>Feature sequence0001 1706 10156 gene locus_tag LOCUS_00010 1706 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 10156 10446 gene locus_tag LOCUS_00020 10156 10446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 10473 11468 gene locus_tag LOCUS_00030 10473 11468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 11468 11758 gene locus_tag LOCUS_00040 11468 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 12400 12068 gene locus_tag LOCUS_00050 12400 12068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 12718 12431 gene locus_tag LOCUS_00060 12718 12431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 12929 13105 gene locus_tag LOCUS_00070 12929 13105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 13107 13880 gene locus_tag LOCUS_00080 13107 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 13891 15411 gene locus_tag LOCUS_00090 13891 15411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 15422 15709 gene locus_tag LOCUS_00100 15422 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 15720 16610 gene locus_tag LOCUS_00110 15720 16610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 16607 17185 gene locus_tag LOCUS_00120 16607 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17182 18519 gene locus_tag LOCUS_00130 17182 18519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 18530 19639 gene locus_tag LOCUS_00140 18530 19639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 19654 20184 gene locus_tag LOCUS_00150 19654 20184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20203 20682 gene locus_tag LOCUS_00160 20203 20682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 22443 22027 gene locus_tag LOCUS_00170 22443 22027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 24073 22907 gene locus_tag LOCUS_00180 24073 22907 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533246.1 protein_id gnl|my_center|LOCUS_00180 24671 24066 gene locus_tag LOCUS_00190 24671 24066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 26525 25524 gene locus_tag LOCUS_00200 26525 25524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533238.1 protein_id gnl|my_center|LOCUS_00200 26872 26528 gene locus_tag LOCUS_00210 26872 26528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 >Feature sequence0002 1839 1006 gene locus_tag LOCUS_00220 gene dapB 1839 1006 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38103 protein_id gnl|my_center|LOCUS_00220 2687 1836 gene locus_tag LOCUS_00230 gene dapA 2687 1836 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GT6 protein_id gnl|my_center|LOCUS_00230 3430 2948 gene locus_tag LOCUS_00240 3430 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 4455 3433 gene locus_tag LOCUS_00250 gene ribF 4455 3433 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D32 protein_id gnl|my_center|LOCUS_00250 5444 4482 gene locus_tag LOCUS_00260 5444 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 5755 6156 gene locus_tag LOCUS_00270 5755 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 6973 6173 gene locus_tag LOCUS_00280 6973 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 7637 8086 gene locus_tag LOCUS_00290 7637 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 8083 9348 gene locus_tag LOCUS_00300 8083 9348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 9394 11133 gene locus_tag LOCUS_00310 9394 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 11197 12507 gene locus_tag LOCUS_00320 11197 12507 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943766.1 protein_id gnl|my_center|LOCUS_00320 12531 15197 gene locus_tag LOCUS_00330 gene alaS 12531 15197 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MK64 protein_id gnl|my_center|LOCUS_00330 15349 16152 gene locus_tag LOCUS_00340 15349 16152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 17606 16170 gene locus_tag LOCUS_00350 17606 16170 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_00350 17730 18164 gene locus_tag LOCUS_00360 17730 18164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 18233 18550 gene locus_tag LOCUS_00370 18233 18550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 18557 19234 gene locus_tag LOCUS_00380 18557 19234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 19446 21185 gene locus_tag LOCUS_00390 19446 21185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 21329 22849 gene locus_tag LOCUS_00400 21329 22849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 23397 22867 gene locus_tag LOCUS_00410 23397 22867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 23822 23895 gene locus_tag LOCUS_t00010 23822 23895 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23939 24022 gene locus_tag LOCUS_t00020 23939 24022 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 24085 24158 gene locus_tag LOCUS_t00030 24085 24158 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24202 24276 gene locus_tag LOCUS_t00040 24202 24276 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0003 454 708 gene locus_tag LOCUS_00420 454 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 1872 889 gene locus_tag LOCUS_00430 1872 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 3683 2502 gene locus_tag LOCUS_00440 3683 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 4812 4630 gene locus_tag LOCUS_00450 4812 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 5678 5406 gene locus_tag LOCUS_00460 5678 5406 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531584.1 protein_id gnl|my_center|LOCUS_00460 5759 6091 gene locus_tag LOCUS_00470 5759 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 6084 6431 gene locus_tag LOCUS_00480 6084 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 6780 7925 gene locus_tag LOCUS_00490 6780 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 10301 8709 gene locus_tag LOCUS_00500 10301 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339589.1 protein_id gnl|my_center|LOCUS_00500 11293 11009 gene locus_tag LOCUS_00510 11293 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 11348 11701 gene locus_tag LOCUS_00520 11348 11701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 11701 12396 gene locus_tag LOCUS_00530 11701 12396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 13035 12760 gene locus_tag LOCUS_00540 13035 12760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 13117 13515 gene locus_tag LOCUS_00550 13117 13515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_00550 15114 13726 gene locus_tag LOCUS_00560 15114 13726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 15047 15340 gene locus_tag LOCUS_00570 15047 15340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 18019 17015 gene locus_tag LOCUS_00580 18019 17015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 19057 18038 gene locus_tag LOCUS_00590 19057 18038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 19364 20383 gene locus_tag LOCUS_00600 19364 20383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 20386 20931 gene locus_tag LOCUS_00610 20386 20931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 21029 22126 gene locus_tag LOCUS_00620 21029 22126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 >Feature sequence0004 1970 675 gene locus_tag LOCUS_00630 1970 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 4326 2002 gene locus_tag LOCUS_00640 4326 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 7605 4576 gene locus_tag LOCUS_00650 7605 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 7727 8491 gene locus_tag LOCUS_00660 7727 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 8793 9554 gene locus_tag LOCUS_00670 8793 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 protein_id gnl|my_center|LOCUS_00670 10429 9566 gene locus_tag LOCUS_00680 gene moaX 10429 9566 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6MWY3 protein_id gnl|my_center|LOCUS_00680 10740 11519 gene locus_tag LOCUS_00690 10740 11519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 11805 14027 gene locus_tag LOCUS_00700 gene maeB 11805 14027 CDS product bifunctional malic enzyme oxidoreductase/phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_00700 14780 14199 gene locus_tag LOCUS_00710 14780 14199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 15441 14887 gene locus_tag LOCUS_00720 gene def 15441 14887 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8K2 protein_id gnl|my_center|LOCUS_00720 15618 16712 gene locus_tag LOCUS_00730 15618 16712 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKI9 protein_id gnl|my_center|LOCUS_00730 17514 16777 gene locus_tag LOCUS_00740 17514 16777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 18422 17763 gene locus_tag LOCUS_00750 18422 17763 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_00750 19100 18477 gene locus_tag LOCUS_00760 gene folE 19100 18477 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63K51 protein_id gnl|my_center|LOCUS_00760 19693 19127 gene locus_tag LOCUS_00770 19693 19127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 20114 20413 gene locus_tag LOCUS_00780 20114 20413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 20485 21513 gene locus_tag LOCUS_00790 20485 21513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 >Feature sequence0005 2472 589 gene locus_tag LOCUS_00800 2472 589 CDS product type I secretion outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958458.1 protein_id gnl|my_center|LOCUS_00800 4017 2737 gene locus_tag LOCUS_00810 4017 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 6756 4021 gene locus_tag LOCUS_00820 6756 4021 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_00820 7616 6774 gene locus_tag LOCUS_00830 7616 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 8092 7637 gene locus_tag LOCUS_00840 8092 7637 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940359.1 protein_id gnl|my_center|LOCUS_00840 8782 8132 gene locus_tag LOCUS_00850 gene exbB 8782 8132 CDS product TolQ transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177702.1 protein_id gnl|my_center|LOCUS_00850 10174 9023 gene locus_tag LOCUS_00860 gene truD 10174 9023 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RSX8 protein_id gnl|my_center|LOCUS_00860 11386 10184 gene locus_tag LOCUS_00870 11386 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 11793 13163 gene locus_tag LOCUS_00880 11793 13163 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897651.1 protein_id gnl|my_center|LOCUS_00880 13240 14019 gene locus_tag LOCUS_00890 13240 14019 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140144.1 protein_id gnl|my_center|LOCUS_00890 16352 14310 gene locus_tag LOCUS_00900 16352 14310 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_00900 16640 17656 gene locus_tag LOCUS_00910 16640 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256855.1 protein_id gnl|my_center|LOCUS_00910 17659 19176 gene locus_tag LOCUS_00920 17659 19176 CDS product stage V sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_00920 19529 20302 gene locus_tag LOCUS_00930 19529 20302 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_00930 >Feature sequence0006 895 494 gene locus_tag LOCUS_00940 895 494 CDS product mercuric resistance operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_00940 1538 981 gene locus_tag LOCUS_00950 1538 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 1659 3860 gene locus_tag LOCUS_00960 1659 3860 CDS product cadmium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942791.1 protein_id gnl|my_center|LOCUS_00960 3857 4228 gene locus_tag LOCUS_00970 3857 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 4951 4502 gene locus_tag LOCUS_00980 4951 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 4943 5761 gene locus_tag LOCUS_00990 4943 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 5748 6941 gene locus_tag LOCUS_01000 5748 6941 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941496.1 protein_id gnl|my_center|LOCUS_01000 6952 10050 gene locus_tag LOCUS_01010 gene czcA 6952 10050 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123153.1 protein_id gnl|my_center|LOCUS_01010 10124 11167 gene locus_tag LOCUS_01020 10124 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 12664 11177 gene locus_tag LOCUS_01030 12664 11177 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204917.1 protein_id gnl|my_center|LOCUS_01030 13161 12652 gene locus_tag LOCUS_01040 13161 12652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 13946 13158 gene locus_tag LOCUS_01050 13946 13158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 14527 13943 gene locus_tag LOCUS_01060 14527 13943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 14996 14571 gene locus_tag LOCUS_01070 14996 14571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 14881 15759 gene locus_tag LOCUS_01080 14881 15759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 15797 16183 gene locus_tag LOCUS_01090 15797 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 16410 16688 gene locus_tag LOCUS_01100 16410 16688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083527.1 protein_id gnl|my_center|LOCUS_01100 >Feature sequence0007 114 890 gene locus_tag LOCUS_01110 114 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 2649 955 gene locus_tag LOCUS_01120 gene thiC 2649 955 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HB59 protein_id gnl|my_center|LOCUS_01120 2937 4289 gene locus_tag LOCUS_01130 2937 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 4418 4840 gene locus_tag LOCUS_01140 4418 4840 CDS product cell-cycle regulation protein HIT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829828.1 protein_id gnl|my_center|LOCUS_01140 5812 4889 gene locus_tag LOCUS_01150 5812 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 6096 6809 gene locus_tag LOCUS_01160 gene phoB 6096 6809 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_01160 6806 8584 gene locus_tag LOCUS_01170 gene phoR 6806 8584 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_01170 10162 8594 gene locus_tag LOCUS_01180 10162 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 10642 13062 gene locus_tag LOCUS_01190 10642 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 14590 13106 gene locus_tag LOCUS_01200 14590 13106 CDS product NADH:flavin oxidoreductase / NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038790.1 protein_id gnl|my_center|LOCUS_01200 15736 14621 gene locus_tag LOCUS_01210 gene bioB 15736 14621 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT7 protein_id gnl|my_center|LOCUS_01210 15941 16966 gene locus_tag LOCUS_01220 gene acoA 15941 16966 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4N0 protein_id gnl|my_center|LOCUS_01220 16993 17973 gene locus_tag LOCUS_01230 gene acoB 16993 17973 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_01230 18049 18261 gene locus_tag LOCUS_01240 18049 18261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 >Feature sequence0008 765 1781 gene locus_tag LOCUS_01250 gene add 765 1781 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RY2 protein_id gnl|my_center|LOCUS_01250 1826 2593 gene locus_tag LOCUS_01260 1826 2593 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938841.1 protein_id gnl|my_center|LOCUS_01260 3868 2606 gene locus_tag LOCUS_01270 3868 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 5037 3889 gene locus_tag LOCUS_01280 5037 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 6206 5037 gene locus_tag LOCUS_01290 6206 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 6239 7228 gene locus_tag LOCUS_01300 6239 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 7288 9018 gene locus_tag LOCUS_01310 7288 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 9031 9459 gene locus_tag LOCUS_01320 9031 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 9786 9550 gene locus_tag LOCUS_01330 9786 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 10738 9833 gene locus_tag LOCUS_01340 10738 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 11135 10806 gene locus_tag LOCUS_01350 11135 10806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 11092 11376 gene locus_tag LOCUS_01360 11092 11376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 12396 11722 gene locus_tag LOCUS_01370 12396 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 13004 12393 gene locus_tag LOCUS_01380 13004 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 13218 14960 gene locus_tag LOCUS_01390 13218 14960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 14957 16330 gene locus_tag LOCUS_01400 14957 16330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_01400 >Feature sequence0009 327 899 gene locus_tag LOCUS_01410 327 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 1586 4456 gene locus_tag LOCUS_01420 1586 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 4609 5745 gene locus_tag LOCUS_01430 4609 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 7387 5747 gene locus_tag LOCUS_01440 7387 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 8337 7432 gene locus_tag LOCUS_01450 8337 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 9872 8334 gene locus_tag LOCUS_01460 9872 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 10013 10246 gene locus_tag LOCUS_01470 10013 10246 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531584.1 protein_id gnl|my_center|LOCUS_01470 12332 10326 gene locus_tag LOCUS_01480 12332 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 12653 13753 gene locus_tag LOCUS_01490 gene intA 12653 13753 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087297.1 protein_id gnl|my_center|LOCUS_01490 15982 14198 gene locus_tag LOCUS_01500 15982 14198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 16218 16805 gene locus_tag LOCUS_01510 16218 16805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 >Feature sequence0010 3300 232 gene locus_tag LOCUS_01520 3300 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 4348 3332 gene locus_tag LOCUS_01530 4348 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 5440 4421 gene locus_tag LOCUS_01540 5440 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 7020 5596 gene locus_tag LOCUS_01550 gene dnaB 7020 5596 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EG4 protein_id gnl|my_center|LOCUS_01550 7558 7106 gene locus_tag LOCUS_01560 gene rplI 7558 7106 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE1 protein_id gnl|my_center|LOCUS_01560 7822 7604 gene locus_tag LOCUS_01570 7822 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01570 8346 7822 gene locus_tag LOCUS_01580 8346 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 10780 8597 gene locus_tag LOCUS_01590 gene hppA 10780 8597 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHJ2 protein_id gnl|my_center|LOCUS_01590 11537 10827 gene locus_tag LOCUS_01600 gene pth 11537 10827 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS1 protein_id gnl|my_center|LOCUS_01600 12209 11601 gene locus_tag LOCUS_01610 gene rplY 12209 11601 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZW3 protein_id gnl|my_center|LOCUS_01610 13376 12432 gene locus_tag LOCUS_01620 gene prsA 13376 12432 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE8 protein_id gnl|my_center|LOCUS_01620 13503 13431 gene locus_tag LOCUS_t00050 13503 13431 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13929 15380 gene locus_tag LOCUS_01630 13929 15380 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_01630 15434 16996 gene locus_tag LOCUS_01640 15434 16996 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 protein_id gnl|my_center|LOCUS_01640 >Feature sequence0011 604 113 gene locus_tag LOCUS_01650 604 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 2620 785 gene locus_tag LOCUS_01660 gene ffh 2620 785 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329358.1 protein_id gnl|my_center|LOCUS_01660 2761 4629 gene locus_tag LOCUS_01670 2761 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 7300 4640 gene locus_tag LOCUS_01680 7300 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 7781 7323 gene locus_tag LOCUS_01690 7781 7323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 8737 8024 gene locus_tag LOCUS_01700 8737 8024 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMX6 protein_id gnl|my_center|LOCUS_01700 9738 8734 gene locus_tag LOCUS_01710 9738 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 9867 10070 gene locus_tag LOCUS_01720 9867 10070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 10940 10152 gene locus_tag LOCUS_01730 gene sdhB 10940 10152 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225083.1 protein_id gnl|my_center|LOCUS_01730 12927 11011 gene locus_tag LOCUS_01740 gene sdhA 12927 11011 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_01740 13771 13034 gene locus_tag LOCUS_01750 13771 13034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_01750 15107 14223 gene locus_tag LOCUS_01760 15107 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 14991 15275 gene locus_tag LOCUS_01770 14991 15275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 15446 15841 gene locus_tag LOCUS_01780 15446 15841 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039429.1 protein_id gnl|my_center|LOCUS_01780 16503 16982 gene locus_tag LOCUS_01790 16503 16982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 >Feature sequence0012 2 751 gene locus_tag LOCUS_01800 2 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 1513 2499 gene locus_tag LOCUS_01810 1513 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 2617 3567 gene locus_tag LOCUS_01820 2617 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 3732 4481 gene locus_tag LOCUS_01830 3732 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 4929 5447 gene locus_tag LOCUS_01840 4929 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 6872 6174 gene locus_tag LOCUS_01850 6872 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 7333 6869 gene locus_tag LOCUS_01860 7333 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 8238 7438 gene locus_tag LOCUS_01870 8238 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 8441 8217 gene locus_tag LOCUS_01880 8441 8217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 9367 8444 gene locus_tag LOCUS_01890 9367 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 10153 9491 gene locus_tag LOCUS_01900 10153 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 10512 10216 gene locus_tag LOCUS_01910 10512 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 10913 11413 gene locus_tag LOCUS_01920 10913 11413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 11492 11857 gene locus_tag LOCUS_01930 11492 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 11888 13795 gene locus_tag LOCUS_01940 11888 13795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 13731 14012 gene locus_tag LOCUS_01950 13731 14012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 14077 14835 gene locus_tag LOCUS_01960 14077 14835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 15716 14853 gene locus_tag LOCUS_01970 15716 14853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 16244 15906 gene locus_tag LOCUS_01980 16244 15906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence0013 <1 688 gene locus_tag LOCUS_01990 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259547.1:N-methyltryptophan oxidase 1384 923 gene locus_tag LOCUS_02000 1384 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 1668 1766 gene locus_tag LOCUS_t00060 1668 1766 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2056 2322 gene locus_tag LOCUS_02010 2056 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 2319 3806 gene locus_tag LOCUS_02020 gene panF 2319 3806 CDS product pantothenate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404732.1 protein_id gnl|my_center|LOCUS_02020 3793 5280 gene locus_tag LOCUS_02030 3793 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 5422 7263 gene locus_tag LOCUS_02040 5422 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 7815 9215 gene locus_tag LOCUS_02050 7815 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 9236 10789 gene locus_tag LOCUS_02060 9236 10789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 11720 10905 gene locus_tag LOCUS_02070 11720 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_02070 12769 13596 gene locus_tag LOCUS_02080 12769 13596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 13805 15112 gene locus_tag LOCUS_02090 13805 15112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 15986 15147 gene locus_tag LOCUS_02100 15986 15147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 >Feature sequence0014 <1 1206 gene locus_tag LOCUS_02110 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258002.1:molybdopterin oxidoreductase 1212 2600 gene locus_tag LOCUS_02120 1212 2600 CDS product molybdopterin oxidoreductase membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_02120 2593 3132 gene locus_tag LOCUS_02130 2593 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02130 3135 3863 gene locus_tag LOCUS_02140 3135 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 3863 5518 gene locus_tag LOCUS_02150 3863 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 5531 6127 gene locus_tag LOCUS_02160 5531 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 6164 7039 gene locus_tag LOCUS_02170 6164 7039 CDS product photosynthetic protein synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885550.1 protein_id gnl|my_center|LOCUS_02170 7123 8097 gene locus_tag LOCUS_02180 7123 8097 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF38 protein_id gnl|my_center|LOCUS_02180 8131 9768 gene locus_tag LOCUS_02190 gene coxA1 8131 9768 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0S6 protein_id gnl|my_center|LOCUS_02190 9817 10488 gene locus_tag LOCUS_02200 9817 10488 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_02200 10498 11082 gene locus_tag LOCUS_02210 10498 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 11252 12352 gene locus_tag LOCUS_02220 gene moaA 11252 12352 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJD2 protein_id gnl|my_center|LOCUS_02220 12414 12827 gene locus_tag LOCUS_02230 12414 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 12861 15068 gene locus_tag LOCUS_02240 12861 15068 CDS product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_02240 15086 15766 gene locus_tag LOCUS_02250 15086 15766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 15823 16083 gene locus_tag LOCUS_02260 15823 16083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 >Feature sequence0015 <1 1090 gene locus_tag LOCUS_02270 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P37049:phosphodiesterase YaeI 1146 2252 gene locus_tag LOCUS_02280 1146 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 4339 2249 gene locus_tag LOCUS_02290 4339 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 5141 4449 gene locus_tag LOCUS_02300 5141 4449 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_02300 5140 5514 gene locus_tag LOCUS_02310 5140 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 5632 6234 gene locus_tag LOCUS_02320 gene hemG 5632 6234 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853972.1 protein_id gnl|my_center|LOCUS_02320 6310 6984 gene locus_tag LOCUS_02330 6310 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 6981 8645 gene locus_tag LOCUS_02340 6981 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 8642 9985 gene locus_tag LOCUS_02350 8642 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122547.1 protein_id gnl|my_center|LOCUS_02350 10025 10678 gene locus_tag LOCUS_02360 10025 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 11604 10783 gene locus_tag LOCUS_02370 11604 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846138.1 protein_id gnl|my_center|LOCUS_02370 <15781 11810 gene locus_tag LOCUS_02380 <15781 11810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence0016 1032 367 gene locus_tag LOCUS_02390 1032 367 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461647.1 protein_id gnl|my_center|LOCUS_02390 1207 1620 gene locus_tag LOCUS_02400 1207 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 2182 2021 gene locus_tag LOCUS_02410 2182 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 2899 2513 gene locus_tag LOCUS_02420 2899 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 5505 3061 gene locus_tag LOCUS_02430 5505 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 6011 5568 gene locus_tag LOCUS_02440 6011 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 6992 6174 gene locus_tag LOCUS_02450 gene proC 6992 6174 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK62 protein_id gnl|my_center|LOCUS_02450 7089 7820 gene locus_tag LOCUS_02460 7089 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 7948 8331 gene locus_tag LOCUS_02470 7948 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 8529 9494 gene locus_tag LOCUS_02480 8529 9494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 10177 9857 gene locus_tag LOCUS_02490 10177 9857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 11089 10520 gene locus_tag LOCUS_02500 11089 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 14144 11676 gene locus_tag LOCUS_02510 14144 11676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02510 15404 14214 gene locus_tag LOCUS_02520 15404 14214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 >Feature sequence0017 432 73 gene locus_tag LOCUS_02530 432 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 2675 771 gene locus_tag LOCUS_02540 2675 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 2772 3542 gene locus_tag LOCUS_02550 2772 3542 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027437.1 protein_id gnl|my_center|LOCUS_02550 3716 8803 gene locus_tag LOCUS_02560 3716 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 10129 8930 gene locus_tag LOCUS_02570 10129 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 10260 11264 gene locus_tag LOCUS_02580 10260 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 11358 12578 gene locus_tag LOCUS_02590 11358 12578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 13428 12583 gene locus_tag LOCUS_02600 13428 12583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 13540 14460 gene locus_tag LOCUS_02610 13540 14460 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403980.1 protein_id gnl|my_center|LOCUS_02610 >Feature sequence0018 3335 582 gene locus_tag LOCUS_02620 3335 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 6566 3474 gene locus_tag LOCUS_02630 6566 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 6829 6590 gene locus_tag LOCUS_02640 6829 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 6898 7521 gene locus_tag LOCUS_02650 6898 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 8356 7847 gene locus_tag LOCUS_02660 8356 7847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 9144 8359 gene locus_tag LOCUS_02670 9144 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 10189 9131 gene locus_tag LOCUS_02680 10189 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 12607 10457 gene locus_tag LOCUS_02690 12607 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 13244 12948 gene locus_tag LOCUS_02700 13244 12948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 14178 13213 gene locus_tag LOCUS_02710 14178 13213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 14573 14175 gene locus_tag LOCUS_02720 14573 14175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 >Feature sequence0019 443 1045 gene locus_tag LOCUS_02730 443 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 1042 1302 gene locus_tag LOCUS_02740 1042 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 1317 1868 gene locus_tag LOCUS_02750 1317 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 1924 2589 gene locus_tag LOCUS_02760 1924 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 2601 3365 gene locus_tag LOCUS_02770 2601 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 3368 4075 gene locus_tag LOCUS_02780 3368 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 4072 4959 gene locus_tag LOCUS_02790 4072 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 5136 5990 gene locus_tag LOCUS_02800 5136 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 5993 6424 gene locus_tag LOCUS_02810 5993 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 6421 6834 gene locus_tag LOCUS_02820 6421 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 6908 7258 gene locus_tag LOCUS_02830 6908 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 7327 8142 gene locus_tag LOCUS_02840 7327 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 8335 8973 gene locus_tag LOCUS_02850 8335 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 8996 9655 gene locus_tag LOCUS_02860 8996 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 9694 10863 gene locus_tag LOCUS_02870 9694 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 10853 12394 gene locus_tag LOCUS_02880 10853 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 12399 12827 gene locus_tag LOCUS_02890 12399 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 12843 13349 gene locus_tag LOCUS_02900 12843 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 >Feature sequence0020 1768 1070 gene locus_tag LOCUS_02910 1768 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 2075 3784 gene locus_tag LOCUS_02920 2075 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 5843 3834 gene locus_tag LOCUS_02930 gene rnr 5843 3834 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D34 protein_id gnl|my_center|LOCUS_02930 7493 5928 gene locus_tag LOCUS_02940 7493 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 7634 8557 gene locus_tag LOCUS_02950 7634 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 8824 10755 gene locus_tag LOCUS_02960 gene htpG 8824 10755 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61185 protein_id gnl|my_center|LOCUS_02960 10903 12048 gene locus_tag LOCUS_02970 gene pfkA 10903 12048 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34529 protein_id gnl|my_center|LOCUS_02970 12089 12970 gene locus_tag LOCUS_02980 12089 12970 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085668.1 protein_id gnl|my_center|LOCUS_02980 >Feature sequence0021 710 1228 gene locus_tag LOCUS_02990 710 1228 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948551.1 protein_id gnl|my_center|LOCUS_02990 1225 1965 gene locus_tag LOCUS_03000 gene fabG 1225 1965 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_03000 2557 1988 gene locus_tag LOCUS_03010 2557 1988 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124477.1 protein_id gnl|my_center|LOCUS_03010 4033 2558 gene locus_tag LOCUS_03020 4033 2558 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524967.1 protein_id gnl|my_center|LOCUS_03020 4072 4920 gene locus_tag LOCUS_03030 4072 4920 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_03030 7317 4924 gene locus_tag LOCUS_03040 7317 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 7474 8553 gene locus_tag LOCUS_03050 7474 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 8868 8680 gene locus_tag LOCUS_03060 8868 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 9116 9718 gene locus_tag LOCUS_03070 9116 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 9765 10298 gene locus_tag LOCUS_03080 9765 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 13244 10335 gene locus_tag LOCUS_03090 13244 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 <14453 13388 gene locus_tag LOCUS_03100 <14453 13388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:RNA-binding protein >Feature sequence0022 1639 809 gene locus_tag LOCUS_03110 1639 809 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142046.1 protein_id gnl|my_center|LOCUS_03110 2643 1735 gene locus_tag LOCUS_03120 2643 1735 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_03120 4016 2736 gene locus_tag LOCUS_03130 gene tolB 4016 2736 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H67 protein_id gnl|my_center|LOCUS_03130 5178 4324 gene locus_tag LOCUS_03140 5178 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 5752 5315 gene locus_tag LOCUS_03150 gene tolR 5752 5315 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707365.1 protein_id gnl|my_center|LOCUS_03150 6520 5807 gene locus_tag LOCUS_03160 6520 5807 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_03160 6737 7261 gene locus_tag LOCUS_03170 6737 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 7294 8172 gene locus_tag LOCUS_03180 7294 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 8183 10582 gene locus_tag LOCUS_03190 8183 10582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 10592 11314 gene locus_tag LOCUS_03200 10592 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 11327 12418 gene locus_tag LOCUS_03210 11327 12418 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_03210 12687 13121 gene locus_tag LOCUS_03220 12687 13121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 13105 13737 gene locus_tag LOCUS_03230 13105 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 <14271 13759 gene locus_tag LOCUS_03240 <14271 13759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001703490.1:putative quinone reductase Qor >Feature sequence0023 1452 250 gene locus_tag LOCUS_03250 1452 250 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BQ0 protein_id gnl|my_center|LOCUS_03250 1745 4972 gene locus_tag LOCUS_03260 1745 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 6478 5222 gene locus_tag LOCUS_03270 gene clpX 6478 5222 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C83 protein_id gnl|my_center|LOCUS_03270 7126 6488 gene locus_tag LOCUS_03280 gene clpP 7126 6488 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY6 protein_id gnl|my_center|LOCUS_03280 9008 7689 gene locus_tag LOCUS_03290 gene tig 9008 7689 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CE9 protein_id gnl|my_center|LOCUS_03290 12736 9149 gene locus_tag LOCUS_03300 12736 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 <13806 12760 gene locus_tag LOCUS_03310 <13806 12760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942662.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence0024 2816 267 gene locus_tag LOCUS_03320 2816 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 4100 3813 gene locus_tag LOCUS_03330 4100 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 4189 4905 gene locus_tag LOCUS_03340 4189 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 4909 5535 gene locus_tag LOCUS_03350 4909 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 5631 6779 gene locus_tag LOCUS_03360 5631 6779 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_03360 13630 7115 gene locus_tag LOCUS_03370 13630 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 >Feature sequence0025 3289 3804 gene locus_tag LOCUS_03380 3289 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 5484 3949 gene locus_tag LOCUS_03390 5484 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 8373 5728 gene locus_tag LOCUS_03400 gene leuS 8373 5728 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMC0 protein_id gnl|my_center|LOCUS_03400 9170 8592 gene locus_tag LOCUS_03410 9170 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 9371 9859 gene locus_tag LOCUS_03420 9371 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943969.1 protein_id gnl|my_center|LOCUS_03420 9924 11684 gene locus_tag LOCUS_03430 9924 11684 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_03430 13126 11678 gene locus_tag LOCUS_03440 13126 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 >Feature sequence0026 3348 1783 gene locus_tag LOCUS_03450 3348 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 3521 4837 gene locus_tag LOCUS_03460 3521 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 4950 6728 gene locus_tag LOCUS_03470 gene mnmG 4950 6728 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94613 protein_id gnl|my_center|LOCUS_03470 6978 8189 gene locus_tag LOCUS_03480 gene cyaA 6978 8189 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247973.1 protein_id gnl|my_center|LOCUS_03480 8312 9133 gene locus_tag LOCUS_03490 8312 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 9174 9860 gene locus_tag LOCUS_03500 9174 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 9857 10735 gene locus_tag LOCUS_03510 9857 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 10881 11678 gene locus_tag LOCUS_03520 10881 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 11745 12719 gene locus_tag LOCUS_03530 11745 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 >Feature sequence0027 764 456 gene locus_tag LOCUS_03540 764 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 1413 796 gene locus_tag LOCUS_03550 1413 796 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809641.1 protein_id gnl|my_center|LOCUS_03550 4540 1406 gene locus_tag LOCUS_03560 gene czcA 4540 1406 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123153.1 protein_id gnl|my_center|LOCUS_03560 5744 4551 gene locus_tag LOCUS_03570 5744 4551 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941496.1 protein_id gnl|my_center|LOCUS_03570 6645 5731 gene locus_tag LOCUS_03580 6645 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 6727 6873 gene locus_tag LOCUS_03590 6727 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 7635 7264 gene locus_tag LOCUS_03600 7635 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 9800 7632 gene locus_tag LOCUS_03610 9800 7632 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269255.1 protein_id gnl|my_center|LOCUS_03610 9948 10505 gene locus_tag LOCUS_03620 9948 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 10564 10995 gene locus_tag LOCUS_03630 gene merR 10564 10995 CDS product mercuric resistance operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2Q8 protein_id gnl|my_center|LOCUS_03630 11699 11520 gene locus_tag LOCUS_03640 11699 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 11667 12356 gene locus_tag LOCUS_03650 11667 12356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 12605 12883 gene locus_tag LOCUS_03660 12605 12883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422948.1 protein_id gnl|my_center|LOCUS_03660 >Feature sequence0028 2 958 gene locus_tag LOCUS_03670 2 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 955 4419 gene locus_tag LOCUS_03680 955 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 4416 6020 gene locus_tag LOCUS_03690 4416 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 6380 6766 gene locus_tag LOCUS_03700 6380 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 6940 7572 gene locus_tag LOCUS_03710 6940 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 7655 8233 gene locus_tag LOCUS_03720 7655 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 8233 8784 gene locus_tag LOCUS_03730 8233 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 9244 10554 gene locus_tag LOCUS_03740 9244 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 10554 11183 gene locus_tag LOCUS_03750 10554 11183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 11454 12803 gene locus_tag LOCUS_03760 11454 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence0029 683 3238 gene locus_tag LOCUS_03770 683 3238 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015699.1 protein_id gnl|my_center|LOCUS_03770 4344 3235 gene locus_tag LOCUS_03780 4344 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 5204 4464 gene locus_tag LOCUS_03790 5204 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 7141 5369 gene locus_tag LOCUS_03800 7141 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 7466 7903 gene locus_tag LOCUS_03810 7466 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 8657 8115 gene locus_tag LOCUS_03820 8657 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 9191 8841 gene locus_tag LOCUS_03830 9191 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 9505 9212 gene locus_tag LOCUS_03840 9505 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 9480 9665 gene locus_tag LOCUS_03850 9480 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 9750 9983 gene locus_tag LOCUS_03860 9750 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 10155 10289 gene locus_tag LOCUS_03870 10155 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 12400 10385 gene locus_tag LOCUS_03880 12400 10385 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89T74 protein_id gnl|my_center|LOCUS_03880 >Feature sequence0030 331 603 gene locus_tag LOCUS_03890 331 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 871 623 gene locus_tag LOCUS_03900 871 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 1017 1523 gene locus_tag LOCUS_03910 1017 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 1623 3221 gene locus_tag LOCUS_03920 1623 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 3236 4135 gene locus_tag LOCUS_03930 3236 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 4180 5793 gene locus_tag LOCUS_03940 4180 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 6708 5797 gene locus_tag LOCUS_03950 6708 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 8436 7135 gene locus_tag LOCUS_03960 8436 7135 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_03960 10634 8916 gene locus_tag LOCUS_03970 10634 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 11197 10637 gene locus_tag LOCUS_03980 11197 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 11713 11213 gene locus_tag LOCUS_03990 11713 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 12684 11782 gene locus_tag LOCUS_04000 12684 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 >Feature sequence0031 454 1479 gene locus_tag LOCUS_04010 454 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 1476 3410 gene locus_tag LOCUS_04020 1476 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 3407 5167 gene locus_tag LOCUS_04030 3407 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 5167 11916 gene locus_tag LOCUS_04040 5167 11916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 11978 12751 gene locus_tag LOCUS_04050 11978 12751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 >Feature sequence0032 2229 619 gene locus_tag LOCUS_04060 gene purH 2229 619 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU9 protein_id gnl|my_center|LOCUS_04060 2811 2317 gene locus_tag LOCUS_04070 2811 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 3516 2938 gene locus_tag LOCUS_04080 3516 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 4994 4107 gene locus_tag LOCUS_04090 4994 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 7053 5134 gene locus_tag LOCUS_04100 gene dnaK 7053 5134 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_04100 9776 7362 gene locus_tag LOCUS_04110 gene lon 9776 7362 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2J0 protein_id gnl|my_center|LOCUS_04110 9999 11012 gene locus_tag LOCUS_04120 9999 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 11196 11020 gene locus_tag LOCUS_04130 11196 11020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 11416 12288 gene locus_tag LOCUS_04140 11416 12288 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_04140 >Feature sequence0033 1 888 gene locus_tag LOCUS_04150 1 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 1451 996 gene locus_tag LOCUS_04160 1451 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 2321 1632 gene locus_tag LOCUS_04170 2321 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 2914 2318 gene locus_tag LOCUS_04180 2914 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 3092 3595 gene locus_tag LOCUS_04190 3092 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 4167 3586 gene locus_tag LOCUS_04200 4167 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 8009 4164 gene locus_tag LOCUS_04210 8009 4164 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_04210 10118 8037 gene locus_tag LOCUS_04220 10118 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 11527 10115 gene locus_tag LOCUS_04230 11527 10115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 12016 11612 gene locus_tag LOCUS_04240 12016 11612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 >Feature sequence0034 418 2196 gene locus_tag LOCUS_04250 418 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3560 2193 gene locus_tag LOCUS_04260 3560 2193 CDS product type I restriction endonuclease MjaXP subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890088.1 protein_id gnl|my_center|LOCUS_04260 5566 3557 gene locus_tag LOCUS_04270 5566 3557 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_04270 6085 5702 gene locus_tag LOCUS_04280 gene rpsI 6085 5702 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73PE6 protein_id gnl|my_center|LOCUS_04280 6563 6129 gene locus_tag LOCUS_04290 gene rplM 6563 6129 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLV7 protein_id gnl|my_center|LOCUS_04290 7023 8027 gene locus_tag LOCUS_04300 7023 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 8074 8973 gene locus_tag LOCUS_04310 gene nadK 8074 8973 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH6 protein_id gnl|my_center|LOCUS_04310 8992 9726 gene locus_tag LOCUS_04320 8992 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_04320 11087 9681 gene locus_tag LOCUS_04330 11087 9681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 12388 11084 gene locus_tag LOCUS_04340 12388 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 >Feature sequence0035 335 7315 gene locus_tag LOCUS_04350 335 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 9799 8729 gene locus_tag LOCUS_04360 9799 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence0036 3068 2199 gene locus_tag LOCUS_04370 3068 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 3406 4386 gene locus_tag LOCUS_04380 3406 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 4871 4425 gene locus_tag LOCUS_04390 4871 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 5400 6023 gene locus_tag LOCUS_04400 5400 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 6766 8538 gene locus_tag LOCUS_04410 6766 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 8641 11271 gene locus_tag LOCUS_04420 8641 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 11172 11945 gene locus_tag LOCUS_04430 11172 11945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence0037 <1 877 gene locus_tag LOCUS_04440 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938554.1:glutamine synthetase 1457 999 gene locus_tag LOCUS_04450 1457 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 2230 1484 gene locus_tag LOCUS_04460 gene apaH 2230 1484 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGT6 protein_id gnl|my_center|LOCUS_04460 2251 2619 gene locus_tag LOCUS_04470 2251 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 4173 2725 gene locus_tag LOCUS_04480 4173 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 5033 4470 gene locus_tag LOCUS_04490 5033 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 5144 5692 gene locus_tag LOCUS_04500 5144 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 5830 6846 gene locus_tag LOCUS_04510 5830 6846 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_04510 6953 7537 gene locus_tag LOCUS_04520 6953 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 8684 7542 gene locus_tag LOCUS_04530 8684 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 8790 10127 gene locus_tag LOCUS_04540 8790 10127 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083372.1 protein_id gnl|my_center|LOCUS_04540 10228 10782 gene locus_tag LOCUS_04550 10228 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 11190 10813 gene locus_tag LOCUS_04560 11190 10813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence0038 191 820 gene locus_tag LOCUS_04570 gene hisB 191 820 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI3 protein_id gnl|my_center|LOCUS_04570 867 2501 gene locus_tag LOCUS_04580 867 2501 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_04580 2525 2932 gene locus_tag LOCUS_04590 2525 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 2985 3058 gene locus_tag LOCUS_t00070 2985 3058 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3146 3961 gene locus_tag LOCUS_04600 3146 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 4015 4731 gene locus_tag LOCUS_04610 4015 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5026 4808 gene locus_tag LOCUS_04620 5026 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 4908 5219 gene locus_tag LOCUS_04630 4908 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 5298 6386 gene locus_tag LOCUS_04640 5298 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 7476 6394 gene locus_tag LOCUS_04650 7476 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 7780 8793 gene locus_tag LOCUS_04660 gene recA 7780 8793 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5X5 protein_id gnl|my_center|LOCUS_04660 10803 8857 gene locus_tag LOCUS_04670 10803 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 >Feature sequence0039 844 4725 gene locus_tag LOCUS_04680 844 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 4765 6216 gene locus_tag LOCUS_04690 4765 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 6438 6716 gene locus_tag LOCUS_04700 6438 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 6949 9045 gene locus_tag LOCUS_04710 6949 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 9248 9018 gene locus_tag LOCUS_04720 9248 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 9555 10361 gene locus_tag LOCUS_04730 9555 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 >Feature sequence0040 2731 1058 gene locus_tag LOCUS_04740 2731 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 3424 2780 gene locus_tag LOCUS_04750 3424 2780 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_04750 3592 4245 gene locus_tag LOCUS_04760 3592 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 4388 4786 gene locus_tag LOCUS_04770 4388 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 6961 4823 gene locus_tag LOCUS_04780 6961 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 7053 7532 gene locus_tag LOCUS_04790 7053 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 9080 7581 gene locus_tag LOCUS_04800 gene glpK 9080 7581 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PBZ5 protein_id gnl|my_center|LOCUS_04800 9622 10101 gene locus_tag LOCUS_04810 9622 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 10362 10889 gene locus_tag LOCUS_04820 gene aroK 10362 10889 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DN7 protein_id gnl|my_center|LOCUS_04820 >Feature sequence0041 1736 2719 gene locus_tag LOCUS_04830 1736 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 2881 4236 gene locus_tag LOCUS_04840 gene dhs1 2881 4236 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC31 protein_id gnl|my_center|LOCUS_04840 6100 4259 gene locus_tag LOCUS_04850 6100 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 7101 6283 gene locus_tag LOCUS_04860 7101 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 7509 8426 gene locus_tag LOCUS_04870 7509 8426 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403300.1 protein_id gnl|my_center|LOCUS_04870 8504 9385 gene locus_tag LOCUS_04880 8504 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_04880 9512 10783 gene locus_tag LOCUS_04890 gene adcK4 9512 10783 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_04890 <11788 10780 gene locus_tag LOCUS_04900 <11788 10780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393062.1:twitching motility protein PilT >Feature sequence0042 1072 2169 gene locus_tag LOCUS_04910 1072 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 2253 3893 gene locus_tag LOCUS_04920 2253 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 3918 4898 gene locus_tag LOCUS_04930 3918 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 5318 5920 gene locus_tag LOCUS_04940 5318 5920 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 protein_id gnl|my_center|LOCUS_04940 6044 6913 gene locus_tag LOCUS_04950 6044 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 6944 7807 gene locus_tag LOCUS_04960 6944 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 8135 7872 gene locus_tag LOCUS_04970 8135 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 8640 9050 gene locus_tag LOCUS_04980 8640 9050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 8947 9465 gene locus_tag LOCUS_04990 8947 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 9597 10088 gene locus_tag LOCUS_05000 9597 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence0043 3970 2249 gene locus_tag LOCUS_05010 3970 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 5434 4289 gene locus_tag LOCUS_05020 5434 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098754.