOCUS_33240 6241 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 6259 7146 gene locus_tag LOCUS_33250 6259 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 >Feature sequence103 873 337 gene locus_tag LOCUS_33260 873 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 1729 962 gene locus_tag LOCUS_33270 1729 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 2058 2624 gene locus_tag LOCUS_33280 2058 2624 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XWH6 protein_id gnl|my_center|LOCUS_33280 2950 4215 gene locus_tag LOCUS_33290 2950 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 4928 4254 gene locus_tag LOCUS_33300 4928 4254 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072086.1 protein_id gnl|my_center|LOCUS_33300 5340 5720 gene locus_tag LOCUS_33310 5340 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 >Feature sequence104 3345 2275 gene locus_tag LOCUS_33320 3345 2275 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265511.1 protein_id gnl|my_center|LOCUS_33320 4558 3338 gene locus_tag LOCUS_33330 4558 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 5220 4555 gene locus_tag LOCUS_33340 5220 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 5972 5277 gene locus_tag LOCUS_33350 5972 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 >Feature sequence105 <1 1591 gene locus_tag LOCUS_33360 <1 1591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261752.1:transporter 1603 2046 gene locus_tag LOCUS_33370 1603 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 2915 2121 gene locus_tag LOCUS_33380 2915 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957679.1 protein_id gnl|my_center|LOCUS_33380 3169 4590 gene locus_tag LOCUS_33390 gene cysS 3169 4590 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CD5 protein_id gnl|my_center|LOCUS_33390 4846 5766 gene locus_tag LOCUS_33400 4846 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 >Feature sequence106 1036 2223 gene locus_tag LOCUS_33410 gene aroB 1036 2223 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_33410 3329 2292 gene locus_tag LOCUS_33420 gene glnA 3329 2292 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E31 protein_id gnl|my_center|LOCUS_33420 3682 4341 gene locus_tag LOCUS_33430 3682 4341 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_33430 4446 4610 gene locus_tag LOCUS_33440 4446 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 5528 5665 gene locus_tag LOCUS_33450 5528 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 >Feature sequence107 703 3777 gene locus_tag LOCUS_33460 703 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 3824 5410 gene locus_tag LOCUS_33470 3824 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 >Feature sequence108 1634 513 gene locus_tag LOCUS_33480 gene rlmG 1634 513 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WJ78 protein_id gnl|my_center|LOCUS_33480 3364 1775 gene locus_tag LOCUS_33490 3364 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 4641 4396 gene locus_tag LOCUS_33500 4641 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 >Feature sequence109 <1 703 gene locus_tag LOCUS_33510 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545027.1:ABC transporter permease 752 1576 gene locus_tag LOCUS_33520 752 1576 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941775.1 protein_id gnl|my_center|LOCUS_33520 1576 2067 gene locus_tag LOCUS_33530 1576 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 2098 3465 gene locus_tag LOCUS_33540 gene mgtE 2098 3465 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0I3 protein_id gnl|my_center|LOCUS_33540 3462 4175 gene locus_tag LOCUS_33550 3462 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 4280 4945 gene locus_tag LOCUS_33560 4280 4945 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XA08 protein_id gnl|my_center|LOCUS_33560 >Feature sequence110 1266 3116 gene locus_tag LOCUS_33570 1266 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 4950 3247 gene locus_tag LOCUS_33580 4950 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 >Feature sequence111 989 1600 gene locus_tag LOCUS_33590 989 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 1597 2007 gene locus_tag LOCUS_33600 1597 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 <4474 2059 gene locus_tag LOCUS_33610 <4474 2059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DB6:DNA-directed DNA polymerase >Feature sequence112 1921 2883 gene locus_tag LOCUS_33620 1921 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 2890 3834 gene locus_tag LOCUS_33630 2890 3834 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_33630 <4385 3843 gene locus_tag LOCUS_33640 <4385 3843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583864.1:nucleoside triphosphate pyrophosphohydrolase >Feature sequence113 638 2311 gene locus_tag LOCUS_33650 638 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 2295 3767 gene locus_tag LOCUS_33660 2295 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 >Feature sequence114 820 2199 gene locus_tag LOCUS_33670 gene blcA 820 2199 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974400.1 protein_id gnl|my_center|LOCUS_33670 2192 2932 gene locus_tag LOCUS_33680 2192 2932 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_33680 >Feature sequence115 1 1077 gene locus_tag LOCUS_33690 1 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 1084 1569 gene locus_tag LOCUS_33700 1084 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_33700 1805 3172 gene locus_tag LOCUS_33710 1805 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 3611 3429 gene locus_tag LOCUS_33720 3611 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 >Feature sequence116 >Feature sequence117 215 1498 gene locus_tag LOCUS_33730 gene amt-3 215 1498 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG35 protein_id gnl|my_center|LOCUS_33730 1521 1865 gene locus_tag LOCUS_33740 1521 1865 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931828.1 protein_id gnl|my_center|LOCUS_33740 3231 1897 gene locus_tag LOCUS_33750 3231 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 >Feature sequence118 2074 1241 gene locus_tag LOCUS_33760 2074 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 2120 2269 gene locus_tag LOCUS_33770 2120 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 >Feature sequence119 142 1179 gene locus_tag LOCUS_33780 142 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 1468 2355 gene locus_tag LOCUS_33790 1468 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 >Feature sequence120 76 1425 gene locus_tag LOCUS_33800 76 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 1559 1428 gene locus_tag LOCUS_33810 1559 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 2109 1876 gene locus_tag LOCUS_33820 2109 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 >Feature sequence121 1929 751 gene locus_tag LOCUS_33830 1929 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 >Feature sequence122 714 1364 gene locus_tag LOCUS_33840 gene hlyI 714 1364 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229810.1 protein_id gnl|my_center|LOCUS_33840