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence0044 2432 834 gene locus_tag LOCUS_05030 2432 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4999 2561 gene locus_tag LOCUS_05040 4999 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 5130 5036 gene locus_tag LOCUS_t00080 5130 5036 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 5829 5197 gene locus_tag LOCUS_05050 5829 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 6026 7135 gene locus_tag LOCUS_05060 gene dnaJ 6026 7135 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H58 protein_id gnl|my_center|LOCUS_05060 7862 7203 gene locus_tag LOCUS_05070 7862 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 8200 7922 gene locus_tag LOCUS_05080 8200 7922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 9981 8344 gene locus_tag LOCUS_05090 gene pruA 9981 8344 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_05090 10726 10097 gene locus_tag LOCUS_05100 10726 10097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 >Feature sequence0045 93 1151 gene locus_tag LOCUS_05110 93 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 1244 2734 gene locus_tag LOCUS_05120 gene murF 1244 2734 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU0 protein_id gnl|my_center|LOCUS_05120 3328 2786 gene locus_tag LOCUS_05130 3328 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_05130 4310 3462 gene locus_tag LOCUS_05140 4310 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143543.1 protein_id gnl|my_center|LOCUS_05140 5242 4340 gene locus_tag LOCUS_05150 5242 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 6402 5329 gene locus_tag LOCUS_05160 6402 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 7493 6603 gene locus_tag LOCUS_05170 7493 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 8044 8514 gene locus_tag LOCUS_05180 8044 8514 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73LE0 protein_id gnl|my_center|LOCUS_05180 8665 10821 gene locus_tag LOCUS_05190 8665 10821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 >Feature sequence0046 2721 460 gene locus_tag LOCUS_05200 2721 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 2882 2667 gene locus_tag LOCUS_05210 2882 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 4848 2875 gene locus_tag LOCUS_05220 4848 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 6006 4849 gene locus_tag LOCUS_05230 6006 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 6947 6003 gene locus_tag LOCUS_05240 6947 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 7657 6944 gene locus_tag LOCUS_05250 7657 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 8535 7669 gene locus_tag LOCUS_05260 8535 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 9319 8582 gene locus_tag LOCUS_05270 9319 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 9883 9419 gene locus_tag LOCUS_05280 9883 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 10383 9880 gene locus_tag LOCUS_05290 10383 9880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 11140 10397 gene locus_tag LOCUS_05300 11140 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 >Feature sequence0047 446 300 gene locus_tag LOCUS_05310 446 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 1238 453 gene locus_tag LOCUS_05320 gene sfsA 1238 453 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61664 protein_id gnl|my_center|LOCUS_05320 3055 1271 gene locus_tag LOCUS_05330 3055 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 4110 3151 gene locus_tag LOCUS_05340 4110 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 4967 4389 gene locus_tag LOCUS_05350 4967 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 5072 5647 gene locus_tag LOCUS_05360 5072 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 6659 5733 gene locus_tag LOCUS_05370 6659 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 6864 7826 gene locus_tag LOCUS_05380 6864 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 7833 8597 gene locus_tag LOCUS_05390 gene queC 7833 8597 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWK2 protein_id gnl|my_center|LOCUS_05390 >Feature sequence0048 942 1835 gene locus_tag LOCUS_05400 942 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 1832 2233 gene locus_tag LOCUS_05410 1832 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 2274 2960 gene locus_tag LOCUS_05420 2274 2960 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223927.1 protein_id gnl|my_center|LOCUS_05420 4143 2983 gene locus_tag LOCUS_05430 4143 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 4537 4124 gene locus_tag LOCUS_05440 4537 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 4965 4540 gene locus_tag LOCUS_05450 4965 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 6547 5060 gene locus_tag LOCUS_05460 6547 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 7031 8254 gene locus_tag LOCUS_05470 7031 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 8669 9892 gene locus_tag LOCUS_05480 8669 9892 CDS product GDL motif peptide-associated radical SAM/SPASM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200682.1 protein_id gnl|my_center|LOCUS_05480 10361 9900 gene locus_tag LOCUS_05490 10361 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 >Feature sequence0049 2277 1789 gene locus_tag LOCUS_05500 2277 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 2852 2373 gene locus_tag LOCUS_05510 2852 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 3132 2950 gene locus_tag LOCUS_05520 3132 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 4128 3412 gene locus_tag LOCUS_05530 4128 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 4416 5753 gene locus_tag LOCUS_05540 gene bioA 4416 5753 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038009.1 protein_id gnl|my_center|LOCUS_05540 5750 7126 gene locus_tag LOCUS_05550 5750 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 8085 7234 gene locus_tag LOCUS_05560 8085 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 8439 10073 gene locus_tag LOCUS_05570 8439 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 10110 10895 gene locus_tag LOCUS_05580 10110 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence0050 1443 139 gene locus_tag LOCUS_05590 1443 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 1823 4450 gene locus_tag LOCUS_05600 1823 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 6591 4564 gene locus_tag LOCUS_05610 6591 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 10538 6945 gene locus_tag LOCUS_05620 10538 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 >Feature sequence0051 304 741 gene locus_tag LOCUS_05630 304 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 971 1405 gene locus_tag LOCUS_05640 gene merR 971 1405 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166628.1 protein_id gnl|my_center|LOCUS_05640 1395 2201 gene locus_tag LOCUS_05650 1395 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2198 2461 gene locus_tag LOCUS_05660 2198 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 2458 2844 gene locus_tag LOCUS_05670 2458 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 3563 2940 gene locus_tag LOCUS_05680 3563 2940 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809641.1 protein_id gnl|my_center|LOCUS_05680 4265 3687 gene locus_tag LOCUS_05690 4265 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 5182 4280 gene locus_tag LOCUS_05700 5182 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 5731 5276 gene locus_tag LOCUS_05710 5731 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 5907 6311 gene locus_tag LOCUS_05720 5907 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 6396 7808 gene locus_tag LOCUS_05730 gene czcC 6396 7808 CDS product outer membrane protein CzcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_05730 7805 9922 gene locus_tag LOCUS_05740 7805 9922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 >Feature sequence0052 <1 789 gene locus_tag LOCUS_05750 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5NGR3:protein translocase subunit SecA 844 1371 gene locus_tag LOCUS_05760 gene yrrK 844 1371 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34634 protein_id gnl|my_center|LOCUS_05760 1368 2591 gene locus_tag LOCUS_05770 1368 2591 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933876.1 protein_id gnl|my_center|LOCUS_05770 3530 2601 gene locus_tag LOCUS_05780 3530 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3702 4760 gene locus_tag LOCUS_05790 3702 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 5559 4777 gene locus_tag LOCUS_05800 gene bioD 5559 4777 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NA77 protein_id gnl|my_center|LOCUS_05800 6967 5708 gene locus_tag LOCUS_05810 6967 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 7430 6999 gene locus_tag LOCUS_05820 7430 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 7873 7499 gene locus_tag LOCUS_05830 7873 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence0053 2534 648 gene locus_tag LOCUS_05840 2534 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 3529 2534 gene locus_tag LOCUS_05850 3529 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 4145 3534 gene locus_tag LOCUS_05860 4145 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 5014 4148 gene locus_tag LOCUS_05870 5014 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 5889 5086 gene locus_tag LOCUS_05880 5889 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 6722 6258 gene locus_tag LOCUS_05890 6722 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 7461 6724 gene locus_tag LOCUS_05900 7461 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 8640 7759 gene locus_tag LOCUS_05910 8640 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 9003 8755 gene locus_tag LOCUS_05920 9003 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 9074 9502 gene locus_tag LOCUS_05930 9074 9502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 10095 9499 gene locus_tag LOCUS_05940 10095 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 10981 10766 gene locus_tag LOCUS_05950 10981 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 >Feature sequence0054 991 3489 gene locus_tag LOCUS_05960 991 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3664 4419 gene locus_tag LOCUS_05970 3664 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 5003 4479 gene locus_tag LOCUS_05980 5003 4479 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_05980 4884 5147 gene locus_tag LOCUS_05990 4884 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 5717 6298 gene locus_tag LOCUS_06000 5717 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 7251 6877 gene locus_tag LOCUS_06010 7251 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 7700 7254 gene locus_tag LOCUS_06020 7700 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 8418 7921 gene locus_tag LOCUS_06030 8418 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 9032 9397 gene locus_tag LOCUS_06040 9032 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 9542 9856 gene locus_tag LOCUS_06050 9542 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 >Feature sequence0055 221 1396 gene locus_tag LOCUS_06060 221 1396 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074378.1 protein_id gnl|my_center|LOCUS_06060 3143 1620 gene locus_tag LOCUS_06070 3143 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 3486 3292 gene locus_tag LOCUS_06080 3486 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 3469 3660 gene locus_tag LOCUS_06090 3469 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4158 4520 gene locus_tag LOCUS_06100 4158 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4517 5905 gene locus_tag LOCUS_06110 4517 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5924 6115 gene locus_tag LOCUS_06120 5924 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 6279 6890 gene locus_tag LOCUS_06130 6279 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6971 7306 gene locus_tag LOCUS_06140 6971 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 7303 9279 gene locus_tag LOCUS_06150 7303 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 9459 10283 gene locus_tag LOCUS_06160 9459 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 10316 10657 gene locus_tag LOCUS_06170 10316 10657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 >Feature sequence0056 192 1622 gene locus_tag LOCUS_06180 192 1622 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_06180 2797 2459 gene locus_tag LOCUS_06190 2797 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 4119 2968 gene locus_tag LOCUS_06200 4119 2968 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_06200 6552 4168 gene locus_tag LOCUS_06210 6552 4168 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486377.1 protein_id gnl|my_center|LOCUS_06210 7149 9821 gene locus_tag LOCUS_06220 7149 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 10687 9845 gene locus_tag LOCUS_06230 10687 9845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence0057 >Feature sequence0058 725 2014 gene locus_tag LOCUS_06240 725 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 2034 3689 gene locus_tag LOCUS_06250 2034 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 3711 4385 gene locus_tag LOCUS_06260 3711 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 4357 5499 gene locus_tag LOCUS_06270 4357 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 5800 7539 gene locus_tag LOCUS_06280 5800 7539 CDS product ovoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119824.1 protein_id gnl|my_center|LOCUS_06280 7701 9128 gene locus_tag LOCUS_06290 7701 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 9921 9196 gene locus_tag LOCUS_06300 9921 9196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 >Feature sequence0059 1818 829 gene locus_tag LOCUS_06310 1818 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 2600 1815 gene locus_tag LOCUS_06320 gene folP 2600 1815 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942453.1 protein_id gnl|my_center|LOCUS_06320 4278 3025 gene locus_tag LOCUS_06330 4278 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4201 4368 gene locus_tag LOCUS_06340 4201 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 4794 4624 gene locus_tag LOCUS_06350 4794 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5846 5196 gene locus_tag LOCUS_06360 5846 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 6403 5921 gene locus_tag LOCUS_06370 gene fabZ 6403 5921 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2W6 protein_id gnl|my_center|LOCUS_06370 7121 6555 gene locus_tag LOCUS_06380 7121 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 7705 7166 gene locus_tag LOCUS_06390 7705 7166 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946255.1 protein_id gnl|my_center|LOCUS_06390 10582 7994 gene locus_tag LOCUS_06400 gene yaeT 10582 7994 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT3 protein_id gnl|my_center|LOCUS_06400 >Feature sequence0060 3574 2336 gene locus_tag LOCUS_06410 gene gdhA 3574 2336 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPH7 protein_id gnl|my_center|LOCUS_06410 4610 3705 gene locus_tag LOCUS_06420 4610 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 4627 4959 gene locus_tag LOCUS_06430 4627 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 5565 8090 gene locus_tag LOCUS_06440 5565 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 8119 9177 gene locus_tag LOCUS_06450 8119 9177 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_06450 9810 9553 gene locus_tag LOCUS_06460 9810 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 >Feature sequence0061 2634 2710 gene locus_tag LOCUS_t00090 2634 2710 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2800 2876 gene locus_tag LOCUS_t00100 2800 2876 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2922 2997 gene locus_tag LOCUS_t00110 2922 2997 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3089 3171 gene locus_tag LOCUS_t00120 3089 3171 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3201 3285 gene locus_tag LOCUS_t00130 3201 3285 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3300 3382 gene locus_tag LOCUS_t00140 3300 3382 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3408 3490 gene locus_tag LOCUS_t00150 3408 3490 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3533 3617 gene locus_tag LOCUS_t00160 3533 3617 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4422 3664 gene locus_tag LOCUS_06470 4422 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 4876 4520 gene locus_tag LOCUS_06480 4876 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 5036 5521 gene locus_tag LOCUS_06490 gene fur 5036 5521 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_06490 5928 6308 gene locus_tag LOCUS_06500 5928 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 6475 7650 gene locus_tag LOCUS_06510 6475 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 7706 8437 gene locus_tag LOCUS_06520 7706 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 8434 9285 gene locus_tag LOCUS_06530 8434 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 >Feature sequence0062 1404 2672 gene locus_tag LOCUS_06540 1404 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 3070 2726 gene locus_tag LOCUS_06550 3070 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 3645 7016 gene locus_tag LOCUS_06560 3645 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 8755 7301 gene locus_tag LOCUS_06570 8755 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 <10623 8793 gene locus_tag LOCUS_06580 <10623 8793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085646.1:ATPase >Feature sequence0063 323 1594 gene locus_tag LOCUS_06590 323 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 1648 2079 gene locus_tag LOCUS_06600 1648 2079 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_06600 2089 2571 gene locus_tag LOCUS_06610 2089 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407422.1 protein_id gnl|my_center|LOCUS_06610 2752 2824 gene locus_tag LOCUS_t00170 2752 2824 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3141 3695 gene locus_tag LOCUS_06620 3141 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 3870 5336 gene locus_tag LOCUS_06630 3870 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 5425 7533 gene locus_tag LOCUS_06640 5425 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 7823 9442 gene locus_tag LOCUS_06650 7823 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 9483 10190 gene locus_tag LOCUS_06660 9483 10190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence0064 2529 1774 gene locus_tag LOCUS_06670 2529 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3684 2617 gene locus_tag LOCUS_06680 3684 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4777 3713 gene locus_tag LOCUS_06690 4777 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 5563 4784 gene locus_tag LOCUS_06700 5563 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 6350 5580 gene locus_tag LOCUS_06710 6350 5580 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121261.1 protein_id gnl|my_center|LOCUS_06710 7142 6402 gene locus_tag LOCUS_06720 7142 6402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_06720 7810 7157 gene locus_tag LOCUS_06730 7810 7157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 8141 9934 gene locus_tag LOCUS_06740 8141 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence0065 2754 835 gene locus_tag LOCUS_06750 2754 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 3278 3784 gene locus_tag LOCUS_06760 3278 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 3781 4749 gene locus_tag LOCUS_06770 3781 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 4746 5954 gene locus_tag LOCUS_06780 4746 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 7388 6054 gene locus_tag LOCUS_06790 7388 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 <10336 8083 gene locus_tag LOCUS_06800 <10336 8083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877386.1:B12-binding domain-containing radical SAM protein >Feature sequence0066 1844 3370 gene locus_tag LOCUS_06810 1844 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 6489 3682 gene locus_tag LOCUS_06820 6489 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 5557 5650 gene locus_tag LOCUS_t00180 5557 5650 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6591 7007 gene locus_tag LOCUS_06830 6591 7007 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817449.1 protein_id gnl|my_center|LOCUS_06830 7500 7018 gene locus_tag LOCUS_06840 7500 7018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 7836 8441 gene locus_tag LOCUS_06850 7836 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 10023 8455 gene locus_tag LOCUS_06860 10023 8455 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence0067 1484 213 gene locus_tag LOCUS_06870 1484 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_06870 1687 2997 gene locus_tag LOCUS_06880 1687 2997 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_06880 3040 5055 gene locus_tag LOCUS_06890 3040 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026880.1 protein_id gnl|my_center|LOCUS_06890 5708 5097 gene locus_tag LOCUS_06900 gene udk 5708 5097 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4Y5 protein_id gnl|my_center|LOCUS_06900 6462 5827 gene locus_tag LOCUS_06910 6462 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 7980 6523 gene locus_tag LOCUS_06920 7980 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 9964 8531 gene locus_tag LOCUS_06930 9964 8531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 >Feature sequence0068 83 9 gene locus_tag LOCUS_t00190 83 9 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 227 658 gene locus_tag LOCUS_06940 227 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 1189 731 gene locus_tag LOCUS_06950 1189 731 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895549.1 protein_id gnl|my_center|LOCUS_06950 2424 1219 gene locus_tag LOCUS_06960 2424 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 2570 3289 gene locus_tag LOCUS_06970 2570 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142774.1 protein_id gnl|my_center|LOCUS_06970 3702 5030 gene locus_tag LOCUS_06980 gene czcB 3702 5030 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037294.1 protein_id gnl|my_center|LOCUS_06980 5055 8819 gene locus_tag LOCUS_06990 5055 8819 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence0069 1606 1268 gene locus_tag LOCUS_07000 1606 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 3160 1673 gene locus_tag LOCUS_07010 3160 1673 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_07010 3470 5287 gene locus_tag LOCUS_07020 gene sppA 3470 5287 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEG2 protein_id gnl|my_center|LOCUS_07020 6208 5294 gene locus_tag LOCUS_07030 6208 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 6285 6830 gene locus_tag LOCUS_07040 6285 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 7014 6941 gene locus_tag LOCUS_t00200 7014 6941 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7095 7023 gene locus_tag LOCUS_t00210 7095 7023 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7318 7245 gene locus_tag LOCUS_t00220 7318 7245 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7593 7520 gene locus_tag LOCUS_t00230 7593 7520 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7723 7651 gene locus_tag LOCUS_t00240 7723 7651 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7870 7798 gene locus_tag LOCUS_t00250 7870 7798 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7981 7908 gene locus_tag LOCUS_t00260 7981 7908 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 8072 7997 gene locus_tag LOCUS_t00270 8072 7997 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 8240 8168 gene locus_tag LOCUS_t00280 8240 8168 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8333 8262 gene locus_tag LOCUS_t00290 8333 8262 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8558 8486 gene locus_tag LOCUS_t00300 8558 8486 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8767 8696 gene locus_tag LOCUS_t00310 8767 8696 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8845 8773 gene locus_tag LOCUS_t00320 8845 8773 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0070 1385 504 gene locus_tag LOCUS_07050 1385 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 1882 1487 gene locus_tag LOCUS_07060 1882 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 1997 2866 gene locus_tag LOCUS_07070 1997 2866 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_07070 2933 3577 gene locus_tag LOCUS_07080 2933 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4031 4471 gene locus_tag LOCUS_07090 4031 4471 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925584.1 protein_id gnl|my_center|LOCUS_07090 5614 4478 gene locus_tag LOCUS_07100 5614 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 7082 5844 gene locus_tag LOCUS_07110 7082 5844 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390244.1 protein_id gnl|my_center|LOCUS_07110 7725 8594 gene locus_tag LOCUS_07120 7725 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence0071 1525 1256 gene locus_tag LOCUS_07130 1525 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 2295 1654 gene locus_tag LOCUS_07140 2295 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 2849 2298 gene locus_tag LOCUS_07150 2849 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 3165 2974 gene locus_tag LOCUS_07160 3165 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07160 4130 3444 gene locus_tag LOCUS_07170 4130 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07170 4870 4214 gene locus_tag LOCUS_07180 4870 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 9646 6005 gene locus_tag LOCUS_07190 9646 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 10052 9672 gene locus_tag LOCUS_07200 10052 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence0072 1488 13 gene locus_tag LOCUS_07210 gene nadA 1488 13 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_07210 3280 1553 gene locus_tag LOCUS_07220 3280 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 3651 3415 gene locus_tag LOCUS_07230 3651 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3748 3996 gene locus_tag LOCUS_07240 3748 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4269 4523 gene locus_tag LOCUS_07250 4269 4523 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DU1 protein_id gnl|my_center|LOCUS_07250 4542 5162 gene locus_tag LOCUS_07260 4542 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 5159 6514 gene locus_tag LOCUS_07270 5159 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 6511 6888 gene locus_tag LOCUS_07280 gene rplS 6511 6888 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31742 protein_id gnl|my_center|LOCUS_07280 6920 7315 gene locus_tag LOCUS_07290 6920 7315 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ1 protein_id gnl|my_center|LOCUS_07290 8024 7425 gene locus_tag LOCUS_07300 8024 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 >Feature sequence0073 462 2417 gene locus_tag LOCUS_07310 462 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 3136 2450 gene locus_tag LOCUS_07320 3136 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 5124 3607 gene locus_tag LOCUS_07330 5124 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_07330 5565 6053 gene locus_tag LOCUS_07340 5565 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 8369 6075 gene locus_tag LOCUS_07350 8369 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence0074 490 119 gene locus_tag LOCUS_07360 490 119 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535286.1 protein_id gnl|my_center|LOCUS_07360 987 547 gene locus_tag LOCUS_07370 987 547 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_07370 1066 1290 gene locus_tag LOCUS_07380 1066 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 3976 1298 gene locus_tag LOCUS_07390 3976 1298 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403520.1 protein_id gnl|my_center|LOCUS_07390 4489 6792 gene locus_tag LOCUS_07400 4489 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence0075 <1 1008 gene locus_tag LOCUS_07410 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035842.1:cystathionine gamma-synthase 1501 1106 gene locus_tag LOCUS_07420 1501 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 2160 1513 gene locus_tag LOCUS_07430 2160 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2799 3464 gene locus_tag LOCUS_07440 2799 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3742 3485 gene locus_tag LOCUS_07450 3742 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 4070 3798 gene locus_tag LOCUS_07460 4070 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4648 4139 gene locus_tag LOCUS_07470 4648 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 5289 4645 gene locus_tag LOCUS_07480 5289 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 8672 5517 gene locus_tag LOCUS_07490 8672 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 9412 8723 gene locus_tag LOCUS_07500 9412 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence0076 226 456 gene locus_tag LOCUS_07510 226 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 470 1453 gene locus_tag LOCUS_07520 470 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1461 3023 gene locus_tag LOCUS_07530 gene fadD 1461 3023 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971788.1 protein_id gnl|my_center|LOCUS_07530 3020 4951 gene locus_tag LOCUS_07540 3020 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 6057 5260 gene locus_tag LOCUS_07550 6057 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 6647 7576 gene locus_tag LOCUS_07560 6647 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 7689 8591 gene locus_tag LOCUS_07570 7689 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 8684 9637 gene locus_tag LOCUS_07580 8684 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence0077 2421 490 gene locus_tag LOCUS_07590 2421 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 3949 2603 gene locus_tag LOCUS_07600 3949 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 6260 3969 gene locus_tag LOCUS_07610 6260 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 8058 6793 gene locus_tag LOCUS_07620 8058 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 8860 8117 gene locus_tag LOCUS_07630 8860 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964914.1 protein_id gnl|my_center|LOCUS_07630 9109 8903 gene locus_tag LOCUS_07640 9109 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence0078 <1 832 gene locus_tag LOCUS_07650 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92WJ7:histidine kinase 1857 841 gene locus_tag LOCUS_07660 1857 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 2949 1918 gene locus_tag LOCUS_07670 2949 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 4792 3089 gene locus_tag LOCUS_07680 4792 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 4911 6812 gene locus_tag LOCUS_07690 gene argS 4911 6812 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0R5 protein_id gnl|my_center|LOCUS_07690 6910 7713 gene locus_tag LOCUS_07700 6910 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 7938 8396 gene locus_tag LOCUS_07710 7938 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 8512 9378 gene locus_tag LOCUS_07720 8512 9378 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence0079 1321 2508 gene locus_tag LOCUS_07730 1321 2508 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_07730 3549 2518 gene locus_tag LOCUS_07740 gene hpnA 3549 2518 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_07740 4308 3721 gene locus_tag LOCUS_07750 4308 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 4564 4421 gene locus_tag LOCUS_07760 4564 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 6783 5344 gene locus_tag LOCUS_07770 6783 5344 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Z74 protein_id gnl|my_center|LOCUS_07770 7151 8533 gene locus_tag LOCUS_07780 7151 8533 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence0080 340 846 gene locus_tag LOCUS_07790 340 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 2729 903 gene locus_tag LOCUS_07800 2729 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 4432 3164 gene locus_tag LOCUS_07810 4432 3164 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224741.1 protein_id gnl|my_center|LOCUS_07810 4595 5767 gene locus_tag LOCUS_07820 4595 5767 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939045.1 protein_id gnl|my_center|LOCUS_07820 5779 6861 gene locus_tag LOCUS_07830 5779 6861 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710628.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence0081 214 6123 gene locus_tag LOCUS_07840 214 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 6120 7766 gene locus_tag LOCUS_07850 6120 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 7753 8676 gene locus_tag LOCUS_07860 7753 8676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 8673 8936 gene locus_tag LOCUS_07870 8673 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence0082 409 876 gene locus_tag LOCUS_07880 409 876 CDS product thioesterase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 protein_id gnl|my_center|LOCUS_07880 952 2199 gene locus_tag LOCUS_07890 952 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 3985 2222 gene locus_tag LOCUS_07900 3985 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 4178 4717 gene locus_tag LOCUS_07910 4178 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 5744 4698 gene locus_tag LOCUS_07920 5744 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 6465 5791 gene locus_tag LOCUS_07930 6465 5791 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870617.1 protein_id gnl|my_center|LOCUS_07930 7951 6470 gene locus_tag LOCUS_07940 7951 6470 CDS product potassium transporter KefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence0083 79 2169 gene locus_tag LOCUS_07950 79 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 2812 2180 gene locus_tag LOCUS_07960 2812 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 3309 2854 gene locus_tag LOCUS_07970 3309 2854 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974585.1 protein_id gnl|my_center|LOCUS_07970 3466 4419 gene locus_tag LOCUS_07980 3466 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 5578 4703 gene locus_tag LOCUS_07990 5578 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 7368 5608 gene locus_tag LOCUS_08000 7368 5608 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705083.1 protein_id gnl|my_center|LOCUS_08000 7798 7361 gene locus_tag LOCUS_08010 7798 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 8970 7969 gene locus_tag LOCUS_08020 8970 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 >Feature sequence0084 <1 1151 gene locus_tag LOCUS_08030 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141814.1:sensor histidine kinase 1221 3368 gene locus_tag LOCUS_08040 1221 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 3902 3405 gene locus_tag LOCUS_08050 3902 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 4077 4601 gene locus_tag LOCUS_08060 4077 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 7134 4609 gene locus_tag LOCUS_08070 7134 4609 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_08070 8374 7097 gene locus_tag LOCUS_08080 8374 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence0085 1018 716 gene locus_tag LOCUS_08090 1018 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 1176 2648 gene locus_tag LOCUS_08100 1176 2648 CDS product endoglycosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224247.1 protein_id gnl|my_center|LOCUS_08100 2795 3940 gene locus_tag LOCUS_08110 2795 3940 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937915.1 protein_id gnl|my_center|LOCUS_08110 3955 4806 gene locus_tag LOCUS_08120 3955 4806 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720000.1 protein_id gnl|my_center|LOCUS_08120 4809 5759 gene locus_tag LOCUS_08130 4809 5759 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920179.1 protein_id gnl|my_center|LOCUS_08130 5756 6553 gene locus_tag LOCUS_08140 5756 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 7897 6614 gene locus_tag LOCUS_08150 7897 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 7998 8888 gene locus_tag LOCUS_08160 7998 8888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 >Feature sequence0086 <1 555 gene locus_tag LOCUS_08170 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UZ20:histidine--tRNA ligase 598 2103 gene locus_tag LOCUS_08180 598 2103 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_08180 2498 2250 gene locus_tag LOCUS_08190 2498 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 3299 2664 gene locus_tag LOCUS_08200 gene plsY 3299 2664 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66905 protein_id gnl|my_center|LOCUS_08200 4082 3354 gene locus_tag LOCUS_08210 gene hisI 4082 3354 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEK7 protein_id gnl|my_center|LOCUS_08210 4945 4145 gene locus_tag LOCUS_08220 gene hisF 4945 4145 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q92 protein_id gnl|my_center|LOCUS_08220 5661 4939 gene locus_tag LOCUS_08230 gene hisA 5661 4939 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA6 protein_id gnl|my_center|LOCUS_08230 6281 5658 gene locus_tag LOCUS_08240 gene hisH 6281 5658 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW0 protein_id gnl|my_center|LOCUS_08240 6856 6428 gene locus_tag LOCUS_08250 6856 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 7655 6930 gene locus_tag LOCUS_08260 gene algU 7655 6930 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_08260 8752 7757 gene locus_tag LOCUS_08270 8752 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 9104 8793 gene locus_tag LOCUS_08280 9104 8793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence0087 423 5747 gene locus_tag LOCUS_08290 423 5747 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_08290 6021 5719 gene locus_tag LOCUS_08300 6021 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 7901 6318 gene locus_tag LOCUS_08310 7901 6318 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945835.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence0088 69 1511 gene locus_tag LOCUS_08320 69 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2058 3335 gene locus_tag LOCUS_08330 2058 3335 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_08330 3365 4792 gene locus_tag LOCUS_08340 3365 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 4881 6272 gene locus_tag LOCUS_08350 4881 6272 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973721.1 protein_id gnl|my_center|LOCUS_08350 6329 7831 gene locus_tag LOCUS_08360 6329 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 8092 7898 gene locus_tag LOCUS_08370 8092 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 8094 9062 gene locus_tag LOCUS_08380 8094 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence0089 1575 1018 gene locus_tag LOCUS_08390 1575 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 2007 1723 gene locus_tag LOCUS_08400 2007 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_08400 3712 2132 gene locus_tag LOCUS_08410 3712 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 4032 4208 gene locus_tag LOCUS_08420 4032 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639145.2 protein_id gnl|my_center|LOCUS_08420 4395 4231 gene locus_tag LOCUS_08430 4395 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 6277 4574 gene locus_tag LOCUS_08440 6277 4574 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584150.1 protein_id gnl|my_center|LOCUS_08440 8984 6372 gene locus_tag LOCUS_08450 8984 6372 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966095.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence0090 931 1518 gene locus_tag LOCUS_08460 931 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1633 2250 gene locus_tag LOCUS_08470 1633 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 2744 2247 gene locus_tag LOCUS_08480 2744 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 4104 2779 gene locus_tag LOCUS_08490 4104 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 4903 4175 gene locus_tag LOCUS_08500 4903 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 5040 5312 gene locus_tag LOCUS_08510 5040 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 5393 7051 gene locus_tag LOCUS_08520 5393 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 7142 8155 gene locus_tag LOCUS_08530 7142 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 8148 9296 gene locus_tag LOCUS_08540 8148 9296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence0091 1715 930 gene locus_tag LOCUS_08550 1715 930 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071887.1 protein_id gnl|my_center|LOCUS_08550 2228 1800 gene locus_tag LOCUS_08560 2228 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 2729 3448 gene locus_tag LOCUS_08570 2729 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 4430 3561 gene locus_tag LOCUS_08580 gene map 4430 3561 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHQ4 protein_id gnl|my_center|LOCUS_08580 4665 5699 gene locus_tag LOCUS_08590 4665 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 6259 5711 gene locus_tag LOCUS_08600 6259 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 6337 7440 gene locus_tag LOCUS_08610 6337 7440 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_08610 7568 8470 gene locus_tag LOCUS_08620 7568 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 8722 8928 gene locus_tag LOCUS_08630 8722 8928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence0092 4269 2308 gene locus_tag LOCUS_08640 4269 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 4925 4344 gene locus_tag LOCUS_08650 4925 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 6611 5184 gene locus_tag LOCUS_08660 6611 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 7805 6813 gene locus_tag LOCUS_08670 7805 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence0093 995 1633 gene locus_tag LOCUS_08680 995 1633 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974604.1 protein_id gnl|my_center|LOCUS_08680 1757 1957 gene locus_tag LOCUS_08690 1757 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 2466 2098 gene locus_tag LOCUS_08700 2466 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3131 2730 gene locus_tag LOCUS_08710 3131 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 3740 3231 gene locus_tag LOCUS_08720 3740 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 3931 7644 gene locus_tag LOCUS_08730 3931 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 <9188 7654 gene locus_tag LOCUS_08740 <9188 7654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326708.1:ferrous iron transporter B >Feature sequence0094 <1 1088 gene locus_tag LOCUS_08750 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_008920731.1:nitrogen-fixing protein NifU 1368 3167 gene locus_tag LOCUS_08760 1368 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880130.1 protein_id gnl|my_center|LOCUS_08760 3309 7091 gene locus_tag LOCUS_08770 3309 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 8312 7473 gene locus_tag LOCUS_08780 8312 7473 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532542.1 protein_id gnl|my_center|LOCUS_08780 8983 8333 gene locus_tag LOCUS_08790 8983 8333 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence0095 375 1499 gene locus_tag LOCUS_08800 375 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1715 2614 gene locus_tag LOCUS_08810 1715 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 2754 3821 gene locus_tag LOCUS_08820 2754 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 5583 3787 gene locus_tag LOCUS_08830 5583 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 6575 5580 gene locus_tag LOCUS_08840 6575 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 7233 6955 gene locus_tag LOCUS_08850 7233 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence0096 1040 1630 gene locus_tag LOCUS_08860 1040 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1787 2461 gene locus_tag LOCUS_08870 1787 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 3621 2821 gene locus_tag LOCUS_08880 3621 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 4372 3674 gene locus_tag LOCUS_08890 4372 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 5619 5170 gene locus_tag LOCUS_08900 5619 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 6002 6949 gene locus_tag LOCUS_08910 6002 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 8599 6962 gene locus_tag LOCUS_08920 8599 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence0097 2220 1255 gene locus_tag LOCUS_08930 2220 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 2388 4139 gene locus_tag LOCUS_08940 2388 4139 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_08940 5179 4151 gene locus_tag LOCUS_08950 5179 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 6096 5185 gene locus_tag LOCUS_08960 gene speE 6096 5185 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI29 protein_id gnl|my_center|LOCUS_08960 6657 6169 gene locus_tag LOCUS_08970 6657 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 <9045 6661 gene locus_tag LOCUS_08980 <9045 6661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113763.1:Fe(III) dicitrate transporter FecA >Feature sequence0098 13 822 gene locus_tag LOCUS_08990 13 822 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731334.1 protein_id gnl|my_center|LOCUS_08990 876 2012 gene locus_tag LOCUS_09000 876 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2208 3968 gene locus_tag LOCUS_09010 2208 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 3965 5374 gene locus_tag LOCUS_09020 3965 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_09020 5371 5949 gene locus_tag LOCUS_09030 5371 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 6145 6333 gene locus_tag LOCUS_09040 6145 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 6888 9008 gene locus_tag LOCUS_09050 6888 9008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence0099 1144 1671 gene locus_tag LOCUS_09060 1144 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1887 3857 gene locus_tag LOCUS_09070 1887 3857 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877796.1 protein_id gnl|my_center|LOCUS_09070 3876 5159 gene locus_tag LOCUS_09080 3876 5159 CDS product beta-ketothiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527148.1 protein_id gnl|my_center|LOCUS_09080 5910 5230 gene locus_tag LOCUS_09090 5910 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 6115 6690 gene locus_tag LOCUS_09100 6115 6690 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087753.1 protein_id gnl|my_center|LOCUS_09100 7529 6687 gene locus_tag LOCUS_09110 7529 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 8494 7526 gene locus_tag LOCUS_09120 8494 7526 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MH4 protein_id gnl|my_center|LOCUS_09120 8672 8986 gene locus_tag LOCUS_09130 8672 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence0100 1938 1402 gene locus_tag LOCUS_09140 1938 1402 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014133.1 protein_id gnl|my_center|LOCUS_09140 3332 1977 gene locus_tag LOCUS_09150 3332 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 4441 3542 gene locus_tag LOCUS_09160 4441 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 5313 5113 gene locus_tag LOCUS_09170 5313 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 5272 6129 gene locus_tag LOCUS_09180 5272 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence0101 870 520 gene locus_tag LOCUS_09190 gene trx 870 520 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ76 protein_id gnl|my_center|LOCUS_09190 1110 2045 gene locus_tag LOCUS_09200 1110 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2608 2096 gene locus_tag LOCUS_09210 gene nbaC 2608 2096 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_09210 3785 2628 gene locus_tag LOCUS_09220 3785 2628 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_09220 3994 4518 gene locus_tag LOCUS_09230 3994 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4780 5835 gene locus_tag LOCUS_09240 4780 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 6387 7520 gene locus_tag LOCUS_09250 6387 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 7507 7761 gene locus_tag LOCUS_09260 7507 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 8942 7815 gene locus_tag LOCUS_09270 gene cls 8942 7815 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039240.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence0102 1367 378 gene locus_tag LOCUS_09280 gene fabD-2 1367 378 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS0 protein_id gnl|my_center|LOCUS_09280 2473 1421 gene locus_tag LOCUS_09290 gene plsX 2473 1421 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS2 protein_id gnl|my_center|LOCUS_09290 2770 2585 gene locus_tag LOCUS_09300 gene rpmF 2770 2585 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67187 protein_id gnl|my_center|LOCUS_09300 3752 3024 gene locus_tag LOCUS_09310 3752 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4207 8349 gene locus_tag LOCUS_09320 4207 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 8875 8354 gene locus_tag LOCUS_09330 8875 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence0103 611 2407 gene locus_tag LOCUS_09340 611 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2420 3673 gene locus_tag LOCUS_09350 gene gspF 2420 3673 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_09350 3818 4261 gene locus_tag LOCUS_09360 gene gspG 3818 4261 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097349.1 protein_id gnl|my_center|LOCUS_09360 4395 5189 gene locus_tag LOCUS_09370 4395 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 5189 6004 gene locus_tag LOCUS_09380 5189 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 6001 6711 gene locus_tag LOCUS_09390 6001 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 6725 8266 gene locus_tag LOCUS_09400 6725 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence0104 498 755 gene locus_tag LOCUS_09410 498 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2147 1239 gene locus_tag LOCUS_09420 2147 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 2229 2711 gene locus_tag LOCUS_09430 gene coaD 2229 2711 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8I0 protein_id gnl|my_center|LOCUS_09430 2714 3373 gene locus_tag LOCUS_09440 2714 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 3735 5090 gene locus_tag LOCUS_09450 3735 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 5164 5886 gene locus_tag LOCUS_09460 5164 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 5930 6379 gene locus_tag LOCUS_09470 5930 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 6815 7276 gene locus_tag LOCUS_09480 6815 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence0105 2053 2223 gene locus_tag LOCUS_09490 2053 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3051 2728 gene locus_tag LOCUS_09500 3051 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 3107 3520 gene locus_tag LOCUS_09510 3107 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 4608 5261 gene locus_tag LOCUS_09520 gene parA 4608 5261 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_09520 5263 5826 gene locus_tag LOCUS_09530 5263 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 7083 5830 gene locus_tag LOCUS_09540 7083 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 7316 7954 gene locus_tag LOCUS_09550 7316 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 7951 8229 gene locus_tag LOCUS_09560 7951 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence0106 2722 44 gene locus_tag LOCUS_09570 2722 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_09570 3019 3507 gene locus_tag LOCUS_09580 3019 3507 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944499.1 protein_id gnl|my_center|LOCUS_09580 3891 3517 gene locus_tag LOCUS_09590 3891 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 4358 4020 gene locus_tag LOCUS_09600 4358 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 5396 4410 gene locus_tag LOCUS_09610 gene argC 5396 4410 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J8 protein_id gnl|my_center|LOCUS_09610 6735 5398 gene locus_tag LOCUS_09620 gene argB 6735 5398 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J6 protein_id gnl|my_center|LOCUS_09620 7798 6788 gene locus_tag LOCUS_09630 gene argF' 7798 6788 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J2 protein_id gnl|my_center|LOCUS_09630 8080 8739 gene locus_tag LOCUS_09640 8080 8739 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266927.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence0107 3571 4059 gene locus_tag LOCUS_09650 3571 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 4249 5262 gene locus_tag LOCUS_09660 4249 5262 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_09660 5365 5841 gene locus_tag LOCUS_09670 5365 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 7047 5995 gene locus_tag LOCUS_09680 7047 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 7253 7861 gene locus_tag LOCUS_09690 7253 7861 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1T4 protein_id gnl|my_center|LOCUS_09690 >Feature sequence0108 448 29 gene locus_tag LOCUS_09700 448 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 516 1643 gene locus_tag LOCUS_09710 516 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 3671 1824 gene locus_tag LOCUS_09720 3671 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 protein_id gnl|my_center|LOCUS_09720 3937 4836 gene locus_tag LOCUS_09730 3937 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 6556 4907 gene locus_tag LOCUS_09740 6556 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 7456 6908 gene locus_tag LOCUS_09750 gene fabG 7456 6908 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence0109 1383 448 gene locus_tag LOCUS_09760 1383 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2307 1474 gene locus_tag LOCUS_09770 gene tauD 2307 1474 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706738.1 protein_id gnl|my_center|LOCUS_09770 4551 2479 gene locus_tag LOCUS_09780 4551 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 5660 4548 gene locus_tag LOCUS_09790 5660 4548 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121269.1 protein_id gnl|my_center|LOCUS_09790 6963 5944 gene locus_tag LOCUS_09800 6963 5944 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_09800 7874 7038 gene locus_tag LOCUS_09810 7874 7038 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385446.1 protein_id gnl|my_center|LOCUS_09810 8732 8181 gene locus_tag LOCUS_09820 8732 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence0110 1157 189 gene locus_tag LOCUS_09830 1157 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2327 1461 gene locus_tag LOCUS_09840 2327 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3573 2641 gene locus_tag LOCUS_09850 3573 2641 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404822.1 protein_id gnl|my_center|LOCUS_09850 3482 4495 gene locus_tag LOCUS_09860 3482 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 4924 4532 gene locus_tag LOCUS_09870 4924 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 5115 5759 gene locus_tag LOCUS_09880 5115 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 5756 6838 gene locus_tag LOCUS_09890 5756 6838 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence0111 1006 305 gene locus_tag LOCUS_09900 1006 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263126.1 protein_id gnl|my_center|LOCUS_09900 2139 1003 gene locus_tag LOCUS_09910 gene serC 2139 1003 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81BC0 protein_id gnl|my_center|LOCUS_09910 3192 2302 gene locus_tag LOCUS_09920 3192 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5143 3692 gene locus_tag LOCUS_09930 5143 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 6487 5543 gene locus_tag LOCUS_09940 6487 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 6944 7378 gene locus_tag LOCUS_09950 6944 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence0112 223 858 gene locus_tag LOCUS_09960 223 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 4237 962 gene locus_tag LOCUS_09970 gene czcA 4237 962 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_09970 5669 4314 gene locus_tag LOCUS_09980 5669 4314 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106254.1 protein_id gnl|my_center|LOCUS_09980 7175 5988 gene locus_tag LOCUS_09990 gene cpx 7175 5988 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_09990 8701 7337 gene locus_tag LOCUS_10000 8701 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence0113 183 425 gene locus_tag LOCUS_10010 183 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 3997 596 gene locus_tag LOCUS_10020 3997 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 5536 4316 gene locus_tag LOCUS_10030 5536 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 6356 5631 gene locus_tag LOCUS_10040 6356 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 6636 8519 gene locus_tag LOCUS_10050 6636 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 8498 8662 gene locus_tag LOCUS_10060 8498 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence0114 468 2036 gene locus_tag LOCUS_10070 468 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 2724 2038 gene locus_tag LOCUS_10080 gene pyrE 2724 2038 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ECL9 protein_id gnl|my_center|LOCUS_10080 3110 2832 gene locus_tag LOCUS_10090 3110 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 3040 4188 gene locus_tag LOCUS_10100 3040 4188 CDS product vtpJ-therm inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879175.1 protein_id gnl|my_center|LOCUS_10100 4762 4223 gene locus_tag LOCUS_10110 4762 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4900 7008 gene locus_tag LOCUS_10120 4900 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 7806 7105 gene locus_tag LOCUS_10130 7806 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 8170 7832 gene locus_tag LOCUS_10140 8170 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence0115 687 2009 gene locus_tag LOCUS_10150 gene hcp 687 2009 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM63 protein_id gnl|my_center|LOCUS_10150 3515 2283 gene locus_tag LOCUS_10160 3515 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 4321 3512 gene locus_tag LOCUS_10170 gene natA 4321 3512 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_10170 4449 6050 gene locus_tag LOCUS_10180 4449 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 7386 6325 gene locus_tag LOCUS_10190 7386 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 8409 7426 gene locus_tag LOCUS_10200 8409 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence0116 3499 3059 gene locus_tag LOCUS_10210 3499 3059 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940359.1 protein_id gnl|my_center|LOCUS_10210 4177 3671 gene locus_tag LOCUS_10220 4177 3671 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390003.1 protein_id gnl|my_center|LOCUS_10220 4911 4177 gene locus_tag LOCUS_10230 gene tolQ-2 4911 4177 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940358.1 protein_id gnl|my_center|LOCUS_10230 5799 4996 gene locus_tag LOCUS_10240 5799 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 7033 5864 gene locus_tag LOCUS_10250 7033 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 8270 7215 gene locus_tag LOCUS_10260 8270 7215 CDS product EF-P lysine aminoacylase GenX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338254.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence0117 2334 3608 gene locus_tag LOCUS_10270 2334 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3610 4068 gene locus_tag LOCUS_10280 3610 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 5235 4141 gene locus_tag LOCUS_10290 5235 4141 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884030.1 protein_id gnl|my_center|LOCUS_10290 5404 5330 gene locus_tag LOCUS_t00330 5404 5330 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5602 5528 gene locus_tag LOCUS_t00340 5602 5528 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6860 5856 gene locus_tag LOCUS_10300 6860 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 6995 8668 gene locus_tag LOCUS_10310 6995 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence0118 2179 1157 gene locus_tag LOCUS_10320 2179 1157 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403202.1 protein_id gnl|my_center|LOCUS_10320 4059 2191 gene locus_tag LOCUS_10330 gene korA 4059 2191 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_10330 4959 4339 gene locus_tag LOCUS_10340 4959 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 5558 4995 gene locus_tag LOCUS_10350 5558 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 5648 6670 gene locus_tag LOCUS_10360 5648 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 6856 8103 gene locus_tag LOCUS_10370 6856 8103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence0119 3054 1324 gene locus_tag LOCUS_10380 3054 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5423 3402 gene locus_tag LOCUS_10390 5423 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 8494 5768 gene locus_tag LOCUS_10400 8494 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 >Feature sequence0120 452 1378 gene locus_tag LOCUS_10410 452 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1523 2998 gene locus_tag LOCUS_10420 1523 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4058 3006 gene locus_tag LOCUS_10430 4058 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 4189 6645 gene locus_tag LOCUS_10440 4189 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038019.1 protein_id gnl|my_center|LOCUS_10440 <8657 6695 gene locus_tag LOCUS_10450 <8657 6695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085075.1:two-component hybrid sensor and regulator >Feature sequence0121 1932 1264 gene locus_tag LOCUS_10460 1932 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2753 3196 gene locus_tag LOCUS_10470 2753 3196 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947901.1 protein_id gnl|my_center|LOCUS_10470 3236 3628 gene locus_tag LOCUS_10480 3236 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4038 3835 gene locus_tag LOCUS_10490 4038 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 4594 4157 gene locus_tag LOCUS_10500 4594 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 4837 5148 gene locus_tag LOCUS_10510 4837 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 5819 6736 gene locus_tag LOCUS_10520 5819 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 7369 8097 gene locus_tag LOCUS_10530 7369 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence0122 1339 3645 gene locus_tag LOCUS_10540 1339 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461054.1 protein_id gnl|my_center|LOCUS_10540 3642 3968 gene locus_tag LOCUS_10550 gene bolA 3642 3968 CDS product global transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071343.1 protein_id gnl|my_center|LOCUS_10550 4100 4173 gene locus_tag LOCUS_t00350 4100 4173 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4204 4278 gene locus_tag LOCUS_t00360 4204 4278 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5383 4775 gene locus_tag LOCUS_10560 5383 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 5641 5411 gene locus_tag LOCUS_10570 5641 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 5967 6602 gene locus_tag LOCUS_10580 5967 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 6615 7583 gene locus_tag LOCUS_10590 6615 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence0123 4532 1158 gene locus_tag LOCUS_10600 gene ileS 4532 1158 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73JB2 protein_id gnl|my_center|LOCUS_10600 4823 6010 gene locus_tag LOCUS_10610 4823 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 7191 6091 gene locus_tag LOCUS_10620 7191 6091 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_10620 7796 7242 gene locus_tag LOCUS_10630 7796 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 >Feature sequence0124 2276 2437 gene locus_tag LOCUS_10640 2276 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2681 2538 gene locus_tag LOCUS_10650 2681 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 4942 3182 gene locus_tag LOCUS_10660 4942 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 5586 5110 gene locus_tag LOCUS_10670 5586 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 7106 5646 gene locus_tag LOCUS_10680 7106 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 7402 8058 gene locus_tag LOCUS_10690 7402 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence0125 2233 842 gene locus_tag LOCUS_10700 gene murC 2233 842 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61679 protein_id gnl|my_center|LOCUS_10700 2511 3758 gene locus_tag LOCUS_10710 2511 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 4678 3770 gene locus_tag LOCUS_10720 4678 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 6886 4766 gene locus_tag LOCUS_10730 6886 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 7245 7994 gene locus_tag LOCUS_10740 7245 7994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence0126 451 1452 gene locus_tag LOCUS_10750 451 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10750 1479 1949 gene locus_tag LOCUS_10760 1479 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10760 1967 2053 gene locus_tag LOCUS_t00370 1967 2053 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2292 2831 gene locus_tag LOCUS_10770 2292 2831 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142877.1 protein_id gnl|my_center|LOCUS_10770 2931 3815 gene locus_tag LOCUS_10780 2931 3815 CDS product putative 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701652.1 protein_id gnl|my_center|LOCUS_10780 3879 4805 gene locus_tag LOCUS_10790 3879 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 5520 4903 gene locus_tag LOCUS_10800 gene cysC 5520 4903 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CR04 protein_id gnl|my_center|LOCUS_10800 6586 5606 gene locus_tag LOCUS_10810 6586 5606 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331193.1 protein_id gnl|my_center|LOCUS_10810 7011 8390 gene locus_tag LOCUS_10820 7011 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 >Feature sequence0127 1026 2543 gene locus_tag LOCUS_10830 gene rtcB 1026 2543 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ME60 protein_id gnl|my_center|LOCUS_10830 3882 2563 gene locus_tag LOCUS_10840 gene lysC 3882 2563 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG73 protein_id gnl|my_center|LOCUS_10840 4527 7775 gene locus_tag LOCUS_10850 4527 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence0128 1947 8483 gene locus_tag LOCUS_10860 1947 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence0129 2 988 gene locus_tag LOCUS_10870 2 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1038 2189 gene locus_tag LOCUS_10880 1038 2189 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973142.1 protein_id gnl|my_center|LOCUS_10880 2326 3402 gene locus_tag LOCUS_10890 2326 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 5157 3415 gene locus_tag LOCUS_10900 5157 3415 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_10900 5795 5379 gene locus_tag LOCUS_10910 5795 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 5961 6353 gene locus_tag LOCUS_10920 5961 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 7032 6412 gene locus_tag LOCUS_10930 7032 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 7249 8139 gene locus_tag LOCUS_10940 gene ilvE 7249 8139 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005489.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence0130 <1 1708 gene locus_tag LOCUS_10950 <1 1708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257128.1:thioredoxin domain-containing protein 3181 1712 gene locus_tag LOCUS_10960 3181 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 3550 3239 gene locus_tag LOCUS_10970 3550 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 3664 4518 gene locus_tag LOCUS_10980 gene spnIM 3664 4518 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CPJ4 protein_id gnl|my_center|LOCUS_10980 5143 4586 gene locus_tag LOCUS_10990 gene frr 5143 4586 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJP0 protein_id gnl|my_center|LOCUS_10990 5972 5133 gene locus_tag LOCUS_11000 gene pyrH 5972 5133 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW2 protein_id gnl|my_center|LOCUS_11000 6713 6060 gene locus_tag LOCUS_11010 gene tsf 6713 6060 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61333 protein_id gnl|my_center|LOCUS_11010 7638 6718 gene locus_tag LOCUS_11020 gene rpsB 7638 6718 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence0131 1069 281 gene locus_tag LOCUS_11030 1069 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1236 1066 gene locus_tag LOCUS_11040 1236 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1998 1264 gene locus_tag LOCUS_11050 1998 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2269 1988 gene locus_tag LOCUS_11060 2269 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2616 2269 gene locus_tag LOCUS_11070 2616 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3606 2698 gene locus_tag LOCUS_11080 3606 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3803 3606 gene locus_tag LOCUS_11090 3803 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 <8456 3800 gene locus_tag LOCUS_11100 <8456 3800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204890.1:helicase SNF2 family protein >Feature sequence0132 117 1253 gene locus_tag LOCUS_11110 117 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2108 1257 gene locus_tag LOCUS_11120 2108 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3184 2105 gene locus_tag LOCUS_11130 3184 2105 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388253.1 protein_id gnl|my_center|LOCUS_11130 4532 3102 gene locus_tag LOCUS_11140 gene crtI 4532 3102 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_11140 4782 5882 gene locus_tag LOCUS_11150 4782 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 5961 6698 gene locus_tag LOCUS_11160 5961 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 6789 7688 gene locus_tag LOCUS_11170 6789 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence0133 1093 104 gene locus_tag LOCUS_11180 1093 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2303 1194 gene locus_tag LOCUS_11190 2303 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2721 3587 gene locus_tag LOCUS_11200 2721 3587 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228419.1 protein_id gnl|my_center|LOCUS_11200 3702 5216 gene locus_tag LOCUS_11210 gene iolA 3702 5216 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098259.1 protein_id gnl|my_center|LOCUS_11210 5276 6628 gene locus_tag LOCUS_11220 5276 6628 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_11220 7255 6644 gene locus_tag LOCUS_11230 7255 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888833.1 protein_id gnl|my_center|LOCUS_11230 8065 7271 gene locus_tag LOCUS_11240 8065 7271 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence0134 388 1155 gene locus_tag LOCUS_11250 388 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1164 1955 gene locus_tag LOCUS_11260 1164 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1980 2309 gene locus_tag LOCUS_11270 1980 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 2322 2657 gene locus_tag LOCUS_11280 2322 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2934 3110 gene locus_tag LOCUS_11290 2934 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3638 4480 gene locus_tag LOCUS_11300 3638 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 4494 5675 gene locus_tag LOCUS_11310 4494 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 5692 6210 gene locus_tag LOCUS_11320 5692 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 6211 6615 gene locus_tag LOCUS_11330 6211 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 6690 7169 gene locus_tag LOCUS_11340 6690 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence0135 1692 247 gene locus_tag LOCUS_11350 1692 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 3505 1940 gene locus_tag LOCUS_11360 3505 1940 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368806.1 protein_id gnl|my_center|LOCUS_11360 5732 3549 gene locus_tag LOCUS_11370 5732 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 5851 6129 gene locus_tag LOCUS_11380 5851 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 6268 7179 gene locus_tag LOCUS_11390 gene rluD 6268 7179 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H11 protein_id gnl|my_center|LOCUS_11390 7218 7952 gene locus_tag LOCUS_11400 7218 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence0136 4297 620 gene locus_tag LOCUS_11410 4297 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4610 4299 gene locus_tag LOCUS_11420 4610 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 5970 5710 gene locus_tag LOCUS_11430 5970 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 6575 6210 gene locus_tag LOCUS_11440 6575 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 6627 7154 gene locus_tag LOCUS_11450 6627 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence0137 188 514 gene locus_tag LOCUS_11460 188 514 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6Z6 protein_id gnl|my_center|LOCUS_11460 511 1158 gene locus_tag LOCUS_11470 gene recR 511 1158 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G6Y1 protein_id gnl|my_center|LOCUS_11470 1681 2163 gene locus_tag LOCUS_11480 gene mglB 1681 2163 CDS product dynein regulation protein LC7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_11480 2181 2768 gene locus_tag LOCUS_11490 gene mglA 2181 2768 CDS product cell polarity determinant GTPase MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_11490 3120 3902 gene locus_tag LOCUS_11500 3120 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 5667 3988 gene locus_tag LOCUS_11510 5667 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 5881 6741 gene locus_tag LOCUS_11520 5881 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence0138 671 450 gene locus_tag LOCUS_11530 671 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 607 1623 gene locus_tag LOCUS_11540 607 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 3232 1625 gene locus_tag LOCUS_11550 3232 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 4175 3273 gene locus_tag LOCUS_11560 4175 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 5735 4194 gene locus_tag LOCUS_11570 5735 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 6375 5866 gene locus_tag LOCUS_11580 6375 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 6506 6784 gene locus_tag LOCUS_11590 6506 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 8047 6902 gene locus_tag LOCUS_11600 8047 6902 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence0139 193 1599 gene locus_tag LOCUS_11610 193 1599 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029117.1 protein_id gnl|my_center|LOCUS_11610 1596 3014 gene locus_tag LOCUS_11620 1596 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 3338 3946 gene locus_tag LOCUS_11630 3338 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 3943 4974 gene locus_tag LOCUS_11640 3943 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence0140 581 1927 gene locus_tag LOCUS_11650 581 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2892 1963 gene locus_tag LOCUS_11660 2892 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 3190 4452 gene locus_tag LOCUS_11670 3190 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 7088 4653 gene locus_tag LOCUS_11680 gene lon 7088 4653 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL28 protein_id gnl|my_center|LOCUS_11680 7934 7338 gene locus_tag LOCUS_11690 7934 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence0141 1211 930 gene locus_tag LOCUS_11700 1211 930 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 protein_id gnl|my_center|LOCUS_11700 1796 1233 gene locus_tag LOCUS_11710 1796 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2670 1756 gene locus_tag LOCUS_11720 2670 1756 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI18 protein_id gnl|my_center|LOCUS_11720 3712 2702 gene locus_tag LOCUS_11730 gene hprK 3712 2702 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61323 protein_id gnl|my_center|LOCUS_11730 4506 3883 gene locus_tag LOCUS_11740 4506 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_11740 6132 4645 gene locus_tag LOCUS_11750 gene rpoN 6132 4645 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ1 protein_id gnl|my_center|LOCUS_11750 8050 6419 gene locus_tag LOCUS_11760 gene pyrG 8050 6419 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY3 protein_id gnl|my_center|LOCUS_11760 >Feature sequence0142 1393 2511 gene locus_tag LOCUS_11770 1393 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 3869 2949 gene locus_tag LOCUS_11780 3869 2949 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727261.1 protein_id gnl|my_center|LOCUS_11780 4023 4706 gene locus_tag LOCUS_11790 4023 4706 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120055.1 protein_id gnl|my_center|LOCUS_11790 5656 4835 gene locus_tag LOCUS_11800 5656 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 5884 7836 gene locus_tag LOCUS_11810 5884 7836 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143453.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence0143 171 2597 gene locus_tag LOCUS_11820 171 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 3034 2669 gene locus_tag LOCUS_11830 3034 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3565 3395 gene locus_tag LOCUS_11840 3565 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 3805 4806 gene locus_tag LOCUS_11850 3805 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 4979 5842 gene locus_tag LOCUS_11860 4979 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 6303 5938 gene locus_tag LOCUS_11870 6303 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 <8035 6725 gene locus_tag LOCUS_11880 <8035 6725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 >Feature sequence0144 <1 2550 gene locus_tag LOCUS_11890 <1 2550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:cation transporter 2550 3140 gene locus_tag LOCUS_11900 2550 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 3254 3814 gene locus_tag LOCUS_11910 3254 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 3850 4536 gene locus_tag LOCUS_11920 3850 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 4713 5150 gene locus_tag LOCUS_11930 4713 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 6578 5232 gene locus_tag LOCUS_11940 6578 5232 CDS product metallo-oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119305.1 protein_id gnl|my_center|LOCUS_11940 7559 6918 gene locus_tag LOCUS_11950 7559 6918 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272276.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence0145 3914 4450 gene locus_tag LOCUS_11960 3914 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 4450 4797 gene locus_tag LOCUS_11970 4450 4797 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938797.1 protein_id gnl|my_center|LOCUS_11970 4935 5405 gene locus_tag LOCUS_11980 4935 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 5409 7370 gene locus_tag LOCUS_11990 5409 7370 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336918.1 protein_id gnl|my_center|LOCUS_11990 7397 7759 gene locus_tag LOCUS_12000 7397 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence0146 1403 2323 gene locus_tag LOCUS_12010 1403 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2378 3061 gene locus_tag LOCUS_12020 2378 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 4030 3071 gene locus_tag LOCUS_12030 gene echA4 4030 3071 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403426.1 protein_id gnl|my_center|LOCUS_12030 4269 4802 gene locus_tag LOCUS_12040 4269 4802 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932505.1 protein_id gnl|my_center|LOCUS_12040 5079 5678 gene locus_tag LOCUS_12050 5079 5678 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532957.1 protein_id gnl|my_center|LOCUS_12050 5850 6179 gene locus_tag LOCUS_12060 5850 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 6258 7175 gene locus_tag LOCUS_12070 6258 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence0147 2218 1403 gene locus_tag LOCUS_12080 2218 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2468 4057 gene locus_tag LOCUS_12090 2468 4057 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MII8 protein_id gnl|my_center|LOCUS_12090 4234 7026 gene locus_tag LOCUS_12100 4234 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 7028 7780 gene locus_tag LOCUS_12110 7028 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence0148 1015 71 gene locus_tag LOCUS_12120 1015 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1886 2767 gene locus_tag LOCUS_12130 1886 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3479 2769 gene locus_tag LOCUS_12140 3479 2769 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB2 protein_id gnl|my_center|LOCUS_12140 4839 3502 gene locus_tag LOCUS_12150 4839 3502 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_12150 6594 5086 gene locus_tag LOCUS_12160 6594 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 7178 6591 gene locus_tag LOCUS_12170 7178 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence0149 1486 1794 gene locus_tag LOCUS_12180 1486 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 2792 1827 gene locus_tag LOCUS_12190 2792 1827 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_12190 2945 4618 gene locus_tag LOCUS_12200 2945 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 5255 4635 gene locus_tag LOCUS_12210 5255 4635 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD4 protein_id gnl|my_center|LOCUS_12210 6040 7626 gene locus_tag LOCUS_12220 6040 7626 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039072.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence0150 1246 500 gene locus_tag LOCUS_12230 1246 500 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_12230 1302 2027 gene locus_tag LOCUS_12240 1302 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2095 2682 gene locus_tag LOCUS_12250 2095 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4764 2713 gene locus_tag LOCUS_12260 gene ligA 4764 2713 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ER9 protein_id gnl|my_center|LOCUS_12260 6482 4980 gene locus_tag LOCUS_12270 6482 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 7112 6888 gene locus_tag LOCUS_12280 7112 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 7027 7422 gene locus_tag LOCUS_12290 gene erpA 7027 7422 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45344 protein_id gnl|my_center|LOCUS_12290 >Feature sequence0151 2173 737 gene locus_tag LOCUS_12300 2173 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192390.1 protein_id gnl|my_center|LOCUS_12300 2386 2730 gene locus_tag LOCUS_12310 gene clpS1 2386 2730 CDS product ATP-dependent Clp protease adapter protein ClpS 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q63 protein_id gnl|my_center|LOCUS_12310 2717 5158 gene locus_tag LOCUS_12320 2717 5158 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_12320 5552 5241 gene locus_tag LOCUS_12330 5552 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 5599 6420 gene locus_tag LOCUS_12340 5599 6420 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600052.1 protein_id gnl|my_center|LOCUS_12340 6593 6506 gene locus_tag LOCUS_t00380 6593 6506 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6663 7517 gene locus_tag LOCUS_12350 6663 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 7543 7616 gene locus_tag LOCUS_t00390 7543 7616 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0152 444 1826 gene locus_tag LOCUS_12360 444 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 4638 1894 gene locus_tag LOCUS_12370 gene valS 4638 1894 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ6 protein_id gnl|my_center|LOCUS_12370 5589 4789 gene locus_tag LOCUS_12380 5589 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 5619 6434 gene locus_tag LOCUS_12390 5619 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 6441 7025 gene locus_tag LOCUS_12400 6441 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence0153 <1 2809 gene locus_tag LOCUS_12410 <1 2809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WDH5:DNA topoisomerase 1 3352 2813 gene locus_tag LOCUS_12420 gene ptpA 3352 2813 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_12420 4281 3352 gene locus_tag LOCUS_12430 4281 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 4299 6056 gene locus_tag LOCUS_12440 4299 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 6089 6976 gene locus_tag LOCUS_12450 6089 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 6973 7167 gene locus_tag LOCUS_12460 6973 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12460 >Feature sequence0154 617 1285 gene locus_tag LOCUS_12470 617 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1278 4439 gene locus_tag LOCUS_12480 1278 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 2454 2360 gene locus_tag LOCUS_t00400 2454 2360 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4508 5008 gene locus_tag LOCUS_12490 4508 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 5025 6737 gene locus_tag LOCUS_12500 5025 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 6912 7592 gene locus_tag LOCUS_12510 6912 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence0155 1627 47 gene locus_tag LOCUS_12520 1627 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 2489 1797 gene locus_tag LOCUS_12530 2489 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3676 2672 gene locus_tag LOCUS_12540 3676 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4170 4928 gene locus_tag LOCUS_12550 4170 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 6207 4945 gene locus_tag LOCUS_12560 6207 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 6404 6868 gene locus_tag LOCUS_12570 6404 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 <7870 6946 gene locus_tag LOCUS_12580 <7870 6946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038594.1:oligopeptidase B >Feature sequence0156 1339 2934 gene locus_tag LOCUS_12590 1339 2934 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205720.1 protein_id gnl|my_center|LOCUS_12590 2956 4497 gene locus_tag LOCUS_12600 2956 4497 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537510.1 protein_id gnl|my_center|LOCUS_12600 4947 4714 gene locus_tag LOCUS_12610 4947 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 5757 5134 gene locus_tag LOCUS_12620 5757 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 6616 5789 gene locus_tag LOCUS_12630 6616 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 7418 7161 gene locus_tag LOCUS_12640 7418 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence0157 <1 1266 gene locus_tag LOCUS_12650 <1 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123110.1:multidrug resistance protein 1289 1540 gene locus_tag LOCUS_12660 1289 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1649 2317 gene locus_tag LOCUS_12670 1649 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2394 3725 gene locus_tag LOCUS_12680 gene hemL 2394 3725 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48247 protein_id gnl|my_center|LOCUS_12680 3736 4065 gene locus_tag LOCUS_12690 3736 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 4062 4565 gene locus_tag LOCUS_12700 4062 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 4578 5375 gene locus_tag LOCUS_12710 gene atpB 4578 5375 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P952 protein_id gnl|my_center|LOCUS_12710 5444 5803 gene locus_tag LOCUS_12720 5444 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 <7844 6396 gene locus_tag LOCUS_12730 <7844 6396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947578.1:alkaline phosphatase family protein >Feature sequence0158 1710 94 gene locus_tag LOCUS_12740 1710 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1972 3249 gene locus_tag LOCUS_12750 1972 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3340 5670 gene locus_tag LOCUS_12760 3340 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388856.1 protein_id gnl|my_center|LOCUS_12760 6034 5843 gene locus_tag LOCUS_12770 6034 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 6218 6523 gene locus_tag LOCUS_12780 6218 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 6709 7800 gene locus_tag LOCUS_12790 gene rtcB 6709 7800 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P433 protein_id gnl|my_center|LOCUS_12790 >Feature sequence0159 3 1805 gene locus_tag LOCUS_12800 3 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 2431 2024 gene locus_tag LOCUS_12810 2431 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 2563 3699 gene locus_tag LOCUS_12820 gene dhlE 2563 3699 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162675.1 protein_id gnl|my_center|LOCUS_12820 3855 4529 gene locus_tag LOCUS_12830 gene hlyI 3855 4529 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229810.1 protein_id gnl|my_center|LOCUS_12830 4649 5347 gene locus_tag LOCUS_12840 4649 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258597.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence0160 4627 5763 gene locus_tag LOCUS_12850 4627 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 6061 7734 gene locus_tag LOCUS_12860 6061 7734 CDS product GGDEF domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070885.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence0161 1337 1558 gene locus_tag LOCUS_12870 1337 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1837 2739 gene locus_tag LOCUS_12880 1837 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 3630 2764 gene locus_tag LOCUS_12890 3630 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 5433 3643 gene locus_tag LOCUS_12900 5433 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 6427 5528 gene locus_tag LOCUS_12910 6427 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence0162 1388 1095 gene locus_tag LOCUS_12920 1388 1095 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_12920 2412 1633 gene locus_tag LOCUS_12930 2412 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 3885 2620 gene locus_tag LOCUS_12940 3885 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 4034 3870 gene locus_tag LOCUS_12950 4034 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 4203 5114 gene locus_tag LOCUS_12960 4203 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5324 7039 gene locus_tag LOCUS_12970 gene rpsA 5324 7039 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence0163 1976 966 gene locus_tag LOCUS_12980 1976 966 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_12980 3036 2068 gene locus_tag LOCUS_12990 3036 2068 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_12990 4377 3361 gene locus_tag LOCUS_13000 4377 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_13000 4846 7176 gene locus_tag LOCUS_13010 4846 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 <7761 7226 gene locus_tag LOCUS_13020 <7761 7226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_008992035.1:2-phosphosulfolactate phosphatase >Feature sequence0164 733 1854 gene locus_tag LOCUS_13030 733 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 3480 1861 gene locus_tag LOCUS_13040 3480 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4353 3496 gene locus_tag LOCUS_13050 4353 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 5888 4353 gene locus_tag LOCUS_13060 5888 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 6340 6795 gene locus_tag LOCUS_13070 6340 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence0165 164 619 gene locus_tag LOCUS_13080 164 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 749 1468 gene locus_tag LOCUS_13090 749 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1465 3960 gene locus_tag LOCUS_13100 gene relA 1465 3960 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723527.1 protein_id gnl|my_center|LOCUS_13100 4061 4231 gene locus_tag LOCUS_13110 4061 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 4581 6974 gene locus_tag LOCUS_13120 4581 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 7268 7095 gene locus_tag LOCUS_13130 7268 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence0166 1978 1700 gene locus_tag LOCUS_13140 1978 1700 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349636.1 protein_id gnl|my_center|LOCUS_13140 2993 2079 gene locus_tag LOCUS_13150 2993 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 3381 3226 gene locus_tag LOCUS_13160 3381 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 4069 3749 gene locus_tag LOCUS_13170 4069 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 3959 4723 gene locus_tag LOCUS_13180 3959 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 5533 5195 gene locus_tag LOCUS_13190 5533 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 5737 6453 gene locus_tag LOCUS_13200 5737 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 7077 6475 gene locus_tag LOCUS_13210 gene sodC2 7077 6475 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ3 protein_id gnl|my_center|LOCUS_13210 <7744 7097 gene locus_tag LOCUS_13220 <7744 7097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083526.1:copper-translocating P-type ATPase >Feature sequence0167 243 980 gene locus_tag LOCUS_13230 243 980 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249459.1 protein_id gnl|my_center|LOCUS_13230 970 2760 gene locus_tag LOCUS_13240 970 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3991 2786 gene locus_tag LOCUS_13250 3991 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 4261 4025 gene locus_tag LOCUS_13260 4261 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 4838 4290 gene locus_tag LOCUS_13270 4838 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 5087 6427 gene locus_tag LOCUS_13280 5087 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 7020 6424 gene locus_tag LOCUS_13290 7020 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence0168 3426 1594 gene locus_tag LOCUS_13300 gene lepA 3426 1594 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60789 protein_id gnl|my_center|LOCUS_13300 3737 4756 gene locus_tag LOCUS_13310 3737 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 4856 5224 gene locus_tag LOCUS_13320 4856 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 5536 6666 gene locus_tag LOCUS_13330 5536 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 6700 7266 gene locus_tag LOCUS_13340 6700 7266 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence0169 <1 1332 gene locus_tag LOCUS_13350 <1 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P54744:serine/threonine-protein kinase PknB 1329 3683 gene locus_tag LOCUS_13360 1329 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3824 3693 gene locus_tag LOCUS_13370 3824 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 3938 4396 gene locus_tag LOCUS_13380 3938 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 6058 4412 gene locus_tag LOCUS_13390 6058 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence0170 51 1448 gene locus_tag LOCUS_13400 51 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1745 3277 gene locus_tag LOCUS_13410 1745 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 3396 5306 gene locus_tag LOCUS_13420 3396 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 6379 5276 gene locus_tag LOCUS_13430 6379 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 6572 7504 gene locus_tag LOCUS_13440 6572 7504 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHT1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence0171 54 566 gene locus_tag LOCUS_13450 54 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 3412 1079 gene locus_tag LOCUS_13460 3412 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 4072 3485 gene locus_tag LOCUS_13470 4072 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 5310 4363 gene locus_tag LOCUS_13480 5310 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 5393 5683 gene locus_tag LOCUS_13490 5393 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 5771 6004 gene locus_tag LOCUS_13500 5771 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence0172 1716 694 gene locus_tag LOCUS_13510 1716 694 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970046.1 protein_id gnl|my_center|LOCUS_13510 2636 1713 gene locus_tag LOCUS_13520 2636 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550164.1 protein_id gnl|my_center|LOCUS_13520 4160 2781 gene locus_tag LOCUS_13530 4160 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 5242 4199 gene locus_tag LOCUS_13540 5242 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 7041 5278 gene locus_tag LOCUS_13550 7041 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence0173 1734 2258 gene locus_tag LOCUS_13560 1734 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 6996 2281 gene locus_tag LOCUS_13570 6996 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 7604 6993 gene locus_tag LOCUS_13580 7604 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence0174 <1 3247 gene locus_tag LOCUS_13590 <1 3247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256390.1:protein kinase 4235 3264 gene locus_tag LOCUS_13600 4235 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 4526 4278 gene locus_tag LOCUS_13610 4526 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 6448 4610 gene locus_tag LOCUS_13620 6448 4610 CDS product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence0175 <1 1503 gene locus_tag LOCUS_13630 <1 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DP0:carbamoyl-phosphate synthase (glutamine-hydrolyzing) 1561 2046 gene locus_tag LOCUS_13640 gene greA 1561 2046 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFC6 protein_id gnl|my_center|LOCUS_13640 2145 2708 gene locus_tag LOCUS_13650 2145 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 2764 3252 gene locus_tag LOCUS_13660 2764 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 3422 4294 gene locus_tag LOCUS_13670 3422 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 4364 6010 gene locus_tag LOCUS_13680 gene pgi 4364 6010 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DK5 protein_id gnl|my_center|LOCUS_13680 6100 7476 gene locus_tag LOCUS_13690 6100 7476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence0176 237 512 gene locus_tag LOCUS_13700 237 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 960 493 gene locus_tag LOCUS_13710 960 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1506 988 gene locus_tag LOCUS_13720 1506 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887342.1 protein_id gnl|my_center|LOCUS_13720 1898 2287 gene locus_tag LOCUS_13730 1898 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 3648 2299 gene locus_tag LOCUS_13740 3648 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3896 4270 gene locus_tag LOCUS_13750 3896 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4245 6098 gene locus_tag LOCUS_13760 4245 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 6153 6356 gene locus_tag LOCUS_13770 6153 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 <7603 6375 gene locus_tag LOCUS_13780 <7603 6375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228635.1:cytochrome P450 >Feature sequence0177 376 1125 gene locus_tag LOCUS_13790 376 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 2135 1143 gene locus_tag LOCUS_13800 2135 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3434 2154 gene locus_tag LOCUS_13810 3434 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4439 4732 gene locus_tag LOCUS_13820 4439 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4988 5413 gene locus_tag LOCUS_13830 4988 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 5601 7115 gene locus_tag LOCUS_13840 5601 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence0178 587 189 gene locus_tag LOCUS_13850 587 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 3459 697 gene locus_tag LOCUS_13860 gene sucA 3459 697 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946279.1 protein_id gnl|my_center|LOCUS_13860 3807 4853 gene locus_tag LOCUS_13870 3807 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 4928 6013 gene locus_tag LOCUS_13880 4928 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 6231 7133 gene locus_tag LOCUS_13890 6231 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence0179 1277 1489 gene locus_tag LOCUS_13900 1277 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1637 2545 gene locus_tag LOCUS_13910 1637 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3427 2549 gene locus_tag LOCUS_13920 3427 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 3866 3411 gene locus_tag LOCUS_13930 3866 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 4071 5144 gene locus_tag LOCUS_13940 4071 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 5917 5267 gene locus_tag LOCUS_13950 5917 5267 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028999.1 protein_id gnl|my_center|LOCUS_13950 6730 6062 gene locus_tag LOCUS_13960 6730 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 <7578 6862 gene locus_tag LOCUS_13970 <7578 6862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114165.1:transcriptional regulator >Feature sequence0180 1808 2578 gene locus_tag LOCUS_13980 1808 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 2628 4346 gene locus_tag LOCUS_13990 2628 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 4849 6393 gene locus_tag LOCUS_14000 4849 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence0181 2406 1006 gene locus_tag LOCUS_14010 2406 1006 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105845.1 protein_id gnl|my_center|LOCUS_14010 3854 2403 gene locus_tag LOCUS_14020 3854 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4431 3856 gene locus_tag LOCUS_14030 4431 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 4748 4428 gene locus_tag LOCUS_14040 4748 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 6019 4766 gene locus_tag LOCUS_14050 6019 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence0182 1549 68 gene locus_tag LOCUS_14060 1549 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1688 3199 gene locus_tag LOCUS_14070 1688 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 3363 5294 gene locus_tag LOCUS_14080 3363 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 5429 6574 gene locus_tag LOCUS_14090 5429 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 <7560 6571 gene locus_tag LOCUS_14100 <7560 6571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257994.1:capsular polysaccharide biosynthesis protein CapK >Feature sequence0183 618 1136 gene locus_tag LOCUS_14110 618 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1199 2044 gene locus_tag LOCUS_14120 1199 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 2551 2129 gene locus_tag LOCUS_14130 2551 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 3203 5785 gene locus_tag LOCUS_14140 gene gyrA 3203 5785 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5J7 protein_id gnl|my_center|LOCUS_14140 5957 6565 gene locus_tag LOCUS_14150 5957 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence0184 917 15 gene locus_tag LOCUS_14160 917 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1918 1037 gene locus_tag LOCUS_14170 1918 1037 CDS product antibiotic biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887721.1 protein_id gnl|my_center|LOCUS_14170 3330 1915 gene locus_tag LOCUS_14180 gene pcnB_1 3330 1915 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84415 protein_id gnl|my_center|LOCUS_14180 3542 4414 gene locus_tag LOCUS_14190 3542 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 6648 4597 gene locus_tag LOCUS_14200 6648 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 7409 6687 gene locus_tag LOCUS_14210 7409 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence0185 527 195 gene locus_tag LOCUS_14220 527 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 587 1024 gene locus_tag LOCUS_14230 587 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 2829 1039 gene locus_tag LOCUS_14240 2829 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 4734 3529 gene locus_tag LOCUS_14250 gene mauG 4734 3529 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_14250 5085 5393 gene locus_tag LOCUS_14260 5085 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 5652 7364 gene locus_tag LOCUS_14270 5652 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence0186 570 130 gene locus_tag LOCUS_14280 570 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1015 650 gene locus_tag LOCUS_14290 gene rplR 1015 650 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPP2 protein_id gnl|my_center|LOCUS_14290 1582 1043 gene locus_tag LOCUS_14300 gene rplF 1582 1043 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CG5 protein_id gnl|my_center|LOCUS_14300 1993 1601 gene locus_tag LOCUS_14310 gene rpsH 1993 1601 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH0 protein_id gnl|my_center|LOCUS_14310 2669 2013 gene locus_tag LOCUS_14320 gene rplE 2669 2013 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z9 protein_id gnl|my_center|LOCUS_14320 3002 2682 gene locus_tag LOCUS_14330 gene rplX 3002 2682 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPP7 protein_id gnl|my_center|LOCUS_14330 3370 3002 gene locus_tag LOCUS_14340 gene rplN 3370 3002 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U869 protein_id gnl|my_center|LOCUS_14340 3657 3367 gene locus_tag LOCUS_14350 gene rpsQ 3657 3367 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CDX1 protein_id gnl|my_center|LOCUS_14350 3890 3654 gene locus_tag LOCUS_14360 3890 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 4303 3887 gene locus_tag LOCUS_14370 gene rplP 4303 3887 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7J9 protein_id gnl|my_center|LOCUS_14370 4997 4317 gene locus_tag LOCUS_14380 gene rpsC 4997 4317 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z4 protein_id gnl|my_center|LOCUS_14380 5340 5005 gene locus_tag LOCUS_14390 gene rplV 5340 5005 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z3 protein_id gnl|my_center|LOCUS_14390 5628 5353 gene locus_tag LOCUS_14400 gene rpsS 5628 5353 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG43 protein_id gnl|my_center|LOCUS_14400 6455 5631 gene locus_tag LOCUS_14410 gene rplB 6455 5631 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60401 protein_id gnl|my_center|LOCUS_14410 6750 6460 gene locus_tag LOCUS_14420 gene rplW 6750 6460 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5X3 protein_id gnl|my_center|LOCUS_14420 7418 6747 gene locus_tag LOCUS_14430 gene rplD 7418 6747 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE19 protein_id gnl|my_center|LOCUS_14430 >Feature sequence0187 <1 1033 gene locus_tag LOCUS_14440 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120395.1:nuclease 1030 4374 gene locus_tag LOCUS_14450 1030 4374 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US04 protein_id gnl|my_center|LOCUS_14450 4552 5025 gene locus_tag LOCUS_14460 4552 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence0188 2803 1004 gene locus_tag LOCUS_14470 gene glnS 2803 1004 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727A5 protein_id gnl|my_center|LOCUS_14470 3295 2915 gene locus_tag LOCUS_14480 3295 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 3775 3440 gene locus_tag LOCUS_14490 3775 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 5258 3867 gene locus_tag LOCUS_14500 5258 3867 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036664.1 protein_id gnl|my_center|LOCUS_14500 6685 5315 gene locus_tag LOCUS_14510 6685 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140024.1 protein_id gnl|my_center|LOCUS_14510 <7472 6685 gene locus_tag LOCUS_14520 <7472 6685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140025.1:ABC transporter >Feature sequence0189 1145 45 gene locus_tag LOCUS_14530 gene dnaN 1145 45 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H91 protein_id gnl|my_center|LOCUS_14530 1849 1998 gene locus_tag LOCUS_14540 1849 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1995 2450 gene locus_tag LOCUS_14550 1995 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2772 4427 gene locus_tag LOCUS_14560 2772 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4461 5066 gene locus_tag LOCUS_14570 4461 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 5156 6454 gene locus_tag LOCUS_14580 gene mnmE 5156 6454 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFI8 protein_id gnl|my_center|LOCUS_14580 <7470 6483 gene locus_tag LOCUS_14590 <7470 6483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q749W3:8-amino-7-oxononanoate synthase >Feature sequence0190 397 1779 gene locus_tag LOCUS_14600 397 1779 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_14600 1811 3007 gene locus_tag LOCUS_14610 1811 3007 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 protein_id gnl|my_center|LOCUS_14610 4082 3009 gene locus_tag LOCUS_14620 4082 3009 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_14620 4169 5140 gene locus_tag LOCUS_14630 4169 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 5414 6064 gene locus_tag LOCUS_14640 5414 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 6951 6061 gene locus_tag LOCUS_14650 6951 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence0191 <1 1060 gene locus_tag LOCUS_14660 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808454.1:capsule biosynthesis protein 2607 1150 gene locus_tag LOCUS_14670 2607 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3104 4714 gene locus_tag LOCUS_14680 3104 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 4868 5638 gene locus_tag LOCUS_14690 4868 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 6901 5657 gene locus_tag LOCUS_14700 gene fabF 6901 5657 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67612 protein_id gnl|my_center|LOCUS_14700 7285 6917 gene locus_tag LOCUS_14710 7285 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence0192 2 589 gene locus_tag LOCUS_14720 2 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1243 620 gene locus_tag LOCUS_14730 1243 620 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_14730 1310 3844 gene locus_tag LOCUS_14740 1310 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 4190 3846 gene locus_tag LOCUS_14750 4190 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 4416 5003 gene locus_tag LOCUS_14760 4416 5003 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_14760 5361 5978 gene locus_tag LOCUS_14770 5361 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence0193 1596 841 gene locus_tag LOCUS_14780 1596 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2471 1752 gene locus_tag LOCUS_14790 2471 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 2782 3594 gene locus_tag LOCUS_14800 2782 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 4386 3613 gene locus_tag LOCUS_14810 4386 3613 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648703.1 protein_id gnl|my_center|LOCUS_14810 4715 4642 gene locus_tag LOCUS_t00410 4715 4642 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5043 5840 gene locus_tag LOCUS_14820 5043 5840 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_14820 5894 6211 gene locus_tag LOCUS_14830 gene yhbY 5894 6211 CDS product RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AGK4 protein_id gnl|my_center|LOCUS_14830 >Feature sequence0194 1093 1539 gene locus_tag LOCUS_14840 1093 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1536 2210 gene locus_tag LOCUS_14850 1536 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3571 2225 gene locus_tag LOCUS_14860 3571 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_14860 5751 3598 gene locus_tag LOCUS_14870 5751 3598 CDS product filamin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121212.1 protein_id gnl|my_center|LOCUS_14870 6419 5964 gene locus_tag LOCUS_14880 6419 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence0195 1386 1676 gene locus_tag LOCUS_14890 1386 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1919 2845 gene locus_tag LOCUS_14900 1919 2845 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWS2 protein_id gnl|my_center|LOCUS_14900 2838 3692 gene locus_tag LOCUS_14910 2838 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 <7395 4027 gene locus_tag LOCUS_14920 <7395 4027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74AE8:pyruvate carboxylase >Feature sequence0196 215 940 gene locus_tag LOCUS_14930 215 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 975 1841 gene locus_tag LOCUS_14940 975 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1841 2587 gene locus_tag LOCUS_14950 1841 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 2584 3528 gene locus_tag LOCUS_14960 2584 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 3531 4685 gene locus_tag LOCUS_14970 3531 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 4685 6676 gene locus_tag LOCUS_14980 4685 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 6765 6974 gene locus_tag LOCUS_14990 6765 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence0197 876 334 gene locus_tag LOCUS_15000 876 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387862.1 protein_id gnl|my_center|LOCUS_15000 924 1145 gene locus_tag LOCUS_15010 924 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2263 1079 gene locus_tag LOCUS_15020 2263 1079 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969317.1 protein_id gnl|my_center|LOCUS_15020 2795 2274 gene locus_tag LOCUS_15030 2795 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 3968 2967 gene locus_tag LOCUS_15040 3968 2967 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140671.1 protein_id gnl|my_center|LOCUS_15040 5244 4408 gene locus_tag LOCUS_15050 5244 4408 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_15050 6689 5358 gene locus_tag LOCUS_15060 6689 5358 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_15060 <7366 6682 gene locus_tag LOCUS_15070 <7366 6682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767052.1:peptidase U62 >Feature sequence0198 1749 3104 gene locus_tag LOCUS_15080 1749 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 6964 3134 gene locus_tag LOCUS_15090 gene dnaE 6964 3134 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence0199 1602 82 gene locus_tag LOCUS_15100 1602 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2728 1655 gene locus_tag LOCUS_15110 2728 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 5075 2757 gene locus_tag LOCUS_15120 5075 2757 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108124.1 protein_id gnl|my_center|LOCUS_15120 5210 6175 gene locus_tag LOCUS_15130 5210 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6343 7278 gene locus_tag LOCUS_15140 6343 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence0200 <1 1205 gene locus_tag LOCUS_15150 <1 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023607.1:cell surface protein 2141 1209 gene locus_tag LOCUS_15160 2141 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 2607 6749 gene locus_tag LOCUS_15170 2607 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence0201 1133 42 gene locus_tag LOCUS_15180 1133 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1630 1244 gene locus_tag LOCUS_15190 1630 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1811 3043 gene locus_tag LOCUS_15200 1811 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 3099 3953 gene locus_tag LOCUS_15210 3099 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3950 4924 gene locus_tag LOCUS_15220 3950 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 5052 6326 gene locus_tag LOCUS_15230 5052 6326 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531269.1 protein_id gnl|my_center|LOCUS_15230 7128 6355 gene locus_tag LOCUS_15240 7128 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence0202 1136 333 gene locus_tag LOCUS_15250 1136 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1418 2098 gene locus_tag LOCUS_15260 1418 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 5065 2429 gene locus_tag LOCUS_15270 5065 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 5819 5247 gene locus_tag LOCUS_15280 5819 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 6786 6100 gene locus_tag LOCUS_15290 6786 6100 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204013.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15290 6837 7262 gene locus_tag LOCUS_15300 6837 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence0203 489 713 gene locus_tag LOCUS_15310 489 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1702 821 gene locus_tag LOCUS_15320 gene mqnD 1702 821 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FZ8 protein_id gnl|my_center|LOCUS_15320 2465 1755 gene locus_tag LOCUS_15330 gene mqnB 2465 1755 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FZ9 protein_id gnl|my_center|LOCUS_15330 2781 3458 gene locus_tag LOCUS_15340 2781 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3551 5239 gene locus_tag LOCUS_15350 3551 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 5239 6384 gene locus_tag LOCUS_15360 5239 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence0204 <1 622 gene locus_tag LOCUS_15370 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WCJ6:histidine kinase 682 1344 gene locus_tag LOCUS_15380 682 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1401 1940 gene locus_tag LOCUS_15390 1401 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2078 2611 gene locus_tag LOCUS_15400 2078 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2618 3106 gene locus_tag LOCUS_15410 2618 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 3722 3087 gene locus_tag LOCUS_15420 3722 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 5207 3813 gene locus_tag LOCUS_15430 5207 3813 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_15430 5326 5946 gene locus_tag LOCUS_15440 5326 5946 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140806.1 protein_id gnl|my_center|LOCUS_15440 6039 7229 gene locus_tag LOCUS_15450 6039 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence0205 921 1721 gene locus_tag LOCUS_15460 921 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1870 3870 gene locus_tag LOCUS_15470 1870 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3867 6578 gene locus_tag LOCUS_15480 3867 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 <7294 6686 gene locus_tag LOCUS_15490 <7294 6686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067720.1:alpha/beta hydrolase >Feature sequence0206 602 1759 gene locus_tag LOCUS_15500 602 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1764 2978 gene locus_tag LOCUS_15510 1764 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3320 3084 gene locus_tag LOCUS_15520 3320 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 5018 3417 gene locus_tag LOCUS_15530 gene paaZ 5018 3417 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223462.1 protein_id gnl|my_center|LOCUS_15530 5746 5129 gene locus_tag LOCUS_15540 5746 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 <7287 6123 gene locus_tag LOCUS_15550 <7287 6123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E2Q9:3-isopropylmalate dehydratase large subunit >Feature sequence0207 1426 2040 gene locus_tag LOCUS_15560 1426 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 3655 2147 gene locus_tag LOCUS_15570 3655 2147 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086079.1 protein_id gnl|my_center|LOCUS_15570 3910 4623 gene locus_tag LOCUS_15580 3910 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 4620 6038 gene locus_tag LOCUS_15590 4620 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 6096 6809 gene locus_tag LOCUS_15600 6096 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence0208 3 227 gene locus_tag LOCUS_15610 3 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 265 1110 gene locus_tag LOCUS_15620 265 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1811 1101 gene locus_tag LOCUS_15630 gene phoU 1811 1101 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E69 protein_id gnl|my_center|LOCUS_15630 2738 1905 gene locus_tag LOCUS_15640 gene pstB 2738 1905 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MGA7 protein_id gnl|my_center|LOCUS_15640 3619 2735 gene locus_tag LOCUS_15650 gene pstA 3619 2735 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S082 protein_id gnl|my_center|LOCUS_15650 4547 3621 gene locus_tag LOCUS_15660 4547 3621 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCU9 protein_id gnl|my_center|LOCUS_15660 5600 4575 gene locus_tag LOCUS_15670 5600 4575 CDS product protein sphX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence0209 978 2543 gene locus_tag LOCUS_15680 978 2543 CDS product FAD-linked oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_15680 2540 3181 gene locus_tag LOCUS_15690 2540 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3178 3768 gene locus_tag LOCUS_15700 3178 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 4011 7022 gene locus_tag LOCUS_15710 4011 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence0210 360 85 gene locus_tag LOCUS_15720 360 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 860 357 gene locus_tag LOCUS_15730 gene yscR 860 357 CDS product EscR/YscR/HrcR family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056360.1 protein_id gnl|my_center|LOCUS_15730 751 1236 gene locus_tag LOCUS_15740 751 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1794 1381 gene locus_tag LOCUS_15750 1794 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2808 1798 gene locus_tag LOCUS_15760 gene rpoA 2808 1798 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B3 protein_id gnl|my_center|LOCUS_15760 3449 2820 gene locus_tag LOCUS_15770 3449 2820 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459108.1 protein_id gnl|my_center|LOCUS_15770 3836 3453 gene locus_tag LOCUS_15780 gene rpsK 3836 3453 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WSB5 protein_id gnl|my_center|LOCUS_15780 4214 3843 gene locus_tag LOCUS_15790 gene rpsM 4214 3843 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CF7 protein_id gnl|my_center|LOCUS_15790 6166 4850 gene locus_tag LOCUS_15800 gene secY 6166 4850 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG28 protein_id gnl|my_center|LOCUS_15800 6918 6418 gene locus_tag LOCUS_15810 6918 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence0211 877 2484 gene locus_tag LOCUS_15820 877 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 3753 2542 gene locus_tag LOCUS_15830 3753 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 5686 3743 gene locus_tag LOCUS_15840 5686 3743 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_15840 5819 6472 gene locus_tag LOCUS_15850 5819 6472 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937441.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence0212 4028 3024 gene locus_tag LOCUS_15860 4028 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 4178 4927 gene locus_tag LOCUS_15870 4178 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 4973 6754 gene locus_tag LOCUS_15880 4973 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence0213 587 1675 gene locus_tag LOCUS_15890 587 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039772.1 protein_id gnl|my_center|LOCUS_15890 1895 4804 gene locus_tag LOCUS_15900 1895 4804 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_15900 5146 4862 gene locus_tag LOCUS_15910 5146 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 5055 5996 gene locus_tag LOCUS_15920 gene lpqC 5055 5996 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence0214 <1 2314 gene locus_tag LOCUS_15930 <1 2314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888194.1:N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA 2311 3528 gene locus_tag LOCUS_15940 2311 3528 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403215.1 protein_id gnl|my_center|LOCUS_15940 3639 4025 gene locus_tag LOCUS_15950 3639 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089576.1 protein_id gnl|my_center|LOCUS_15950 5354 4041 gene locus_tag LOCUS_15960 5354 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 5326 5544 gene locus_tag LOCUS_15970 5326 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 <7153 5509 gene locus_tag LOCUS_15980 <7153 5509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258185.1:peptidase S45 >Feature sequence0215 1848 220 gene locus_tag LOCUS_15990 1848 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 2097 2846 gene locus_tag LOCUS_16000 2097 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 3592 2972 gene locus_tag LOCUS_16010 3592 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 4002 3790 gene locus_tag LOCUS_16020 4002 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 3995 4876 gene locus_tag LOCUS_16030 3995 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 5535 4894 gene locus_tag LOCUS_16040 5535 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 5984 5559 gene locus_tag LOCUS_16050 5984 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 6092 6955 gene locus_tag LOCUS_16060 6092 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence0216 756 385 gene locus_tag LOCUS_16070 gene crcB 756 385 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHY7 protein_id gnl|my_center|LOCUS_16070 1067 846 gene locus_tag LOCUS_16080 1067 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 948 1595 gene locus_tag LOCUS_16090 948 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence0217 <1 2083 gene locus_tag LOCUS_16100 <1 2083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747K3:UvrABC system protein B 2087 2497 gene locus_tag LOCUS_16110 gene rghR 2087 2497 CDS product HTH-type transcriptional repressor RghR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32236 protein_id gnl|my_center|LOCUS_16110 3425 2505 gene locus_tag LOCUS_16120 3425 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 4196 3510 gene locus_tag LOCUS_16130 4196 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 4571 5542 gene locus_tag LOCUS_16140 4571 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 6247 5597 gene locus_tag LOCUS_16150 6247 5597 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933700.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence0218 1825 557 gene locus_tag LOCUS_16160 gene yeiM 1825 557 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_16160 1818 2498 gene locus_tag LOCUS_16170 gene upp 1818 2498 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S320 protein_id gnl|my_center|LOCUS_16170 2528 3139 gene locus_tag LOCUS_16180 gene tdk 2528 3139 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y084 protein_id gnl|my_center|LOCUS_16180 3523 4314 gene locus_tag LOCUS_16190 3523 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 4311 5621 gene locus_tag LOCUS_16200 4311 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence0219 1220 141 gene locus_tag LOCUS_16210 1220 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2606 1614 gene locus_tag LOCUS_16220 2606 1614 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 protein_id gnl|my_center|LOCUS_16220 3161 2712 gene locus_tag LOCUS_16230 3161 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 3398 3326 gene locus_tag LOCUS_t00420 3398 3326 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3511 3439 gene locus_tag LOCUS_t00430 3511 3439 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3611 3536 gene locus_tag LOCUS_t00440 3611 3536 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3780 3706 gene locus_tag LOCUS_t00450 3780 3706 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3999 3927 gene locus_tag LOCUS_t00460 3999 3927 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4118 4043 gene locus_tag LOCUS_t00470 4118 4043 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4234 4161 gene locus_tag LOCUS_t00480 4234 4161 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4364 4292 gene locus_tag LOCUS_t00490 4364 4292 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4630 4540 gene locus_tag LOCUS_t00500 4630 4540 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4785 4696 gene locus_tag LOCUS_t00510 4785 4696 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4910 4822 gene locus_tag LOCUS_t00520 4910 4822 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5038 4949 gene locus_tag LOCUS_t00530 5038 4949 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5129 5041 gene locus_tag LOCUS_t00540 5129 5041 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6037 5537 gene locus_tag LOCUS_16240 6037 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 <7056 6021 gene locus_tag LOCUS_16250 <7056 6021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120681.1:sulfatase >Feature sequence0220 317 1342 gene locus_tag LOCUS_16260 317 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2159 1413 gene locus_tag LOCUS_16270 2159 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 4091 2232 gene locus_tag LOCUS_16280 4091 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 6516 4483 gene locus_tag LOCUS_16290 6516 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence0221 2017 1379 gene locus_tag LOCUS_16300 2017 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 2519 2103 gene locus_tag LOCUS_16310 2519 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 4219 2579 gene locus_tag LOCUS_16320 4219 2579 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z766 protein_id gnl|my_center|LOCUS_16320 5427 4354 gene locus_tag LOCUS_16330 5427 4354 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089280.1 protein_id gnl|my_center|LOCUS_16330 6376 5471 gene locus_tag LOCUS_16340 6376 5471 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886818.1 protein_id gnl|my_center|LOCUS_16340 6599 6841 gene locus_tag LOCUS_16350 6599 6841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence0222 3526 1688 gene locus_tag LOCUS_16360 3526 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 5613 3592 gene locus_tag LOCUS_16370 5613 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 6919 5873 gene locus_tag LOCUS_16380 6919 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence0223 1387 839 gene locus_tag LOCUS_16390 1387 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2319 1549 gene locus_tag LOCUS_16400 2319 1549 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HD72 protein_id gnl|my_center|LOCUS_16400 2734 2414 gene locus_tag LOCUS_16410 2734 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 2621 4828 gene locus_tag LOCUS_16420 2621 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 5161 6579 gene locus_tag LOCUS_16430 5161 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence0224 668 210 gene locus_tag LOCUS_16440 668 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 3590 795 gene locus_tag LOCUS_16450 3590 795 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_16450 4300 3812 gene locus_tag LOCUS_16460 4300 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 4956 4351 gene locus_tag LOCUS_16470 4956 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 6148 5408 gene locus_tag LOCUS_16480 6148 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence0225 <1 1486 gene locus_tag LOCUS_16490 <1 1486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030785.1:polyketide synthase 1550 6901 gene locus_tag LOCUS_16500 1550 6901 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence0226 942 2249 gene locus_tag LOCUS_16510 942 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2327 2611 gene locus_tag LOCUS_16520 2327 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2665 3894 gene locus_tag LOCUS_16530 2665 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 4659 3910 gene locus_tag LOCUS_16540 4659 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 4559 4828 gene locus_tag LOCUS_16550 4559 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 5892 5155 gene locus_tag LOCUS_16560 5892 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 6291 6785 gene locus_tag LOCUS_16570 6291 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence0227 1931 402 gene locus_tag LOCUS_16580 1931 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2705 2061 gene locus_tag LOCUS_16590 2705 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2946 3365 gene locus_tag LOCUS_16600 2946 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 3484 4737 gene locus_tag LOCUS_16610 3484 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 5677 4751 gene locus_tag LOCUS_16620 5677 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 5661 6086 gene locus_tag LOCUS_16630 5661 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence0228 1063 170 gene locus_tag LOCUS_16640 1063 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1543 1133 gene locus_tag LOCUS_16650 1543 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2333 1695 gene locus_tag LOCUS_16660 2333 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2239 2565 gene locus_tag LOCUS_16670 2239 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 2749 3198 gene locus_tag LOCUS_16680 2749 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3375 3995 gene locus_tag LOCUS_16690 3375 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 4618 4088 gene locus_tag LOCUS_16700 4618 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 5293 4847 gene locus_tag LOCUS_16710 5293 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 5366 6442 gene locus_tag LOCUS_16720 5366 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 6968 6477 gene locus_tag LOCUS_16730 6968 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence0229 <1 591 gene locus_tag LOCUS_16740 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228721.1:carotenoid cleavage dioxygenase 707 1945 gene locus_tag LOCUS_16750 707 1945 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920947.1 protein_id gnl|my_center|LOCUS_16750 1995 2612 gene locus_tag LOCUS_16760 1995 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2776 4734 gene locus_tag LOCUS_16770 2776 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_16770 5052 4750 gene locus_tag LOCUS_16780 5052 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 5889 5125 gene locus_tag LOCUS_16790 5889 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 <6961 6115 gene locus_tag LOCUS_16800 <6961 6115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y8U7:glutathione synthetase >Feature sequence0230 2498 1014 gene locus_tag LOCUS_16810 2498 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 2732 2660 gene locus_tag LOCUS_t00550 2732 2660 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5671 2858 gene locus_tag LOCUS_16820 5671 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 6160 5681 gene locus_tag LOCUS_16830 6160 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence0231 1186 482 gene locus_tag LOCUS_16840 1186 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1468 1304 gene locus_tag LOCUS_16850 1468 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1831 2310 gene locus_tag LOCUS_16860 1831 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2589 3215 gene locus_tag LOCUS_16870 2589 3215 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_16870 3346 3579 gene locus_tag LOCUS_16880 3346 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3576 4634 gene locus_tag LOCUS_16890 3576 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 4911 5444 gene locus_tag LOCUS_16900 4911 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 5447 6115 gene locus_tag LOCUS_16910 5447 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 <6909 6292 gene locus_tag LOCUS_16920 <6909 6292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083526.1:copper-translocating P-type ATPase >Feature sequence0232 658 1512 gene locus_tag LOCUS_16930 658 1512 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975449.1 protein_id gnl|my_center|LOCUS_16930 1680 2351 gene locus_tag LOCUS_16940 gene rplC 1680 2351 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30762 protein_id gnl|my_center|LOCUS_16940 2431 3186 gene locus_tag LOCUS_16950 gene rlmE 2431 3186 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729T9 protein_id gnl|my_center|LOCUS_16950 3470 3703 gene locus_tag LOCUS_16960 3470 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 3777 5729 gene locus_tag LOCUS_16970 gene typA 3777 5729 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_16970 6602 5799 gene locus_tag LOCUS_16980 6602 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence0233 237 641 gene locus_tag LOCUS_16990 237 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 696 1799 gene locus_tag LOCUS_17000 696 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2840 1776 gene locus_tag LOCUS_17010 2840 1776 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_17010 3112 3285 gene locus_tag LOCUS_17020 3112 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 3426 4664 gene locus_tag LOCUS_17030 gene argG 3426 4664 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59607 protein_id gnl|my_center|LOCUS_17030 >Feature sequence0234 <1 578 gene locus_tag LOCUS_17040 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082025.1:peptidase C11 648 1325 gene locus_tag LOCUS_17050 648 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_17050 1877 1335 gene locus_tag LOCUS_17060 1877 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2102 3322 gene locus_tag LOCUS_17070 2102 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706990.1 protein_id gnl|my_center|LOCUS_17070 3337 4617 gene locus_tag LOCUS_17080 3337 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 5493 4675 gene locus_tag LOCUS_17090 5493 4675 CDS product desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807002.1 protein_id gnl|my_center|LOCUS_17090 6457 5639 gene locus_tag LOCUS_17100 6457 5639 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118565.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence0235 377 3316 gene locus_tag LOCUS_17110 377 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3345 5408 gene locus_tag LOCUS_17120 3345 5408 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_17120 5909 6799 gene locus_tag LOCUS_17130 5909 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence0236 620 1837 gene locus_tag LOCUS_17140 620 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3263 1851 gene locus_tag LOCUS_17150 3263 1851 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B650 protein_id gnl|my_center|LOCUS_17150 4037 3369 gene locus_tag LOCUS_17160 4037 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 4540 4067 gene locus_tag LOCUS_17170 4540 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 4912 6825 gene locus_tag LOCUS_17180 4912 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence0237 <1 861 gene locus_tag LOCUS_17190 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003409654.1:membrane protein 2482 884 gene locus_tag LOCUS_17200 2482 884 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887610.1 protein_id gnl|my_center|LOCUS_17200 3359 2490 gene locus_tag LOCUS_17210 3359 2490 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532747.1 protein_id gnl|my_center|LOCUS_17210 3627 4856 gene locus_tag LOCUS_17220 3627 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence0238 872 336 gene locus_tag LOCUS_17230 872 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1022 2137 gene locus_tag LOCUS_17240 gene speB 1022 2137 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_17240 2180 3400 gene locus_tag LOCUS_17250 2180 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 3770 4996 gene locus_tag LOCUS_17260 3770 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence0239 983 90 gene locus_tag LOCUS_17270 983 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 2647 1745 gene locus_tag LOCUS_17280 2647 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 3145 3765 gene locus_tag LOCUS_17290 gene rpoE 3145 3765 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230397.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence0240 638 2695 gene locus_tag LOCUS_17300 gene thrS 638 2695 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6L8 protein_id gnl|my_center|LOCUS_17300 3034 4287 gene locus_tag LOCUS_17310 3034 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 4913 4479 gene locus_tag LOCUS_17320 4913 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 6315 4984 gene locus_tag LOCUS_17330 6315 4984 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533381.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence0241 <1 827 gene locus_tag LOCUS_17340 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K4PU03:peptide chain release factor 3 1124 1966 gene locus_tag LOCUS_17350 1124 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140126.1 protein_id gnl|my_center|LOCUS_17350 2058 4331 gene locus_tag LOCUS_17360 2058 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4699 4337 gene locus_tag LOCUS_17370 4699 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 4871 6373 gene locus_tag LOCUS_17380 4871 6373 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence0242 364 903 gene locus_tag LOCUS_17390 364 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1206 1757 gene locus_tag LOCUS_17400 1206 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2442 2903 gene locus_tag LOCUS_17410 2442 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 3220 5370 gene locus_tag LOCUS_17420 3220 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 5397 5921 gene locus_tag LOCUS_17430 5397 5921 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_17430 5928 6650 gene locus_tag LOCUS_17440 5928 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence0243 1267 170 gene locus_tag LOCUS_17450 gene ddl 1267 170 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG68 protein_id gnl|my_center|LOCUS_17450 1518 1396 gene locus_tag LOCUS_17460 1518 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1743 3104 gene locus_tag LOCUS_17470 gene serS 1743 3104 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KB2 protein_id gnl|my_center|LOCUS_17470 3159 3836 gene locus_tag LOCUS_17480 3159 3836 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868825.1 protein_id gnl|my_center|LOCUS_17480 5500 4226 gene locus_tag LOCUS_17490 5500 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence0244 <1 804 gene locus_tag LOCUS_17500 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338430.1:NADH pyrophosphatase 1725 814 gene locus_tag LOCUS_17510 1725 814 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976359.1 protein_id gnl|my_center|LOCUS_17510 2493 1795 gene locus_tag LOCUS_17520 2493 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 3069 2731 gene locus_tag LOCUS_17530 3069 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 3157 4413 gene locus_tag LOCUS_17540 3157 4413 CDS product GDL motif peptide-associated radical SAM/SPASM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200682.1 protein_id gnl|my_center|LOCUS_17540 5414 4692 gene locus_tag LOCUS_17550 5414 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence0245 1008 424 gene locus_tag LOCUS_17560 1008 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1679 1332 gene locus_tag LOCUS_17570 1679 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021271.1 protein_id gnl|my_center|LOCUS_17570 2644 1928 gene locus_tag LOCUS_17580 2644 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 3817 2654 gene locus_tag LOCUS_17590 3817 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946040.1 protein_id gnl|my_center|LOCUS_17590 4146 3847 gene locus_tag LOCUS_17600 4146 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 4227 5831 gene locus_tag LOCUS_17610 4227 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 5882 6133 gene locus_tag LOCUS_17620 5882 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 6124 6774 gene locus_tag LOCUS_17630 6124 6774 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence0246 1868 534 gene locus_tag LOCUS_17640 1868 534 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_17640 2544 4382 gene locus_tag LOCUS_17650 2544 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 4379 5704 gene locus_tag LOCUS_17660 4379 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence0247 910 59 gene locus_tag LOCUS_17670 910 59 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390733.1 protein_id gnl|my_center|LOCUS_17670 2559 928 gene locus_tag LOCUS_17680 2559 928 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390732.1 protein_id gnl|my_center|LOCUS_17680 2787 3626 gene locus_tag LOCUS_17690 2787 3626 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390731.1 protein_id gnl|my_center|LOCUS_17690 3676 5949 gene locus_tag LOCUS_17700 3676 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 5995 6387 gene locus_tag LOCUS_17710 5995 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence0248 346 1647 gene locus_tag LOCUS_17720 346 1647 CDS product reverse transcriptase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_17720 3835 1754 gene locus_tag LOCUS_17730 3835 1754 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 protein_id gnl|my_center|LOCUS_17730 4078 4392 gene locus_tag LOCUS_17740 4078 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 4513 6735 gene locus_tag LOCUS_17750 4513 6735 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088156.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence0249 1741 2127 gene locus_tag LOCUS_17760 1741 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 2436 2176 gene locus_tag LOCUS_17770 2436 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 3655 2552 gene locus_tag LOCUS_17780 gene dnaJ 3655 2552 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH58 protein_id gnl|my_center|LOCUS_17780 4272 3676 gene locus_tag LOCUS_17790 gene grpE 4272 3676 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56236 protein_id gnl|my_center|LOCUS_17790 5449 4331 gene locus_tag LOCUS_17800 gene hrcA 5449 4331 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV3 protein_id gnl|my_center|LOCUS_17800 <6738 5538 gene locus_tag LOCUS_17810 <6738 5538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729894.1:coproporphyrinogen III oxidase >Feature sequence0250 2 982 gene locus_tag LOCUS_17820 2 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1421 6697 gene locus_tag LOCUS_17830 1421 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence0251 1762 182 gene locus_tag LOCUS_17840 1762 182 CDS product reverse transcriptase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_17840 3796 2153 gene locus_tag LOCUS_17850 3796 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence0252 726 1310 gene locus_tag LOCUS_17860 726 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3315 1393 gene locus_tag LOCUS_17870 gene gyrB 3315 1393 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU72 protein_id gnl|my_center|LOCUS_17870 3287 3847 gene locus_tag LOCUS_17880 3287 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 6248 3762 gene locus_tag LOCUS_17890 6248 3762 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H4 protein_id gnl|my_center|LOCUS_17890 6490 6708 gene locus_tag LOCUS_17900 gene infA 6490 6708 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61688 protein_id gnl|my_center|LOCUS_17900 >Feature sequence0253 712 251 gene locus_tag LOCUS_17910 712 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228322.1 protein_id gnl|my_center|LOCUS_17910 825 2021 gene locus_tag LOCUS_17920 825 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2314 2961 gene locus_tag LOCUS_17930 2314 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3439 3038 gene locus_tag LOCUS_17940 3439 3038 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122849.1 protein_id gnl|my_center|LOCUS_17940 3527 4522 gene locus_tag LOCUS_17950 3527 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919490.1 protein_id gnl|my_center|LOCUS_17950 5390 4533 gene locus_tag LOCUS_17960 5390 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 6112 5546 gene locus_tag LOCUS_17970 6112 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence0254 1309 449 gene locus_tag LOCUS_17980 1309 449 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886659.1 protein_id gnl|my_center|LOCUS_17980 1474 2271 gene locus_tag LOCUS_17990 1474 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 3869 2328 gene locus_tag LOCUS_18000 3869 2328 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 protein_id gnl|my_center|LOCUS_18000 4252 4530 gene locus_tag LOCUS_18010 4252 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 4562 5815 gene locus_tag LOCUS_18020 4562 5815 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence0255 426 1382 gene locus_tag LOCUS_18030 426 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 1392 2465 gene locus_tag LOCUS_18040 1392 2465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028242.1 protein_id gnl|my_center|LOCUS_18040 3549 4568 gene locus_tag LOCUS_18050 3549 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 5021 6052 gene locus_tag LOCUS_18060 gene fabH2 5021 6052 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence0256 412 867 gene locus_tag LOCUS_18070 412 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 920 2404 gene locus_tag LOCUS_18080 920 2404 CDS product lignostilbene alpha-beta-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055870.1 protein_id gnl|my_center|LOCUS_18080 2494 3210 gene locus_tag LOCUS_18090 2494 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4136 3252 gene locus_tag LOCUS_18100 4136 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 4548 4300 gene locus_tag LOCUS_18110 4548 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 4436 5605 gene locus_tag LOCUS_18120 4436 5605 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence0257 180 644 gene locus_tag LOCUS_18130 180 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140128.1 protein_id gnl|my_center|LOCUS_18130 690 2141 gene locus_tag LOCUS_18140 690 2141 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941467.1 protein_id gnl|my_center|LOCUS_18140 2234 2785 gene locus_tag LOCUS_18150 2234 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2778 3530 gene locus_tag LOCUS_18160 2778 3530 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224231.1 protein_id gnl|my_center|LOCUS_18160 3588 4973 gene locus_tag LOCUS_18170 3588 4973 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_18170 5881 5045 gene locus_tag LOCUS_18180 5881 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence0258 320 1843 gene locus_tag LOCUS_18190 320 1843 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704452.1 protein_id gnl|my_center|LOCUS_18190 2840 1860 gene locus_tag LOCUS_18200 2840 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 3144 4169 gene locus_tag LOCUS_18210 gene rnz 3144 4169 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTB0 protein_id gnl|my_center|LOCUS_18210 4222 5619 gene locus_tag LOCUS_18220 gene accC 4222 5619 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence0259 2814 2185 gene locus_tag LOCUS_18230 2814 2185 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_18230 3128 3982 gene locus_tag LOCUS_18240 3128 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 4094 4231 gene locus_tag LOCUS_18250 4094 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 4759 4250 gene locus_tag LOCUS_18260 4759 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 5240 6331 gene locus_tag LOCUS_18270 5240 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence0260 269 1153 gene locus_tag LOCUS_18280 269 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 1262 2293 gene locus_tag LOCUS_18290 1262 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2290 2904 gene locus_tag LOCUS_18300 2290 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2942 3016 gene locus_tag LOCUS_t00560 2942 3016 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3201 3129 gene locus_tag LOCUS_t00570 3201 3129 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3336 3263 gene locus_tag LOCUS_t00580 3336 3263 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4150 3422 gene locus_tag LOCUS_18310 4150 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 5000 4335 gene locus_tag LOCUS_18320 5000 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 5876 5352 gene locus_tag LOCUS_18330 5876 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence0261 636 271 gene locus_tag LOCUS_18340 636 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1089 1541 gene locus_tag LOCUS_18350 1089 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 2498 1554 gene locus_tag LOCUS_18360 2498 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 3047 2595 gene locus_tag LOCUS_18370 3047 2595 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977376.1 protein_id gnl|my_center|LOCUS_18370 4657 3098 gene locus_tag LOCUS_18380 4657 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 6483 4897 gene locus_tag LOCUS_18390 6483 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence0262 737 1576 gene locus_tag LOCUS_18400 737 1576 CDS product retinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402797.1 protein_id gnl|my_center|LOCUS_18400 1638 2960 gene locus_tag LOCUS_18410 gene norM 1638 2960 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783536.1 protein_id gnl|my_center|LOCUS_18410 3086 3982 gene locus_tag LOCUS_18420 3086 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 4628 3966 gene locus_tag LOCUS_18430 4628 3966 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence0263 366 878 gene locus_tag LOCUS_18440 366 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 885 1679 gene locus_tag LOCUS_18450 885 1679 CDS product toluene tolerance protein Ttg2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545754.1 protein_id gnl|my_center|LOCUS_18450 1702 2451 gene locus_tag LOCUS_18460 1702 2451 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_18460 2456 3862 gene locus_tag LOCUS_18470 2456 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 4867 3935 gene locus_tag LOCUS_18480 4867 3935 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114813.1 protein_id gnl|my_center|LOCUS_18480 5218 4991 gene locus_tag LOCUS_18490 5218 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 5368 6180 gene locus_tag LOCUS_18500 5368 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence0264 433 1236 gene locus_tag LOCUS_18510 433 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1526 1263 gene locus_tag LOCUS_18520 1526 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2934 1549 gene locus_tag LOCUS_18530 2934 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 4276 2957 gene locus_tag LOCUS_18540 4276 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 4502 5521 gene locus_tag LOCUS_18550 4502 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 5645 6286 gene locus_tag LOCUS_18560 5645 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence0265 728 2089 gene locus_tag LOCUS_18570 728 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2512 3354 gene locus_tag LOCUS_18580 2512 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 3571 4743 gene locus_tag LOCUS_18590 3571 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_18590 4831 6012 gene locus_tag LOCUS_18600 4831 6012 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707150.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence0266 2158 1313 gene locus_tag LOCUS_18610 gene deoD 2158 1313 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE80 protein_id gnl|my_center|LOCUS_18610 2844 3452 gene locus_tag LOCUS_18620 2844 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4364 3483 gene locus_tag LOCUS_18630 4364 3483 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230430.1 protein_id gnl|my_center|LOCUS_18630 5170 4433 gene locus_tag LOCUS_18640 5170 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 5052 5615 gene locus_tag LOCUS_18650 5052 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 5742 6245 gene locus_tag LOCUS_18660 5742 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence0267 631 125 gene locus_tag LOCUS_18670 631 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2078 693 gene locus_tag LOCUS_18680 2078 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 2969 2151 gene locus_tag LOCUS_18690 2969 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 4417 2966 gene locus_tag LOCUS_18700 4417 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 5694 4531 gene locus_tag LOCUS_18710 5694 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence0268 928 638 gene locus_tag LOCUS_18720 928 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258032.1 protein_id gnl|my_center|LOCUS_18720 1591 956 gene locus_tag LOCUS_18730 1591 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_18730 2836 1595 gene locus_tag LOCUS_18740 2836 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 6377 2829 gene locus_tag LOCUS_18750 6377 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence0269 375 794 gene locus_tag LOCUS_18760 375 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1677 3926 gene locus_tag LOCUS_18770 1677 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 4256 4699 gene locus_tag LOCUS_18780 4256 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 4696 5358 gene locus_tag LOCUS_18790 4696 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 5701 6447 gene locus_tag LOCUS_18800 5701 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence0270 1179 493 gene locus_tag LOCUS_18810 gene ung2 1179 493 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3Z0 protein_id gnl|my_center|LOCUS_18810 2918 1404 gene locus_tag LOCUS_18820 gene pepA 2918 1404 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2Q7 protein_id gnl|my_center|LOCUS_18820 3458 5380 gene locus_tag LOCUS_18830 3458 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 5484 6359 gene locus_tag LOCUS_18840 5484 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence0271 436 1134 gene locus_tag LOCUS_18850 436 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1619 1167 gene locus_tag LOCUS_18860 1619 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1872 2765 gene locus_tag LOCUS_18870 1872 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 3188 2796 gene locus_tag LOCUS_18880 3188 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 3386 3964 gene locus_tag LOCUS_18890 3386 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 4509 4000 gene locus_tag LOCUS_18900 4509 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence0272 126 1643 gene locus_tag LOCUS_18910 126 1643 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_18910 2202 1636 gene locus_tag LOCUS_18920 2202 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 3143 2229 gene locus_tag LOCUS_18930 3143 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 4357 3392 gene locus_tag LOCUS_18940 4357 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 5602 4484 gene locus_tag LOCUS_18950 5602 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence0273 1824 202 gene locus_tag LOCUS_18960 1824 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 2254 1898 gene locus_tag LOCUS_18970 2254 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 3380 5080 gene locus_tag LOCUS_18980 3380 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence0274 931 167 gene locus_tag LOCUS_18990 931 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 5010 1222 gene locus_tag LOCUS_19000 5010 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 5647 5390 gene locus_tag LOCUS_19010 5647 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 6021 5749 gene locus_tag LOCUS_19020 6021 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 6020 6310 gene locus_tag LOCUS_19030 6020 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence0275 3364 890 gene locus_tag LOCUS_19040 3364 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 4304 3777 gene locus_tag LOCUS_19050 4304 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 5017 4301 gene locus_tag LOCUS_19060 5017 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 5691 5014 gene locus_tag LOCUS_19070 gene sigE 5691 5014 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VW35 protein_id gnl|my_center|LOCUS_19070 >Feature sequence0276 <1 562 gene locus_tag LOCUS_19080 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258732.1:ABC transporter ATP-binding protein 702 2501 gene locus_tag LOCUS_19090 702 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2498 3595 gene locus_tag LOCUS_19100 2498 3595 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_19100 3679 5316 gene locus_tag LOCUS_19110 gene glyQS 3679 5316 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56206 protein_id gnl|my_center|LOCUS_19110 5725 5444 gene locus_tag LOCUS_19120 5725 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 <6456 5882 gene locus_tag LOCUS_19130 <6456 5882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258849.1:rhomboid family intramembrane serine protease >Feature sequence0277 438 722 gene locus_tag LOCUS_19140 438 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 794 2479 gene locus_tag LOCUS_19150 794 2479 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897264.1 protein_id gnl|my_center|LOCUS_19150 2718 3638 gene locus_tag LOCUS_19160 2718 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 3934 3728 gene locus_tag LOCUS_19170 3934 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 3927 5258 gene locus_tag LOCUS_19180 3927 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 6405 5278 gene locus_tag LOCUS_19190 6405 5278 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727100.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence0278 310 238 gene locus_tag LOCUS_t00590 310 238 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 580 1206 gene locus_tag LOCUS_19200 580 1206 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_19200 1203 1637 gene locus_tag LOCUS_19210 1203 1637 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 protein_id gnl|my_center|LOCUS_19210 1738 2043 gene locus_tag LOCUS_19220 1738 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2040 4280 gene locus_tag LOCUS_19230 2040 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 4763 4263 gene locus_tag LOCUS_19240 4763 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 6443 4902 gene locus_tag LOCUS_19250 6443 4902 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766760.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence0279 1766 1209 gene locus_tag LOCUS_19260 1766 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 3183 1789 gene locus_tag LOCUS_19270 3183 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 3861 5081 gene locus_tag LOCUS_19280 3861 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence0280 525 1442 gene locus_tag LOCUS_19290 525 1442 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_457556.1 protein_id gnl|my_center|LOCUS_19290 2479 1538 gene locus_tag LOCUS_19300 2479 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705518.1 protein_id gnl|my_center|LOCUS_19300 3092 4735 gene locus_tag LOCUS_19310 3092 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 4964 4770 gene locus_tag LOCUS_19320 4964 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 6365 5139 gene locus_tag LOCUS_19330 6365 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence0281 633 298 gene locus_tag LOCUS_19340 633 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 593 775 gene locus_tag LOCUS_19350 593 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1881 772 gene locus_tag LOCUS_19360 1881 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 3299 2340 gene locus_tag LOCUS_19370 3299 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 4139 3414 gene locus_tag LOCUS_19380 4139 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 5229 4201 gene locus_tag LOCUS_19390 5229 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 5909 5319 gene locus_tag LOCUS_19400 5909 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence0282 4000 524 gene locus_tag LOCUS_19410 4000 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 5320 4487 gene locus_tag LOCUS_19420 gene murI 5320 4487 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E11 protein_id gnl|my_center|LOCUS_19420 <6416 5337 gene locus_tag LOCUS_19430 <6416 5337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228466.1:acyl-CoA dehydrogenase >Feature sequence0283 173 658 gene locus_tag LOCUS_19440 173 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 1815 790 gene locus_tag LOCUS_19450 1815 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2874 1828 gene locus_tag LOCUS_19460 2874 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4793 3582 gene locus_tag LOCUS_19470 gene ftsY 4793 3582 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E32 protein_id gnl|my_center|LOCUS_19470 >Feature sequence0284 563 1024 gene locus_tag LOCUS_19480 563 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1532 2470 gene locus_tag LOCUS_19490 1532 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2736 2467 gene locus_tag LOCUS_19500 2736 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2648 4561 gene locus_tag LOCUS_19510 2648 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 <6401 4575 gene locus_tag LOCUS_19520 <6401 4575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393971.1:PAS domain-containing sensor histidine kinase >Feature sequence0285 960 475 gene locus_tag LOCUS_19530 960 475 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_19530 2753 1005 gene locus_tag LOCUS_19540 2753 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 3421 2801 gene locus_tag LOCUS_19550 3421 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 3460 4554 gene locus_tag LOCUS_19560 3460 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 5244 4624 gene locus_tag LOCUS_19570 5244 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 5588 6016 gene locus_tag LOCUS_19580 5588 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence0286 45 563 gene locus_tag LOCUS_19590 45 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 633 2699 gene locus_tag LOCUS_19600 gene metG 633 2699 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1Q0 protein_id gnl|my_center|LOCUS_19600 3637 2798 gene locus_tag LOCUS_19610 3637 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 3893 5056 gene locus_tag LOCUS_19620 3893 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 5135 5422 gene locus_tag LOCUS_19630 5135 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence0287 2 1039 gene locus_tag LOCUS_19640 2 1039 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 protein_id gnl|my_center|LOCUS_19640 1212 2096 gene locus_tag LOCUS_19650 1212 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2925 2134 gene locus_tag LOCUS_19660 2925 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 3265 3017 gene locus_tag LOCUS_19670 3265 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 3234 4106 gene locus_tag LOCUS_19680 3234 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 4355 4843 gene locus_tag LOCUS_19690 4355 4843 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893937.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence0288 2294 1869 gene locus_tag LOCUS_19700 2294 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 3794 2553 gene locus_tag LOCUS_19710 gene tgt 3794 2553 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E53 protein_id gnl|my_center|LOCUS_19710 5033 3867 gene locus_tag LOCUS_19720 gene queA 5033 3867 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB05 protein_id gnl|my_center|LOCUS_19720 >Feature sequence0289 <1 699 gene locus_tag LOCUS_19730 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048147030.1:dolichol-P-glucose synthetase 736 1656 gene locus_tag LOCUS_19740 736 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2323 1604 gene locus_tag LOCUS_19750 2323 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2508 3416 gene locus_tag LOCUS_19760 2508 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 3630 3983 gene locus_tag LOCUS_19770 3630 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 6328 4070 gene locus_tag LOCUS_19780 6328 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence0290 >Feature sequence0291 285 644 gene locus_tag LOCUS_19790 285 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 641 1675 gene locus_tag LOCUS_19800 641 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 5263 1670 gene locus_tag LOCUS_19810 5263 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 <6338 5270 gene locus_tag LOCUS_19820 <6338 5270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000625590.1:transcriptional regulator >Feature sequence0292 2250 2921 gene locus_tag LOCUS_19830 gene maiA 2250 2921 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765137.1 protein_id gnl|my_center|LOCUS_19830 4547 2922 gene locus_tag LOCUS_19840 gene rtcR 4547 2922 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112813.1 protein_id gnl|my_center|LOCUS_19840 4692 5966 gene locus_tag LOCUS_19850 gene rtcB 4692 5966 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMD9 protein_id gnl|my_center|LOCUS_19850 >Feature sequence0293 632 1672 gene locus_tag LOCUS_19860 632 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1756 3054 gene locus_tag LOCUS_19870 1756 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 4733 3120 gene locus_tag LOCUS_19880 4733 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence0294 937 1461 gene locus_tag LOCUS_19890 gene defA 937 1461 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I068 protein_id gnl|my_center|LOCUS_19890 2278 1469 gene locus_tag LOCUS_19900 2278 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 3687 2299 gene locus_tag LOCUS_19910 3687 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 4607 3777 gene locus_tag LOCUS_19920 4607 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 5895 4630 gene locus_tag LOCUS_19930 5895 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence0295 2978 1197 gene locus_tag LOCUS_19940 2978 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 3199 3873 gene locus_tag LOCUS_19950 gene hpt 3199 3873 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q839B2 protein_id gnl|my_center|LOCUS_19950 4041 4544 gene locus_tag LOCUS_19960 4041 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 5079 4519 gene locus_tag LOCUS_19970 5079 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 6257 5169 gene locus_tag LOCUS_19980 6257 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence0296 3177 1528 gene locus_tag LOCUS_19990 3177 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 4691 3387 gene locus_tag LOCUS_20000 gene eno 4691 3387 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J10 protein_id gnl|my_center|LOCUS_20000 >Feature sequence0297 1059 2669 gene locus_tag LOCUS_20010 1059 2669 CDS product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457553.1 protein_id gnl|my_center|LOCUS_20010 4121 2736 gene locus_tag LOCUS_20020 4121 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 5887 4193 gene locus_tag LOCUS_20030 5887 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence0298 2704 1769 gene locus_tag LOCUS_20040 2704 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 3251 2913 gene locus_tag LOCUS_20050 3251 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3133 3906 gene locus_tag LOCUS_20060 3133 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 4203 5852 gene locus_tag LOCUS_20070 4203 5852 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence0299 <1 543 gene locus_tag LOCUS_20080 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113970.1:transcriptional regulator 1055 540 gene locus_tag LOCUS_20090 1055 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 1055 1480 gene locus_tag LOCUS_20100 gene yrdB 1055 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07080 protein_id gnl|my_center|LOCUS_20100 2591 1506 gene locus_tag LOCUS_20110 2591 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 4370 2865 gene locus_tag LOCUS_20120 gene panF 4370 2865 CDS product pantothenate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404732.1 protein_id gnl|my_center|LOCUS_20120 4590 4363 gene locus_tag LOCUS_20130 4590 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 <6243 4597 gene locus_tag LOCUS_20140 <6243 4597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939285.1:sulfate transporter >Feature sequence0300 1084 2415 gene locus_tag LOCUS_20150 1084 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 3084 2476 gene locus_tag LOCUS_20160 3084 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 3669 3148 gene locus_tag LOCUS_20170 3669 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 5396 3822 gene locus_tag LOCUS_20180 5396 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence0301 439 1881 gene locus_tag LOCUS_20190 439 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 1919 3988 gene locus_tag LOCUS_20200 1919 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 4476 5021 gene locus_tag LOCUS_20210 4476 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 <6228 5056 gene locus_tag LOCUS_20220 <6228 5056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C66:ATP-dependent zinc metalloprotease FtsH >Feature sequence0302 527 2509 gene locus_tag LOCUS_20230 527 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2593 2748 gene locus_tag LOCUS_20240 2593 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 3165 4250 gene locus_tag LOCUS_20250 3165 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 6019 4247 gene locus_tag LOCUS_20260 6019 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence0303 2203 1742 gene locus_tag LOCUS_20270 2203 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2610 3476 gene locus_tag LOCUS_20280 2610 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 3925 3602 gene locus_tag LOCUS_20290 3925 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 4152 4481 gene locus_tag LOCUS_20300 4152 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 5357 4473 gene locus_tag LOCUS_20310 5357 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 <6219 5354 gene locus_tag LOCUS_20320 <6219 5354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140385.1:cation transporter >Feature sequence0304 <1 1629 gene locus_tag LOCUS_20330 <1 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92WJ7:histidine kinase 2219 1647 gene locus_tag LOCUS_20340 2219 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 3793 2333 gene locus_tag LOCUS_20350 3793 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 4101 5108 gene locus_tag LOCUS_20360 4101 5108 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143449.1 protein_id gnl|my_center|LOCUS_20360 5858 5139 gene locus_tag LOCUS_20370 5858 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence0305 1333 302 gene locus_tag LOCUS_20380 gene rsmH 1333 302 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK87 protein_id gnl|my_center|LOCUS_20380 1471 2283 gene locus_tag LOCUS_20390 1471 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2391 2987 gene locus_tag LOCUS_20400 2391 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3053 4414 gene locus_tag LOCUS_20410 gene lysA 3053 4414 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE4 protein_id gnl|my_center|LOCUS_20410 >Feature sequence0306 138 659 gene locus_tag LOCUS_20420 138 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 743 2434 gene locus_tag LOCUS_20430 743 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2677 3285 gene locus_tag LOCUS_20440 2677 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 3416 4540 gene locus_tag LOCUS_20450 3416 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 5353 4601 gene locus_tag LOCUS_20460 gene cobB 5353 4601 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67919 protein_id gnl|my_center|LOCUS_20460 5506 6057 gene locus_tag LOCUS_20470 5506 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence0307 1203 2168 gene locus_tag LOCUS_20480 1203 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2325 4580 gene locus_tag LOCUS_20490 2325 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 5963 4596 gene locus_tag LOCUS_20500 5963 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence0308 66 443 gene locus_tag LOCUS_20510 66 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 559 1062 gene locus_tag LOCUS_20520 559 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 1070 1633 gene locus_tag LOCUS_20530 1070 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 1634 2152 gene locus_tag LOCUS_20540 1634 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2850 2146 gene locus_tag LOCUS_20550 2850 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 4028 2934 gene locus_tag LOCUS_20560 4028 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 4412 4080 gene locus_tag LOCUS_20570 gene ydzA 4412 4080 CDS product putative membrane protein YdzA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31485 protein_id gnl|my_center|LOCUS_20570 4593 5678 gene locus_tag LOCUS_20580 4593 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence0309 1594 785 gene locus_tag LOCUS_20590 1594 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2586 1567 gene locus_tag LOCUS_20600 2586 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2904 4049 gene locus_tag LOCUS_20610 2904 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 6011 4092 gene locus_tag LOCUS_20620 6011 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence0310 1467 736 gene locus_tag LOCUS_20630 1467 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 4421 1725 gene locus_tag LOCUS_20640 4421 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 <6127 4490 gene locus_tag LOCUS_20650 <6127 4490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WJD6:endonuclease MutS2 >Feature sequence0311 <1 559 gene locus_tag LOCUS_20660 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803855.1:glycosyl transferase 2085 541 gene locus_tag LOCUS_20670 gene snr1 2085 541 CDS product cytochrome C Snr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103259.1 protein_id gnl|my_center|LOCUS_20670 2540 2082 gene locus_tag LOCUS_20680 2540 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 3283 2786 gene locus_tag LOCUS_20690 3283 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 5574 3280 gene locus_tag LOCUS_20700 5574 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence0312 652 2226 gene locus_tag LOCUS_20710 652 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106273.1 protein_id gnl|my_center|LOCUS_20710 2806 2285 gene locus_tag LOCUS_20720 2806 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3549 3064 gene locus_tag LOCUS_20730 3549 3064 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIW4 protein_id gnl|my_center|LOCUS_20730 3647 4453 gene locus_tag LOCUS_20740 3647 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 4450 5997 gene locus_tag LOCUS_20750 4450 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence0313 1069 155 gene locus_tag LOCUS_20760 1069 155 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 protein_id gnl|my_center|LOCUS_20760 3144 1114 gene locus_tag LOCUS_20770 gene glgB 3144 1114 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJB4 protein_id gnl|my_center|LOCUS_20770 3323 4612 gene locus_tag LOCUS_20780 3323 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 4670 5194 gene locus_tag LOCUS_20790 4670 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 5966 5217 gene locus_tag LOCUS_20800 5966 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 >Feature sequence0314 1831 380 gene locus_tag LOCUS_20810 gene purB 1831 380 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFU0 protein_id gnl|my_center|LOCUS_20810 2012 2665 gene locus_tag LOCUS_20820 2012 2665 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MF13 protein_id gnl|my_center|LOCUS_20820 2767 3678 gene locus_tag LOCUS_20830 2767 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 3902 5656 gene locus_tag LOCUS_20840 3902 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence0315 402 1157 gene locus_tag LOCUS_20850 402 1157 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_20850 5580 1132 gene locus_tag LOCUS_20860 5580 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229642.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence0316 1114 143 gene locus_tag LOCUS_20870 1114 143 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_20870 1711 2028 gene locus_tag LOCUS_20880 1711 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 3349 2114 gene locus_tag LOCUS_20890 3349 2114 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_20890 3270 3635 gene locus_tag LOCUS_20900 3270 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 4813 3719 gene locus_tag LOCUS_20910 4813 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence0317 <1 1322 gene locus_tag LOCUS_20920 <1 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729127.1:molybdopterin oxidoreductase 1414 1902 gene locus_tag LOCUS_20930 1414 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2343 1987 gene locus_tag LOCUS_20940 2343 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2513 3418 gene locus_tag LOCUS_20950 2513 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 5299 3425 gene locus_tag LOCUS_20960 5299 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 6067 5384 gene locus_tag LOCUS_20970 6067 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence0318 4110 2197 gene locus_tag LOCUS_20980 4110 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 5234 4278 gene locus_tag LOCUS_20990 5234 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026838.1 protein_id gnl|my_center|LOCUS_20990 6007 5231 gene locus_tag LOCUS_21000 6007 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence0319 368 1351 gene locus_tag LOCUS_21010 368 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 3383 1422 gene locus_tag LOCUS_21020 3383 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 3725 4720 gene locus_tag LOCUS_21030 3725 4720 CDS product N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084237.1 protein_id gnl|my_center|LOCUS_21030 5616 4675 gene locus_tag LOCUS_21040 5616 4675 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529752.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence0320 3068 3607 gene locus_tag LOCUS_21050 3068 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 3705 4580 gene locus_tag LOCUS_21060 3705 4580 CDS product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 protein_id gnl|my_center|LOCUS_21060 4873 5319 gene locus_tag LOCUS_21070 4873 5319 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403946.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence0321 2013 1363 gene locus_tag LOCUS_21080 2013 1363 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_21080 3029 2538 gene locus_tag LOCUS_21090 3029 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 3704 3051 gene locus_tag LOCUS_21100 3704 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 4715 3828 gene locus_tag LOCUS_21110 gene cyoE1 4715 3828 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I719 protein_id gnl|my_center|LOCUS_21110 5299 4712 gene locus_tag LOCUS_21120 5299 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence0322 <1 580 gene locus_tag LOCUS_21130 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258943.1:short-chain dehydrogenase 1615 602 gene locus_tag LOCUS_21140 1615 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 1667 2206 gene locus_tag LOCUS_21150 1667 2206 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225286.1 protein_id gnl|my_center|LOCUS_21150 3440 2439 gene locus_tag LOCUS_21160 3440 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 3495 4859 gene locus_tag LOCUS_21170 3495 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147894.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence0323 789 442 gene locus_tag LOCUS_21180 789 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2431 962 gene locus_tag LOCUS_21190 2431 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2602 3009 gene locus_tag LOCUS_21200 2602 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3086 3985 gene locus_tag LOCUS_21210 3086 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316074.1 protein_id gnl|my_center|LOCUS_21210 4153 5385 gene locus_tag LOCUS_21220 4153 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence0324 1 162 gene locus_tag LOCUS_21230 1 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 999 226 gene locus_tag LOCUS_21240 gene phoB 999 226 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_21240 1580 996 gene locus_tag LOCUS_21250 1580 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2960 1701 gene locus_tag LOCUS_21260 2960 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 <6034 3106 gene locus_tag LOCUS_21270 <6034 3106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769481.1:TonB-dependent receptor >Feature sequence0325 1462 281 gene locus_tag LOCUS_21280 1462 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176639.1 protein_id gnl|my_center|LOCUS_21280 1571 1813 gene locus_tag LOCUS_21290 1571 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21290 1826 2137 gene locus_tag LOCUS_21300 1826 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 3796 2174 gene locus_tag LOCUS_21310 3796 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 3762 3917 gene locus_tag LOCUS_21320 3762 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 5541 4126 gene locus_tag LOCUS_21330 5541 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence0326 257 814 gene locus_tag LOCUS_21340 257 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 1128 1607 gene locus_tag LOCUS_21350 1128 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 1628 2152 gene locus_tag LOCUS_21360 1628 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970379.1 protein_id gnl|my_center|LOCUS_21360 2194 2562 gene locus_tag LOCUS_21370 2194 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2651 3052 gene locus_tag LOCUS_21380 2651 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 4243 3362 gene locus_tag LOCUS_21390 4243 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 4146 4370 gene locus_tag LOCUS_21400 4146 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 5119 4814 gene locus_tag LOCUS_21410 5119 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 5238 5507 gene locus_tag LOCUS_21420 5238 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 5500 5778 gene locus_tag LOCUS_21430 5500 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence0327 75 551 gene locus_tag LOCUS_21440 75 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 548 895 gene locus_tag LOCUS_21450 548 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 997 2886 gene locus_tag LOCUS_21460 997 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2883 3905 gene locus_tag LOCUS_21470 2883 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 4268 3906 gene locus_tag LOCUS_21480 4268 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 5300 4278 gene locus_tag LOCUS_21490 5300 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence0328 1014 940 gene locus_tag LOCUS_t00600 1014 940 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1827 1162 gene locus_tag LOCUS_21500 1827 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2311 1961 gene locus_tag LOCUS_21510 2311 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2725 4605 gene locus_tag LOCUS_21520 gene mpl 2725 4605 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_21520 4630 5154 gene locus_tag LOCUS_21530 4630 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 5211 5507 gene locus_tag LOCUS_21540 gene nuoK 5211 5507 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RU97 protein_id gnl|my_center|LOCUS_21540 >Feature sequence0329 1644 1123 gene locus_tag LOCUS_21550 1644 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 1703 1930 gene locus_tag LOCUS_21560 1703 1930 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531584.1 protein_id gnl|my_center|LOCUS_21560 1969 2478 gene locus_tag LOCUS_21570 1969 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 3265 3672 gene locus_tag LOCUS_21580 3265 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 >Feature sequence0330 493 1005 gene locus_tag LOCUS_21590 493 1005 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393459.1 protein_id gnl|my_center|LOCUS_21590 1009 3474 gene locus_tag LOCUS_21600 1009 3474 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_21600 3512 4525 gene locus_tag LOCUS_21610 3512 4525 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974722.1 protein_id gnl|my_center|LOCUS_21610 4664 5194 gene locus_tag LOCUS_21620 4664 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence0331 2792 1425 gene locus_tag LOCUS_21630 2792 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 3127 3756 gene locus_tag LOCUS_21640 3127 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 3977 5539 gene locus_tag LOCUS_21650 3977 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence0332 1327 2583 gene locus_tag LOCUS_21660 1327 2583 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_21660 2678 3154 gene locus_tag LOCUS_21670 2678 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190192.1 protein_id gnl|my_center|LOCUS_21670 3780 5339 gene locus_tag LOCUS_21680 3780 5339 CDS product pyridoxal-5'-phosphate-dependent protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence0333 1331 2242 gene locus_tag LOCUS_21690 1331 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3387 2239 gene locus_tag LOCUS_21700 3387 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 5414 3819 gene locus_tag LOCUS_21710 5414 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 5934 5506 gene locus_tag LOCUS_21720 5934 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence0334 148 2409 gene locus_tag LOCUS_21730 148 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2566 3213 gene locus_tag LOCUS_21740 2566 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence0335 102 1028 gene locus_tag LOCUS_21750 102 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368588.1 protein_id gnl|my_center|LOCUS_21750 1050 1931 gene locus_tag LOCUS_21760 1050 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2027 2374 gene locus_tag LOCUS_21770 2027 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2522 3844 gene locus_tag LOCUS_21780 2522 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 4038 5081 gene locus_tag LOCUS_21790 4038 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence0336 188 643 gene locus_tag LOCUS_21800 188 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence0337 1754 3454 gene locus_tag LOCUS_21810 1754 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 <5906 3468 gene locus_tag LOCUS_21820 <5906 3468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9S2C0:serine/threonine-protein kinase PksC >Feature sequence0338 757 1395 gene locus_tag LOCUS_21830 757 1395 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7S4 protein_id gnl|my_center|LOCUS_21830 3863 1452 gene locus_tag LOCUS_21840 3863 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence0339 <1 1779 gene locus_tag LOCUS_21850 <1 1779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085075.1:two-component hybrid sensor and regulator 1874 2635 gene locus_tag LOCUS_21860 1874 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 5793 2641 gene locus_tag LOCUS_21870 5793 2641 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence0340 1157 843 gene locus_tag LOCUS_21880 1157 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1069 2766 gene locus_tag LOCUS_21890 1069 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 3868 2822 gene locus_tag LOCUS_21900 3868 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 4597 4229 gene locus_tag LOCUS_21910 gene rplL 4597 4229 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE21 protein_id gnl|my_center|LOCUS_21910 <5873 4594 gene locus_tag LOCUS_21920 <5873 4594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39844:D-alanyl-D-alanine carboxypeptidase DacC >Feature sequence0341 292 1845 gene locus_tag LOCUS_21930 292 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 3431 2157 gene locus_tag LOCUS_21940 3431 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 4264 5358 gene locus_tag LOCUS_21950 4264 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence0342 <1 787 gene locus_tag LOCUS_21960 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F9L0:fumarate hydratase class II 1198 2871 gene locus_tag LOCUS_21970 1198 2871 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039072.1 protein_id gnl|my_center|LOCUS_21970 2890 3228 gene locus_tag LOCUS_21980 2890 3228 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_21980 5090 3234 gene locus_tag LOCUS_21990 5090 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 5718 5080 gene locus_tag LOCUS_22000 5718 5080 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence0343 351 70 gene locus_tag LOCUS_22010 351 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 513 355 gene locus_tag LOCUS_22020 513 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1619 615 gene locus_tag LOCUS_22030 1619 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2784 1708 gene locus_tag LOCUS_22040 2784 1708 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_22040 2957 4405 gene locus_tag LOCUS_22050 2957 4405 CDS product cardiolipin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930806.1 protein_id gnl|my_center|LOCUS_22050 5504 4593 gene locus_tag LOCUS_22060 5504 4593 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142854.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence0344 1124 1279 gene locus_tag LOCUS_22070 1124 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 3265 1751 gene locus_tag LOCUS_22080 3265 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence0345 2392 815 gene locus_tag LOCUS_22090 2392 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 3355 2492 gene locus_tag LOCUS_22100 3355 2492 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_22100 3437 4351 gene locus_tag LOCUS_22110 3437 4351 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707778.1 protein_id gnl|my_center|LOCUS_22110 4498 5598 gene locus_tag LOCUS_22120 4498 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence0346 1603 1361 gene locus_tag LOCUS_22130 1603 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2164 1637 gene locus_tag LOCUS_22140 2164 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2663 2166 gene locus_tag LOCUS_22150 2663 2166 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_22150 2718 3041 gene locus_tag LOCUS_22160 2718 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 3679 3011 gene locus_tag LOCUS_22170 3679 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 5265 3688 gene locus_tag LOCUS_22180 gene nadB 5265 3688 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C48 protein_id gnl|my_center|LOCUS_22180 >Feature sequence0347 <1 676 gene locus_tag LOCUS_22190 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704585.1:putative enoyl-coa hydratase/isomerase 1057 1854 gene locus_tag LOCUS_22200 1057 1854 CDS product DNA ligase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 protein_id gnl|my_center|LOCUS_22200 1851 3011 gene locus_tag LOCUS_22210 1851 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378843.1 protein_id gnl|my_center|LOCUS_22210 3825 3022 gene locus_tag LOCUS_22220 3825 3022 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256276.1 protein_id gnl|my_center|LOCUS_22220 4818 3895 gene locus_tag LOCUS_22230 4818 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 5340 4858 gene locus_tag LOCUS_22240 5340 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence0348 1595 2779 gene locus_tag LOCUS_22250 gene leuB 1595 2779 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089061.1 protein_id gnl|my_center|LOCUS_22250 5245 2837 gene locus_tag LOCUS_22260 5245 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence0349 <1 3029 gene locus_tag LOCUS_22270 <1 3029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016360.1:diguanylate phosphodiesterase <5804 3036 gene locus_tag LOCUS_22280 <5804 3036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227000.1:5-methyltetrahydrofolate--homocysteine methyltransferase >Feature sequence0350 1366 2607 gene locus_tag LOCUS_22290 1366 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2604 3806 gene locus_tag LOCUS_22300 2604 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence0351 2380 3261 gene locus_tag LOCUS_22310 2380 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141815.1 protein_id gnl|my_center|LOCUS_22310 4716 3271 gene locus_tag LOCUS_22320 4716 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 4688 4963 gene locus_tag LOCUS_22330 4688 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 5092 5727 gene locus_tag LOCUS_22340 5092 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence0352 4028 1956 gene locus_tag LOCUS_22350 4028 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence0353 1391 357 gene locus_tag LOCUS_22360 gene moxR 1391 357 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_22360 2453 1548 gene locus_tag LOCUS_22370 2453 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 4191 2551 gene locus_tag LOCUS_22380 4191 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 5242 4505 gene locus_tag LOCUS_22390 5242 4505 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230868.1 protein_id gnl|my_center|LOCUS_22390 <5783 5281 gene locus_tag LOCUS_22400 <5783 5281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205769.1:cytochrome P450 family protein >Feature sequence0354 1333 302 gene locus_tag LOCUS_22410 1333 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 2118 1330 gene locus_tag LOCUS_22420 2118 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2610 4886 gene locus_tag LOCUS_22430 2610 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence0355 1950 1423 gene locus_tag LOCUS_22440 1950 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 3077 1947 gene locus_tag LOCUS_22450 3077 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 3190 3975 gene locus_tag LOCUS_22460 3190 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 5691 4153 gene locus_tag LOCUS_22470 5691 4153 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence0356 2135 1347 gene locus_tag LOCUS_22480 2135 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2360 4669 gene locus_tag LOCUS_22490 2360 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 <5755 4788 gene locus_tag LOCUS_22500 <5755 4788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071328.1:dipeptidyl peptidase S46 family protein >Feature sequence0357 1709 291 gene locus_tag LOCUS_22510 gene pntB 1709 291 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAZ6 protein_id gnl|my_center|LOCUS_22510 3342 1744 gene locus_tag LOCUS_22520 gene pntA 3342 1744 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z6X5 protein_id gnl|my_center|LOCUS_22520 3559 4038 gene locus_tag LOCUS_22530 gene moaC 3559 4038 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WV5 protein_id gnl|my_center|LOCUS_22530 <5751 4099 gene locus_tag LOCUS_22540 <5751 4099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GH6:glutamine--fructose-6-phosphate aminotransferase [isomerizing] >Feature sequence0358 761 1933 gene locus_tag LOCUS_22550 761 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2051 4444 gene locus_tag LOCUS_22560 2051 4444 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022610.1 protein_id gnl|my_center|LOCUS_22560 5718 4540 gene locus_tag LOCUS_22570 gene glyA 5718 4540 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJR6 protein_id gnl|my_center|LOCUS_22570 >Feature sequence0359 920 651 gene locus_tag LOCUS_22580 920 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 874 1473 gene locus_tag LOCUS_22590 874 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 3259 1514 gene locus_tag LOCUS_22600 3259 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 4467 3586 gene locus_tag LOCUS_22610 4467 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 5392 4808 gene locus_tag LOCUS_22620 5392 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence0360 2564 411 gene locus_tag LOCUS_22630 2564 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2751 3320 gene locus_tag LOCUS_22640 2751 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 3590 3784 gene locus_tag LOCUS_22650 3590 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907541.1 protein_id gnl|my_center|LOCUS_22650 4002 5513 gene locus_tag LOCUS_22660 4002 5513 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence0361 <1 764 gene locus_tag LOCUS_22670 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011265665.1:aminodeoxychorismate synthase, component I 1655 942 gene locus_tag LOCUS_22680 1655 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 2033 2581 gene locus_tag LOCUS_22690 2033 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 4162 2714 gene locus_tag LOCUS_22700 4162 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 4783 5688 gene locus_tag LOCUS_22710 4783 5688 CDS product putative proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702073.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence0362 <1 664 gene locus_tag LOCUS_22720 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259373.1:histidine kinase 661 1206 gene locus_tag LOCUS_22730 661 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 1308 2624 gene locus_tag LOCUS_22740 1308 2624 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_22740 3606 2662 gene locus_tag LOCUS_22750 3606 2662 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_22750 5348 3672 gene locus_tag LOCUS_22760 5348 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence0363 570 2156 gene locus_tag LOCUS_22770 570 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2158 2901 gene locus_tag LOCUS_22780 2158 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 3053 5170 gene locus_tag LOCUS_22790 3053 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence0364 <1 642 gene locus_tag LOCUS_22800 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263541.1:carboxylate--amine ligase 945 2168 gene locus_tag LOCUS_22810 945 2168 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970796.1 protein_id gnl|my_center|LOCUS_22810 2238 2960 gene locus_tag LOCUS_22820 2238 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 3037 3798 gene locus_tag LOCUS_22830 3037 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence0365 412 77 gene locus_tag LOCUS_22840 412 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 624 1382 gene locus_tag LOCUS_22850 624 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 1489 2406 gene locus_tag LOCUS_22860 1489 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2805 2455 gene locus_tag LOCUS_22870 2805 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3359 2835 gene locus_tag LOCUS_22880 3359 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 5429 3573 gene locus_tag LOCUS_22890 5429 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 5500 5634 gene locus_tag LOCUS_22900 5500 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence0366 56 1423 gene locus_tag LOCUS_22910 56 1423 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865056.1 protein_id gnl|my_center|LOCUS_22910 2028 2936 gene locus_tag LOCUS_22920 gene yodP 2028 2936 CDS product N-acetyltransferase YodP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34895 protein_id gnl|my_center|LOCUS_22920 2988 4040 gene locus_tag LOCUS_22930 2988 4040 CDS product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388931.1 protein_id gnl|my_center|LOCUS_22930 5015 4380 gene locus_tag LOCUS_22940 5015 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence0367 2143 2868 gene locus_tag LOCUS_22950 2143 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2909 4159 gene locus_tag LOCUS_22960 2909 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230888.1 protein_id gnl|my_center|LOCUS_22960 4224 4898 gene locus_tag LOCUS_22970 4224 4898 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969927.1 protein_id gnl|my_center|LOCUS_22970 <5669 4876 gene locus_tag LOCUS_22980 <5669 4876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918417.1:TVP38/TMEM64 family protein >Feature sequence0368 1717 914 gene locus_tag LOCUS_22990 1717 914 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_22990 2075 4030 gene locus_tag LOCUS_23000 2075 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence0369 <1 1547 gene locus_tag LOCUS_23010 <1 1547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_018306202.1:ArsR family transcriptional regulator 1579 2037 gene locus_tag LOCUS_23020 1579 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2281 3066 gene locus_tag LOCUS_23030 2281 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 3403 5034 gene locus_tag LOCUS_23040 3403 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 5614 5051 gene locus_tag LOCUS_23050 5614 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence0370 2377 1343 gene locus_tag LOCUS_23060 2377 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143082.1 protein_id gnl|my_center|LOCUS_23060 2500 4800 gene locus_tag LOCUS_23070 2500 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 4832 5293 gene locus_tag LOCUS_23080 4832 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence0371 <1 1614 gene locus_tag LOCUS_23090 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940273.1:asparagine synthetase B 1743 2780 gene locus_tag LOCUS_23100 1743 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 4025 2811 gene locus_tag LOCUS_23110 4025 2811 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 protein_id gnl|my_center|LOCUS_23110 4161 4706 gene locus_tag LOCUS_23120 4161 4706 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THX9 protein_id gnl|my_center|LOCUS_23120 <5641 4715 gene locus_tag LOCUS_23130 <5641 4715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545777.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0372 2901 1108 gene locus_tag LOCUS_23140 gene recN 2901 1108 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH7 protein_id gnl|my_center|LOCUS_23140 3630 2953 gene locus_tag LOCUS_23150 gene sigX 3630 2953 CDS product ECF RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35165 protein_id gnl|my_center|LOCUS_23150 4121 5440 gene locus_tag LOCUS_23160 4121 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence0373 1203 463 gene locus_tag LOCUS_23170 1203 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 1399 1968 gene locus_tag LOCUS_23180 1399 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2004 2936 gene locus_tag LOCUS_23190 2004 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 3166 3540 gene locus_tag LOCUS_23200 3166 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 <5636 3623 gene locus_tag LOCUS_23210 <5636 3623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZUE1:Lon protease >Feature sequence0374 1912 554 gene locus_tag LOCUS_23220 gene guaB 1912 554 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B47 protein_id gnl|my_center|LOCUS_23220 2339 2578 gene locus_tag LOCUS_23230 2339 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 2587 3363 gene locus_tag LOCUS_23240 2587 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 4686 3511 gene locus_tag LOCUS_23250 4686 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 5630 4701 gene locus_tag LOCUS_23260 5630 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence0375 1763 300 gene locus_tag LOCUS_23270 gene amiE 1763 300 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229130.1 protein_id gnl|my_center|LOCUS_23270 2117 1875 gene locus_tag LOCUS_23280 2117 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2025 2699 gene locus_tag LOCUS_23290 2025 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 3014 4663 gene locus_tag LOCUS_23300 3014 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence0376 <1 695 gene locus_tag LOCUS_23310 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_002346474.1:3-ketoacyl-ACP reductase 695 1939 gene locus_tag LOCUS_23320 695 1939 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213028.1 protein_id gnl|my_center|LOCUS_23320 1996 2817 gene locus_tag LOCUS_23330 1996 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2814 3665 gene locus_tag LOCUS_23340 2814 3665 CDS product polyketide biosynthesis enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346477.1 protein_id gnl|my_center|LOCUS_23340 3662 4522 gene locus_tag LOCUS_23350 3662 4522 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213024.1 protein_id gnl|my_center|LOCUS_23350 4525 5340 gene locus_tag LOCUS_23360 4525 5340 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213024.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence0377 521 2293 gene locus_tag LOCUS_23370 521 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 2366 3013 gene locus_tag LOCUS_23380 2366 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 3035 4138 gene locus_tag LOCUS_23390 3035 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 4248 5138 gene locus_tag LOCUS_23400 4248 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence0378 <1 2749 gene locus_tag LOCUS_23410 <1 2749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083081.1:cytosine deaminase 2867 3250 gene locus_tag LOCUS_23420 2867 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 3360 3614 gene locus_tag LOCUS_23430 3360 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 5559 3676 gene locus_tag LOCUS_23440 5559 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence0379 167 1015 gene locus_tag LOCUS_23450 167 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 2074 1133 gene locus_tag LOCUS_23460 2074 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 2878 2162 gene locus_tag LOCUS_23470 2878 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 5511 3079 gene locus_tag LOCUS_23480 5511 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 >Feature sequence0380 256 1191 gene locus_tag LOCUS_23490 256 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2270 1188 gene locus_tag LOCUS_23500 2270 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2747 2466 gene locus_tag LOCUS_23510 2747 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 3043 3128 gene locus_tag LOCUS_t00610 3043 3128 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3214 3299 gene locus_tag LOCUS_t00620 3214 3299 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4428 3376 gene locus_tag LOCUS_23520 4428 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 <5604 4788 gene locus_tag LOCUS_23530 <5604 4788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HL81:thiol-disulfide oxidoreductase ResA >Feature sequence0381 1131 2102 gene locus_tag LOCUS_23540 1131 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 2220 4181 gene locus_tag LOCUS_23550 2220 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 5378 4248 gene locus_tag LOCUS_23560 5378 4248 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704524.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence0382 1427 60 gene locus_tag LOCUS_23570 gene mtaB 1427 60 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_23570 3432 1441 gene locus_tag LOCUS_23580 3432 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 4390 3686 gene locus_tag LOCUS_23590 gene rluE 4390 3686 CDS product ribosomal large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX48 protein_id gnl|my_center|LOCUS_23590 >Feature sequence0383 <1 994 gene locus_tag LOCUS_23600 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029250.1:serine/threonine protein kinase 1124 2449 gene locus_tag LOCUS_23610 1124 2449 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_23610 4877 2466 gene locus_tag LOCUS_23620 4877 2466 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228238.1 protein_id gnl|my_center|LOCUS_23620 5505 4924 gene locus_tag LOCUS_23630 5505 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence0384 2247 3260 gene locus_tag LOCUS_23640 2247 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 3499 3828 gene locus_tag LOCUS_23650 3499 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 3898 5547 gene locus_tag LOCUS_23660 3898 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 >Feature sequence0385 1930 836 gene locus_tag LOCUS_23670 1930 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 1836 2180 gene locus_tag LOCUS_23680 1836 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 2606 4486 gene locus_tag LOCUS_23690 2606 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence0386 838 2808 gene locus_tag LOCUS_23700 838 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2834 3397 gene locus_tag LOCUS_23710 2834 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 <5579 3322 gene locus_tag LOCUS_23720 <5579 3322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461688.1:phosphoenolpyruvate synthase >Feature sequence0387 959 1639 gene locus_tag LOCUS_23730 gene rpsC 959 1639 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z4 protein_id gnl|my_center|LOCUS_23730 1685 2995 gene locus_tag LOCUS_23740 1685 2995 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582594.1 protein_id gnl|my_center|LOCUS_23740 3203 3712 gene locus_tag LOCUS_23750 3203 3712 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410818.1 protein_id gnl|my_center|LOCUS_23750 3868 5403 gene locus_tag LOCUS_23760 3868 5403 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526144.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence0388 3145 8 gene locus_tag LOCUS_23770 3145 8 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061300.1 protein_id gnl|my_center|LOCUS_23770 4483 3164 gene locus_tag LOCUS_23780 4483 3164 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005391278.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence0389 1705 830 gene locus_tag LOCUS_23790 1705 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 2280 1702 gene locus_tag LOCUS_23800 2280 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 3366 2776 gene locus_tag LOCUS_23810 gene mglA 3366 2776 CDS product cell polarity determinant GTPase MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_23810 5271 3466 gene locus_tag LOCUS_23820 5271 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 >Feature sequence0390 <1 1358 gene locus_tag LOCUS_23830 <1 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085076.1:two-component hybrid sensor and regulator 1809 5513 gene locus_tag LOCUS_23840 1809 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence0391 706 2187 gene locus_tag LOCUS_23850 706 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2511 2194 gene locus_tag LOCUS_23860 2511 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 2670 4493 gene locus_tag LOCUS_23870 2670 4493 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895539.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence0392 943 2412 gene locus_tag LOCUS_23880 943 2412 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_23880 3519 2419 gene locus_tag LOCUS_23890 3519 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 4806 3580 gene locus_tag LOCUS_23900 4806 3580 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228024.1 protein_id gnl|my_center|LOCUS_23900 <5554 4803 gene locus_tag LOCUS_23910 <5554 4803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272519.1:phosphoenolpyruvate-utilizing protein >Feature sequence0393 3594 2689 gene locus_tag LOCUS_23920 3594 2689 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_23920 4134 3763 gene locus_tag LOCUS_23930 4134 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 4181 5245 gene locus_tag LOCUS_23940 4181 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence0394 2280 1 gene locus_tag LOCUS_23950 2280 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 3664 2408 gene locus_tag LOCUS_23960 3664 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence0395 2421 1414 gene locus_tag LOCUS_23970 2421 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2532 3869 gene locus_tag LOCUS_23980 2532 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 4046 4567 gene locus_tag LOCUS_23990 4046 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 5380 4613 gene locus_tag LOCUS_24000 gene pppA 5380 4613 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence0396 2877 1069 gene locus_tag LOCUS_24010 2877 1069 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978031.1 protein_id gnl|my_center|LOCUS_24010 4002 2992 gene locus_tag LOCUS_24020 gene dctP 4002 2992 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721134.1 protein_id gnl|my_center|LOCUS_24020 5409 4162 gene locus_tag LOCUS_24030 5409 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 >Feature sequence0397 <1 664 gene locus_tag LOCUS_24040 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941642.1:tail protein 711 1193 gene locus_tag LOCUS_24050 711 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 1236 1700 gene locus_tag LOCUS_24060 1236 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1715 2167 gene locus_tag LOCUS_24070 1715 2167 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_24070 2182 2370 gene locus_tag LOCUS_24080 2182 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2374 3093 gene locus_tag LOCUS_24090 2374 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 3090 4724 gene locus_tag LOCUS_24100 3090 4724 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_24100 4721 5161 gene locus_tag LOCUS_24110 4721 5161 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_24110 5181 5486 gene locus_tag LOCUS_24120 5181 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence0398 <1 2277 gene locus_tag LOCUS_24130 <1 2277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067720.1:alpha/beta hydrolase 2335 3549 gene locus_tag LOCUS_24140 2335 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 4114 3593 gene locus_tag LOCUS_24150 4114 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence0399 <1 708 gene locus_tag LOCUS_24160 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92WJ7:histidine kinase note possible pseudo, frameshifted 740 1585 gene locus_tag LOCUS_24170 740 1585 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038387.1 protein_id gnl|my_center|LOCUS_24170 1689 1994 gene locus_tag LOCUS_24180 1689 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence0400 <1 1337 gene locus_tag LOCUS_24190 <1 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920434.1:peptidase M16 1334 2908 gene locus_tag LOCUS_24200 1334 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 3560 4651 gene locus_tag LOCUS_24210 3560 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057438.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence0401 2544 1996 gene locus_tag LOCUS_24220 2544 1996 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082901.1 protein_id gnl|my_center|LOCUS_24220 3315 3578 gene locus_tag LOCUS_24230 3315 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 3899 3723 gene locus_tag LOCUS_24240 3899 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 3814 4806 gene locus_tag LOCUS_24250 3814 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence0402 4168 3653 gene locus_tag LOCUS_24260 4168 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 4964 4209 gene locus_tag LOCUS_24270 4964 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence0403 931 2106 gene locus_tag LOCUS_24280 931 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 3292 2111 gene locus_tag LOCUS_24290 3292 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 4201 3482 gene locus_tag LOCUS_24300 4201 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 4444 4656 gene locus_tag LOCUS_24310 gene thiS 4444 4656 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence0404 231 1994 gene locus_tag LOCUS_24320 231 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2088 3026 gene locus_tag LOCUS_24330 2088 3026 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123324.1 protein_id gnl|my_center|LOCUS_24330 3023 4330 gene locus_tag LOCUS_24340 3023 4330 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123325.1 protein_id gnl|my_center|LOCUS_24340 <5491 4340 gene locus_tag LOCUS_24350 <5491 4340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460643.1:alpha/beta hydrolase >Feature sequence0405 <1 812 gene locus_tag LOCUS_24360 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902654.1:glutaconyl-CoA decarboxylase subunit alpha 812 1459 gene locus_tag LOCUS_24370 812 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2384 1482 gene locus_tag LOCUS_24380 2384 1482 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_24380 2478 2933 gene locus_tag LOCUS_24390 2478 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence0406 2083 698 gene locus_tag LOCUS_24400 2083 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2334 3803 gene locus_tag LOCUS_24410 2334 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence0407 3177 1351 gene locus_tag LOCUS_24420 3177 1351 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_24420 3654 3403 gene locus_tag LOCUS_24430 3654 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 4651 3947 gene locus_tag LOCUS_24440 4651 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence0408 3 221 gene locus_tag LOCUS_24450 3 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 668 1120 gene locus_tag LOCUS_24460 668 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 1130 2296 gene locus_tag LOCUS_24470 1130 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2316 3266 gene locus_tag LOCUS_24480 2316 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 4349 3282 gene locus_tag LOCUS_24490 4349 3282 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_24490 4820 4428 gene locus_tag LOCUS_24500 4820 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 5151 4897 gene locus_tag LOCUS_24510 5151 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence0409 130 1254 gene locus_tag LOCUS_24520 130 1254 CDS product taurine catabolism dioxygenase TauD/TfdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195311.1 protein_id gnl|my_center|LOCUS_24520 2283 1276 gene locus_tag LOCUS_24530 2283 1276 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_24530 2651 3301 gene locus_tag LOCUS_24540 2651 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 3312 3548 gene locus_tag LOCUS_24550 3312 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence0410 <1 978 gene locus_tag LOCUS_24560 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039033.1:peptidase S9 1005 3068 gene locus_tag LOCUS_24570 1005 3068 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZU4 protein_id gnl|my_center|LOCUS_24570 3222 4772 gene locus_tag LOCUS_24580 gene sulP 3222 4772 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_24580 4812 5291 gene locus_tag LOCUS_24590 4812 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113784.1 protein_id gnl|my_center|LOCUS_24590 >Feature sequence0411 258 10 gene locus_tag LOCUS_24600 258 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 421 699 gene locus_tag LOCUS_24610 421 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 1100 1432 gene locus_tag LOCUS_24620 1100 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 2359 2216 gene locus_tag LOCUS_24630 2359 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 3459 3599 gene locus_tag LOCUS_24640 3459 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence0412 871 17 gene locus_tag LOCUS_24650 871 17 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027437.1 protein_id gnl|my_center|LOCUS_24650 973 1524 gene locus_tag LOCUS_24660 973 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1525 1887 gene locus_tag LOCUS_24670 1525 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1954 2508 gene locus_tag LOCUS_24680 1954 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 3804 2512 gene locus_tag LOCUS_24690 3804 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 5093 4029 gene locus_tag LOCUS_24700 5093 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence0413 872 24 gene locus_tag LOCUS_24710 872 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 765 1082 gene locus_tag LOCUS_24720 765 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 1270 1977 gene locus_tag LOCUS_24730 1270 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 3409 1982 gene locus_tag LOCUS_24740 3409 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 4685 3588 gene locus_tag LOCUS_24750 4685 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence0414 535 1977 gene locus_tag LOCUS_24760 535 1977 CDS product benzoyl-CoA oxygenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_24760 3025 2012 gene locus_tag LOCUS_24770 3025 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 5213 3117 gene locus_tag LOCUS_24780 5213 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence0415 1094 486 gene locus_tag LOCUS_24790 1094 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 4390 1316 gene locus_tag LOCUS_24800 4390 1316 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933213.1 protein_id gnl|my_center|LOCUS_24800 >Feature sequence0416 <1 641 gene locus_tag LOCUS_24810 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937846.1:sensor histidine kinase 791 1492 gene locus_tag LOCUS_24820 791 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 3308 1749 gene locus_tag LOCUS_24830 3308 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 4312 3317 gene locus_tag LOCUS_24840 4312 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence0417 1114 923 gene locus_tag LOCUS_24850 1114 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 1739 2983 gene locus_tag LOCUS_24860 1739 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 3205 4254 gene locus_tag LOCUS_24870 3205 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 4687 4319 gene locus_tag LOCUS_24880 4687 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 4692 4835 gene locus_tag LOCUS_24890 4692 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 <5430 4870 gene locus_tag LOCUS_24900 <5430 4870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112888.1:oxidoreductase >Feature sequence0418 779 1495 gene locus_tag LOCUS_24910 779 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 2179 1523 gene locus_tag LOCUS_24920 2179 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 2960 2211 gene locus_tag LOCUS_24930 2960 2211 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_24930 3769 2957 gene locus_tag LOCUS_24940 3769 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_24940 4505 3837 gene locus_tag LOCUS_24950 4505 3837 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258011.1 protein_id gnl|my_center|LOCUS_24950 >Feature sequence0419 710 312 gene locus_tag LOCUS_24960 710 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 2571 940 gene locus_tag LOCUS_24970 2571 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 3013 3921 gene locus_tag LOCUS_24980 3013 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 4044 4754 gene locus_tag LOCUS_24990 4044 4754 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684133.1 protein_id gnl|my_center|LOCUS_24990 4773 5348 gene locus_tag LOCUS_25000 4773 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence0420 4336 4953 gene locus_tag LOCUS_25010 4336 4953 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109025.1 protein_id gnl|my_center|LOCUS_25010 5332 4982 gene locus_tag LOCUS_25020 5332 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975312.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence0421 1352 2143 gene locus_tag LOCUS_25030 1352 2143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_25030 2143 4119 gene locus_tag LOCUS_25040 2143 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 4247 4579 gene locus_tag LOCUS_25050 4247 4579 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259116.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence0422 <1 678 gene locus_tag LOCUS_25060 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004534266.1:citrate synthase 730 3465 gene locus_tag LOCUS_25070 730 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 3494 5065 gene locus_tag LOCUS_25080 3494 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence0423 2528 525 gene locus_tag LOCUS_25090 2528 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 3539 2811 gene locus_tag LOCUS_25100 3539 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 4482 3565 gene locus_tag LOCUS_25110 4482 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence0424 228 632 gene locus_tag LOCUS_25120 228 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 932 678 gene locus_tag LOCUS_25130 932 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2783 972 gene locus_tag LOCUS_25140 2783 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 4247 3000 gene locus_tag LOCUS_25150 4247 3000 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_25150 <5406 4264 gene locus_tag LOCUS_25160 <5406 4264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482694.1:ABC transporter permease >Feature sequence0425 1121 3247 gene locus_tag LOCUS_25170 1121 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 3327 4058 gene locus_tag LOCUS_25180 3327 4058 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230868.1 protein_id gnl|my_center|LOCUS_25180 5024 4080 gene locus_tag LOCUS_25190 5024 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 >Feature sequence0426 810 884 gene locus_tag LOCUS_t00630 810 884 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 937 1010 gene locus_tag LOCUS_t00640 937 1010 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1036 1110 gene locus_tag LOCUS_t00650 1036 1110 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1145 1218 gene locus_tag LOCUS_t00660 1145 1218 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1408 1481 gene locus_tag LOCUS_t00670 1408 1481 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1524 1595 gene locus_tag LOCUS_t00680 1524 1595 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1637 1710 gene locus_tag LOCUS_t00690 1637 1710 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1753 1824 gene locus_tag LOCUS_t00700 1753 1824 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1987 2340 gene locus_tag LOCUS_25200 1987 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 2372 3970 gene locus_tag LOCUS_25210 2372 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 <5405 4053 gene locus_tag LOCUS_25220 <5405 4053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O30913:elongation factor G 1 >Feature sequence0427 <1 593 gene locus_tag LOCUS_25230 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104866.1:DNA-binding response regulator 3843 610 gene locus_tag LOCUS_25240 3843 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 <5404 4336 gene locus_tag LOCUS_25250 <5404 4336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942176.1:hybrid sensor histidine kinase/response regulator >Feature sequence0428 1863 1558 gene locus_tag LOCUS_25260 1863 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 4193 2061 gene locus_tag LOCUS_25270 gene fusA 4193 2061 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URV2 protein_id gnl|my_center|LOCUS_25270 >Feature sequence0429 1159 728 gene locus_tag LOCUS_25280 1159 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 1723 1169 gene locus_tag LOCUS_25290 1723 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 3701 1884 gene locus_tag LOCUS_25300 3701 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence0430 657 1973 gene locus_tag LOCUS_25310 gene argH 657 1973 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EPL1 protein_id gnl|my_center|LOCUS_25310 2061 3179 gene locus_tag LOCUS_25320 2061 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3493 4935 gene locus_tag LOCUS_25330 3493 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence0431 599 925 gene locus_tag LOCUS_25340 599 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 940 1353 gene locus_tag LOCUS_25350 940 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 1362 1742 gene locus_tag LOCUS_25360 1362 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 2329 1925 gene locus_tag LOCUS_25370 2329 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 2352 2663 gene locus_tag LOCUS_25380 2352 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 3807 2674 gene locus_tag LOCUS_25390 3807 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 4606 3821 gene locus_tag LOCUS_25400 4606 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence0432 398 1798 gene locus_tag LOCUS_25410 398 1798 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969758.1 protein_id gnl|my_center|LOCUS_25410 1962 3131 gene locus_tag LOCUS_25420 1962 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 3215 4288 gene locus_tag LOCUS_25430 3215 4288 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942955.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence0433 147 1028 gene locus_tag LOCUS_25440 147 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 1290 3089 gene locus_tag LOCUS_25450 1290 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 3477 4499 gene locus_tag LOCUS_25460 3477 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence0434 852 1550 gene locus_tag LOCUS_25470 852 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1671 2336 gene locus_tag LOCUS_25480 1671 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2749 2357 gene locus_tag LOCUS_25490 2749 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 3802 2834 gene locus_tag LOCUS_25500 3802 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 4697 3789 gene locus_tag LOCUS_25510 4697 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113539.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence0435 2185 1088 gene locus_tag LOCUS_25520 2185 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2778 2365 gene locus_tag LOCUS_25530 2778 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 3685 5277 gene locus_tag LOCUS_25540 3685 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence0436 2080 728 gene locus_tag LOCUS_25550 gene hemA 2080 728 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747I2 protein_id gnl|my_center|LOCUS_25550 2904 2077 gene locus_tag LOCUS_25560 2904 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 3397 2999 gene locus_tag LOCUS_25570 3397 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 3556 3885 gene locus_tag LOCUS_25580 3556 3885 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8V8 protein_id gnl|my_center|LOCUS_25580 5259 4036 gene locus_tag LOCUS_25590 5259 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence0437 487 1728 gene locus_tag LOCUS_25600 gene acd 487 1728 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229645.1 protein_id gnl|my_center|LOCUS_25600 1918 2931 gene locus_tag LOCUS_25610 1918 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 2967 4589 gene locus_tag LOCUS_25620 gene cht1 2967 4589 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_25620 4586 4774 gene locus_tag LOCUS_25630 4586 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 4816 5151 gene locus_tag LOCUS_25640 4816 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence0438 196 708 gene locus_tag LOCUS_25650 196 708 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969234.1 protein_id gnl|my_center|LOCUS_25650 933 1301 gene locus_tag LOCUS_25660 933 1301 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948237.1 protein_id gnl|my_center|LOCUS_25660 2401 2853 gene locus_tag LOCUS_25670 2401 2853 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948236.1 protein_id gnl|my_center|LOCUS_25670 4666 2861 gene locus_tag LOCUS_25680 4666 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence0439 635 2887 gene locus_tag LOCUS_25690 635 2887 CDS product bifunctional hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 protein_id gnl|my_center|LOCUS_25690 3528 2932 gene locus_tag LOCUS_25700 3528 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 4270 3542 gene locus_tag LOCUS_25710 4270 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 4594 4337 gene locus_tag LOCUS_25720 4594 4337 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537908.1 protein_id gnl|my_center|LOCUS_25720 5107 4694 gene locus_tag LOCUS_25730 5107 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 >Feature sequence0440 767 1336 gene locus_tag LOCUS_25740 767 1336 CDS product putative alternative RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705660.1 protein_id gnl|my_center|LOCUS_25740 1541 2812 gene locus_tag LOCUS_25750 1541 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 3461 2838 gene locus_tag LOCUS_25760 3461 2838 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708652.1 protein_id gnl|my_center|LOCUS_25760 4579 3458 gene locus_tag LOCUS_25770 4579 3458 CDS product S-adenosylmethionine--diacylglycerol 3-amino-3-carboxypropyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530941.1 protein_id gnl|my_center|LOCUS_25770 >Feature sequence0441 377 1111 gene locus_tag LOCUS_25780 377 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 1223 1750 gene locus_tag LOCUS_25790 1223 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2075 2815 gene locus_tag LOCUS_25800 2075 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 3168 2866 gene locus_tag LOCUS_25810 3168 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 3652 3266 gene locus_tag LOCUS_25820 3652 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 3546 3938 gene locus_tag LOCUS_25830 3546 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence0442 1199 753 gene locus_tag LOCUS_25840 1199 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206964.1 protein_id gnl|my_center|LOCUS_25840 1299 2069 gene locus_tag LOCUS_25850 1299 2069 CDS product putative transcriptional regulator, AraC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700820.1 protein_id gnl|my_center|LOCUS_25850 2151 2774 gene locus_tag LOCUS_25860 2151 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 3327 4742 gene locus_tag LOCUS_25870 3327 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 4773 5129 gene locus_tag LOCUS_25880 4773 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence0443 2024 1410 gene locus_tag LOCUS_25890 2024 1410 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077260.1 protein_id gnl|my_center|LOCUS_25890 3133 2102 gene locus_tag LOCUS_25900 gene fba 3133 2102 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69600 protein_id gnl|my_center|LOCUS_25900 4655 3243 gene locus_tag LOCUS_25910 4655 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence0444 2694 2260 gene locus_tag LOCUS_25920 2694 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121337.1 protein_id gnl|my_center|LOCUS_25920 2946 3022 gene locus_tag LOCUS_t00710 2946 3022 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3733 3116 gene locus_tag LOCUS_25930 3733 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 5011 3743 gene locus_tag LOCUS_25940 5011 3743 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003489.1 protein_id gnl|my_center|LOCUS_25940 5151 5238 gene locus_tag LOCUS_t00720 5151 5238 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0445 252 1109 gene locus_tag LOCUS_25950 252 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 1109 2077 gene locus_tag LOCUS_25960 1109 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2241 3314 gene locus_tag LOCUS_25970 2241 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 3341 4672 gene locus_tag LOCUS_25980 3341 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence0446 558 1442 gene locus_tag LOCUS_25990 558 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 2122 1463 gene locus_tag LOCUS_26000 2122 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 2329 3153 gene locus_tag LOCUS_26010 2329 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 >Feature sequence0447 164 532 gene locus_tag LOCUS_26020 164 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 970 644 gene locus_tag LOCUS_26030 970 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 1991 951 gene locus_tag LOCUS_26040 1991 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2186 1992 gene locus_tag LOCUS_26050 2186 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence0448 914 699 gene locus_tag LOCUS_26060 914 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 1181 2113 gene locus_tag LOCUS_26070 1181 2113 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_26070 2922 2143 gene locus_tag LOCUS_26080 2922 2143 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107740.1 protein_id gnl|my_center|LOCUS_26080 4486 3158 gene locus_tag LOCUS_26090 4486 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence0449 5158 2156 gene locus_tag LOCUS_26100 5158 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence0450 <1 1004 gene locus_tag LOCUS_26110 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403981.1:betaine-aldehyde dehydrogenase note possible pseudo, internal stop codon, frameshifted 1038 1844 gene locus_tag LOCUS_26120 1038 1844 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403982.1 protein_id gnl|my_center|LOCUS_26120 1878 2348 gene locus_tag LOCUS_26130 1878 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2564 2379 gene locus_tag LOCUS_26140 2564 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 3910 2561 gene locus_tag LOCUS_26150 3910 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 4367 4083 gene locus_tag LOCUS_26160 4367 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 <5286 4479 gene locus_tag LOCUS_26170 <5286 4479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140798.1:esterase >Feature sequence0451 1838 4135 gene locus_tag LOCUS_26180 1838 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 4256 4338 gene locus_tag LOCUS_t00730 4256 4338 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4622 4413 gene locus_tag LOCUS_26190 4622 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence0452 621 2228 gene locus_tag LOCUS_26200 621 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 2383 2790 gene locus_tag LOCUS_26210 2383 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence0453 592 128 gene locus_tag LOCUS_26220 592 128 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403506.1 protein_id gnl|my_center|LOCUS_26220 840 2120 gene locus_tag LOCUS_26230 840 2120 CDS product 2-amino-3-ketobutyrate CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_26230 2231 3211 gene locus_tag LOCUS_26240 gene fabD 2231 3211 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B46 protein_id gnl|my_center|LOCUS_26240 3231 3770 gene locus_tag LOCUS_26250 3231 3770 CDS product (3R)-hydroxymyristoyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346472.1 protein_id gnl|my_center|LOCUS_26250 3816 5114 gene locus_tag LOCUS_26260 3816 5114 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213032.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence0454 >Feature sequence0455 265 2061 gene locus_tag LOCUS_26270 265 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 2149 2427 gene locus_tag LOCUS_26280 gene ihfA-1 2149 2427 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ8 protein_id gnl|my_center|LOCUS_26280 2514 3242 gene locus_tag LOCUS_26290 2514 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 3376 3451 gene locus_tag LOCUS_t00740 3376 3451 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3540 4388 gene locus_tag LOCUS_26300 gene surE 3540 4388 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX0 protein_id gnl|my_center|LOCUS_26300 4465 5013 gene locus_tag LOCUS_26310 gene apt 4465 5013 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCV7 protein_id gnl|my_center|LOCUS_26310 >Feature sequence0456 <1 714 gene locus_tag LOCUS_26320 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932970.1:prolyl oligopeptidase 884 3946 gene locus_tag LOCUS_26330 884 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 >Feature sequence0457 2478 2405 gene locus_tag LOCUS_t00750 2478 2405 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2588 2514 gene locus_tag LOCUS_t00760 2588 2514 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3321 2650 gene locus_tag LOCUS_26340 3321 2650 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZHF4 protein_id gnl|my_center|LOCUS_26340 4073 3318 gene locus_tag LOCUS_26350 gene rph 4073 3318 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCA5 protein_id gnl|my_center|LOCUS_26350 4523 4248 gene locus_tag LOCUS_26360 4523 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence0458 1617 2018 gene locus_tag LOCUS_26370 1617 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 2993 2019 gene locus_tag LOCUS_26380 2993 2019 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705501.1 protein_id gnl|my_center|LOCUS_26380 3166 4872 gene locus_tag LOCUS_26390 3166 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057740.1 protein_id gnl|my_center|LOCUS_26390 >Feature sequence0459 1232 1828 gene locus_tag LOCUS_26400 1232 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2108 3217 gene locus_tag LOCUS_26410 2108 3217 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND11 protein_id gnl|my_center|LOCUS_26410 3698 3240 gene locus_tag LOCUS_26420 3698 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 <5259 3789 gene locus_tag LOCUS_26430 <5259 3789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030099.1:peptidase >Feature sequence0460 1429 80 gene locus_tag LOCUS_26440 1429 80 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937602.1 protein_id gnl|my_center|LOCUS_26440 1834 3696 gene locus_tag LOCUS_26450 1834 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence0461 2298 3872 gene locus_tag LOCUS_26460 2298 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 4067 4696 gene locus_tag LOCUS_26470 4067 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence0462 868 4734 gene locus_tag LOCUS_26480 868 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence0463 <1 1051 gene locus_tag LOCUS_26490 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140097.1:Xaa-Pro aminopeptidase 1392 2828 gene locus_tag LOCUS_26500 1392 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 3006 4730 gene locus_tag LOCUS_26510 3006 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 >Feature sequence0464 1620 760 gene locus_tag LOCUS_26520 1620 760 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271588.1 protein_id gnl|my_center|LOCUS_26520 3998 1710 gene locus_tag LOCUS_26530 3998 1710 CDS product tungsten formylmethanofuran dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403352.1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence0465 1107 1421 gene locus_tag LOCUS_26540 1107 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 3470 1464 gene locus_tag LOCUS_26550 3470 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 4609 3623 gene locus_tag LOCUS_26560 4609 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 >Feature sequence0466 27 1541 gene locus_tag LOCUS_26570 27 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 2553 1552 gene locus_tag LOCUS_26580 2553 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 2716 3336 gene locus_tag LOCUS_26590 2716 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 3350 3616 gene locus_tag LOCUS_26600 3350 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 3713 4399 gene locus_tag LOCUS_26610 3713 4399 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709525.1 protein_id gnl|my_center|LOCUS_26610 >Feature sequence0467 2753 369 gene locus_tag LOCUS_26620 2753 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2873 3586 gene locus_tag LOCUS_26630 2873 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence0468 <1 1555 gene locus_tag LOCUS_26640 <1 1555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118284.1:ABC transporter permease 1552 2877 gene locus_tag LOCUS_26650 1552 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence0469 574 1242 gene locus_tag LOCUS_26660 574 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 3229 1505 gene locus_tag LOCUS_26670 3229 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence0470 1048 479 gene locus_tag LOCUS_26680 1048 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1257 1045 gene locus_tag LOCUS_26690 1257 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 2270 1644 gene locus_tag LOCUS_26700 2270 1644 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808006.1 protein_id gnl|my_center|LOCUS_26700 2522 3127 gene locus_tag LOCUS_26710 2522 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 3254 3652 gene locus_tag LOCUS_26720 3254 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 3660 4181 gene locus_tag LOCUS_26730 3660 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 5075 4209 gene locus_tag LOCUS_26740 5075 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence0471 385 2241 gene locus_tag LOCUS_26750 385 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 2599 2303 gene locus_tag LOCUS_26760 2599 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2484 3860 gene locus_tag LOCUS_26770 2484 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 4779 3883 gene locus_tag LOCUS_26780 gene nap 4779 3883 CDS product putative carboxylesterase nap inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96688 protein_id gnl|my_center|LOCUS_26780 >Feature sequence0472 940 356 gene locus_tag LOCUS_26790 940 356 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550468.1 protein_id gnl|my_center|LOCUS_26790 1170 2546 gene locus_tag LOCUS_26800 1170 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 3278 3018 gene locus_tag LOCUS_26810 3278 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 3437 3841 gene locus_tag LOCUS_26820 3437 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 <5216 4118 gene locus_tag LOCUS_26830 <5216 4118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939632.1:Fis family transcriptional regulator >Feature sequence0473 2014 2604 gene locus_tag LOCUS_26840 2014 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 3188 2613 gene locus_tag LOCUS_26850 3188 2613 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954461.1 protein_id gnl|my_center|LOCUS_26850 3363 5120 gene locus_tag LOCUS_26860 3363 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence0474 58 984 gene locus_tag LOCUS_26870 58 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 1226 2185 gene locus_tag LOCUS_26880 1226 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 2804 2202 gene locus_tag LOCUS_26890 2804 2202 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089909.1 protein_id gnl|my_center|LOCUS_26890 2865 3593 gene locus_tag LOCUS_26900 2865 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 4683 3643 gene locus_tag LOCUS_26910 gene adhP 4683 3643 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189850.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence0475 498 4 gene locus_tag LOCUS_26920 498 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 1126 575 gene locus_tag LOCUS_26930 1126 575 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_26930 1313 1741 gene locus_tag LOCUS_26940 1313 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 1919 2395 gene locus_tag LOCUS_26950 1919 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 2611 2871 gene locus_tag LOCUS_26960 2611 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence0476 <1 1128 gene locus_tag LOCUS_26970 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WCK3:UPF0753 protein 1322 1978 gene locus_tag LOCUS_26980 1322 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 1978 3408 gene locus_tag LOCUS_26990 1978 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 4312 3482 gene locus_tag LOCUS_27000 gene ephD 4312 3482 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206171.1 protein_id gnl|my_center|LOCUS_27000 <5204 4370 gene locus_tag LOCUS_27010 <5204 4370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036964.1:aldehyde dehydrogenase >Feature sequence0477 <1 564 gene locus_tag LOCUS_27020 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940393.1:flavodoxin 599 1258 gene locus_tag LOCUS_27030 599 1258 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 protein_id gnl|my_center|LOCUS_27030 1670 1281 gene locus_tag LOCUS_27040 1670 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 2257 1691 gene locus_tag LOCUS_27050 2257 1691 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532391.1 protein_id gnl|my_center|LOCUS_27050 3061 2267 gene locus_tag LOCUS_27060 3061 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 3878 3282 gene locus_tag LOCUS_27070 3878 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 4468 4025 gene locus_tag LOCUS_27080 4468 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 <5199 4554 gene locus_tag LOCUS_27090 <5199 4554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002216257.1:transporter >Feature sequence0478 114 500 gene locus_tag LOCUS_27100 114 500 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_27100 497 2740 gene locus_tag LOCUS_27110 497 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 3113 2754 gene locus_tag LOCUS_27120 3113 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 3520 4887 gene locus_tag LOCUS_27130 3520 4887 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_27130 >Feature sequence0479 268 1590 gene locus_tag LOCUS_27140 268 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 2175 1645 gene locus_tag LOCUS_27150 2175 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 4068 2326 gene locus_tag LOCUS_27160 4068 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence0480 2166 2732 gene locus_tag LOCUS_27170 gene rpoE 2166 2732 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230856.1 protein_id gnl|my_center|LOCUS_27170 2729 3883 gene locus_tag LOCUS_27180 2729 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 3887 4585 gene locus_tag LOCUS_27190 3887 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence0481 <1 776 gene locus_tag LOCUS_27200 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WC96:3-hydroxy-3-methylglutaryl coenzyme A reductase 951 1922 gene locus_tag LOCUS_27210 951 1922 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 protein_id gnl|my_center|LOCUS_27210 1991 2926 gene locus_tag LOCUS_27220 1991 2926 CDS product squalene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258542.1 protein_id gnl|my_center|LOCUS_27220 2967 4304 gene locus_tag LOCUS_27230 2967 4304 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_27230 4301 4849 gene locus_tag LOCUS_27240 4301 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence0482 <1 1330 gene locus_tag LOCUS_27250 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084777.1:RiPP maturation radical SAM protein 1 1338 2132 gene locus_tag LOCUS_27260 1338 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 2553 2149 gene locus_tag LOCUS_27270 2553 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 2574 2930 gene locus_tag LOCUS_27280 2574 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 3275 2931 gene locus_tag LOCUS_27290 3275 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 4226 3384 gene locus_tag LOCUS_27300 4226 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 4816 4325 gene locus_tag LOCUS_27310 4816 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence0483 786 505 gene locus_tag LOCUS_27320 786 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 1442 804 gene locus_tag LOCUS_27330 1442 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 1799 4627 gene locus_tag LOCUS_27340 1799 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 >Feature sequence0484 453 2156 gene locus_tag LOCUS_27350 453 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2499 2903 gene locus_tag LOCUS_27360 2499 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072996.1 protein_id gnl|my_center|LOCUS_27360 3298 2921 gene locus_tag LOCUS_27370 3298 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 4081 3338 gene locus_tag LOCUS_27380 4081 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 <5161 4146 gene locus_tag LOCUS_27390 <5161 4146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249728.1:recombinase XerC >Feature sequence0485 1253 606 gene locus_tag LOCUS_27400 1253 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 1521 2327 gene locus_tag LOCUS_27410 1521 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 3816 2419 gene locus_tag LOCUS_27420 3816 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 4074 4796 gene locus_tag LOCUS_27430 4074 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence0486 588 253 gene locus_tag LOCUS_27440 588 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 1410 682 gene locus_tag LOCUS_27450 1410 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_27450 2477 1614 gene locus_tag LOCUS_27460 2477 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 2645 4972 gene locus_tag LOCUS_27470 2645 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence0487 318 557 gene locus_tag LOCUS_27480 318 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 591 1928 gene locus_tag LOCUS_27490 591 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 1925 2224 gene locus_tag LOCUS_27500 1925 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 3217 2231 gene locus_tag LOCUS_27510 3217 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 4293 3232 gene locus_tag LOCUS_27520 4293 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence0488 2457 10 gene locus_tag LOCUS_27530 2457 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 2689 3750 gene locus_tag LOCUS_27540 gene tqsA 2689 3750 CDS product pheromone autoinducer 2 transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118216.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence0489 821 111 gene locus_tag LOCUS_27550 821 111 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_27550 1135 2676 gene locus_tag LOCUS_27560 1135 2676 CDS product 5' nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945856.1 protein_id gnl|my_center|LOCUS_27560 2987 2751 gene locus_tag LOCUS_27570 gene rpmB 2987 2751 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN8 protein_id gnl|my_center|LOCUS_27570 3797 3210 gene locus_tag LOCUS_27580 3797 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 >Feature sequence0490 555 1397 gene locus_tag LOCUS_27590 gene yneD 555 1397 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 protein_id gnl|my_center|LOCUS_27590 2234 1887 gene locus_tag LOCUS_27600 2234 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2605 2216 gene locus_tag LOCUS_27610 2605 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 4096 2660 gene locus_tag LOCUS_27620 4096 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 4323 4688 gene locus_tag LOCUS_27630 4323 4688 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918415.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence0491 2819 963 gene locus_tag LOCUS_27640 2819 963 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389322.1 protein_id gnl|my_center|LOCUS_27640 3208 2816 gene locus_tag LOCUS_27650 3208 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 4959 3205 gene locus_tag LOCUS_27660 4959 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence0492 <1 773 gene locus_tag LOCUS_27670 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030174.1:oxidoreductase 936 1685 gene locus_tag LOCUS_27680 936 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_27680 1707 2453 gene locus_tag LOCUS_27690 1707 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 2937 3022 gene locus_tag LOCUS_t00770 2937 3022 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3070 4266 gene locus_tag LOCUS_27700 gene tuf 3070 4266 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAH0 protein_id gnl|my_center|LOCUS_27700 <5096 4319 gene locus_tag LOCUS_27710 <5096 4319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085686.1:osmotically inducible protein C >Feature sequence0493 <1 1468 gene locus_tag LOCUS_27720 <1 1468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035732.1:hybrid sensor histidine kinase/response regulator 1718 2650 gene locus_tag LOCUS_27730 1718 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 2800 3798 gene locus_tag LOCUS_27740 2800 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 3970 4707 gene locus_tag LOCUS_27750 3970 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence0494 1318 623 gene locus_tag LOCUS_27760 1318 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 1805 2611 gene locus_tag LOCUS_27770 1805 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 2601 3392 gene locus_tag LOCUS_27780 2601 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 <5084 3401 gene locus_tag LOCUS_27790 <5084 3401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000200580.1:hemolysin >Feature sequence0495 1852 3093 gene locus_tag LOCUS_27800 1852 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 3386 4255 gene locus_tag LOCUS_27810 3386 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 <5081 4270 gene locus_tag LOCUS_27820 <5081 4270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257492.1:alpha/beta hydrolase >Feature sequence0496 1963 656 gene locus_tag LOCUS_27830 1963 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence0497 2061 724 gene locus_tag LOCUS_27840 gene norM 2061 724 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZS2 protein_id gnl|my_center|LOCUS_27840 2960 2151 gene locus_tag LOCUS_27850 2960 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 3643 2960 gene locus_tag LOCUS_27860 3643 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 4896 3733 gene locus_tag LOCUS_27870 4896 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence0498 3924 793 gene locus_tag LOCUS_27880 3924 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 4898 4323 gene locus_tag LOCUS_27890 4898 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 >Feature sequence0499 3243 4331 gene locus_tag LOCUS_27900 3243 4331 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719803.1 protein_id gnl|my_center|LOCUS_27900 >Feature sequence0500 42 1136 gene locus_tag LOCUS_27910 42 1136 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Z6 protein_id gnl|my_center|LOCUS_27910 1211 3397 gene locus_tag LOCUS_27920 gene uvrC 1211 3397 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747I7 protein_id gnl|my_center|LOCUS_27920 4419 3493 gene locus_tag LOCUS_27930 4419 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 4869 4429 gene locus_tag LOCUS_27940 4869 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence0501 487 1509 gene locus_tag LOCUS_27950 487 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 3142 1739 gene locus_tag LOCUS_27960 3142 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 4080 3133 gene locus_tag LOCUS_27970 4080 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 4849 4166 gene locus_tag LOCUS_27980 4849 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence0502 2003 336 gene locus_tag LOCUS_27990 gene cysI 2003 336 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192117.1 protein_id gnl|my_center|LOCUS_27990 2295 2014 gene locus_tag LOCUS_28000 2295 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 2652 3857 gene locus_tag LOCUS_28010 2652 3857 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_28010 3903 5045 gene locus_tag LOCUS_28020 3903 5045 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence0503 796 724 gene locus_tag LOCUS_t00780 796 724 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 985 913 gene locus_tag LOCUS_t00790 985 913 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1172 1101 gene locus_tag LOCUS_t00800 1172 1101 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4029 1327 gene locus_tag LOCUS_28030 4029 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 4849 4280 gene locus_tag LOCUS_28040 4849 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence0504 1220 744 gene locus_tag LOCUS_28050 1220 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 1404 2177 gene locus_tag LOCUS_28060 gene uppS 1404 2177 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_28060 2174 3019 gene locus_tag LOCUS_28070 2174 3019 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAG4 protein_id gnl|my_center|LOCUS_28070 3305 3072 gene locus_tag LOCUS_28080 3305 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 4085 3789 gene locus_tag LOCUS_28090 4085 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 >Feature sequence0505 953 1681 gene locus_tag LOCUS_28100 953 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2249 2695 gene locus_tag LOCUS_28110 2249 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 3213 4604 gene locus_tag LOCUS_28120 3213 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 >Feature sequence0506 4805 2616 gene locus_tag LOCUS_28130 4805 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 >Feature sequence0507 362 601 gene locus_tag LOCUS_28140 362 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 1290 619 gene locus_tag LOCUS_28150 1290 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 3990 1579 gene locus_tag LOCUS_28160 3990 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 <5040 4105 gene locus_tag LOCUS_28170 <5040 4105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971461.1:integrase >Feature sequence0508 238 1641 gene locus_tag LOCUS_28180 gene glgC 238 1641 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SMC1 protein_id gnl|my_center|LOCUS_28180 1688 3178 gene locus_tag LOCUS_28190 gene glgA 1688 3178 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIS8 protein_id gnl|my_center|LOCUS_28190 4934 3216 gene locus_tag LOCUS_28200 4934 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence0509 1115 1570 gene locus_tag LOCUS_28210 1115 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 1619 2554 gene locus_tag LOCUS_28220 gene gluQ 1619 2554 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTR9 protein_id gnl|my_center|LOCUS_28220 2629 4851 gene locus_tag LOCUS_28230 2629 4851 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence0510 2848 2207 gene locus_tag LOCUS_28240 2848 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 3082 3552 gene locus_tag LOCUS_28250 3082 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 3707 5035 gene locus_tag LOCUS_28260 3707 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence0511 1544 477 gene locus_tag LOCUS_28270 1544 477 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085526.1 protein_id gnl|my_center|LOCUS_28270 1804 1592 gene locus_tag LOCUS_28280 1804 1592 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089636.1 protein_id gnl|my_center|LOCUS_28280 <5033 1891 gene locus_tag LOCUS_28290 <5033 1891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O31827:plipastatin synthase subunit E >Feature sequence0512 1616 303 gene locus_tag LOCUS_28300 1616 303 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_28300 1700 2476 gene locus_tag LOCUS_28310 1700 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957581.1 protein_id gnl|my_center|LOCUS_28310 2666 3601 gene locus_tag LOCUS_28320 2666 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence0513 967 242 gene locus_tag LOCUS_28330 967 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1481 1179 gene locus_tag LOCUS_28340 1481 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 1874 1554 gene locus_tag LOCUS_28350 1874 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 2671 1871 gene locus_tag LOCUS_28360 2671 1871 CDS product putative dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704240.1 protein_id gnl|my_center|LOCUS_28360 3397 2684 gene locus_tag LOCUS_28370 3397 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence0514 743 1201 gene locus_tag LOCUS_28380 743 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221985.1 protein_id gnl|my_center|LOCUS_28380 1352 2260 gene locus_tag LOCUS_28390 1352 2260 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_28390 2308 3291 gene locus_tag LOCUS_28400 2308 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 3329 3751 gene locus_tag LOCUS_28410 3329 3751 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338309.1 protein_id gnl|my_center|LOCUS_28410 3884 4213 gene locus_tag LOCUS_28420 3884 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 >Feature sequence0515 331 981 gene locus_tag LOCUS_28430 331 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 1066 1395 gene locus_tag LOCUS_28440 1066 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 2253 2585 gene locus_tag LOCUS_28450 2253 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 4135 2630 gene locus_tag LOCUS_28460 4135 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 <5001 4258 gene locus_tag LOCUS_28470 <5001 4258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S530:UDP-N-acetylmuramoylalanine--D-glutamate ligase >Feature sequence0516 1497 814 gene locus_tag LOCUS_28480 1497 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 2316 1510 gene locus_tag LOCUS_28490 gene tpiA 2316 1510 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96744 protein_id gnl|my_center|LOCUS_28490 3616 2381 gene locus_tag LOCUS_28500 3616 2381 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462175.1 protein_id gnl|my_center|LOCUS_28500 4045 3800 gene locus_tag LOCUS_28510 4045 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence0517 216 683 gene locus_tag LOCUS_28520 216 683 CDS product UPF0093 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O26018 protein_id gnl|my_center|LOCUS_28520 680 1459 gene locus_tag LOCUS_28530 680 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 1514 2005 gene locus_tag LOCUS_28540 1514 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 2039 2359 gene locus_tag LOCUS_28550 2039 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 2356 3408 gene locus_tag LOCUS_28560 2356 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 3405 4157 gene locus_tag LOCUS_28570 3405 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 4171 4242 gene locus_tag LOCUS_t00810 4171 4242 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0518 1 198 gene locus_tag LOCUS_28580 1 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 861 1829 gene locus_tag LOCUS_28590 861 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 2690 1914 gene locus_tag LOCUS_28600 2690 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 3071 2751 gene locus_tag LOCUS_28610 3071 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 3485 3712 gene locus_tag LOCUS_28620 3485 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 4452 3775 gene locus_tag LOCUS_28630 4452 3775 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_28630 >Feature sequence0519 1727 927 gene locus_tag LOCUS_28640 1727 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 2957 1767 gene locus_tag LOCUS_28650 2957 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 3068 3436 gene locus_tag LOCUS_28660 3068 3436 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143408.1 protein_id gnl|my_center|LOCUS_28660 3491 3850 gene locus_tag LOCUS_28670 3491 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 4294 3860 gene locus_tag LOCUS_28680 4294 3860 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329166.1 protein_id gnl|my_center|LOCUS_28680 4776 4543 gene locus_tag LOCUS_28690 4776 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 >Feature sequence0520 842 3769 gene locus_tag LOCUS_28700 842 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 4727 3939 gene locus_tag LOCUS_28710 gene cysH 4727 3939 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence0521 1817 636 gene locus_tag LOCUS_28720 1817 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 1953 4196 gene locus_tag LOCUS_28730 1953 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 >Feature sequence0522 1212 409 gene locus_tag LOCUS_28740 1212 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 2413 1220 gene locus_tag LOCUS_28750 2413 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 4328 2427 gene locus_tag LOCUS_28760 4328 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 >Feature sequence0523 <1 1304 gene locus_tag LOCUS_28770 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:sulfurtransferase 2272 1319 gene locus_tag LOCUS_28780 2272 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 3402 2362 gene locus_tag LOCUS_28790 3402 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 4843 3524 gene locus_tag LOCUS_28800 4843 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence0524 724 152 gene locus_tag LOCUS_28810 gene rpoE 724 152 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_28810 2613 928 gene locus_tag LOCUS_28820 2613 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 3389 2631 gene locus_tag LOCUS_28830 3389 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 <4946 3536 gene locus_tag LOCUS_28840 <4946 3536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258514.1:ABC transporter ATP-binding protein >Feature sequence0525 429 70 gene locus_tag LOCUS_28850 429 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 1279 518 gene locus_tag LOCUS_28860 gene prpC 1279 518 CDS product protein phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34779 protein_id gnl|my_center|LOCUS_28860 1437 2924 gene locus_tag LOCUS_28870 gene cinA 1437 2924 CDS product putative competence-damage inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKI6 protein_id gnl|my_center|LOCUS_28870 2937 4070 gene locus_tag LOCUS_28880 gene recA 2937 4070 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62215 protein_id gnl|my_center|LOCUS_28880 >Feature sequence0526 1145 2749 gene locus_tag LOCUS_28890 1145 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 >Feature sequence0527 222 1856 gene locus_tag LOCUS_28900 222 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 1879 2430 gene locus_tag LOCUS_28910 1879 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 3774 2470 gene locus_tag LOCUS_28920 3774 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918537.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence0528 662 1051 gene locus_tag LOCUS_28930 662 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 >Feature sequence0529 680 985 gene locus_tag LOCUS_28940 680 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 1336 1010 gene locus_tag LOCUS_28950 1336 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 1848 1396 gene locus_tag LOCUS_28960 1848 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 2398 1820 gene locus_tag LOCUS_28970 2398 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28970 3051 2395 gene locus_tag LOCUS_28980 3051 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 3486 3064 gene locus_tag LOCUS_28990 3486 3064 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258525.1 protein_id gnl|my_center|LOCUS_28990 4552 3494 gene locus_tag LOCUS_29000 4552 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 >Feature sequence0530 788 414 gene locus_tag LOCUS_29010 788 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 1834 785 gene locus_tag LOCUS_29020 1834 785 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258727.1 protein_id gnl|my_center|LOCUS_29020 3112 1985 gene locus_tag LOCUS_29030 3112 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 3282 3683 gene locus_tag LOCUS_29040 3282 3683 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640294.1 protein_id gnl|my_center|LOCUS_29040 >Feature sequence0531 2109 1018 gene locus_tag LOCUS_29050 2109 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 3453 2278 gene locus_tag LOCUS_29060 3453 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 4049 3636 gene locus_tag LOCUS_29070 4049 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 4063 4701 gene locus_tag LOCUS_29080 4063 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 >Feature sequence0532 1572 2459 gene locus_tag LOCUS_29090 1572 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406215.1 protein_id gnl|my_center|LOCUS_29090 2599 3381 gene locus_tag LOCUS_29100 2599 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532752.1 protein_id gnl|my_center|LOCUS_29100 >Feature sequence0533 2042 705 gene locus_tag LOCUS_29110 2042 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 4472 2073 gene locus_tag LOCUS_29120 4472 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 >Feature sequence0534 2727 805 gene locus_tag LOCUS_29130 2727 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_29130 2933 3721 gene locus_tag LOCUS_29140 2933 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 3836 4825 gene locus_tag LOCUS_29150 3836 4825 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730493.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence0535 162 1472 gene locus_tag LOCUS_29160 162 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 1492 2580 gene locus_tag LOCUS_29170 1492 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 4500 2674 gene locus_tag LOCUS_29180 4500 2674 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028428.1 protein_id gnl|my_center|LOCUS_29180 >Feature sequence0536 792 520 gene locus_tag LOCUS_29190 792 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 1688 789 gene locus_tag LOCUS_29200 1688 789 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365754.1 protein_id gnl|my_center|LOCUS_29200 1936 3858 gene locus_tag LOCUS_29210 1936 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 4807 3902 gene locus_tag LOCUS_29220 4807 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 >Feature sequence0537 1739 1191 gene locus_tag LOCUS_29230 1739 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 2005 2538 gene locus_tag LOCUS_29240 2005 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 2777 3886 gene locus_tag LOCUS_29250 2777 3886 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031173.1 protein_id gnl|my_center|LOCUS_29250 4033 4722 gene locus_tag LOCUS_29260 4033 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 >Feature sequence0538 1680 418 gene locus_tag LOCUS_29270 1680 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 1984 2238 gene locus_tag LOCUS_29280 1984 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 2269 2745 gene locus_tag LOCUS_29290 2269 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 3650 2802 gene locus_tag LOCUS_29300 3650 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 3757 4503 gene locus_tag LOCUS_29310 3757 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence0539 >Feature sequence0540 848 384 gene locus_tag LOCUS_29320 848 384 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_29320 1501 845 gene locus_tag LOCUS_29330 gene msrA 1501 845 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHL9 protein_id gnl|my_center|LOCUS_29330 2307 1669 gene locus_tag LOCUS_29340 2307 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 2849 3334 gene locus_tag LOCUS_29350 2849 3334 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058135.1 protein_id gnl|my_center|LOCUS_29350 3402 4064 gene locus_tag LOCUS_29360 3402 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056700.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence0541 478 1299 gene locus_tag LOCUS_29370 478 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 1787 1458 gene locus_tag LOCUS_29380 1787 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 2108 1881 gene locus_tag LOCUS_29390 2108 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 2032 2946 gene locus_tag LOCUS_29400 2032 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 2943 4502 gene locus_tag LOCUS_29410 2943 4502 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396014.1 protein_id gnl|my_center|LOCUS_29410 >Feature sequence0542 1386 463 gene locus_tag LOCUS_29420 1386 463 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490846.1 protein_id gnl|my_center|LOCUS_29420 1735 1478 gene locus_tag LOCUS_29430 1735 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 2030 2983 gene locus_tag LOCUS_29440 2030 2983 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258990.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence0543 443 1954 gene locus_tag LOCUS_29450 443 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 2119 2979 gene locus_tag LOCUS_29460 gene nei 2119 2979 CDS product endonuclease 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N9V3 protein_id gnl|my_center|LOCUS_29460 2976 4535 gene locus_tag LOCUS_29470 2976 4535 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404766.1 protein_id gnl|my_center|LOCUS_29470 >Feature sequence0544 <1 768 gene locus_tag LOCUS_29480 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016497.1:D-amino acid dehydrogenase large subunit 996 3368 gene locus_tag LOCUS_29490 996 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence0545 1316 1390 gene locus_tag LOCUS_t00820 1316 1390 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1587 2993 gene locus_tag LOCUS_29500 gene rimO 1587 2993 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747R0 protein_id gnl|my_center|LOCUS_29500 3868 3017 gene locus_tag LOCUS_29510 3868 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 4689 3904 gene locus_tag LOCUS_29520 4689 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence0546 3233 1143 gene locus_tag LOCUS_29530 3233 1143 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545126.1 protein_id gnl|my_center|LOCUS_29530 3993 3313 gene locus_tag LOCUS_29540 3993 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 >Feature sequence0547 51 2021 gene locus_tag LOCUS_29550 51 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 2428 2063 gene locus_tag LOCUS_29560 2428 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence0548 103 1383 gene locus_tag LOCUS_29570 103 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 1748 2365 gene locus_tag LOCUS_29580 1748 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 2662 3498 gene locus_tag LOCUS_29590 2662 3498 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537945.1 protein_id gnl|my_center|LOCUS_29590 3644 4681 gene locus_tag LOCUS_29600 3644 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 >Feature sequence0549 1653 4400 gene locus_tag LOCUS_29610 1653 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 4643 4567 gene locus_tag LOCUS_t00830 4643 4567 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0550 2463 226 gene locus_tag LOCUS_29620 2463 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 2444 2599 gene locus_tag LOCUS_29630 2444 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence0551 2404 941 gene locus_tag LOCUS_29640 2404 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 4071 2401 gene locus_tag LOCUS_29650 4071 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence0552 1570 2997 gene locus_tag LOCUS_29660 1570 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 3100 4275 gene locus_tag LOCUS_29670 3100 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence0553 385 2868 gene locus_tag LOCUS_29680 385 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3208 3349 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgctccggcggcggctgctcgcagtcctgcg >Feature sequence0554 <1 1022 gene locus_tag LOCUS_29690 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942078.1:kinase 1204 1848 gene locus_tag LOCUS_29700 1204 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 2200 2910 gene locus_tag LOCUS_29710 2200 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 3051 3548 gene locus_tag LOCUS_29720 3051 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 3920 3606 gene locus_tag LOCUS_29730 3920 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 4364 3969 gene locus_tag LOCUS_29740 4364 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 >Feature sequence0555 2436 493 gene locus_tag LOCUS_29750 2436 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 3140 3781 gene locus_tag LOCUS_29760 3140 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 4304 4378 gene locus_tag LOCUS_t00840 4304 4378 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4423 4497 gene locus_tag LOCUS_t00850 4423 4497 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4526 4598 gene locus_tag LOCUS_t00860 4526 4598 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4641 4714 gene locus_tag LOCUS_t00870 4641 4714 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0556 <1 2056 gene locus_tag LOCUS_29770 <1 2056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122787.1:helicase 2123 3391 gene locus_tag LOCUS_29780 2123 3391 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 protein_id gnl|my_center|LOCUS_29780 3808 3428 gene locus_tag LOCUS_29790 3808 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 4785 3826 gene locus_tag LOCUS_29800 4785 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 >Feature sequence0557 2508 4211 gene locus_tag LOCUS_29810 2508 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 >Feature sequence0558 2382 1717 gene locus_tag LOCUS_29820 2382 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 2672 3601 gene locus_tag LOCUS_29830 2672 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 <4771 3621 gene locus_tag LOCUS_29840 <4771 3621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707122.1:NADPH-dependent 2,4-dienoyl-CoA reductase >Feature sequence0559 915 1649 gene locus_tag LOCUS_29850 915 1649 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729133.1 protein_id gnl|my_center|LOCUS_29850 2764 1655 gene locus_tag LOCUS_29860 2764 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 3955 2804 gene locus_tag LOCUS_29870 3955 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_29870 >Feature sequence0560 395 2335 gene locus_tag LOCUS_29880 395 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 3935 2289 gene locus_tag LOCUS_29890 gene choB 3935 2289 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206169.1 protein_id gnl|my_center|LOCUS_29890 4006 4425 gene locus_tag LOCUS_29900 gene dksA 4006 4425 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67865 protein_id gnl|my_center|LOCUS_29900 >Feature sequence0561 >Feature sequence0562 1132 410 gene locus_tag LOCUS_29910 1132 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 1866 1132 gene locus_tag LOCUS_29920 1866 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 2738 1863 gene locus_tag LOCUS_29930 2738 1863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727706.1 protein_id gnl|my_center|LOCUS_29930 3241 2735 gene locus_tag LOCUS_29940 gene mmpR5 3241 2735 CDS product HTH-type transcriptional regulator MmpR5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I6Y8F7 protein_id gnl|my_center|LOCUS_29940 3584 3327 gene locus_tag LOCUS_29950 3584 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 >Feature sequence0563 2023 1394 gene locus_tag LOCUS_29960 gene rimP 2023 1394 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT6 protein_id gnl|my_center|LOCUS_29960 2679 3206 gene locus_tag LOCUS_29970 2679 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 3225 3857 gene locus_tag LOCUS_29980 3225 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 4375 3863 gene locus_tag LOCUS_29990 4375 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 >Feature sequence0564 1497 265 gene locus_tag LOCUS_30000 1497 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 4067 1494 gene locus_tag LOCUS_30010 4067 1494 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258037.1 protein_id gnl|my_center|LOCUS_30010 4443 4069 gene locus_tag LOCUS_30020 4443 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_30020 >Feature sequence0565 187 639 gene locus_tag LOCUS_30030 187 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 884 705 gene locus_tag LOCUS_30040 884 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 1065 1625 gene locus_tag LOCUS_30050 1065 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 1662 2162 gene locus_tag LOCUS_30060 1662 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 >Feature sequence0566 2124 307 gene locus_tag LOCUS_30070 2124 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 3218 3934 gene locus_tag LOCUS_30080 3218 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 >Feature sequence0567 1477 2193 gene locus_tag LOCUS_30090 1477 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 2457 4136 gene locus_tag LOCUS_30100 2457 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence0568 535 1647 gene locus_tag LOCUS_30110 535 1647 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931011.1 protein_id gnl|my_center|LOCUS_30110 1741 2961 gene locus_tag LOCUS_30120 1741 2961 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_30120 2933 3700 gene locus_tag LOCUS_30130 2933 3700 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 protein_id gnl|my_center|LOCUS_30130 >Feature sequence0569 2790 250 gene locus_tag LOCUS_30140 2790 250 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035312.1 protein_id gnl|my_center|LOCUS_30140 >Feature sequence0570 334 1593 gene locus_tag LOCUS_30150 334 1593 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 protein_id gnl|my_center|LOCUS_30150 2615 1644 gene locus_tag LOCUS_30160 2615 1644 CDS product fructose-bisphosphatase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_30160 3152 2664 gene locus_tag LOCUS_30170 3152 2664 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_30170 4481 3156 gene locus_tag LOCUS_30180 gene hom 4481 3156 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI0 protein_id gnl|my_center|LOCUS_30180 >Feature sequence0571 494 2011 gene locus_tag LOCUS_30190 494 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30190 2855 2196 gene locus_tag LOCUS_30200 2855 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 >Feature sequence0572 <1 1025 gene locus_tag LOCUS_30210 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIV4:GTPase Der 1366 3066 gene locus_tag LOCUS_30220 1366 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 4353 3472 gene locus_tag LOCUS_30230 4353 3472 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272439.1 protein_id gnl|my_center|LOCUS_30230 >Feature sequence0573 1072 1290 gene locus_tag LOCUS_30240 1072 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 2674 1307 gene locus_tag LOCUS_30250 2674 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 3458 2931 gene locus_tag LOCUS_30260 3458 2931 CDS product thioredoxin peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_30260 >Feature sequence0574 >Feature sequence0575 4713 2452 gene locus_tag LOCUS_30270 4713 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 >Feature sequence0576 1277 270 gene locus_tag LOCUS_30280 1277 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 2947 1289 gene locus_tag LOCUS_30290 2947 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 3794 3567 gene locus_tag LOCUS_30300 3794 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 4252 3791 gene locus_tag LOCUS_30310 4252 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 4356 4580 gene locus_tag LOCUS_30320 4356 4580 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531584.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence0577 1184 483 gene locus_tag LOCUS_30330 1184 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 1126 1482 gene locus_tag LOCUS_30340 1126 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 2511 1552 gene locus_tag LOCUS_30350 2511 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 3374 2580 gene locus_tag LOCUS_30360 3374 2580 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731349.1 protein_id gnl|my_center|LOCUS_30360 4442 3387 gene locus_tag LOCUS_30370 4442 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 4620 4694 gene locus_tag LOCUS_t00880 4620 4694 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0578 <1 827 gene locus_tag LOCUS_30380 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZL9:lipoyl synthase 1169 2839 gene locus_tag LOCUS_30390 1169 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 2836 4056 gene locus_tag LOCUS_30400 2836 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 >Feature sequence0579 738 274 gene locus_tag LOCUS_30410 738 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 1568 819 gene locus_tag LOCUS_30420 1568 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 1761 3452 gene locus_tag LOCUS_30430 1761 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 3542 4147 gene locus_tag LOCUS_30440 3542 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence0580 801 1172 gene locus_tag LOCUS_30450 801 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 2825 1230 gene locus_tag LOCUS_30460 2825 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 3187 3501 gene locus_tag LOCUS_30470 3187 3501 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457487.1 protein_id gnl|my_center|LOCUS_30470 3569 4246 gene locus_tag LOCUS_30480 3569 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815691.1 protein_id gnl|my_center|LOCUS_30480 >Feature sequence0581 367 1893 gene locus_tag LOCUS_30490 367 1893 CDS product serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 protein_id gnl|my_center|LOCUS_30490 2154 3098 gene locus_tag LOCUS_30500 gene trxB 2154 3098 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJE3 protein_id gnl|my_center|LOCUS_30500 3407 4138 gene locus_tag LOCUS_30510 3407 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence0582 879 241 gene locus_tag LOCUS_30520 879 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 2234 1095 gene locus_tag LOCUS_30530 2234 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118452.1 protein_id gnl|my_center|LOCUS_30530 3580 2336 gene locus_tag LOCUS_30540 gene fabF 3580 2336 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_30540 4071 3580 gene locus_tag LOCUS_30550 4071 3580 CDS product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980976.1 protein_id gnl|my_center|LOCUS_30550 4350 4090 gene locus_tag LOCUS_30560 gene acpP 4350 4090 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK91 protein_id gnl|my_center|LOCUS_30560 >Feature sequence0583 447 1472 gene locus_tag LOCUS_30570 447 1472 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258727.1 protein_id gnl|my_center|LOCUS_30570 2195 1596 gene locus_tag LOCUS_30580 2195 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 2474 3004 gene locus_tag LOCUS_30590 2474 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 3485 3024 gene locus_tag LOCUS_30600 3485 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 >Feature sequence0584 1108 698 gene locus_tag LOCUS_30610 1108 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 2061 1156 gene locus_tag LOCUS_30620 2061 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 2298 2663 gene locus_tag LOCUS_30630 2298 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 2803 4485 gene locus_tag LOCUS_30640 2803 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 >Feature sequence0585 214 1707 gene locus_tag LOCUS_30650 214 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 2367 1771 gene locus_tag LOCUS_30660 2367 1771 CDS product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963347.1 protein_id gnl|my_center|LOCUS_30660 2840 2364 gene locus_tag LOCUS_30670 2840 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 2903 3766 gene locus_tag LOCUS_30680 2903 3766 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529052.1 protein_id gnl|my_center|LOCUS_30680 4312 3833 gene locus_tag LOCUS_30690 4312 3833 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141194.1 protein_id gnl|my_center|LOCUS_30690 >Feature sequence0586 681 157 gene locus_tag LOCUS_30700 681 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 1521 697 gene locus_tag LOCUS_30710 1521 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 2551 1568 gene locus_tag LOCUS_30720 2551 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 2757 4169 gene locus_tag LOCUS_30730 2757 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705537.1 protein_id gnl|my_center|LOCUS_30730 >Feature sequence0587 467 1387 gene locus_tag LOCUS_30740 467 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 2007 1384 gene locus_tag LOCUS_30750 2007 1384 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035488.1 protein_id gnl|my_center|LOCUS_30750 2152 3177 gene locus_tag LOCUS_30760 2152 3177 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723784.1 protein_id gnl|my_center|LOCUS_30760 4315 3254 gene locus_tag LOCUS_30770 4315 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 >Feature sequence0588 614 1906 gene locus_tag LOCUS_30780 614 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 2103 3281 gene locus_tag LOCUS_30790 2103 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 4506 3286 gene locus_tag LOCUS_30800 4506 3286 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_30800 >Feature sequence0589 <1 915 gene locus_tag LOCUS_30810 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545143.1:MucD protein 3318 925 gene locus_tag LOCUS_30820 3318 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 >Feature sequence0590 309 2444 gene locus_tag LOCUS_30830 309 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 2660 4606 gene locus_tag LOCUS_30840 2660 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 >Feature sequence0591 3300 4505 gene locus_tag LOCUS_30850 3300 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616634.1 protein_id gnl|my_center|LOCUS_30850 >Feature sequence0592 372 533 gene locus_tag LOCUS_30860 372 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 1069 4266 gene locus_tag LOCUS_30870 1069 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 >Feature sequence0593 991 1437 gene locus_tag LOCUS_30880 991 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 2572 1424 gene locus_tag LOCUS_30890 2572 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 2899 3762 gene locus_tag LOCUS_30900 2899 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 4109 3753 gene locus_tag LOCUS_30910 4109 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 >Feature sequence0594 1583 4069 gene locus_tag LOCUS_30920 gene aaiD 1583 4069 CDS product peptidase S45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071198.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence0595 3 1343 gene locus_tag LOCUS_30930 3 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 3949 1397 gene locus_tag LOCUS_30940 3949 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 4464 3946 gene locus_tag LOCUS_30950 4464 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence0596 1849 500 gene locus_tag LOCUS_30960 1849 500 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_30960 1984 2484 gene locus_tag LOCUS_30970 1984 2484 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_30970 3026 2598 gene locus_tag LOCUS_30980 3026 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 3159 3662 gene locus_tag LOCUS_30990 gene sixA 3159 3662 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943199.1 protein_id gnl|my_center|LOCUS_30990 >Feature sequence0597 1677 3416 gene locus_tag LOCUS_31000 1677 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 3510 4052 gene locus_tag LOCUS_31010 3510 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 >Feature sequence0598 <1 663 gene locus_tag LOCUS_31020 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031630.1:dehydrogenase 1441 689 gene locus_tag LOCUS_31030 1441 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 1732 2229 gene locus_tag LOCUS_31040 1732 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 2671 2240 gene locus_tag LOCUS_31050 2671 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 3549 2899 gene locus_tag LOCUS_31060 3549 2899 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_31060 3666 4421 gene locus_tag LOCUS_31070 3666 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 >Feature sequence0599 1335 952 gene locus_tag LOCUS_31080 gene rbfA 1335 952 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WB0 protein_id gnl|my_center|LOCUS_31080 3849 1360 gene locus_tag LOCUS_31090 3849 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31090 >Feature sequence0600 718 2151 gene locus_tag LOCUS_31100 718 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 2334 2768 gene locus_tag LOCUS_31110 2334 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 3933 2791 gene locus_tag LOCUS_31120 3933 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_31120 <4630 4049 gene locus_tag LOCUS_31130 <4630 4049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057625.1:thioredoxin family protein >Feature sequence0601 2539 4131 gene locus_tag LOCUS_31140 2539 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 >Feature sequence0602 <1 1104 gene locus_tag LOCUS_31150 <1 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140425.1:serine/threonine protein kinase 1505 2638 gene locus_tag LOCUS_31160 gene mqnC 1505 2638 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHE5 protein_id gnl|my_center|LOCUS_31160 3109 2645 gene locus_tag LOCUS_31170 3109 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 3677 3162 gene locus_tag LOCUS_31180 3677 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 >Feature sequence0603 989 249 gene locus_tag LOCUS_31190 989 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 1598 1098 gene locus_tag LOCUS_31200 gene smpB 1598 1098 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM0 protein_id gnl|my_center|LOCUS_31200 2297 1611 gene locus_tag LOCUS_31210 2297 1611 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_31210 2795 3280 gene locus_tag LOCUS_31220 2795 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 3865 3434 gene locus_tag LOCUS_31230 gene rlmH 3865 3434 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Q7 protein_id gnl|my_center|LOCUS_31230 4403 3873 gene locus_tag LOCUS_31240 4403 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 >Feature sequence0604 255 839 gene locus_tag LOCUS_31250 255 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 941 1720 gene locus_tag LOCUS_31260 941 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 1885 2478 gene locus_tag LOCUS_31270 1885 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 2643 2570 gene locus_tag LOCUS_t00890 2643 2570 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3016 4335 gene locus_tag LOCUS_31280 3016 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 >Feature sequence0605 2364 583 gene locus_tag LOCUS_31290 2364 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 4136 2436 gene locus_tag LOCUS_31300 4136 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 >Feature sequence0606 3171 2551 gene locus_tag LOCUS_31310 3171 2551 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_31310 3542 4570 gene locus_tag LOCUS_31320 3542 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 >Feature sequence0607 1489 1031 gene locus_tag LOCUS_31330 gene dut 1489 1031 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61908 protein_id gnl|my_center|LOCUS_31330 3788 1815 gene locus_tag LOCUS_31340 gene pnp 3788 1815 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS9 protein_id gnl|my_center|LOCUS_31340 4289 4020 gene locus_tag LOCUS_31350 4289 4020 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_31350 >Feature sequence0608 523 1119 gene locus_tag LOCUS_31360 523 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 1546 1157 gene locus_tag LOCUS_31370 1546 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 1919 1722 gene locus_tag LOCUS_31380 1919 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 4603 2036 gene locus_tag LOCUS_31390 4603 2036 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565846.1 protein_id gnl|my_center|LOCUS_31390 >Feature sequence0609 2361 3737 gene locus_tag LOCUS_31400 2361 3737 CDS product sodium:glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454913.1 protein_id gnl|my_center|LOCUS_31400 >Feature sequence0610 1217 1831 gene locus_tag LOCUS_31410 1217 1831 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675552.1 protein_id gnl|my_center|LOCUS_31410 4199 2343 gene locus_tag LOCUS_31420 4199 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 >Feature sequence0611 2041 71 gene locus_tag LOCUS_31430 2041 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 3807 2047 gene locus_tag LOCUS_31440 3807 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 >Feature sequence0612 580 1470 gene locus_tag LOCUS_31450 580 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 1593 2405 gene locus_tag LOCUS_31460 1593 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 3399 2473 gene locus_tag LOCUS_31470 3399 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 >Feature sequence0613 273 791 gene locus_tag LOCUS_31480 273 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 2320 863 gene locus_tag LOCUS_31490 2320 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 2697 4088 gene locus_tag LOCUS_31500 2697 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 >Feature sequence0614 430 1164 gene locus_tag LOCUS_31510 430 1164 CDS product CDP-abequose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250556.1 protein_id gnl|my_center|LOCUS_31510 1157 3100 gene locus_tag LOCUS_31520 1157 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 3476 3117 gene locus_tag LOCUS_31530 3476 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 >Feature sequence0615 802 185 gene locus_tag LOCUS_31540 802 185 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_31540 1001 2542 gene locus_tag LOCUS_31550 1001 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 4010 2616 gene locus_tag LOCUS_31560 4010 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 >Feature sequence0616 <1 1349 gene locus_tag LOCUS_31570 <1 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765770.1:hybrid sensor histidine kinase/response regulator 1631 2713 gene locus_tag LOCUS_31580 1631 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 3860 2724 gene locus_tag LOCUS_31590 3860 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence0617 679 1041 gene locus_tag LOCUS_31600 gene cheY5 679 1041 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719598.1 protein_id gnl|my_center|LOCUS_31600 1055 1591 gene locus_tag LOCUS_31610 1055 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 1611 2753 gene locus_tag LOCUS_31620 1611 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525235.1 protein_id gnl|my_center|LOCUS_31620 2777 4408 gene locus_tag LOCUS_31630 2777 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 >Feature sequence0618 730 83 gene locus_tag LOCUS_31640 gene ruvA 730 83 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E87 protein_id gnl|my_center|LOCUS_31640 1266 733 gene locus_tag LOCUS_31650 gene ruvC 1266 733 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E88 protein_id gnl|my_center|LOCUS_31650 2103 1357 gene locus_tag LOCUS_31660 2103 1357 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62036 protein_id gnl|my_center|LOCUS_31660 2286 3755 gene locus_tag LOCUS_31670 2286 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 4179 3700 gene locus_tag LOCUS_31680 4179 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 >Feature sequence0619 680 2809 gene locus_tag LOCUS_31690 680 2809 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203283.1 protein_id gnl|my_center|LOCUS_31690 3112 4104 gene locus_tag LOCUS_31700 3112 4104 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_31700 >Feature sequence0620 2250 3083 gene locus_tag LOCUS_31710 2250 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 4536 3115 gene locus_tag LOCUS_31720 4536 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 >Feature sequence0621 1430 471 gene locus_tag LOCUS_31730 gene tatC 1430 471 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D88 protein_id gnl|my_center|LOCUS_31730 2003 1455 gene locus_tag LOCUS_31740 2003 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 4275 2245 gene locus_tag LOCUS_31750 4275 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 >Feature sequence0622 <1 3262 gene locus_tag LOCUS_31760 <1 3262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039298.1:Oar protein 3368 3967 gene locus_tag LOCUS_31770 3368 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 >Feature sequence0623 <1 949 gene locus_tag LOCUS_31780 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083800.1:acid--CoA ligase 921 1307 gene locus_tag LOCUS_31790 921 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 1307 2446 gene locus_tag LOCUS_31800 gene phaC 1307 2446 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206335.1 protein_id gnl|my_center|LOCUS_31800 4158 2611 gene locus_tag LOCUS_31810 4158 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 >Feature sequence0624 865 71 gene locus_tag LOCUS_31820 865 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 1120 959 gene locus_tag LOCUS_31830 1120 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 1065 1730 gene locus_tag LOCUS_31840 1065 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 2885 1761 gene locus_tag LOCUS_31850 2885 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 3971 2955 gene locus_tag LOCUS_31860 3971 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938351.1 protein_id gnl|my_center|LOCUS_31860 4207 4464 gene locus_tag LOCUS_31870 4207 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 >Feature sequence0625 2062 152 gene locus_tag LOCUS_31880 2062 152 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057278.1 protein_id gnl|my_center|LOCUS_31880 2619 2404 gene locus_tag LOCUS_31890 2619 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 >Feature sequence0626 922 1122 gene locus_tag LOCUS_31900 922 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 3878 1149 gene locus_tag LOCUS_31910 3878 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 >Feature sequence0627 1456 2055 gene locus_tag LOCUS_31920 1456 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 2540 2052 gene locus_tag LOCUS_31930 2540 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 >Feature sequence0628 85 939 gene locus_tag LOCUS_31940 85 939 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_31940 1000 2265 gene locus_tag LOCUS_31950 1000 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_31950 2336 2668 gene locus_tag LOCUS_31960 2336 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 3543 2692 gene locus_tag LOCUS_31970 3543 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 <4527 3665 gene locus_tag LOCUS_31980 <4527 3665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969398.1:adenylate cyclase >Feature sequence0629 1585 1043 gene locus_tag LOCUS_31990 1585 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 2297 3838 gene locus_tag LOCUS_32000 2297 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence0630 4057 914 gene locus_tag LOCUS_32010 4057 914 CDS product Snf2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_011298.2 protein_id gnl|my_center|LOCUS_32010 >Feature sequence0631 320 931 gene locus_tag LOCUS_32020 320 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 1086 3986 gene locus_tag LOCUS_32030 1086 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 >Feature sequence0632 220 1200 gene locus_tag LOCUS_32040 220 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 >Feature sequence0633 617 778 gene locus_tag LOCUS_32050 617 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 903 1925 gene locus_tag LOCUS_32060 903 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 2885 1953 gene locus_tag LOCUS_32070 2885 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 3079 3882 gene locus_tag LOCUS_32080 3079 3882 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_32080 3891 4124 gene locus_tag LOCUS_32090 3891 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 >Feature sequence0634 700 68 gene locus_tag LOCUS_32100 700 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 2653 731 gene locus_tag LOCUS_32110 2653 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 <4501 2828 gene locus_tag LOCUS_32120 <4501 2828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003971785.1:metallophosphoesterase >Feature sequence0635 712 119 gene locus_tag LOCUS_32130 712 119 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948161.1 protein_id gnl|my_center|LOCUS_32130 1096 932 gene locus_tag LOCUS_32140 1096 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 1046 2140 gene locus_tag LOCUS_32150 1046 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 2574 3503 gene locus_tag LOCUS_32160 2574 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 3939 3514 gene locus_tag LOCUS_32170 3939 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932933.1 protein_id gnl|my_center|LOCUS_32170 4249 4019 gene locus_tag LOCUS_32180 4249 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 >Feature sequence0636 171 959 gene locus_tag LOCUS_32190 171 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 2760 976 gene locus_tag LOCUS_32200 2760 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 2947 3630 gene locus_tag LOCUS_32210 2947 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 >Feature sequence0637 586 8 gene locus_tag LOCUS_32220 586 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 3131 2607 gene locus_tag LOCUS_32230 3131 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 3551 3787 gene locus_tag LOCUS_32240 3551 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 >Feature sequence0638 1176 970 gene locus_tag LOCUS_32250 1176 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 1526 2692 gene locus_tag LOCUS_32260 1526 2692 CDS product delta(24(24(1)))-sterol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958072.1 protein_id gnl|my_center|LOCUS_32260 >Feature sequence0639 441 1091 gene locus_tag LOCUS_32270 441 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 1138 2112 gene locus_tag LOCUS_32280 1138 2112 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_32280 2553 2122 gene locus_tag LOCUS_32290 2553 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 3200 2550 gene locus_tag LOCUS_32300 3200 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 4171 3314 gene locus_tag LOCUS_32310 4171 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 >Feature sequence0640 665 2221 gene locus_tag LOCUS_32320 665 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 <4469 2218 gene locus_tag LOCUS_32330 <4469 2218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902160.1:phytoene dehydrogenase >Feature sequence0641 849 478 gene locus_tag LOCUS_32340 849 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 1442 966 gene locus_tag LOCUS_32350 1442 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 2497 1601 gene locus_tag LOCUS_32360 2497 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 2925 2653 gene locus_tag LOCUS_32370 2925 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 4136 2946 gene locus_tag LOCUS_32380 4136 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 >Feature sequence0642 >Feature sequence0643 1279 842 gene locus_tag LOCUS_32390 1279 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_32390 1575 1276 gene locus_tag LOCUS_32400 1575 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066895.1 protein_id gnl|my_center|LOCUS_32400 2236 1646 gene locus_tag LOCUS_32410 2236 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 3082 2390 gene locus_tag LOCUS_32420 3082 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 3279 3497 gene locus_tag LOCUS_32430 3279 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 3974 3519 gene locus_tag LOCUS_32440 3974 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 4381 4055 gene locus_tag LOCUS_32450 4381 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 >Feature sequence0644 933 2105 gene locus_tag LOCUS_32460 933 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 3120 2410 gene locus_tag LOCUS_32470 3120 2410 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_32470 <4452 3191 gene locus_tag LOCUS_32480 <4452 3191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931864.1:FAD-linked oxidase >Feature sequence0645 2431 794 gene locus_tag LOCUS_32490 2431 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 4205 2757 gene locus_tag LOCUS_32500 4205 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence0646 68 847 gene locus_tag LOCUS_32510 68 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 886 1749 gene locus_tag LOCUS_32520 886 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 1870 2397 gene locus_tag LOCUS_32530 1870 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 3360 2434 gene locus_tag LOCUS_32540 3360 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence0647 471 650 gene locus_tag LOCUS_32550 471 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 1075 1356 gene locus_tag LOCUS_32560 1075 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 1662 2045 gene locus_tag LOCUS_32570 1662 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 2230 3408 gene locus_tag LOCUS_32580 gene carA 2230 3408 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH03 protein_id gnl|my_center|LOCUS_32580 >Feature sequence0648 1 225 gene locus_tag LOCUS_32590 1 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 431 1975 gene locus_tag LOCUS_32600 431 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 2037 3170 gene locus_tag LOCUS_32610 2037 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 3149 3568 gene locus_tag LOCUS_32620 3149 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 3552 4115 gene locus_tag LOCUS_32630 3552 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence0649 <1 1556 gene locus_tag LOCUS_32640 <1 1556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QSC7:carboxylic ester hydrolase 1576 2199 gene locus_tag LOCUS_32650 1576 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 3469 2735 gene locus_tag LOCUS_32660 3469 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 >Feature sequence0650 1331 1930 gene locus_tag LOCUS_32670 1331 1930 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYX0 protein_id gnl|my_center|LOCUS_32670 2950 1976 gene locus_tag LOCUS_32680 2950 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 2984 3535 gene locus_tag LOCUS_32690 2984 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 3828 3568 gene locus_tag LOCUS_32700 3828 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 >Feature sequence0651 3475 2504 gene locus_tag LOCUS_32710 3475 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 3656 4324 gene locus_tag LOCUS_32720 3656 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence0652 1446 3098 gene locus_tag LOCUS_32730 1446 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 >Feature sequence0653 802 248 gene locus_tag LOCUS_32740 802 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 2391 829 gene locus_tag LOCUS_32750 2391 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 2758 3732 gene locus_tag LOCUS_32760 2758 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 <4417 3737 gene locus_tag LOCUS_32770 <4417 3737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022007.1:hybrid sensor histidine kinase/response regulator >Feature sequence0654 751 1062 gene locus_tag LOCUS_32780 751 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 1323 2597 gene locus_tag LOCUS_32790 1323 2597 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751431.1 protein_id gnl|my_center|LOCUS_32790 3949 2609 gene locus_tag LOCUS_32800 3949 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 >Feature sequence0655 <1 555 gene locus_tag LOCUS_32810 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MC87:demethylmenaquinone methyltransferase 566 1498 gene locus_tag LOCUS_32820 566 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 3378 1600 gene locus_tag LOCUS_32830 3378 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 >Feature sequence0656 2138 756 gene locus_tag LOCUS_32840 gene purF 2138 756 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN7 protein_id gnl|my_center|LOCUS_32840 2658 2287 gene locus_tag LOCUS_32850 2658 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3773 2799 gene locus_tag LOCUS_32860 gene purC 3773 2799 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2E5 protein_id gnl|my_center|LOCUS_32860 4310 3789 gene locus_tag LOCUS_32870 4310 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 >Feature sequence0657 1286 273 gene locus_tag LOCUS_32880 1286 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 1444 2607 gene locus_tag LOCUS_32890 1444 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 4281 2653 gene locus_tag LOCUS_32900 4281 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 >Feature sequence0658 1462 617 gene locus_tag LOCUS_32910 1462 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 1737 1459 gene locus_tag LOCUS_32920 1737 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 1904 3175 gene locus_tag LOCUS_32930 1904 3175 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_32930 <4399 3319 gene locus_tag LOCUS_32940 <4399 3319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222034.1:L-gulonolactone oxidase >Feature sequence0659 2950 1304 gene locus_tag LOCUS_32950 2950 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence0660 2993 987 gene locus_tag LOCUS_32960 2993 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 3813 3295 gene locus_tag LOCUS_32970 3813 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 >Feature sequence0661 478 1755 gene locus_tag LOCUS_32980 478 1755 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697398.1 protein_id gnl|my_center|LOCUS_32980 2356 1877 gene locus_tag LOCUS_32990 2356 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 3839 2385 gene locus_tag LOCUS_33000 3839 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 >Feature sequence0662 547 1866 gene locus_tag LOCUS_33010 547 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 1961 2170 gene locus_tag LOCUS_33020 1961 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 2303 3298 gene locus_tag LOCUS_33030 2303 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 >Feature sequence0663 1724 936 gene locus_tag LOCUS_33040 1724 936 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088544.1 protein_id gnl|my_center|LOCUS_33040 1746 1949 gene locus_tag LOCUS_33050 1746 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 2475 1969 gene locus_tag LOCUS_33060 2475 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 4027 2678 gene locus_tag LOCUS_33070 4027 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 >Feature sequence0664 3505 2318 gene locus_tag LOCUS_33080 3505 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 3838 3590 gene locus_tag LOCUS_33090 3838 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 >Feature sequence0665 2140 50 gene locus_tag LOCUS_33100 2140 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 2547 2167 gene locus_tag LOCUS_33110 2547 2167 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085073.1 protein_id gnl|my_center|LOCUS_33110 <4369 2585 gene locus_tag LOCUS_33120 <4369 2585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UFZ7:histidine kinase note possible pseudo, internal stop codon, frameshifted >Feature sequence0666 292 4068 gene locus_tag LOCUS_33130 292 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 4065 4352 gene locus_tag LOCUS_33140 4065 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 >Feature sequence0667 2363 1713 gene locus_tag LOCUS_33150 2363 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 >Feature sequence0668 90 2162 gene locus_tag LOCUS_33160 90 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 >Feature sequence0669 3452 807 gene locus_tag LOCUS_33170 3452 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 3862 3449 gene locus_tag LOCUS_33180 3862 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 >Feature sequence0670 1810 1484 gene locus_tag LOCUS_33190 1810 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 2079 1876 gene locus_tag LOCUS_33200 2079 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 2162 2323 gene locus_tag LOCUS_33210 2162 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 3976 2345 gene locus_tag LOCUS_33220 3976 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 >Feature sequence0671 32 2497 gene locus_tag LOCUS_33230 32 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 2502 3302 gene locus_tag LOCUS_33240 2502 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 >Feature sequence0672 1573 689 gene locus_tag LOCUS_33250 1573 689 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_33250 1906 2412 gene locus_tag LOCUS_33260 1906 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 2412 2822 gene locus_tag LOCUS_33270 2412 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 <4346 3007 gene locus_tag LOCUS_33280 <4346 3007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089805.1:alpha/beta hydrolase >Feature sequence0673 3 1034 gene locus_tag LOCUS_33290 3 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 1031 2374 gene locus_tag LOCUS_33300 gene hutI 1031 2374 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RZ05 protein_id gnl|my_center|LOCUS_33300 3110 2394 gene locus_tag LOCUS_33310 3110 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 3814 3107 gene locus_tag LOCUS_33320 gene hisG2 3814 3107 CDS product ATP phosphoribosyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60836 protein_id gnl|my_center|LOCUS_33320 >Feature sequence0674 1964 1290 gene locus_tag LOCUS_33330 1964 1290 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_33330 2290 2682 gene locus_tag LOCUS_33340 2290 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 2777 4222 gene locus_tag LOCUS_33350 2777 4222 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036996.1 protein_id gnl|my_center|LOCUS_33350 >Feature sequence0675 1654 2388 gene locus_tag LOCUS_33360 1654 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 2992 2405 gene locus_tag LOCUS_33370 2992 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 3494 3066 gene locus_tag LOCUS_33380 3494 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 3547 3810 gene locus_tag LOCUS_33390 3547 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 >Feature sequence0676 635 30 gene locus_tag LOCUS_33400 gene algU 635 30 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_33400 1006 2652 gene locus_tag LOCUS_33410 1006 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 >Feature sequence0677 588 1559 gene locus_tag LOCUS_33420 588 1559 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942523.1 protein_id gnl|my_center|LOCUS_33420 1556 2368 gene locus_tag LOCUS_33430 1556 2368 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121044.1 protein_id gnl|my_center|LOCUS_33430 2624 3514 gene locus_tag LOCUS_33440 2624 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 >Feature sequence0678 <1 774 gene locus_tag LOCUS_33450 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000651714.1:oxidoreductase 1855 842 gene locus_tag LOCUS_33460 1855 842 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_33460 3273 1852 gene locus_tag LOCUS_33470 3273 1852 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730651.1 protein_id gnl|my_center|LOCUS_33470 4167 3553 gene locus_tag LOCUS_33480 4167 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence0679 599 270 gene locus_tag LOCUS_33490 599 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 1267 623 gene locus_tag LOCUS_33500 1267 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 2757 1315 gene locus_tag LOCUS_33510 2757 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 2982 4001 gene locus_tag LOCUS_33520 2982 4001 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267772.1 protein_id gnl|my_center|LOCUS_33520 >Feature sequence0680 2855 129 gene locus_tag LOCUS_33530 2855 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 >Feature sequence0681 99 989 gene locus_tag LOCUS_33540 99 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 1043 1561 gene locus_tag LOCUS_33550 1043 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143383.1 protein_id gnl|my_center|LOCUS_33550 1620 3053 gene locus_tag LOCUS_33560 1620 3053 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_33560 3145 3930 gene locus_tag LOCUS_33570 3145 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 4148 3924 gene locus_tag LOCUS_33580 4148 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 >Feature sequence0682 1678 2715 gene locus_tag LOCUS_33590 1678 2715 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027374.1 protein_id gnl|my_center|LOCUS_33590 2712 4154 gene locus_tag LOCUS_33600 2712 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 >Feature sequence0683 1070 141 gene locus_tag LOCUS_33610 1070 141 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705863.1 protein_id gnl|my_center|LOCUS_33610 1884 1264 gene locus_tag LOCUS_33620 1884 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 1996 2625 gene locus_tag LOCUS_33630 1996 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065742.1 protein_id gnl|my_center|LOCUS_33630 2989 2626 gene locus_tag LOCUS_tm00010 2989 2626 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3185 4105 gene locus_tag LOCUS_33640 3185 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 >Feature sequence0684 811 1338 gene locus_tag LOCUS_33650 811 1338 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_33650 2156 1392 gene locus_tag LOCUS_33660 2156 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 3897 2755 gene locus_tag LOCUS_33670 3897 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 >Feature sequence0685 2844 1342 gene locus_tag LOCUS_33680 2844 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 3155 2970 gene locus_tag LOCUS_33690 3155 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 >Feature sequence0686 494 1051 gene locus_tag LOCUS_33700 494 1051 CDS product low-co2 inducible protein lcib inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544972.1 protein_id gnl|my_center|LOCUS_33700 1676 1044 gene locus_tag LOCUS_33710 1676 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 2186 3589 gene locus_tag LOCUS_33720 2186 3589 CDS product NADH dehydrogenase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292956.1 protein_id gnl|my_center|LOCUS_33720 3593 4276 gene locus_tag LOCUS_33730 3593 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 >Feature sequence0687 <1 1348 gene locus_tag LOCUS_33740 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0A392:leucine dehydrogenase 1484 3649 gene locus_tag LOCUS_33750 gene pepO 1484 3649 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 protein_id gnl|my_center|LOCUS_33750 4282 3683 gene locus_tag LOCUS_33760 4282 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 >Feature sequence0688 <1 664 gene locus_tag LOCUS_33770 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SLR1:dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex 708 2129 gene locus_tag LOCUS_33780 gene pdhD 708 2129 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21880 protein_id gnl|my_center|LOCUS_33780 2331 4052 gene locus_tag LOCUS_33790 2331 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 >Feature sequence0689 1198 2196 gene locus_tag LOCUS_33800 1198 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 >Feature sequence0690 <1 2044 gene locus_tag LOCUS_33810 <1 2044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035470.1:site-specific DNA-methyltransferase 2843 2064 gene locus_tag LOCUS_33820 2843 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 <4272 3262 gene locus_tag LOCUS_33830 <4272 3262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272458.1:calcium-transporting P-type ATPase, PMR1-type >Feature sequence0691 579 1229 gene locus_tag LOCUS_33840 579 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 1308 2027 gene locus_tag LOCUS_33850 1308 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 2504 3469 gene locus_tag LOCUS_33860 2504 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 >Feature sequence0692 852 304 gene locus_tag LOCUS_33870 852 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 1253 2347 gene locus_tag LOCUS_33880 1253 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 2482 3930 gene locus_tag LOCUS_33890 2482 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 >Feature sequence0693 310 1398 gene locus_tag LOCUS_33900 310 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 2179 1460 gene locus_tag LOCUS_33910 2179 1460 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142599.1 protein_id gnl|my_center|LOCUS_33910 2331 2891 gene locus_tag LOCUS_33920 2331 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 3531 2902 gene locus_tag LOCUS_33930 3531 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 >Feature sequence0694 1350 1979 gene locus_tag LOCUS_33940 1350 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 2032 2982 gene locus_tag LOCUS_33950 2032 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 >Feature sequence0695 2148 1405 gene locus_tag LOCUS_33960 2148 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 2761 2135 gene locus_tag LOCUS_33970 2761 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 3875 2850 gene locus_tag LOCUS_33980 3875 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 >Feature sequence0696 1230 2210 gene locus_tag LOCUS_33990 1230 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 2429 3037 gene locus_tag LOCUS_34000 2429 3037 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_34000 3095 3877 gene locus_tag LOCUS_34010 3095 3877 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657484.1 protein_id gnl|my_center|LOCUS_34010 >Feature sequence0697 1279 86 gene locus_tag LOCUS_34020 1279 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 1278 1478 gene locus_tag LOCUS_34030 1278 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 1626 2738 gene locus_tag LOCUS_34040 1626 2738 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261512.1 protein_id gnl|my_center|LOCUS_34040 3056 3379 gene locus_tag LOCUS_34050 3056 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 3408 4040 gene locus_tag LOCUS_34060 3408 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 >Feature sequence0698 1159 2043 gene locus_tag LOCUS_34070 1159 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 2136 2498 gene locus_tag LOCUS_34080 2136 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 2740 3276 gene locus_tag LOCUS_34090 2740 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 3471 3902 gene locus_tag LOCUS_34100 3471 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 >Feature sequence0699 269 90 gene locus_tag LOCUS_34110 269 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 333 701 gene locus_tag LOCUS_34120 333 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 2301 670 gene locus_tag LOCUS_34130 2301 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 2629 3315 gene locus_tag LOCUS_34140 2629 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34140 >Feature sequence0700 2233 1208 gene locus_tag LOCUS_34150 2233 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 2496 2314 gene locus_tag LOCUS_34160 2496 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 2976 3959 gene locus_tag LOCUS_34170 gene panB 2976 3959 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM79 protein_id gnl|my_center|LOCUS_34170 >Feature sequence0701 1685 2584 gene locus_tag LOCUS_34180 1685 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 2989 2612 gene locus_tag LOCUS_34190 2989 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 4121 3072 gene locus_tag LOCUS_34200 4121 3072 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 protein_id gnl|my_center|LOCUS_34200 >Feature sequence0702 2653 260 gene locus_tag LOCUS_34210 2653 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 3082 4029 gene locus_tag LOCUS_34220 3082 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 >Feature sequence0703 488 1249 gene locus_tag LOCUS_34230 488 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 2380 1265 gene locus_tag LOCUS_34240 2380 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 2897 2385 gene locus_tag LOCUS_34250 2897 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 3606 2905 gene locus_tag LOCUS_34260 3606 2905 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245567.1 protein_id gnl|my_center|LOCUS_34260 4022 3627 gene locus_tag LOCUS_34270 4022 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 >Feature sequence0704 1869 673 gene locus_tag LOCUS_34280 1869 673 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_34280 3089 1869 gene locus_tag LOCUS_34290 3089 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 >Feature sequence0705 <1 1102 gene locus_tag LOCUS_34300 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867504.1:recombinase XerC 1281 2213 gene locus_tag LOCUS_34310 1281 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 3680 2256 gene locus_tag LOCUS_34320 3680 2256 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_34320 >Feature sequence0706 3092 1152 gene locus_tag LOCUS_34330 3092 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 <4204 3151 gene locus_tag LOCUS_34340 <4204 3151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459978.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence0707 <1 820 gene locus_tag LOCUS_34350 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R169:putative molybdenum cofactor guanylyltransferase 907 1605 gene locus_tag LOCUS_34360 907 1605 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_34360 1669 2943 gene locus_tag LOCUS_34370 1669 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 3089 3736 gene locus_tag LOCUS_34380 3089 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 >Feature sequence0708 2139 2501 gene locus_tag LOCUS_34390 2139 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 >Feature sequence0709 503 24 gene locus_tag LOCUS_34400 503 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 955 614 gene locus_tag LOCUS_34410 955 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 1226 960 gene locus_tag LOCUS_34420 1226 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 1298 1561 gene locus_tag LOCUS_34430 1298 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 3142 1703 gene locus_tag LOCUS_34440 3142 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 4032 3448 gene locus_tag LOCUS_34450 4032 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 >Feature sequence0710 1358 483 gene locus_tag LOCUS_34460 1358 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 2058 2483 gene locus_tag LOCUS_34470 2058 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 2731 3033 gene locus_tag LOCUS_34480 2731 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 >Feature sequence0711 2358 934 gene locus_tag LOCUS_34490 2358 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 <4191 3014 gene locus_tag LOCUS_34500 <4191 3014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405434.1:aminopeptidase >Feature sequence0712 81 1355 gene locus_tag LOCUS_34510 gene cheB3 81 1355 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 3 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62640 protein_id gnl|my_center|LOCUS_34510 1386 2204 gene locus_tag LOCUS_34520 1386 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 2201 2608 gene locus_tag LOCUS_34530 gene cheY40H-4 2201 2608 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942852.1 protein_id gnl|my_center|LOCUS_34530 2689 3627 gene locus_tag LOCUS_34540 gene xerD 2689 3627 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9UPM0 protein_id gnl|my_center|LOCUS_34540 >Feature sequence0713 241 1116 gene locus_tag LOCUS_34550 241 1116 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_34550 1917 1144 gene locus_tag LOCUS_34560 1917 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 3546 2068 gene locus_tag LOCUS_34570 3546 2068 CDS product flavin-binding family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088683.1 protein_id gnl|my_center|LOCUS_34570 >Feature sequence0714 978 340 gene locus_tag LOCUS_34580 978 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 2077 1019 gene locus_tag LOCUS_34590 gene fabH 2077 1019 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV1 protein_id gnl|my_center|LOCUS_34590 2874 2281 gene locus_tag LOCUS_34600 2874 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 <4181 3050 gene locus_tag LOCUS_34610 <4181 3050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942647.1:3-octaprenyl-4-hydroxybenzoate carboxy-lyase >Feature sequence0715 <1 600 gene locus_tag LOCUS_34620 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388724.1:VWA domain-containing protein 1964 618 gene locus_tag LOCUS_34630 1964 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 2479 3819 gene locus_tag LOCUS_34640 2479 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 >Feature sequence0716 973 68 gene locus_tag LOCUS_34650 gene fabG 973 68 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841164.1 protein_id gnl|my_center|LOCUS_34650 1786 1169 gene locus_tag LOCUS_34660 1786 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 2251 3990 gene locus_tag LOCUS_34670 2251 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 >Feature sequence0717 3493 2708 gene locus_tag LOCUS_34680 3493 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 >Feature sequence0718 907 2037 gene locus_tag LOCUS_34690 gene add 907 2037 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403444.1 protein_id gnl|my_center|LOCUS_34690 2103 2543 gene locus_tag LOCUS_34700 2103 2543 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_34700 2572 3429 gene locus_tag LOCUS_34710 gene paaG 2572 3429 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228734.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence0719 1410 2621 gene locus_tag LOCUS_34720 1410 2621 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972178.1 protein_id gnl|my_center|LOCUS_34720 2687 3247 gene locus_tag LOCUS_34730 2687 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 >Feature sequence0720 1302 511 gene locus_tag LOCUS_34740 1302 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 1434 1907 gene locus_tag LOCUS_34750 1434 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941058.1 protein_id gnl|my_center|LOCUS_34750 3063 1924 gene locus_tag LOCUS_34760 3063 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 3175 3750 gene locus_tag LOCUS_34770 3175 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 >Feature sequence0721 322 1437 gene locus_tag LOCUS_34780 322 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 1451 2296 gene locus_tag LOCUS_34790 1451 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 3230 2319 gene locus_tag LOCUS_34800 3230 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 3166 3357 gene locus_tag LOCUS_34810 3166 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 <4160 3595 gene locus_tag LOCUS_34820 <4160 3595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142493.1:DUF159 family protein >Feature sequence0722 <1 978 gene locus_tag LOCUS_34830 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392761.1:radical SAM/SPASM domain-containing protein 1793 906 gene locus_tag LOCUS_34840 1793 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 2529 1855 gene locus_tag LOCUS_34850 gene fabG 2529 1855 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 protein_id gnl|my_center|LOCUS_34850 3521 2580 gene locus_tag LOCUS_34860 3521 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 >Feature sequence0723 569 1387 gene locus_tag LOCUS_34870 569 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_34870 1468 3012 gene locus_tag LOCUS_34880 1468 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 3432 3052 gene locus_tag LOCUS_34890 3432 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 >Feature sequence0724 994 1413 gene locus_tag LOCUS_34900 gene ndk 994 1413 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729L7 protein_id gnl|my_center|LOCUS_34900 1427 2560 gene locus_tag LOCUS_34910 gene rlmN 1427 2560 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E53 protein_id gnl|my_center|LOCUS_34910 3228 2557 gene locus_tag LOCUS_34920 3228 2557 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087169.1 protein_id gnl|my_center|LOCUS_34920 3828 3244 gene locus_tag LOCUS_34930 3828 3244 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222676.1 protein_id gnl|my_center|LOCUS_34930 >Feature sequence0725 <1 2677 gene locus_tag LOCUS_34940 <1 2677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118567.1:serine/threonine protein kinase >Feature sequence0726 284 574 gene locus_tag LOCUS_34950 284 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 1161 661 gene locus_tag LOCUS_34960 1161 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 1482 2906 gene locus_tag LOCUS_34970 gene cafA 1482 2906 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_34970 2966 3445 gene locus_tag LOCUS_34980 2966 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 3528 4001 gene locus_tag LOCUS_34990 3528 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 >Feature sequence0727 351 1910 gene locus_tag LOCUS_35000 gene rsr 351 1910 CDS product ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_35000 4004 2739 gene locus_tag LOCUS_35010 4004 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 >Feature sequence0728 1825 404 gene locus_tag LOCUS_35020 1825 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 2594 2067 gene locus_tag LOCUS_35030 2594 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 >Feature sequence0729 1561 437 gene locus_tag LOCUS_35040 1561 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 2154 1549 gene locus_tag LOCUS_35050 2154 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 2369 3745 gene locus_tag LOCUS_35060 2369 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 >Feature sequence0730 1479 211 gene locus_tag LOCUS_35070 1479 211 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_35070 1624 1382 gene locus_tag LOCUS_35080 1624 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 1976 2986 gene locus_tag LOCUS_35090 1976 2986 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931757.1 protein_id gnl|my_center|LOCUS_35090 3045 4052 gene locus_tag LOCUS_35100 3045 4052 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_35100 >Feature sequence0731 1991 1326 gene locus_tag LOCUS_35110 1991 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 2047 2832 gene locus_tag LOCUS_35120 2047 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_35120 >Feature sequence0732 5 1045 gene locus_tag LOCUS_35130 5 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 1121 1603 gene locus_tag LOCUS_35140 1121 1603 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200519.1 protein_id gnl|my_center|LOCUS_35140 3409 1625 gene locus_tag LOCUS_35150 3409 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 >Feature sequence0733 2802 1630 gene locus_tag LOCUS_35160 2802 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141711.1 protein_id gnl|my_center|LOCUS_35160 2916 3863 gene locus_tag LOCUS_35170 gene qor 2916 3863 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227924.1 protein_id gnl|my_center|LOCUS_35170 >Feature sequence0734 1538 555 gene locus_tag LOCUS_35180 gene estX 1538 555 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113577.1 protein_id gnl|my_center|LOCUS_35180 2050 1712 gene locus_tag LOCUS_35190 2050 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 3189 2158 gene locus_tag LOCUS_35200 3189 2158 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974245.1 protein_id gnl|my_center|LOCUS_35200 >Feature sequence0735 1572 1147 gene locus_tag LOCUS_35210 1572 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 2982 1807 gene locus_tag LOCUS_35220 2982 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 3830 3033 gene locus_tag LOCUS_35230 3830 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 >Feature sequence0736 525 2438 gene locus_tag LOCUS_35240 525 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 2458 3768 gene locus_tag LOCUS_35250 2458 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 4027 3800 gene locus_tag LOCUS_35260 4027 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 >Feature sequence0737 <1 1270 gene locus_tag LOCUS_35270 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HP91:1-pyrroline-5-carboxylate dehydrogenase 1314 2654 gene locus_tag LOCUS_35280 gene argD 1314 2654 CDS product acetylornithine/acetyl-lysine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RZC5 protein_id gnl|my_center|LOCUS_35280 >Feature sequence0738 108 1730 gene locus_tag LOCUS_35290 108 1730 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKK9 protein_id gnl|my_center|LOCUS_35290 1727 3331 gene locus_tag LOCUS_35300 1727 3331 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919157.1 protein_id gnl|my_center|LOCUS_35300 >Feature sequence0739 2536 2159 gene locus_tag LOCUS_35310 2536 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 >Feature sequence0740 976 689 gene locus_tag LOCUS_35320 976 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 879 2372 gene locus_tag LOCUS_35330 879 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 2424 2978 gene locus_tag LOCUS_35340 2424 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 3572 3036 gene locus_tag LOCUS_35350 3572 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 >Feature sequence0741 900 184 gene locus_tag LOCUS_35360 900 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 1876 1031 gene locus_tag LOCUS_35370 1876 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_35370 2314 1934 gene locus_tag LOCUS_35380 2314 1934 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_35380 2727 2311 gene locus_tag LOCUS_35390 2727 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 3162 2803 gene locus_tag LOCUS_35400 3162 2803 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615771.1 protein_id gnl|my_center|LOCUS_35400 <4112 3162 gene locus_tag LOCUS_35410 <4112 3162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JKQ7:chaperone protein HscA >Feature sequence0742 696 256 gene locus_tag LOCUS_35420 696 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 2209 1715 gene locus_tag LOCUS_35430 2209 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 2464 2219 gene locus_tag LOCUS_35440 2464 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 2732 3841 gene locus_tag LOCUS_35450 gene int 2732 3841 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971461.1 protein_id gnl|my_center|LOCUS_35450 >Feature sequence0743 3331 2366 gene locus_tag LOCUS_35460 3331 2366 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941713.1 protein_id gnl|my_center|LOCUS_35460 <4108 3401 gene locus_tag LOCUS_35470 <4108 3401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BZ6:phosphoenolpyruvate-protein phosphotransferase >Feature sequence0744 347 1213 gene locus_tag LOCUS_35480 347 1213 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226373.1 protein_id gnl|my_center|LOCUS_35480 1488 2234 gene locus_tag LOCUS_35490 1488 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 2388 3596 gene locus_tag LOCUS_35500 gene purT 2388 3596 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E56 protein_id gnl|my_center|LOCUS_35500 >Feature sequence0745 463 942 gene locus_tag LOCUS_35510 463 942 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808116.1 protein_id gnl|my_center|LOCUS_35510 939 2096 gene locus_tag LOCUS_35520 939 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35520 2136 3176 gene locus_tag LOCUS_35530 2136 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35530 3198 3953 gene locus_tag LOCUS_35540 3198 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 >Feature sequence0746 1650 1153 gene locus_tag LOCUS_35550 1650 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 1698 2354 gene locus_tag LOCUS_35560 1698 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 2692 2375 gene locus_tag LOCUS_35570 2692 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 3241 2783 gene locus_tag LOCUS_35580 3241 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 3601 3248 gene locus_tag LOCUS_35590 3601 3248 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224553.1 protein_id gnl|my_center|LOCUS_35590 >Feature sequence0747 1185 313 gene locus_tag LOCUS_35600 1185 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 1518 3191 gene locus_tag LOCUS_35610 1518 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 3577 3200 gene locus_tag LOCUS_35620 3577 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 >Feature sequence0748 1707 43 gene locus_tag LOCUS_35630 1707 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 1895 2263 gene locus_tag LOCUS_35640 1895 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975312.1 protein_id gnl|my_center|LOCUS_35640 <4089 2307 gene locus_tag LOCUS_35650 <4089 2307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92WJ7:histidine kinase >Feature sequence0749 415 705 gene locus_tag LOCUS_35660 415 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 1717 722 gene locus_tag LOCUS_35670 1717 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 2031 1714 gene locus_tag LOCUS_35680 2031 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 2500 2138 gene locus_tag LOCUS_35690 2500 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 3031 2531 gene locus_tag LOCUS_35700 3031 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 >Feature sequence0750 1696 728 gene locus_tag LOCUS_35710 1696 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 1927 2151 gene locus_tag LOCUS_35720 1927 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 3158 2091 gene locus_tag LOCUS_35730 3158 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 >Feature sequence0751 3413 216 gene locus_tag LOCUS_35740 gene uvrA 3413 216 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCB4 protein_id gnl|my_center|LOCUS_35740 3628 3709 gene locus_tag LOCUS_t00900 3628 3709 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0752 254 1984 gene locus_tag LOCUS_35750 254 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125671.1 protein_id gnl|my_center|LOCUS_35750 3611 2016 gene locus_tag LOCUS_35760 3611 2016 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_35760 >Feature sequence0753 1722 703 gene locus_tag LOCUS_35770 1722 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 1897 3045 gene locus_tag LOCUS_35780 1897 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 3682 3095 gene locus_tag LOCUS_35790 3682 3095 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730835.1 protein_id gnl|my_center|LOCUS_35790 >Feature sequence0754 221 574 gene locus_tag LOCUS_35800 221 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 1544 582 gene locus_tag LOCUS_35810 1544 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 1975 1541 gene locus_tag LOCUS_35820 1975 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 3207 2233 gene locus_tag LOCUS_35830 3207 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 <4069 3211 gene locus_tag LOCUS_35840 <4069 3211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392036.1:transcriptional regulator >Feature sequence0755 1853 447 gene locus_tag LOCUS_35850 1853 447 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_35850 2426 2106 gene locus_tag LOCUS_35860 2426 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 2632 3519 gene locus_tag LOCUS_35870 2632 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 >Feature sequence0756 1880 1014 gene locus_tag LOCUS_35880 1880 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 3544 1877 gene locus_tag LOCUS_35890 3544 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 >Feature sequence0757 2457 2041 gene locus_tag LOCUS_35900 2457 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 2682 3098 gene locus_tag LOCUS_35910 2682 3098 CDS product acetoin utilization protein AcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460159.1 protein_id gnl|my_center|LOCUS_35910 3143 3574 gene locus_tag LOCUS_35920 3143 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 <4063 3547 gene locus_tag LOCUS_35930 <4063 3547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227777.1:membrane protein >Feature sequence0758 570 1463 gene locus_tag LOCUS_35940 570 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 1585 2694 gene locus_tag LOCUS_35950 1585 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 >Feature sequence0759 3091 1109 gene locus_tag LOCUS_35960 3091 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 >Feature sequence0760 271 1131 gene locus_tag LOCUS_35970 271 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 2891 1128 gene locus_tag LOCUS_35980 2891 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 3717 2920 gene locus_tag LOCUS_35990 3717 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 >Feature sequence0761 1892 399 gene locus_tag LOCUS_36000 1892 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 2001 3191 gene locus_tag LOCUS_36010 2001 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 >Feature sequence0762 883 152 gene locus_tag LOCUS_36020 883 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 1040 1984 gene locus_tag LOCUS_36030 1040 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 2011 3642 gene locus_tag LOCUS_36040 2011 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 >Feature sequence0763 >Feature sequence0764 891 730 gene locus_tag LOCUS_36050 891 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 2076 1147 gene locus_tag LOCUS_36060 2076 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 2182 2880 gene locus_tag LOCUS_36070 2182 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 3172 2897 gene locus_tag LOCUS_36080 3172 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 >Feature sequence0765 1456 122 gene locus_tag LOCUS_36090 1456 122 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895383.1 protein_id gnl|my_center|LOCUS_36090 2225 1449 gene locus_tag LOCUS_36100 2225 1449 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_36100 3038 2229 gene locus_tag LOCUS_36110 3038 2229 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729413.1 protein_id gnl|my_center|LOCUS_36110 3621 3094 gene locus_tag LOCUS_36120 3621 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 >Feature sequence0766 <1 594 gene locus_tag LOCUS_36130 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941337.1:ABC transporter permease 620 1345 gene locus_tag LOCUS_36140 620 1345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_36140 1342 3117 gene locus_tag LOCUS_36150 1342 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 3199 3843 gene locus_tag LOCUS_36160 3199 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 >Feature sequence0767 >Feature sequence0768 706 374 gene locus_tag LOCUS_36170 706 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 2328 730 gene locus_tag LOCUS_36180 gene yhiP 2328 730 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 protein_id gnl|my_center|LOCUS_36180 2702 3637 gene locus_tag LOCUS_36190 2702 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 >Feature sequence0769 129 380 gene locus_tag LOCUS_36200 129 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 2000 417 gene locus_tag LOCUS_36210 2000 417 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_36210 2773 2048 gene locus_tag LOCUS_36220 2773 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 2919 4022 gene locus_tag LOCUS_36230 2919 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 >Feature sequence0770 3220 23 gene locus_tag LOCUS_36240 3220 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 >Feature sequence0771 1134 679 gene locus_tag LOCUS_36250 1134 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 2859 1267 gene locus_tag LOCUS_36260 2859 1267 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902592.1 protein_id gnl|my_center|LOCUS_36260 3759 2944 gene locus_tag LOCUS_36270 3759 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 >Feature sequence0772 2410 863 gene locus_tag LOCUS_36280 2410 863 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_36280 3906 2488 gene locus_tag LOCUS_36290 3906 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 >Feature sequence0773 951 199 gene locus_tag LOCUS_36300 gene ho1 951 199 CDS product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056220.1 protein_id gnl|my_center|LOCUS_36300 2318 1008 gene locus_tag LOCUS_36310 2318 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 3850 2333 gene locus_tag LOCUS_36320 3850 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 >Feature sequence0774 <1 1195 gene locus_tag LOCUS_36330 <1 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226632.1:non-ribosomal peptide synthetase 1315 1830 gene locus_tag LOCUS_36340 1315 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 1847 3598 gene locus_tag LOCUS_36350 1847 3598 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222804.1 protein_id gnl|my_center|LOCUS_36350 >Feature sequence0775 1465 911 gene locus_tag LOCUS_36360 1465 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 2911 1574 gene locus_tag LOCUS_36370 2911 1574 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730531.1 protein_id gnl|my_center|LOCUS_36370 3558 2965 gene locus_tag LOCUS_36380 3558 2965 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411199.1 protein_id gnl|my_center|LOCUS_36380 3979 3611 gene locus_tag LOCUS_36390 3979 3611 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402898.1 protein_id gnl|my_center|LOCUS_36390 >Feature sequence0776 <1 1085 gene locus_tag LOCUS_36400 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530022.1:sulfotransferase 1691 3448 gene locus_tag LOCUS_36410 1691 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 >Feature sequence0777 2617 725 gene locus_tag LOCUS_36420 2617 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 3476 2715 gene locus_tag LOCUS_36430 3476 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 >Feature sequence0778 <1 1122 gene locus_tag LOCUS_36440 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228055.1:isopentenyl-diphosphate Delta-isomerase 1380 3005 gene locus_tag LOCUS_36450 1380 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 >Feature sequence0779 2787 484 gene locus_tag LOCUS_36460 2787 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 4001 3075 gene locus_tag LOCUS_36470 4001 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 >Feature sequence0780 2565 151 gene locus_tag LOCUS_36480 2565 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 3051 2839 gene locus_tag LOCUS_36490 3051 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 >Feature sequence0781 >Feature sequence0782 2720 1131 gene locus_tag LOCUS_36500 2720 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 <3994 2819 gene locus_tag LOCUS_36510 <3994 2819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 >Feature sequence0783 855 616 gene locus_tag LOCUS_36520 855 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 1859 1491 gene locus_tag LOCUS_36530 1859 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 2939 3241 gene locus_tag LOCUS_36540 2939 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 >Feature sequence0784 1696 98 gene locus_tag LOCUS_36550 1696 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 3552 1696 gene locus_tag LOCUS_36560 3552 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence0785 1792 2190 gene locus_tag LOCUS_36570 gene queF 1792 2190 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG9 protein_id gnl|my_center|LOCUS_36570 >Feature sequence0786 165 422 gene locus_tag LOCUS_36580 165 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 1790 579 gene locus_tag LOCUS_36590 1790 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 2368 3534 gene locus_tag LOCUS_36600 2368 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 >Feature sequence0787 <1 564 gene locus_tag LOCUS_36610 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124128.1:serine/threonine protein kinase 588 953 gene locus_tag LOCUS_36620 588 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 2418 1033 gene locus_tag LOCUS_36630 2418 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 3835 2591 gene locus_tag LOCUS_36640 3835 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 >Feature sequence0788 902 1354 gene locus_tag LOCUS_36650 902 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 1470 2411 gene locus_tag LOCUS_36660 1470 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 >Feature sequence0789 689 2170 gene locus_tag LOCUS_36670 689 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 2251 2682 gene locus_tag LOCUS_36680 2251 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 2679 3860 gene locus_tag LOCUS_36690 2679 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 >Feature sequence0790 518 1117 gene locus_tag LOCUS_36700 518 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 1312 2130 gene locus_tag LOCUS_36710 1312 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 2745 2167 gene locus_tag LOCUS_36720 2745 2167 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918364.1 protein_id gnl|my_center|LOCUS_36720 >Feature sequence0791 886 107 gene locus_tag LOCUS_36730 886 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 2068 1067 gene locus_tag LOCUS_36740 2068 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 2351 2058 gene locus_tag LOCUS_36750 2351 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 3364 2351 gene locus_tag LOCUS_36760 3364 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 3684 3391 gene locus_tag LOCUS_36770 3684 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 >Feature sequence0792 905 3331 gene locus_tag LOCUS_36780 905 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36780 >Feature sequence0793 512 1513 gene locus_tag LOCUS_36790 512 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 2485 1535 gene locus_tag LOCUS_36800 2485 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 3552 2752 gene locus_tag LOCUS_36810 3552 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 >Feature sequence0794 384 599 gene locus_tag LOCUS_36820 384 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 596 1426 gene locus_tag LOCUS_36830 596 1426 CDS product carbonyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223827.1 protein_id gnl|my_center|LOCUS_36830 1794 2924 gene locus_tag LOCUS_36840 gene murG 1794 2924 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D6 protein_id gnl|my_center|LOCUS_36840 3105 3479 gene locus_tag LOCUS_36850 3105 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 3514 3858 gene locus_tag LOCUS_36860 3514 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 >Feature sequence0795 1630 2577 gene locus_tag LOCUS_36870 1630 2577 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256857.1 protein_id gnl|my_center|LOCUS_36870 >Feature sequence0796 2896 950 gene locus_tag LOCUS_36880 2896 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 >Feature sequence0797 <1 1553 gene locus_tag LOCUS_36890 <1 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000200580.1:hemolysin 1578 1940 gene locus_tag LOCUS_36900 1578 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 2850 1978 gene locus_tag LOCUS_36910 2850 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 >Feature sequence0798 161 475 gene locus_tag LOCUS_36920 161 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 2397 460 gene locus_tag LOCUS_36930 2397 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 3719 2607 gene locus_tag LOCUS_36940 3719 2607 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827078.1 protein_id gnl|my_center|LOCUS_36940 >Feature sequence0799 2258 1215 gene locus_tag LOCUS_36950 2258 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 2305 2604 gene locus_tag LOCUS_36960 2305 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 3467 2691 gene locus_tag LOCUS_36970 3467 2691 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_36970 >Feature sequence0800 1698 139 gene locus_tag LOCUS_36980 1698 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 2008 3147 gene locus_tag LOCUS_36990 2008 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 >Feature sequence0801 321 2003 gene locus_tag LOCUS_37000 321 2003 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_37000 2007 2999 gene locus_tag LOCUS_37010 2007 2999 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_37010 3521 3036 gene locus_tag LOCUS_37020 3521 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 >Feature sequence0802 >Feature sequence0803 385 3111 gene locus_tag LOCUS_37030 385 3111 CDS product xanthine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703657.1 protein_id gnl|my_center|LOCUS_37030 >Feature sequence0804 2260 23 gene locus_tag LOCUS_37040 gene pcrA 2260 23 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746V7 protein_id gnl|my_center|LOCUS_37040 <3902 2325 gene locus_tag LOCUS_37050 <3902 2325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92WJ7:histidine kinase >Feature sequence0805 195 494 gene locus_tag LOCUS_37060 195 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 726 1661 gene locus_tag LOCUS_37070 726 1661 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882799.1 protein_id gnl|my_center|LOCUS_37070 2994 1726 gene locus_tag LOCUS_37080 2994 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 <3900 2991 gene locus_tag LOCUS_37090 <3900 2991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140780.1:lysophospholipase >Feature sequence0806 1821 958 gene locus_tag LOCUS_37100 1821 958 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_37100 2119 2883 gene locus_tag LOCUS_37110 2119 2883 CDS product peptidase C56 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183301.1 protein_id gnl|my_center|LOCUS_37110 >Feature sequence0807 >Feature sequence0808 2181 1549 gene locus_tag LOCUS_37120 2181 1549 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061663.1 protein_id gnl|my_center|LOCUS_37120 2982 2284 gene locus_tag LOCUS_37130 2982 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 >Feature sequence0809 2167 1085 gene locus_tag LOCUS_37140 2167 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37140 2916 2374 gene locus_tag LOCUS_37150 2916 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 >Feature sequence0810 1211 696 gene locus_tag LOCUS_37160 1211 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 2080 1211 gene locus_tag LOCUS_37170 2080 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 2835 2110 gene locus_tag LOCUS_37180 2835 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 3865 3392 gene locus_tag LOCUS_37190 3865 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 >Feature sequence0811 1388 2416 gene locus_tag LOCUS_37200 1388 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 >Feature sequence0812 64 441 gene locus_tag LOCUS_37210 64 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 890 2101 gene locus_tag LOCUS_37220 gene kamA 890 2101 CDS product L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX4 protein_id gnl|my_center|LOCUS_37220 2177 2962 gene locus_tag LOCUS_37230 2177 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 >Feature sequence0813 880 605 gene locus_tag LOCUS_37240 880 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 864 1589 gene locus_tag LOCUS_37250 864 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 1655 2224 gene locus_tag LOCUS_37260 1655 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 2458 2913 gene locus_tag LOCUS_37270 2458 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 >Feature sequence0814 1487 207 gene locus_tag LOCUS_37280 gene pepP 1487 207 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945838.1 protein_id gnl|my_center|LOCUS_37280 >Feature sequence0815 948 781 gene locus_tag LOCUS_37290 948 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 1826 1020 gene locus_tag LOCUS_37300 1826 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 2004 3728 gene locus_tag LOCUS_37310 2004 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120253.1 protein_id gnl|my_center|LOCUS_37310 >Feature sequence0816 973 338 gene locus_tag LOCUS_37320 973 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 2101 1037 gene locus_tag LOCUS_37330 2101 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 >Feature sequence0817 >Feature sequence0818 1588 1361 gene locus_tag LOCUS_37340 1588 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 >Feature sequence0819 294 524 gene locus_tag LOCUS_37350 294 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 1526 2650 gene locus_tag LOCUS_37360 1526 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 3184 2765 gene locus_tag LOCUS_37370 3184 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 >Feature sequence0820 1067 531 gene locus_tag LOCUS_37380 1067 531 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947340.1 protein_id gnl|my_center|LOCUS_37380 1066 1620 gene locus_tag LOCUS_37390 1066 1620 CDS product topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965776.1 protein_id gnl|my_center|LOCUS_37390 2308 1637 gene locus_tag LOCUS_37400 2308 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 >Feature sequence0821 2206 998 gene locus_tag LOCUS_37410 2206 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 2423 3358 gene locus_tag LOCUS_37420 2423 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 >Feature sequence0822 646 2310 gene locus_tag LOCUS_37430 646 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 2314 3792 gene locus_tag LOCUS_37440 2314 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_37440 >Feature sequence0823 994 1464 gene locus_tag LOCUS_37450 994 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 2557 1892 gene locus_tag LOCUS_37460 gene gstA 2557 1892 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 protein_id gnl|my_center|LOCUS_37460 3680 2598 gene locus_tag LOCUS_37470 3680 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 >Feature sequence0824 >Feature sequence0825 1353 184 gene locus_tag LOCUS_37480 1353 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 1510 2715 gene locus_tag LOCUS_37490 1510 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 2952 3131 gene locus_tag LOCUS_37500 2952 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 3169 3600 gene locus_tag LOCUS_37510 3169 3600 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_37510 >Feature sequence0826 <1 1245 gene locus_tag LOCUS_37520 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000200580.1:hemolysin 3298 1316 gene locus_tag LOCUS_37530 3298 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 >Feature sequence0827 361 1464 gene locus_tag LOCUS_37540 361 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 2353 1478 gene locus_tag LOCUS_37550 2353 1478 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027437.1 protein_id gnl|my_center|LOCUS_37550 3321 2500 gene locus_tag LOCUS_37560 gene dltE 3321 2500 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123022.1 protein_id gnl|my_center|LOCUS_37560 >Feature sequence0828 1261 416 gene locus_tag LOCUS_37570 1261 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 2984 1326 gene locus_tag LOCUS_37580 2984 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 >Feature sequence0829 2462 714 gene locus_tag LOCUS_37590 2462 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 3271 2708 gene locus_tag LOCUS_37600 3271 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 3848 3447 gene locus_tag LOCUS_37610 3848 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 >Feature sequence0830 2302 1085 gene locus_tag LOCUS_37620 2302 1085 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408362.1 protein_id gnl|my_center|LOCUS_37620 3086 2379 gene locus_tag LOCUS_37630 3086 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 >Feature sequence0831 108 1163 gene locus_tag LOCUS_37640 108 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 1258 1752 gene locus_tag LOCUS_37650 1258 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 1739 2746 gene locus_tag LOCUS_37660 1739 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_37660 2743 3096 gene locus_tag LOCUS_37670 2743 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 >Feature sequence0832 551 18 gene locus_tag LOCUS_37680 551 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 991 1884 gene locus_tag LOCUS_37690 991 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 2028 3122 gene locus_tag LOCUS_37700 gene mnmA 2028 3122 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A22 protein_id gnl|my_center|LOCUS_37700 >Feature sequence0833 975 334 gene locus_tag LOCUS_37710 975 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 1105 1869 gene locus_tag LOCUS_37720 1105 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 2078 2890 gene locus_tag LOCUS_37730 2078 2890 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_37730 >Feature sequence0834 2321 888 gene locus_tag LOCUS_37740 2321 888 CDS product lignostilbene alpha-beta-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055870.1 protein_id gnl|my_center|LOCUS_37740 2928 2341 gene locus_tag LOCUS_37750 2928 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886754.1 protein_id gnl|my_center|LOCUS_37750 3134 3745 gene locus_tag LOCUS_37760 3134 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 >Feature sequence0835 2158 1001 gene locus_tag LOCUS_37770 2158 1001 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028858.1 protein_id gnl|my_center|LOCUS_37770 3349 2954 gene locus_tag LOCUS_37780 3349 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 3491 3769 gene locus_tag LOCUS_37790 3491 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 >Feature sequence0836 1685 57 gene locus_tag LOCUS_37800 1685 57 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902419.1 protein_id gnl|my_center|LOCUS_37800 3783 1759 gene locus_tag LOCUS_37810 3783 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 >Feature sequence0837 1204 1869 gene locus_tag LOCUS_37820 1204 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 2024 3088 gene locus_tag LOCUS_37830 2024 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 >Feature sequence0838 <1 718 gene locus_tag LOCUS_37840 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225960.1:phospholipase 715 2589 gene locus_tag LOCUS_37850 715 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 2621 3094 gene locus_tag LOCUS_37860 2621 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 >Feature sequence0839 2597 942 gene locus_tag LOCUS_37870 2597 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898877.1 protein_id gnl|my_center|LOCUS_37870 3354 2644 gene locus_tag LOCUS_37880 3354 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_37880 >Feature sequence0840 <1 661 gene locus_tag LOCUS_37890 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259627.1:hybrid sensor histidine kinase/response regulator 689 2179 gene locus_tag LOCUS_37900 gene atoS 689 2179 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHA1 protein_id gnl|my_center|LOCUS_37900 2251 3267 gene locus_tag LOCUS_37910 2251 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 >Feature sequence0841 <1 1960 gene locus_tag LOCUS_37920 <1 1960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F6C0:glycine--tRNA ligase 3010 2012 gene locus_tag LOCUS_37930 gene hemF 3010 2012 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1S1 protein_id gnl|my_center|LOCUS_37930 3009 3581 gene locus_tag LOCUS_37940 3009 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 >Feature sequence0842 <3805 44 gene locus_tag LOCUS_37950 <3805 44 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255965.1:protein kinase >Feature sequence0843 302 844 gene locus_tag LOCUS_37960 302 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 1083 2417 gene locus_tag LOCUS_37970 1083 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 2480 3619 gene locus_tag LOCUS_37980 2480 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 >Feature sequence0844 1264 290 gene locus_tag LOCUS_37990 1264 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 >Feature sequence0845 <1 750 gene locus_tag LOCUS_38000 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404618.1:methyltransferase 1263 2597 gene locus_tag LOCUS_38010 1263 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 2698 3069 gene locus_tag LOCUS_38020 2698 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 3737 3093 gene locus_tag LOCUS_38030 3737 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 >Feature sequence0846 1630 416 gene locus_tag LOCUS_38040 1630 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 3376 1670 gene locus_tag LOCUS_38050 3376 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 >Feature sequence0847 1590 157 gene locus_tag LOCUS_38060 gene hflX 1590 157 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0N6 protein_id gnl|my_center|LOCUS_38060 2831 1869 gene locus_tag LOCUS_38070 2831 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 3206 2946 gene locus_tag LOCUS_38080 3206 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 3205 3729 gene locus_tag LOCUS_38090 3205 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 >Feature sequence0848 1633 200 gene locus_tag LOCUS_38100 1633 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 3290 1740 gene locus_tag LOCUS_38110 gene proS 3290 1740 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9Q2 protein_id gnl|my_center|LOCUS_38110 >Feature sequence0849 2960 2876 gene locus_tag LOCUS_t00910 2960 2876 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0850 1766 3154 gene locus_tag LOCUS_38120 1766 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 >Feature sequence0851 <1 2766 gene locus_tag LOCUS_38130 <1 2766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence0852 1516 2517 gene locus_tag LOCUS_38140 1516 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 2720 2529 gene locus_tag LOCUS_38150 2720 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 >Feature sequence0853 833 147 gene locus_tag LOCUS_38160 833 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 2508 946 gene locus_tag LOCUS_38170 2508 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 2654 3709 gene locus_tag LOCUS_38180 2654 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 >Feature sequence0854 581 1396 gene locus_tag LOCUS_38190 581 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 1465 2796 gene locus_tag LOCUS_38200 1465 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 >Feature sequence0855 1355 3202 gene locus_tag LOCUS_38210 1355 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 >Feature sequence0856 1387 374 gene locus_tag LOCUS_38220 1387 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 1862 1482 gene locus_tag LOCUS_38230 gene dksA 1862 1482 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZF2 protein_id gnl|my_center|LOCUS_38230 2594 1875 gene locus_tag LOCUS_38240 2594 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 >Feature sequence0857 2 1831 gene locus_tag LOCUS_38250 2 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 1906 2100 gene locus_tag LOCUS_38260 1906 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 >Feature sequence0858 1835 3 gene locus_tag LOCUS_38270 1835 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 2136 2717 gene locus_tag LOCUS_38280 2136 2717 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 protein_id gnl|my_center|LOCUS_38280 2787 3365 gene locus_tag LOCUS_38290 2787 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 >Feature sequence0859 698 1525 gene locus_tag LOCUS_38300 698 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 1567 1794 gene locus_tag LOCUS_38310 1567 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 1794 3530 gene locus_tag LOCUS_38320 1794 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 >Feature sequence0860 241 1137 gene locus_tag LOCUS_38330 241 1137 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089189.1 protein_id gnl|my_center|LOCUS_38330 1224 2435 gene locus_tag LOCUS_38340 1224 2435 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031183.1 protein_id gnl|my_center|LOCUS_38340 >Feature sequence0861 1857 667 gene locus_tag LOCUS_38350 1857 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 2034 2792 gene locus_tag LOCUS_38360 2034 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 >Feature sequence0862 1838 171 gene locus_tag LOCUS_38370 1838 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 <3742 1999 gene locus_tag LOCUS_38380 <3742 1999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369856.1:MFS transporter >Feature sequence0863 1718 1209 gene locus_tag LOCUS_38390 1718 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 >Feature sequence0864 2015 1713 gene locus_tag LOCUS_38400 2015 1713 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_38400 2146 3048 gene locus_tag LOCUS_38410 gene atuB 2146 3048 CDS product citronellol catabolism dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_38410 >Feature sequence0865 65 853 gene locus_tag LOCUS_38420 65 853 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_38420 1145 2065 gene locus_tag LOCUS_38430 1145 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 2175 2828 gene locus_tag LOCUS_38440 2175 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 >Feature sequence0866 376 1104 gene locus_tag LOCUS_38450 376 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 1593 2543 gene locus_tag LOCUS_38460 gene mdh 1593 2543 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SU7 protein_id gnl|my_center|LOCUS_38460 >Feature sequence0867 263 1453 gene locus_tag LOCUS_38470 263 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 1607 2482 gene locus_tag LOCUS_38480 1607 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 >Feature sequence0868 490 2241 gene locus_tag LOCUS_38490 490 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 2332 3114 gene locus_tag LOCUS_38500 2332 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 >Feature sequence0869 <1 2117 gene locus_tag LOCUS_38510 <1 2117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114236.1:GGDEF domain-containing protein 2851 2138 gene locus_tag LOCUS_38520 2851 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 >Feature sequence0870 >Feature sequence0871 1158 2855 gene locus_tag LOCUS_38530 1158 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 3591 2863 gene locus_tag LOCUS_38540 3591 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 >Feature sequence0872 1007 396 gene locus_tag LOCUS_38550 1007 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 2030 1134 gene locus_tag LOCUS_38560 2030 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 3315 2194 gene locus_tag LOCUS_38570 3315 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 >Feature sequence0873 416 1489 gene locus_tag LOCUS_38580 416 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_38580 1570 2448 gene locus_tag LOCUS_38590 1570 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704432.1 protein_id gnl|my_center|LOCUS_38590 <3714 2440 gene locus_tag LOCUS_38600 <3714 2440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RZ58:peptidylprolyl isomerase >Feature sequence0874 1522 389 gene locus_tag LOCUS_38610 1522 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 2026 1601 gene locus_tag LOCUS_38620 2026 1601 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 protein_id gnl|my_center|LOCUS_38620 3009 2221 gene locus_tag LOCUS_38630 gene pspA 3009 2221 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_38630 3470 3012 gene locus_tag LOCUS_38640 3470 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 >Feature sequence0875 720 274 gene locus_tag LOCUS_38650 720 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 1514 717 gene locus_tag LOCUS_38660 1514 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 2425 1511 gene locus_tag LOCUS_38670 2425 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_38670 2698 3507 gene locus_tag LOCUS_38680 2698 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 >Feature sequence0876 1635 1222 gene locus_tag LOCUS_38690 1635 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 <3708 1744 gene locus_tag LOCUS_38700 <3708 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000250020.1:DNA polymerase I >Feature sequence0877 376 1053 gene locus_tag LOCUS_38710 376 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 1830 1084 gene locus_tag LOCUS_38720 1830 1084 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920018.1 protein_id gnl|my_center|LOCUS_38720 2034 3452 gene locus_tag LOCUS_38730 2034 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 >Feature sequence0878 842 2308 gene locus_tag LOCUS_38740 842 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 2316 3020 gene locus_tag LOCUS_38750 2316 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 >Feature sequence0879 1268 630 gene locus_tag LOCUS_38760 1268 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 >Feature sequence0880 1849 524 gene locus_tag LOCUS_38770 1849 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 2475 1993 gene locus_tag LOCUS_38780 2475 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 >Feature sequence0881 912 40 gene locus_tag LOCUS_38790 912 40 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_38790 1805 978 gene locus_tag LOCUS_38800 1805 978 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339567.1 protein_id gnl|my_center|LOCUS_38800 1879 2496 gene locus_tag LOCUS_38810 1879 2496 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704693.1 protein_id gnl|my_center|LOCUS_38810 2517 3548 gene locus_tag LOCUS_38820 2517 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 >Feature sequence0882 3 1598 gene locus_tag LOCUS_38830 3 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 <3698 1579 gene locus_tag LOCUS_38840 <3698 1579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120179.1:aminopeptidase >Feature sequence0883 326 1030 gene locus_tag LOCUS_38850 326 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 1246 1043 gene locus_tag LOCUS_38860 1246 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 2334 1474 gene locus_tag LOCUS_38870 2334 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 >Feature sequence0884 339 803 gene locus_tag LOCUS_38880 339 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 1138 815 gene locus_tag LOCUS_38890 1138 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 2329 1265 gene locus_tag LOCUS_38900 2329 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 2488 3360 gene locus_tag LOCUS_38910 2488 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 >Feature sequence0885 1661 2803 gene locus_tag LOCUS_38920 1661 2803 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249503.1 protein_id gnl|my_center|LOCUS_38920 3055 3546 gene locus_tag LOCUS_38930 3055 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 >Feature sequence0886 1323 679 gene locus_tag LOCUS_38940 1323 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 2051 1422 gene locus_tag LOCUS_38950 2051 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461816.1 protein_id gnl|my_center|LOCUS_38950 3438 2614 gene locus_tag LOCUS_38960 3438 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 >Feature sequence0887 532 1104 gene locus_tag LOCUS_38970 532 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 1712 1101 gene locus_tag LOCUS_38980 1712 1101 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140910.1 protein_id gnl|my_center|LOCUS_38980 3587 1743 gene locus_tag LOCUS_38990 3587 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 >Feature sequence0888 2414 1338 gene locus_tag LOCUS_39000 gene plsX 2414 1338 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y688 protein_id gnl|my_center|LOCUS_39000 <3683 2612 gene locus_tag LOCUS_39010 <3683 2612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730228.1:adenylyl-sulfate kinase >Feature sequence0889 25 2511 gene locus_tag LOCUS_39020 25 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 >Feature sequence0890 877 2859 gene locus_tag LOCUS_39030 877 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 >Feature sequence0891 1008 658 gene locus_tag LOCUS_39040 1008 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 1494 2498 gene locus_tag LOCUS_39050 1494 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39050 3444 2545 gene locus_tag LOCUS_39060 3444 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 >Feature sequence0892 2865 1174 gene locus_tag LOCUS_39070 2865 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 <3674 2958 gene locus_tag LOCUS_39080 <3674 2958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119335.1:RNA-binding protein >Feature sequence0893 705 1391 gene locus_tag LOCUS_39090 705 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 2360 1536 gene locus_tag LOCUS_39100 2360 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 2733 3272 gene locus_tag LOCUS_39110 2733 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 >Feature sequence0894 1353 214 gene locus_tag LOCUS_39120 gene thlA 1353 214 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_39120 1808 1882 gene locus_tag LOCUS_t00920 1808 1882 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2605 1937 gene locus_tag LOCUS_39130 2605 1937 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537552.1 protein_id gnl|my_center|LOCUS_39130 3504 2602 gene locus_tag LOCUS_39140 3504 2602 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461890.1 protein_id gnl|my_center|LOCUS_39140 >Feature sequence0895 1219 2157 gene locus_tag LOCUS_39150 1219 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 >Feature sequence0896 <1 2337 gene locus_tag LOCUS_39160 <1 2337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037292.1:transporter 2428 2949 gene locus_tag LOCUS_39170 2428 2949 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941706.1 protein_id gnl|my_center|LOCUS_39170 3313 3032 gene locus_tag LOCUS_39180 3313 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 >Feature sequence0897 <1 708 gene locus_tag LOCUS_39190 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942248.1:beta-ketoacyl-ACP reductase 757 1014 gene locus_tag LOCUS_39200 gene acpP 757 1014 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67611 protein_id gnl|my_center|LOCUS_39200 1135 2379 gene locus_tag LOCUS_39210 gene fabF-2 1135 2379 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CR7 protein_id gnl|my_center|LOCUS_39210 1682 1589 gene locus_tag LOCUS_t00930 1682 1589 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2442 2918 gene locus_tag LOCUS_39220 2442 2918 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938871.1 protein_id gnl|my_center|LOCUS_39220 2935 3612 gene locus_tag LOCUS_39230 2935 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 >Feature sequence0898 714 1331 gene locus_tag LOCUS_39240 714 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 1726 2910 gene locus_tag LOCUS_39250 1726 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 >Feature sequence0899 2367 61 gene locus_tag LOCUS_39260 2367 61 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902160.1 protein_id gnl|my_center|LOCUS_39260 2843 2400 gene locus_tag LOCUS_39270 2843 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 >Feature sequence0900 302 114 gene locus_tag LOCUS_39280 302 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 993 349 gene locus_tag LOCUS_39290 993 349 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976592.1 protein_id gnl|my_center|LOCUS_39290 1068 1892 gene locus_tag LOCUS_39300 1068 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_39300 >Feature sequence0901 <1 1108 gene locus_tag LOCUS_39310 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103875.1:cyclic peptide transporter 1804 1097 gene locus_tag LOCUS_39320 1804 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 2638 1817 gene locus_tag LOCUS_39330 2638 1817 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083759.1 protein_id gnl|my_center|LOCUS_39330 3117 2647 gene locus_tag LOCUS_39340 3117 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 >Feature sequence0902 645 1190 gene locus_tag LOCUS_39350 645 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 1198 3285 gene locus_tag LOCUS_39360 1198 3285 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015537.1 protein_id gnl|my_center|LOCUS_39360 >Feature sequence0903 2439 1285 gene locus_tag LOCUS_39370 2439 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 3395 2490 gene locus_tag LOCUS_39380 3395 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 >Feature sequence0904 108 1790 gene locus_tag LOCUS_39390 108 1790 CDS product FAD-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_39390 >Feature sequence0905 571 365 gene locus_tag LOCUS_39400 571 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 500 3235 gene locus_tag LOCUS_39410 500 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 >Feature sequence0906 1126 2835 gene locus_tag LOCUS_39420 1126 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 3533 2904 gene locus_tag LOCUS_39430 3533 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 >Feature sequence0907 788 57 gene locus_tag LOCUS_39440 788 57 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532593.1 protein_id gnl|my_center|LOCUS_39440 1852 932 gene locus_tag LOCUS_39450 1852 932 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705820.1 protein_id gnl|my_center|LOCUS_39450 2160 2504 gene locus_tag LOCUS_39460 2160 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 >Feature sequence0908 530 700 gene locus_tag LOCUS_39470 530 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 1162 2409 gene locus_tag LOCUS_39480 gene ftsW 1162 2409 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D5 protein_id gnl|my_center|LOCUS_39480 2827 2426 gene locus_tag LOCUS_39490 2827 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 3490 2990 gene locus_tag LOCUS_39500 3490 2990 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528765.1 protein_id gnl|my_center|LOCUS_39500 >Feature sequence0909 773 1489 gene locus_tag LOCUS_39510 773 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 1665 2030 gene locus_tag LOCUS_39520 1665 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 >Feature sequence0910 <1 801 gene locus_tag LOCUS_39530 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6MU81:elongation factor Tu 1011 1793 gene locus_tag LOCUS_39540 1011 1793 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_39540 1915 2484 gene locus_tag LOCUS_39550 1915 2484 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918397.1 protein_id gnl|my_center|LOCUS_39550 2601 2915 gene locus_tag LOCUS_39560 2601 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 >Feature sequence0911 2843 1506 gene locus_tag LOCUS_39570 2843 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 >Feature sequence0912 1843 2853 gene locus_tag LOCUS_39580 1843 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 3423 3034 gene locus_tag LOCUS_39590 3423 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 >Feature sequence0913 368 1732 gene locus_tag LOCUS_39600 368 1732 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257816.1 protein_id gnl|my_center|LOCUS_39600 1815 2636 gene locus_tag LOCUS_39610 1815 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 >Feature sequence0914 491 45 gene locus_tag LOCUS_39620 491 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 1509 568 gene locus_tag LOCUS_39630 1509 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 1578 1838 gene locus_tag LOCUS_39640 1578 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 2751 1873 gene locus_tag LOCUS_39650 2751 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 >Feature sequence0915 2633 513 gene locus_tag LOCUS_39660 2633 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 >Feature sequence0916 728 1438 gene locus_tag LOCUS_39670 728 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 1660 1493 gene locus_tag LOCUS_39680 1660 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 >Feature sequence0917 3071 1140 gene locus_tag LOCUS_39690 3071 1140 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_39690 >Feature sequence0918 1808 366 gene locus_tag LOCUS_39700 gene gapB 1808 366 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN1 protein_id gnl|my_center|LOCUS_39700 3021 1927 gene locus_tag LOCUS_39710 3021 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 >Feature sequence0919 836 1462 gene locus_tag LOCUS_39720 836 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 2093 1503 gene locus_tag LOCUS_39730 2093 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_39730 3391 2129 gene locus_tag LOCUS_39740 3391 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 >Feature sequence0920 1367 543 gene locus_tag LOCUS_39750 1367 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 2579 1728 gene locus_tag LOCUS_39760 2579 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 <3584 2952 gene locus_tag LOCUS_39770 <3584 2952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNH1:DNA polymerase IV >Feature sequence0921 534 241 gene locus_tag LOCUS_39780 534 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 1382 564 gene locus_tag LOCUS_39790 1382 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 1433 1780 gene locus_tag LOCUS_39800 1433 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 1797 2522 gene locus_tag LOCUS_39810 1797 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 >Feature sequence0922 958 1587 gene locus_tag LOCUS_39820 958 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 1831 3393 gene locus_tag LOCUS_39830 1831 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 >Feature sequence0923 <1 938 gene locus_tag LOCUS_39840 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001066967.1:membrane protein 2480 1386 gene locus_tag LOCUS_39850 2480 1386 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_39850 >Feature sequence0924 <1 1427 gene locus_tag LOCUS_39860 <1 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038655.1:oxidoreductase 3336 1477 gene locus_tag LOCUS_39870 3336 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 >Feature sequence0925 212 1273 gene locus_tag LOCUS_39880 212 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 1761 1270 gene locus_tag LOCUS_39890 1761 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 1901 2401 gene locus_tag LOCUS_39900 1901 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 >Feature sequence0926 1700 390 gene locus_tag LOCUS_39910 gene tyrS 1700 390 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAG0 protein_id gnl|my_center|LOCUS_39910 2778 1765 gene locus_tag LOCUS_39920 2778 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 3227 2844 gene locus_tag LOCUS_39930 3227 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 >Feature sequence0927 <1 1193 gene locus_tag LOCUS_39940 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H90:DNA replication and repair protein RecF >Feature sequence0928 809 3469 gene locus_tag LOCUS_39950 gene clpB 809 3469 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF1 protein_id gnl|my_center|LOCUS_39950 >Feature sequence0929 195 770 gene locus_tag LOCUS_39960 195 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 1446 757 gene locus_tag LOCUS_39970 1446 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 1331 1543 gene locus_tag LOCUS_39980 1331 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 2422 1667 gene locus_tag LOCUS_39990 2422 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 >Feature sequence0930 1216 2805 gene locus_tag LOCUS_40000 1216 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 >Feature sequence0931 1839 124 gene locus_tag LOCUS_40010 1839 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 <3567 2330 gene locus_tag LOCUS_40020 <3567 2330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RG43:adenylosuccinate synthetase >Feature sequence0932 1207 368 gene locus_tag LOCUS_40030 1207 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 1380 1204 gene locus_tag LOCUS_40040 1380 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 2420 1389 gene locus_tag LOCUS_40050 2420 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 3148 2444 gene locus_tag LOCUS_40060 3148 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 >Feature sequence0933 317 562 gene locus_tag LOCUS_40070 317 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 2291 585 gene locus_tag LOCUS_40080 gene phoD 2291 585 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_40080 <3566 2374 gene locus_tag LOCUS_40090 <3566 2374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083755917.1:kinesin >Feature sequence0934 1148 2803 gene locus_tag LOCUS_40100 1148 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 >Feature sequence0935 248 63 gene locus_tag LOCUS_40110 248 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 214 492 gene locus_tag LOCUS_40120 214 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 903 499 gene locus_tag LOCUS_40130 903 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 1083 1922 gene locus_tag LOCUS_40140 gene rbn 1083 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226530.1 protein_id gnl|my_center|LOCUS_40140 1941 2180 gene locus_tag LOCUS_40150 1941 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 2917 2177 gene locus_tag LOCUS_40160 2917 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112385.1 protein_id gnl|my_center|LOCUS_40160 >Feature sequence0936 23 1969 gene locus_tag LOCUS_40170 23 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 2307 3074 gene locus_tag LOCUS_40180 2307 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 >Feature sequence0937 458 1201 gene locus_tag LOCUS_40190 458 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 1337 2434 gene locus_tag LOCUS_40200 gene ychF 1337 2434 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE5 protein_id gnl|my_center|LOCUS_40200 2501 3310 gene locus_tag LOCUS_40210 2501 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 >Feature sequence0938 1220 327 gene locus_tag LOCUS_40220 1220 327 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_40220 1569 1937 gene locus_tag LOCUS_40230 1569 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 2874 1990 gene locus_tag LOCUS_40240 2874 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 <3551 2861 gene locus_tag LOCUS_40250 <3551 2861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729742.1:diacylglycerol kinase >Feature sequence0939 1861 380 gene locus_tag LOCUS_40260 gene abfD 1861 380 CDS product 4-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_40260 1909 2793 gene locus_tag LOCUS_40270 gene tesB 1909 2793 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706717.1 protein_id gnl|my_center|LOCUS_40270 2815 3144 gene locus_tag LOCUS_40280 2815 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 3550 3155 gene locus_tag LOCUS_40290 3550 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 >Feature sequence0940 1431 2603 gene locus_tag LOCUS_40300 1431 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 >Feature sequence0941 1593 2150 gene locus_tag LOCUS_40310 1593 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 3214 2159 gene locus_tag LOCUS_40320 3214 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 >Feature sequence0942 1464 700 gene locus_tag LOCUS_40330 1464 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 1760 3037 gene locus_tag LOCUS_40340 1760 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 >Feature sequence0943 1901 147 gene locus_tag LOCUS_40350 1901 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 2352 1981 gene locus_tag LOCUS_40360 2352 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 >Feature sequence0944 1248 265 gene locus_tag LOCUS_40370 1248 265 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_40370 2143 1262 gene locus_tag LOCUS_40380 2143 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 >Feature sequence0945 234 1163 gene locus_tag LOCUS_40390 234 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 1151 1675 gene locus_tag LOCUS_40400 1151 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 1746 2507 gene locus_tag LOCUS_40410 1746 2507 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657484.1 protein_id gnl|my_center|LOCUS_40410 2577 3227 gene locus_tag LOCUS_40420 2577 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 >Feature sequence0946 <1 651 gene locus_tag LOCUS_40430 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391431.1:sulfotransferase 1645 725 gene locus_tag LOCUS_40440 1645 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 1829 2548 gene locus_tag LOCUS_40450 1829 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 3509 2571 gene locus_tag LOCUS_40460 3509 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 >Feature sequence0947 1489 878 gene locus_tag LOCUS_40470 1489 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 1831 2553 gene locus_tag LOCUS_40480 1831 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 <3522 2758 gene locus_tag LOCUS_40490 <3522 2758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337311.1:MATE family efflux transporter >Feature sequence0948 1803 2024 gene locus_tag LOCUS_40500 1803 2024 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932528.1 protein_id gnl|my_center|LOCUS_40500 2087 2695 gene locus_tag LOCUS_40510 2087 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256136.1 protein_id gnl|my_center|LOCUS_40510 2695 3096 gene locus_tag LOCUS_40520 2695 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 >Feature sequence0949 1977 619 gene locus_tag LOCUS_40530 1977 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 3264 2107 gene locus_tag LOCUS_40540 3264 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 >Feature sequence0950 631 1266 gene locus_tag LOCUS_40550 631 1266 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LC4 protein_id gnl|my_center|LOCUS_40550 1297 2046 gene locus_tag LOCUS_40560 gene yggS 1297 2046 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_40560 >Feature sequence0951 702 1208 gene locus_tag LOCUS_40570 702 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 <3510 1256 gene locus_tag LOCUS_40580 <3510 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230653.1:serine/threonine protein kinase >Feature sequence0952 76 645 gene locus_tag LOCUS_40590 76 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 1398 826 gene locus_tag LOCUS_40600 1398 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 2157 1531 gene locus_tag LOCUS_40610 2157 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 >Feature sequence0953 3296 1860 gene locus_tag LOCUS_40620 3296 1860 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123111.1 protein_id gnl|my_center|LOCUS_40620 >Feature sequence0954 512 1603 gene locus_tag LOCUS_40630 512 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 2310 1663 gene locus_tag LOCUS_40640 2310 1663 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532679.1 protein_id gnl|my_center|LOCUS_40640 >Feature sequence0955 272 1516 gene locus_tag LOCUS_40650 gene argD 272 1516 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7L6 protein_id gnl|my_center|LOCUS_40650 1576 2742 gene locus_tag LOCUS_40660 1576 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 2797 3213 gene locus_tag LOCUS_40670 2797 3213 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532092.1 protein_id gnl|my_center|LOCUS_40670 >Feature sequence0956 <3498 2076 gene locus_tag LOCUS_40680 <3498 2076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258038.1:putative baseplate assembly protein >Feature sequence0957 169 828 gene locus_tag LOCUS_40690 169 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 1079 2089 gene locus_tag LOCUS_40700 1079 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 2590 2120 gene locus_tag LOCUS_40710 2590 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 3426 2659 gene locus_tag LOCUS_40720 3426 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 >Feature sequence0958 324 13 gene locus_tag LOCUS_40730 324 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 1879 359 gene locus_tag LOCUS_40740 1879 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 >Feature sequence0959 >Feature sequence0960 280 1704 gene locus_tag LOCUS_40750 280 1704 CDS product benzoyl-CoA oxygenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_40750 >Feature sequence0961 178 408 gene locus_tag LOCUS_40760 178 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 608 1369 gene locus_tag LOCUS_40770 608 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 1435 2715 gene locus_tag LOCUS_40780 1435 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 >Feature sequence0962 127 1356 gene locus_tag LOCUS_40790 127 1356 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074378.1 protein_id gnl|my_center|LOCUS_40790 1578 1964 gene locus_tag LOCUS_40800 1578 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 >Feature sequence0963 562 1497 gene locus_tag LOCUS_40810 562 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 2524 1517 gene locus_tag LOCUS_40820 gene pilD 2524 1517 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ8 protein_id gnl|my_center|LOCUS_40820 >Feature sequence0964 712 452 gene locus_tag LOCUS_40830 712 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 2195 954 gene locus_tag LOCUS_40840 2195 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 <3478 2238 gene locus_tag LOCUS_40850 <3478 2238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140762.1:peptidase >Feature sequence0965 1451 132 gene locus_tag LOCUS_40860 1451 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 2702 1668 gene locus_tag LOCUS_40870 2702 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 2769 3422 gene locus_tag LOCUS_40880 2769 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 >Feature sequence0966 205 1452 gene locus_tag LOCUS_40890 205 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 2384 1449 gene locus_tag LOCUS_40900 2384 1449 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865320.1 protein_id gnl|my_center|LOCUS_40900 >Feature sequence0967 1953 2870 gene locus_tag LOCUS_40910 1953 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 >Feature sequence0968 <1 2048 gene locus_tag LOCUS_40920 <1 2048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258942.1:two-component system response regulator >Feature sequence0969 <1 724 gene locus_tag LOCUS_40930 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932322.1:peptidoglycan-associated lipoprotein 2305 836 gene locus_tag LOCUS_40940 2305 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 3441 2458 gene locus_tag LOCUS_40950 3441 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 >Feature sequence0970 <1 1164 gene locus_tag LOCUS_40960 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000200580.1:hemolysin 2151 1204 gene locus_tag LOCUS_40970 2151 1204 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978446.1 protein_id gnl|my_center|LOCUS_40970 2425 3003 gene locus_tag LOCUS_40980 2425 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 3166 3435 gene locus_tag LOCUS_40990 3166 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 >Feature sequence0971 503 1963 gene locus_tag LOCUS_41000 503 1963 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403679.1 protein_id gnl|my_center|LOCUS_41000 2749 1985 gene locus_tag LOCUS_41010 gene csgA 2749 1985 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974210.1 protein_id gnl|my_center|LOCUS_41010 >Feature sequence0972 831 2012 gene locus_tag LOCUS_41020 gene ltp1 831 2012 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_41020 2395 3102 gene locus_tag LOCUS_41030 2395 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 >Feature sequence0973 >Feature sequence0974 2119 701 gene locus_tag LOCUS_41040 2119 701 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224282.1 protein_id gnl|my_center|LOCUS_41040 3429 2128 gene locus_tag LOCUS_41050 3429 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 >Feature sequence0975 2667 553 gene locus_tag LOCUS_41060 2667 553 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918882.1 protein_id gnl|my_center|LOCUS_41060 2718 3272 gene locus_tag LOCUS_41070 2718 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 >Feature sequence0976 309 2168 gene locus_tag LOCUS_41080 309 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 2201 2848 gene locus_tag LOCUS_41090 2201 2848 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256910.1 protein_id gnl|my_center|LOCUS_41090 >Feature sequence0977 736 212 gene locus_tag LOCUS_41100 736 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 1797 757 gene locus_tag LOCUS_41110 1797 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 2165 2842 gene locus_tag LOCUS_41120 2165 2842 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902207.1 protein_id gnl|my_center|LOCUS_41120 3290 2826 gene locus_tag LOCUS_41130 3290 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 >Feature sequence0978 <1 1038 gene locus_tag LOCUS_41140 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000908473.1:ATP-dependent DNA ligase 1509 1114 gene locus_tag LOCUS_41150 1509 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 1947 2168 gene locus_tag LOCUS_41160 1947 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 >Feature sequence0979 1412 369 gene locus_tag LOCUS_41170 1412 369 CDS product calcium-gated potassium channel mthK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877130.1 protein_id gnl|my_center|LOCUS_41170 1996 1409 gene locus_tag LOCUS_41180 1996 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 >Feature sequence0980 167 1810 gene locus_tag LOCUS_41190 167 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 >Feature sequence0981 2554 3417 gene locus_tag LOCUS_41200 2554 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 >Feature sequence0982 31 987 gene locus_tag LOCUS_41210 31 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 1293 991 gene locus_tag LOCUS_41220 1293 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224860.1 protein_id gnl|my_center|LOCUS_41220 2214 1315 gene locus_tag LOCUS_41230 2214 1315 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB29 protein_id gnl|my_center|LOCUS_41230 2855 2274 gene locus_tag LOCUS_41240 2855 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 >Feature sequence0983 871 1521 gene locus_tag LOCUS_41250 gene rpoE 871 1521 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229943.1 protein_id gnl|my_center|LOCUS_41250 2338 1595 gene locus_tag LOCUS_41260 2338 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 >Feature sequence0984 896 2029 gene locus_tag LOCUS_41270 gene gcvT 896 2029 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54378 protein_id gnl|my_center|LOCUS_41270 2107 2496 gene locus_tag LOCUS_41280 gene gcvH 2107 2496 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q815Y3 protein_id gnl|my_center|LOCUS_41280 >Feature sequence0985 2989 2711 gene locus_tag LOCUS_41290 2989 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 >Feature sequence0986 >Feature sequence0987 437 721 gene locus_tag LOCUS_41300 437 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 1220 1978 gene locus_tag LOCUS_41310 1220 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 2170 3066 gene locus_tag LOCUS_41320 2170 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 >Feature sequence0988 <1 818 gene locus_tag LOCUS_41330 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WC53:nicotinate phosphoribosyltransferase 815 1513 gene locus_tag LOCUS_41340 815 1513 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_41340 1563 2201 gene locus_tag LOCUS_41350 1563 2201 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_41350 >Feature sequence0989 1 522 gene locus_tag LOCUS_41360 1 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 630 1628 gene locus_tag LOCUS_41370 630 1628 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226328.1 protein_id gnl|my_center|LOCUS_41370 1879 2664 gene locus_tag LOCUS_41380 1879 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 <3407 2692 gene locus_tag LOCUS_41390 <3407 2692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P72171:ornithine utilization regulator >Feature sequence0990 1088 1570 gene locus_tag LOCUS_41400 gene gpo 1088 1570 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SZ6 protein_id gnl|my_center|LOCUS_41400 1842 1678 gene locus_tag LOCUS_41410 1842 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 2234 2596 gene locus_tag LOCUS_41420 2234 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 >Feature sequence0991 64 630 gene locus_tag LOCUS_41430 64 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 860 1546 gene locus_tag LOCUS_41440 860 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 1634 2599 gene locus_tag LOCUS_41450 1634 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 >Feature sequence0992 1285 455 gene locus_tag LOCUS_41460 1285 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41460 1911 1384 gene locus_tag LOCUS_41470 1911 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 >Feature sequence0993 230 1687 gene locus_tag LOCUS_41480 230 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 1859 2425 gene locus_tag LOCUS_41490 1859 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 >Feature sequence0994 1603 164 gene locus_tag LOCUS_41500 1603 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 1904 2920 gene locus_tag LOCUS_41510 1904 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 >Feature sequence0995 <1 2129 gene locus_tag LOCUS_41520 <1 2129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970344.1:DUF490 domain-containing protein 2173 2577 gene locus_tag LOCUS_41530 2173 2577 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141461.1 protein_id gnl|my_center|LOCUS_41530 >Feature sequence0996 123 1964 gene locus_tag LOCUS_41540 gene dnaK 123 1964 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_41540 3197 2004 gene locus_tag LOCUS_41550 3197 2004 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_41550 >Feature sequence0997 648 1316 gene locus_tag LOCUS_41560 648 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 1313 2119 gene locus_tag LOCUS_41570 1313 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 >Feature sequence0998 2236 3012 gene locus_tag LOCUS_41580 2236 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092922.1 protein_id gnl|my_center|LOCUS_41580 >Feature sequence0999 1392 124 gene locus_tag LOCUS_41590 1392 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 <3379 1457 gene locus_tag LOCUS_41600 <3379 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888294.1:oligopeptidase A >Feature sequence1000 659 201 gene locus_tag LOCUS_41610 659 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_41610 913 1392 gene locus_tag LOCUS_41620 913 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 1383 2282 gene locus_tag LOCUS_41630 1383 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 2750 2298 gene locus_tag LOCUS_41640 2750 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 >Feature sequence1001 1924 881 gene locus_tag LOCUS_41650 1924 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 3166 1937 gene locus_tag LOCUS_41660 3166 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 >Feature sequence1002 471 1070 gene locus_tag LOCUS_41670 471 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 1583 1080 gene locus_tag LOCUS_41680 1583 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 1678 3075 gene locus_tag LOCUS_41690 1678 3075 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226840.1 protein_id gnl|my_center|LOCUS_41690 >Feature sequence1003 828 424 gene locus_tag LOCUS_41700 828 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 1567 851 gene locus_tag LOCUS_41710 1567 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 2616 1603 gene locus_tag LOCUS_41720 2616 1603 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229553.1 protein_id gnl|my_center|LOCUS_41720 >Feature sequence1004 2026 2676 gene locus_tag LOCUS_41730 2026 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 2682 3161 gene locus_tag LOCUS_41740 2682 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 >Feature sequence1005 804 67 gene locus_tag LOCUS_41750 804 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 1320 1964 gene locus_tag LOCUS_41760 1320 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 2035 2373 gene locus_tag LOCUS_41770 2035 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 2770 2381 gene locus_tag LOCUS_41780 2770 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 2976 3170 gene locus_tag LOCUS_41790 2976 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 >Feature sequence1006 1040 1408 gene locus_tag LOCUS_41800 1040 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 3061 1520 gene locus_tag LOCUS_41810 3061 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 >Feature sequence1007 1203 250 gene locus_tag LOCUS_41820 1203 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 2438 1200 gene locus_tag LOCUS_41830 2438 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 >Feature sequence1008 1436 2884 gene locus_tag LOCUS_41840 1436 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 3227 2865 gene locus_tag LOCUS_41850 3227 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 >Feature sequence1009 1113 1913 gene locus_tag LOCUS_41860 1113 1913 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 protein_id gnl|my_center|LOCUS_41860 2842 1910 gene locus_tag LOCUS_41870 2842 1910 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_41870 >Feature sequence1010 212 1723 gene locus_tag LOCUS_41880 212 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41880 1720 2502 gene locus_tag LOCUS_41890 gene cobB2 1720 2502 CDS product NAD-dependent protein deacylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E1 protein_id gnl|my_center|LOCUS_41890 >Feature sequence1011 <1 1129 gene locus_tag LOCUS_41900 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207983.1:GTP-binding protein 1167 2387 gene locus_tag LOCUS_41910 1167 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_41910 2427 3161 gene locus_tag LOCUS_41920 2427 3161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_41920 >Feature sequence1012 1057 131 gene locus_tag LOCUS_41930 1057 131 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816771.1 protein_id gnl|my_center|LOCUS_41930 1308 2300 gene locus_tag LOCUS_41940 1308 2300 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 protein_id gnl|my_center|LOCUS_41940 2356 2553 gene locus_tag LOCUS_41950 2356 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 >Feature sequence1013 1530 838 gene locus_tag LOCUS_41960 1530 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 >Feature sequence1014 <1 1603 gene locus_tag LOCUS_41970 <1 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VYR2:translation initiation factor IF-2 2231 3163 gene locus_tag LOCUS_41980 2231 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 >Feature sequence1015 2439 1339 gene locus_tag LOCUS_41990 2439 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 >Feature sequence1016 857 303 gene locus_tag LOCUS_42000 857 303 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFZ5 protein_id gnl|my_center|LOCUS_42000 1528 1905 gene locus_tag LOCUS_42010 1528 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 2134 3018 gene locus_tag LOCUS_42020 2134 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 >Feature sequence1017 1721 564 gene locus_tag LOCUS_42030 1721 564 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083801.1 protein_id gnl|my_center|LOCUS_42030 >Feature sequence1018 >Feature sequence1019 1515 409 gene locus_tag LOCUS_42040 1515 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 >Feature sequence1020 1138 401 gene locus_tag LOCUS_42050 1138 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 1585 1157 gene locus_tag LOCUS_42060 1585 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 3003 1582 gene locus_tag LOCUS_42070 3003 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 >Feature sequence1021 2348 2124 gene locus_tag LOCUS_42080 2348 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 >Feature sequence1022 2 1747 gene locus_tag LOCUS_42090 2 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 <3311 1707 gene locus_tag LOCUS_42100 <3311 1707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969398.1:adenylate cyclase >Feature sequence1023 821 54 gene locus_tag LOCUS_42110 821 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 935 1291 gene locus_tag LOCUS_42120 935 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 2606 2301 gene locus_tag LOCUS_42130 2606 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 <3310 2679 gene locus_tag LOCUS_42140 <3310 2679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118692.1:protein kinase >Feature sequence1024 1755 610 gene locus_tag LOCUS_42150 1755 610 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_42150 2604 1807 gene locus_tag LOCUS_42160 2604 1807 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_42160 <3310 2662 gene locus_tag LOCUS_42170 <3310 2662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000538869.1:3-hydroxybutyryl-CoA dehydrogenase >Feature sequence1025 473 1129 gene locus_tag LOCUS_42180 473 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 1192 1596 gene locus_tag LOCUS_42190 1192 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 1829 2299 gene locus_tag LOCUS_42200 1829 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 >Feature sequence1026 <1 1331 gene locus_tag LOCUS_42210 <1 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390858.1:cyclic nucleotide-binding protein 1697 2677 gene locus_tag LOCUS_42220 1697 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 >Feature sequence1027 2159 495 gene locus_tag LOCUS_42230 2159 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 2265 2609 gene locus_tag LOCUS_42240 2265 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42240 >Feature sequence1028 1 543 gene locus_tag LOCUS_42250 1 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 717 1856 gene locus_tag LOCUS_42260 717 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 >Feature sequence1029 1810 416 gene locus_tag LOCUS_42270 1810 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 2171 2860 gene locus_tag LOCUS_42280 2171 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 >Feature sequence1030 1494 289 gene locus_tag LOCUS_42290 1494 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 >Feature sequence1031 494 1555 gene locus_tag LOCUS_42300 494 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 1595 2428 gene locus_tag LOCUS_42310 1595 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 >Feature sequence1032 437 829 gene locus_tag LOCUS_42320 437 829 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691774.1 protein_id gnl|my_center|LOCUS_42320 <3276 1407 gene locus_tag LOCUS_42330 <3276 1407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SHU0:biosynthetic arginine decarboxylase >Feature sequence1033 >Feature sequence1034 800 1804 gene locus_tag LOCUS_42340 800 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 2193 1909 gene locus_tag LOCUS_42350 2193 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 2418 3167 gene locus_tag LOCUS_42360 2418 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 >Feature sequence1035 804 205 gene locus_tag LOCUS_42370 804 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 984 1709 gene locus_tag LOCUS_42380 984 1709 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_42380 2499 1750 gene locus_tag LOCUS_42390 2499 1750 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_42390 2610 2933 gene locus_tag LOCUS_42400 2610 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 >Feature sequence1036 >Feature sequence1037 3 161 gene locus_tag LOCUS_42410 3 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 209 1075 gene locus_tag LOCUS_42420 209 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 1749 1078 gene locus_tag LOCUS_42430 1749 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 >Feature sequence1038 <1 1749 gene locus_tag LOCUS_42440 <1 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223614.1:glycosyl hydrolase 1761 2660 gene locus_tag LOCUS_42450 gene speE 1761 2660 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHH3 protein_id gnl|my_center|LOCUS_42450 >Feature sequence1039 1135 2157 gene locus_tag LOCUS_42460 1135 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 <3252 2168 gene locus_tag LOCUS_42470 <3252 2168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_085984871.1:alpha/beta hydrolase >Feature sequence1040 375 1745 gene locus_tag LOCUS_42480 375 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 2158 1748 gene locus_tag LOCUS_42490 2158 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 2799 2443 gene locus_tag LOCUS_42500 2799 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 >Feature sequence1041 330 1073 gene locus_tag LOCUS_42510 gene rlmB 330 1073 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CW6 protein_id gnl|my_center|LOCUS_42510 >Feature sequence1042 164 1072 gene locus_tag LOCUS_42520 164 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 1141 2046 gene locus_tag LOCUS_42530 1141 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 2942 2043 gene locus_tag LOCUS_42540 gene prmC 2942 2043 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B2 protein_id gnl|my_center|LOCUS_42540 >Feature sequence1043 372 1589 gene locus_tag LOCUS_42550 372 1589 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_42550 2872 1715 gene locus_tag LOCUS_42560 2872 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 >Feature sequence1044 955 188 gene locus_tag LOCUS_42570 955 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 1232 1813 gene locus_tag LOCUS_42580 1232 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 >Feature sequence1045 460 663 gene locus_tag LOCUS_42590 460 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 740 1531 gene locus_tag LOCUS_42600 740 1531 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143847.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42600 2039 2776 gene locus_tag LOCUS_42610 2039 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 >Feature sequence1046 797 2035 gene locus_tag LOCUS_42620 797 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 >Feature sequence1047 <1 1145 gene locus_tag LOCUS_42630 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004551026.1:phenylacetic acid degradation NADH oxidoreductase PaaE 1142 1894 gene locus_tag LOCUS_42640 1142 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 1935 3143 gene locus_tag LOCUS_42650 1935 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 >Feature sequence1048 >Feature sequence1049 799 1965 gene locus_tag LOCUS_42660 799 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 2398 1976 gene locus_tag LOCUS_42670 2398 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 2582 2977 gene locus_tag LOCUS_42680 2582 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121288.1 protein_id gnl|my_center|LOCUS_42680 >Feature sequence1050 <1 700 gene locus_tag LOCUS_42690 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461443.1:homocitrate synthase 697 1911 gene locus_tag LOCUS_42700 gene leuC 697 1911 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Q9 protein_id gnl|my_center|LOCUS_42700 1908 2408 gene locus_tag LOCUS_42710 1908 2408 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867561.1 protein_id gnl|my_center|LOCUS_42710 >Feature sequence1051 138 1526 gene locus_tag LOCUS_42720 gene gor-2 138 1526 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104922.1 protein_id gnl|my_center|LOCUS_42720 1596 2780 gene locus_tag LOCUS_42730 1596 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 >Feature sequence1052 2408 81 gene locus_tag LOCUS_42740 2408 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 3177 2551 gene locus_tag LOCUS_42750 3177 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 >Feature sequence1053 75 791 gene locus_tag LOCUS_42760 75 791 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_42760 1490 819 gene locus_tag LOCUS_42770 1490 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 2047 1550 gene locus_tag LOCUS_42780 2047 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 <3227 2095 gene locus_tag LOCUS_42790 <3227 2095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404801.1:bifunctional 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase/cyclase/dehydrase >Feature sequence1054 <1 693 gene locus_tag LOCUS_42800 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229841.1:cystathionine beta-synthase 1862 780 gene locus_tag LOCUS_42810 gene hisC1 1862 780 CDS product histidinol-phosphate aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GX0 protein_id gnl|my_center|LOCUS_42810 1981 2607 gene locus_tag LOCUS_42820 1981 2607 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223840.1 protein_id gnl|my_center|LOCUS_42820 >Feature sequence1055 <1 1014 gene locus_tag LOCUS_42830 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338710.1:cyclopropane-fatty-acyl-phospholipid synthase 2581 1028 gene locus_tag LOCUS_42840 2581 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140695.1 protein_id gnl|my_center|LOCUS_42840 3158 2619 gene locus_tag LOCUS_42850 3158 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 >Feature sequence1056 1401 1180 gene locus_tag LOCUS_42860 1401 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 1749 1510 gene locus_tag LOCUS_42870 1749 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 2065 1781 gene locus_tag LOCUS_42880 2065 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 2180 2425 gene locus_tag LOCUS_42890 2180 2425 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531584.1 protein_id gnl|my_center|LOCUS_42890 >Feature sequence1057 1609 656 gene locus_tag LOCUS_42900 1609 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 1732 2535 gene locus_tag LOCUS_42910 1732 2535 CDS product amino acid amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 protein_id gnl|my_center|LOCUS_42910 >Feature sequence1058 1318 1809 gene locus_tag LOCUS_42920 1318 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 1872 2084 gene locus_tag LOCUS_42930 1872 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 >Feature sequence1059 360 2042 gene locus_tag LOCUS_42940 360 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 >Feature sequence1060 <1 528 gene locus_tag LOCUS_42950 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250761.1:phosphatidate cytidylyltransferase <3206 1474 gene locus_tag LOCUS_42960 <3206 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056720.1:hybrid sensor histidine kinase/response regulator >Feature sequence1061 1856 657 gene locus_tag LOCUS_42970 1856 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 3098 2409 gene locus_tag LOCUS_42980 3098 2409 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_42980 >Feature sequence1062 >Feature sequence1063 688 293 gene locus_tag LOCUS_42990 688 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 protein_id gnl|my_center|LOCUS_42990 1042 1815 gene locus_tag LOCUS_43000 1042 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 1800 2342 gene locus_tag LOCUS_43010 1800 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 2701 3075 gene locus_tag LOCUS_43020 2701 3075 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891553.1 protein_id gnl|my_center|LOCUS_43020 >Feature sequence1064 >Feature sequence1065 <1 544 gene locus_tag LOCUS_43030 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P61740:glycerol-3-phosphate dehydrogenase [NAD(P)+] 1117 2619 gene locus_tag LOCUS_43040 1117 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 >Feature sequence1066 2479 743 gene locus_tag LOCUS_43050 2479 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 <3196 2535 gene locus_tag LOCUS_43060 <3196 2535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870229.1:phosphoesterase >Feature sequence1067 71 460 gene locus_tag LOCUS_43070 71 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 523 1701 gene locus_tag LOCUS_43080 523 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 2788 1751 gene locus_tag LOCUS_43090 2788 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 3189 2797 gene locus_tag LOCUS_43100 3189 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 >Feature sequence1068 1734 82 gene locus_tag LOCUS_43110 1734 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 1941 3059 gene locus_tag LOCUS_43120 1941 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 >Feature sequence1069 1110 520 gene locus_tag LOCUS_43130 1110 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 1212 1409 gene locus_tag LOCUS_43140 1212 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 1699 1442 gene locus_tag LOCUS_43150 1699 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 2140 1832 gene locus_tag LOCUS_43160 2140 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 2151 2321 gene locus_tag LOCUS_43170 2151 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 <3179 2630 gene locus_tag LOCUS_43180 <3179 2630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088405.1:4-diphosphocytidyl-2C-methyl-D-erythritol kinase >Feature sequence1070 902 216 gene locus_tag LOCUS_43190 902 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 1677 2516 gene locus_tag LOCUS_43200 gene pknH 1677 2516 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118692.1 protein_id gnl|my_center|LOCUS_43200 >Feature sequence1071 2132 1551 gene locus_tag LOCUS_43210 2132 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 2452 2183 gene locus_tag LOCUS_43220 2452 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 2939 2529 gene locus_tag LOCUS_43230 2939 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 >Feature sequence1072 1 321 gene locus_tag LOCUS_43240 1 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 577 1215 gene locus_tag LOCUS_43250 577 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 1826 1332 gene locus_tag LOCUS_43260 1826 1332 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_43260 2545 1868 gene locus_tag LOCUS_43270 2545 1868 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_43270 >Feature sequence1073 3 608 gene locus_tag LOCUS_43280 gene petC 3 608 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCE1 protein_id gnl|my_center|LOCUS_43280 611 2332 gene locus_tag LOCUS_43290 611 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 2588 2968 gene locus_tag LOCUS_43300 2588 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 >Feature sequence1074 >Feature sequence1075 1537 218 gene locus_tag LOCUS_43310 1537 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 1905 1534 gene locus_tag LOCUS_43320 1905 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 2061 2531 gene locus_tag LOCUS_43330 2061 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 3123 2551 gene locus_tag LOCUS_43340 3123 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 >Feature sequence1076 295 924 gene locus_tag LOCUS_43350 295 924 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225626.1 protein_id gnl|my_center|LOCUS_43350 1867 944 gene locus_tag LOCUS_43360 1867 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 2738 1962 gene locus_tag LOCUS_43370 2738 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 >Feature sequence1077 1385 450 gene locus_tag LOCUS_43380 1385 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 1366 1863 gene locus_tag LOCUS_43390 1366 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 3032 1875 gene locus_tag LOCUS_43400 gene ivd 3032 1875 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202093.1 protein_id gnl|my_center|LOCUS_43400 >Feature sequence1078 >Feature sequence1079 821 1795 gene locus_tag LOCUS_43410 gene speE 821 1795 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI29 protein_id gnl|my_center|LOCUS_43410 >Feature sequence1080 1243 404 gene locus_tag LOCUS_43420 1243 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 2567 1257 gene locus_tag LOCUS_43430 gene rkpK 2567 1257 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931620.1 protein_id gnl|my_center|LOCUS_43430 <3158 2564 gene locus_tag LOCUS_43440 <3158 2564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256544.1:beta-glucosidase >Feature sequence1081 780 1700 gene locus_tag LOCUS_43450 780 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 2913 1717 gene locus_tag LOCUS_43460 2913 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 >Feature sequence1082 >Feature sequence1083 771 2177 gene locus_tag LOCUS_43470 771 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 >Feature sequence1084 <1 2294 gene locus_tag LOCUS_43480 <1 2294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709380.1:adenylate cyclase <3149 2315 gene locus_tag LOCUS_43490 <3149 2315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071738.1:acetoacetate decarboxylase >Feature sequence1085 60 797 gene locus_tag LOCUS_43500 60 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 1527 850 gene locus_tag LOCUS_43510 gene rpsC 1527 850 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z4 protein_id gnl|my_center|LOCUS_43510 1912 1634 gene locus_tag LOCUS_43520 1912 1634 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257727.1 protein_id gnl|my_center|LOCUS_43520 >Feature sequence1086 2020 164 gene locus_tag LOCUS_43530 2020 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 >Feature sequence1087 2173 1007 gene locus_tag LOCUS_43540 2173 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 >Feature sequence1088 314 2533 gene locus_tag LOCUS_43550 314 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 >Feature sequence1089 628 2277 gene locus_tag LOCUS_43560 628 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 >Feature sequence1090 180 1697 gene locus_tag LOCUS_43570 180 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 1760 2443 gene locus_tag LOCUS_43580 1760 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 <3138 2452 gene locus_tag LOCUS_43590 <3138 2452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121881.1:deoxyribodipyrimidine photo-lyase >Feature sequence1091 1061 1663 gene locus_tag LOCUS_43600 1061 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 >Feature sequence1092 1041 88 gene locus_tag LOCUS_43610 1041 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 1180 2115 gene locus_tag LOCUS_43620 1180 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 >Feature sequence1093 1939 110 gene locus_tag LOCUS_43630 1939 110 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726920.1 protein_id gnl|my_center|LOCUS_43630 2053 2955 gene locus_tag LOCUS_43640 2053 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 >Feature sequence1094 2202 436 gene locus_tag LOCUS_43650 2202 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 <3122 2362 gene locus_tag LOCUS_43660 <3122 2362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143600.1:phosphate starvation protein PhoH >Feature sequence1095 1100 1555 gene locus_tag LOCUS_43670 1100 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 1552 2433 gene locus_tag LOCUS_43680 gene folD2 1552 2433 CDS product bifunctional protein FolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU7 protein_id gnl|my_center|LOCUS_43680 <3121 2455 gene locus_tag LOCUS_43690 <3121 2455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391375.1:chromosome partitioning protein ParB >Feature sequence1096 903 217 gene locus_tag LOCUS_43700 gene maiA 903 217 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57109 protein_id gnl|my_center|LOCUS_43700 1273 2649 gene locus_tag LOCUS_43710 gene ndh 1273 2649 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932061.1 protein_id gnl|my_center|LOCUS_43710 >Feature sequence1097 1744 731 gene locus_tag LOCUS_43720 1744 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 >Feature sequence1098 658 1194 gene locus_tag LOCUS_43730 658 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 1220 2020 gene locus_tag LOCUS_43740 1220 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 2505 2029 gene locus_tag LOCUS_43750 2505 2029 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869383.1 protein_id gnl|my_center|LOCUS_43750 >Feature sequence1099 251 409 gene locus_tag LOCUS_43760 251 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 1770 487 gene locus_tag LOCUS_43770 gene eutP 1770 487 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037403.1 protein_id gnl|my_center|LOCUS_43770 1998 2453 gene locus_tag LOCUS_43780 1998 2453 CDS product Appr-1-p processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107679.1 protein_id gnl|my_center|LOCUS_43780 <3115 2467 gene locus_tag LOCUS_43790 <3115 2467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919766.1:1-acyl-sn-glycerol-3-phosphate acyltransferase >Feature sequence1100 778 323 gene locus_tag LOCUS_43800 778 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 2529 868 gene locus_tag LOCUS_43810 2529 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 >Feature sequence1101 2708 1122 gene locus_tag LOCUS_43820 2708 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 >Feature sequence1102 700 485 gene locus_tag LOCUS_43830 700 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 1038 697 gene locus_tag LOCUS_43840 1038 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 1742 1035 gene locus_tag LOCUS_43850 1742 1035 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065117.1 protein_id gnl|my_center|LOCUS_43850 2505 1756 gene locus_tag LOCUS_43860 2505 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 <3114 2607 gene locus_tag LOCUS_43870 <3114 2607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021446.1:ABC transporter ATP-binding protein >Feature sequence1103 2911 1460 gene locus_tag LOCUS_43880 gene gabD 2911 1460 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_43880 >Feature sequence1104 716 1033 gene locus_tag LOCUS_43890 716 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 1975 1097 gene locus_tag LOCUS_43900 1975 1097 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082510.1 protein_id gnl|my_center|LOCUS_43900 2155 2517 gene locus_tag LOCUS_43910 2155 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 <3111 2560 gene locus_tag LOCUS_43920 <3111 2560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143047.1:permease >Feature sequence1105 59 1069 gene locus_tag LOCUS_43930 59 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701476.1 protein_id gnl|my_center|LOCUS_43930 1143 1877 gene locus_tag LOCUS_43940 1143 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 2179 1889 gene locus_tag LOCUS_43950 2179 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 >Feature sequence1106 2440 677 gene locus_tag LOCUS_43960 2440 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 >Feature sequence1107 2072 816 gene locus_tag LOCUS_43970 2072 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 >Feature sequence1108 1810 347 gene locus_tag LOCUS_43980 1810 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 <3100 1864 gene locus_tag LOCUS_43990 <3100 1864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030349.1:ATP-binding protein >Feature sequence1109 202 1407 gene locus_tag LOCUS_44000 gene kbl 202 1407 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTU5 protein_id gnl|my_center|LOCUS_44000 1860 1468 gene locus_tag LOCUS_44010 1860 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 >Feature sequence1110 >Feature sequence1111 275 1003 gene locus_tag LOCUS_44020 275 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 1847 966 gene locus_tag LOCUS_44030 1847 966 CDS product retinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402797.1 protein_id gnl|my_center|LOCUS_44030 1930 2823 gene locus_tag LOCUS_44040 1930 2823 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382934.1 protein_id gnl|my_center|LOCUS_44040 >Feature sequence1112 171 1079 gene locus_tag LOCUS_44050 171 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 1621 1163 gene locus_tag LOCUS_44060 1621 1163 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535495.1 protein_id gnl|my_center|LOCUS_44060 2719 1886 gene locus_tag LOCUS_44070 2719 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 >Feature sequence1113 483 1148 gene locus_tag LOCUS_44080 483 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 1153 2010 gene locus_tag LOCUS_44090 1153 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 >Feature sequence1114 980 522 gene locus_tag LOCUS_44100 980 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 2931 1516 gene locus_tag LOCUS_44110 gene asnS 2931 1516 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E08 protein_id gnl|my_center|LOCUS_44110 >Feature sequence1115 1058 321 gene locus_tag LOCUS_44120 1058 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 2040 1192 gene locus_tag LOCUS_44130 2040 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 2144 2881 gene locus_tag LOCUS_44140 2144 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 >Feature sequence1116 573 1214 gene locus_tag LOCUS_44150 573 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 >Feature sequence1117 1431 478 gene locus_tag LOCUS_44160 1431 478 CDS product inward rectifier potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_44160 1703 1957 gene locus_tag LOCUS_44170 1703 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 1982 2698 gene locus_tag LOCUS_44180 1982 2698 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFH7 protein_id gnl|my_center|LOCUS_44180 >Feature sequence1118 <1 993 gene locus_tag LOCUS_44190 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228060.1:adenosine deaminase 1764 997 gene locus_tag LOCUS_44200 1764 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 2832 1942 gene locus_tag LOCUS_44210 2832 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 >Feature sequence1119 784 1041 gene locus_tag LOCUS_44220 784 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 2348 1266 gene locus_tag LOCUS_44230 2348 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 2953 2324 gene locus_tag LOCUS_44240 2953 2324 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QV1 protein_id gnl|my_center|LOCUS_44240 >Feature sequence1120 394 1131 gene locus_tag LOCUS_44250 394 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 2470 1460 gene locus_tag LOCUS_44260 2470 1460 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267772.1 protein_id gnl|my_center|LOCUS_44260 2914 2495 gene locus_tag LOCUS_44270 2914 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 >Feature sequence1121 1265 69 gene locus_tag LOCUS_44280 gene mraY 1265 69 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_44280 1875 1360 gene locus_tag LOCUS_44290 1875 1360 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258555.1 protein_id gnl|my_center|LOCUS_44290 >Feature sequence1122 <1 803 gene locus_tag LOCUS_44300 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776278.1:alanine dehydrogenase 1812 865 gene locus_tag LOCUS_44310 1812 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 2408 2734 gene locus_tag LOCUS_44320 2408 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 >Feature sequence1123 655 158 gene locus_tag LOCUS_44330 655 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 689 1447 gene locus_tag LOCUS_44340 689 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 >Feature sequence1124 1046 840 gene locus_tag LOCUS_44350 1046 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 1846 1079 gene locus_tag LOCUS_44360 1846 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 2708 1899 gene locus_tag LOCUS_44370 2708 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 >Feature sequence1125 2307 1204 gene locus_tag LOCUS_44380 2307 1204 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_44380 >Feature sequence1126 2106 31 gene locus_tag LOCUS_44390 2106 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 <3055 2366 gene locus_tag LOCUS_44400 <3055 2366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880979.1:O-methyltransferase >Feature sequence1127 813 238 gene locus_tag LOCUS_44410 813 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 1752 901 gene locus_tag LOCUS_44420 1752 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 >Feature sequence1128 <1 1087 gene locus_tag LOCUS_44430 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085481.1:cytochrome-c peroxidase <3047 1095 gene locus_tag LOCUS_44440 <3047 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814533.1:peptidase M13 >Feature sequence1129 1579 2733 gene locus_tag LOCUS_44450 1579 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516666.1 protein_id gnl|my_center|LOCUS_44450 >Feature sequence1130 >Feature sequence1131 346 1449 gene locus_tag LOCUS_44460 346 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 >Feature sequence1132 422 2143 gene locus_tag LOCUS_44470 422 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 2911 2213 gene locus_tag LOCUS_44480 2911 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 >Feature sequence1133 247 810 gene locus_tag LOCUS_44490 247 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 1061 1984 gene locus_tag LOCUS_44500 1061 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 2000 2356 gene locus_tag LOCUS_44510 2000 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 >Feature sequence1134 349 11 gene locus_tag LOCUS_44520 349 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 555 803 gene locus_tag LOCUS_44530 555 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 904 2220 gene locus_tag LOCUS_44540 904 2220 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531508.1 protein_id gnl|my_center|LOCUS_44540 2468 3034 gene locus_tag LOCUS_44550 2468 3034 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528072.1 protein_id gnl|my_center|LOCUS_44550 >Feature sequence1135 886 1935 gene locus_tag LOCUS_44560 886 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 2894 1896 gene locus_tag LOCUS_44570 2894 1896 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865320.1 protein_id gnl|my_center|LOCUS_44570 >Feature sequence1136 1263 2936 gene locus_tag LOCUS_44580 1263 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 >Feature sequence1137 528 2105 gene locus_tag LOCUS_44590 528 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44590 2118 2582 gene locus_tag LOCUS_44600 2118 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 >Feature sequence1138 1343 225 gene locus_tag LOCUS_44610 1343 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 1912 1535 gene locus_tag LOCUS_44620 1912 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 <3030 1968 gene locus_tag LOCUS_44630 <3030 1968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011069661.1:guanylate cyclase >Feature sequence1139 375 2297 gene locus_tag LOCUS_44640 375 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 2299 2610 gene locus_tag LOCUS_44650 2299 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 >Feature sequence1140 <1 852 gene locus_tag LOCUS_44660 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071926.1:ABC transporter substrate-binding protein 1933 881 gene locus_tag LOCUS_44670 1933 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 <3026 1991 gene locus_tag LOCUS_44680 <3026 1991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940649.1:peptidase M24 >Feature sequence1141 3 674 gene locus_tag LOCUS_44690 3 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 1822 731 gene locus_tag LOCUS_44700 1822 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 >Feature sequence1142 1443 136 gene locus_tag LOCUS_44710 gene hisD 1443 136 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FL44 protein_id gnl|my_center|LOCUS_44710 2128 1475 gene locus_tag LOCUS_44720 2128 1475 CDS product ribosomal protein N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889068.1 protein_id gnl|my_center|LOCUS_44720 2565 2173 gene locus_tag LOCUS_44730 2565 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 >Feature sequence1143 1570 821 gene locus_tag LOCUS_44740 1570 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 >Feature sequence1144 1295 1005 gene locus_tag LOCUS_44750 1295 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 2645 1344 gene locus_tag LOCUS_44760 gene miaB 2645 1344 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZF8 protein_id gnl|my_center|LOCUS_44760 >Feature sequence1145 377 1204 gene locus_tag LOCUS_44770 377 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 >Feature sequence1146 >Feature sequence1147 959 1987 gene locus_tag LOCUS_44780 959 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 2554 2012 gene locus_tag LOCUS_44790 2554 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 >Feature sequence1148 1105 32 gene locus_tag LOCUS_44800 gene hemH 1105 32 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FA4 protein_id gnl|my_center|LOCUS_44800 1225 2124 gene locus_tag LOCUS_44810 1225 2124 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536583.1 protein_id gnl|my_center|LOCUS_44810 <3015 2127 gene locus_tag LOCUS_44820 <3015 2127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223342.1:3-(3-hydroxyphenyl)propionate hydroxylase >Feature sequence1149 664 440 gene locus_tag LOCUS_44830 664 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 633 1142 gene locus_tag LOCUS_44840 633 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 1995 1156 gene locus_tag LOCUS_44850 1995 1156 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112463.1 protein_id gnl|my_center|LOCUS_44850 2596 2937 gene locus_tag LOCUS_44860 2596 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 >Feature sequence1150 2575 1247 gene locus_tag LOCUS_44870 2575 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 >Feature sequence1151 1204 473 gene locus_tag LOCUS_44880 1204 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 1666 1217 gene locus_tag LOCUS_44890 1666 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 1779 2663 gene locus_tag LOCUS_44900 1779 2663 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_44900 >Feature sequence1152 1098 349 gene locus_tag LOCUS_44910 1098 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 1148 2875 gene locus_tag LOCUS_44920 1148 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 >Feature sequence1153 1066 428 gene locus_tag LOCUS_44930 1066 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 2567 1203 gene locus_tag LOCUS_44940 2567 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 >Feature sequence1154 2362 377 gene locus_tag LOCUS_44950 2362 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 >Feature sequence1155 1293 391 gene locus_tag LOCUS_44960 gene nadC 1293 391 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_44960 2000 1281 gene locus_tag LOCUS_44970 2000 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143203.1 protein_id gnl|my_center|LOCUS_44970 2841 2032 gene locus_tag LOCUS_44980 2841 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 >Feature sequence1156 733 188 gene locus_tag LOCUS_44990 733 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 657 1100 gene locus_tag LOCUS_45000 657 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 1305 1787 gene locus_tag LOCUS_45010 1305 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 >Feature sequence1157 >Feature sequence1158 2340 109 gene locus_tag LOCUS_45020 2340 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 2992 2609 gene locus_tag LOCUS_45030 2992 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 >Feature sequence1159 697 2388 gene locus_tag LOCUS_45040 697 2388 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_45040 2437 2913 gene locus_tag LOCUS_45050 2437 2913 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480116.1 protein_id gnl|my_center|LOCUS_45050 >Feature sequence1160 1929 817 gene locus_tag LOCUS_45060 gene mqnE 1929 817 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA9 protein_id gnl|my_center|LOCUS_45060 2707 2036 gene locus_tag LOCUS_45070 gene ubiX 2707 2036 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX08 protein_id gnl|my_center|LOCUS_45070 >Feature sequence1161 >Feature sequence1162 690 1565 gene locus_tag LOCUS_45080 690 1565 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227727.1 protein_id gnl|my_center|LOCUS_45080 1562 2548 gene locus_tag LOCUS_45090 1562 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119554.1 protein_id gnl|my_center|LOCUS_45090 >Feature sequence1163 1216 2 gene locus_tag LOCUS_45100 1216 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 2007 1360 gene locus_tag LOCUS_45110 2007 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 >Feature sequence1164 268 1296 gene locus_tag LOCUS_45120 268 1296 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926674.1 protein_id gnl|my_center|LOCUS_45120 2874 1315 gene locus_tag LOCUS_45130 2874 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 >Feature sequence1165 <1 2165 gene locus_tag LOCUS_45140 <1 2165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RUB8:alpha-amylase 2499 2571 gene locus_tag LOCUS_t00940 2499 2571 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1166 >Feature sequence1167 1476 1204 gene locus_tag LOCUS_45150 1476 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 1959 1780 gene locus_tag LOCUS_45160 1959 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 2164 1949 gene locus_tag LOCUS_45170 2164 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 >Feature sequence1168 405 2207 gene locus_tag LOCUS_45180 405 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 2223 2930 gene locus_tag LOCUS_45190 2223 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 >Feature sequence1169 <1 1861 gene locus_tag LOCUS_45200 <1 1861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to G5EBD4:chromosome partition protein Smc 2900 1875 gene locus_tag LOCUS_45210 2900 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 >Feature sequence1170 1376 441 gene locus_tag LOCUS_45220 gene lgtF 1376 441 CDS product beta 1,4 glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 protein_id gnl|my_center|LOCUS_45220 2566 1373 gene locus_tag LOCUS_45230 2566 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 >Feature sequence1171 <2974 1846 gene locus_tag LOCUS_45240 <2974 1846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207983.1:GTP-binding protein >Feature sequence1172 671 1384 gene locus_tag LOCUS_45250 671 1384 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_45250 >Feature sequence1173 2388 898 gene locus_tag LOCUS_45260 2388 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 >Feature sequence1174 1056 2543 gene locus_tag LOCUS_45270 1056 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 >Feature sequence1175 1339 824 gene locus_tag LOCUS_45280 1339 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 2255 1491 gene locus_tag LOCUS_45290 gene cinA1 2255 1491 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338596.1 protein_id gnl|my_center|LOCUS_45290 >Feature sequence1176 652 416 gene locus_tag LOCUS_45300 652 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 827 2857 gene locus_tag LOCUS_45310 827 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 >Feature sequence1177 556 170 gene locus_tag LOCUS_45320 556 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 1090 677 gene locus_tag LOCUS_45330 1090 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45330 1487 2353 gene locus_tag LOCUS_45340 1487 2353 CDS product C-5 sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895122.1 protein_id gnl|my_center|LOCUS_45340 >Feature sequence1178 <1 637 gene locus_tag LOCUS_45350 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000262640.1:staphyloferrin A synthetase SfaB 674 1600 gene locus_tag LOCUS_45360 gene prs 674 1600 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZY1 protein_id gnl|my_center|LOCUS_45360 >Feature sequence1179 1905 298 gene locus_tag LOCUS_45370 1905 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 <2964 1964 gene locus_tag LOCUS_45380 <2964 1964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886881.1:6-aminohexanoate-cyclic-dimer hydrolase >Feature sequence1180 1032 1559 gene locus_tag LOCUS_45390 1032 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 1969 1676 gene locus_tag LOCUS_45400 1969 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 >Feature sequence1181 3 257 gene locus_tag LOCUS_45410 3 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 890 390 gene locus_tag LOCUS_45420 890 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 927 1163 gene locus_tag LOCUS_45430 927 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 >Feature sequence1182 >Feature sequence1183 <1 1471 gene locus_tag LOCUS_45440 <1 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056720.1:hybrid sensor histidine kinase/response regulator <2954 1523 gene locus_tag LOCUS_45450 <2954 1523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000200580.1:hemolysin >Feature sequence1184 >Feature sequence1185 34 2109 gene locus_tag LOCUS_45460 34 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 2307 2122 gene locus_tag LOCUS_45470 2307 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 2643 2467 gene locus_tag LOCUS_45480 2643 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 >Feature sequence1186 970 2031 gene locus_tag LOCUS_45490 970 2031 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_45490 2947 2042 gene locus_tag LOCUS_45500 2947 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 >Feature sequence1187 1070 1705 gene locus_tag LOCUS_45510 1070 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 >Feature sequence1188 592 1272 gene locus_tag LOCUS_45520 592 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 1391 2023 gene locus_tag LOCUS_45530 1391 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 2024 2632 gene locus_tag LOCUS_45540 2024 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 >Feature sequence1189 536 1534 gene locus_tag LOCUS_45550 536 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 2179 1565 gene locus_tag LOCUS_45560 2179 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 >Feature sequence1190 1008 577 gene locus_tag LOCUS_45570 1008 577 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600363.1 protein_id gnl|my_center|LOCUS_45570 2285 1107 gene locus_tag LOCUS_45580 2285 1107 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKF6 protein_id gnl|my_center|LOCUS_45580 >Feature sequence1191 2041 422 gene locus_tag LOCUS_45590 2041 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 >Feature sequence1192 951 1790 gene locus_tag LOCUS_45600 gene cas1 951 1790 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXJ3 protein_id gnl|my_center|LOCUS_45600 1753 2064 gene locus_tag LOCUS_45610 1753 2064 CDS product type I-E CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388101.1 protein_id gnl|my_center|LOCUS_45610 2061 2594 gene locus_tag LOCUS_45620 2061 2594 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287061.1 protein_id gnl|my_center|LOCUS_45620 2660 2932 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggctcccccgcggtcgcggggatggaccc >Feature sequence1193 2115 1576 gene locus_tag LOCUS_45630 2115 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 >Feature sequence1194 2934 2275 gene locus_tag LOCUS_45640 2934 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 >Feature sequence1195 <1 534 gene locus_tag LOCUS_45650 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257128.1:thioredoxin domain-containing protein 735 496 gene locus_tag LOCUS_45660 735 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 641 2380 gene locus_tag LOCUS_45670 641 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 >Feature sequence1196 243 1013 gene locus_tag LOCUS_45680 243 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 2532 1720 gene locus_tag LOCUS_45690 2532 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 >Feature sequence1197 >Feature sequence1198 1072 875 gene locus_tag LOCUS_45700 1072 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 2854 1334 gene locus_tag LOCUS_45710 2854 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 >Feature sequence1199 1751 894 gene locus_tag LOCUS_45720 1751 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 >Feature sequence1200 1767 2750 gene locus_tag LOCUS_45730 1767 2750 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814066.1 protein_id gnl|my_center|LOCUS_45730 >Feature sequence1201 1551 577 gene locus_tag LOCUS_45740 1551 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 >Feature sequence1202 1 228 gene locus_tag LOCUS_45750 1 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 269 988 gene locus_tag LOCUS_45760 269 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 1897 1004 gene locus_tag LOCUS_45770 1897 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706755.1 protein_id gnl|my_center|LOCUS_45770 >Feature sequence1203 >Feature sequence1204 2820 1228 gene locus_tag LOCUS_45780 2820 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 >Feature sequence1205 434 1138 gene locus_tag LOCUS_45790 434 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 1692 1120 gene locus_tag LOCUS_45800 1692 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 2534 1779 gene locus_tag LOCUS_45810 2534 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 2810 2535 gene locus_tag LOCUS_45820 2810 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 >Feature sequence1206 1701 58 gene locus_tag LOCUS_45830 1701 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 <2921 2184 gene locus_tag LOCUS_45840 <2921 2184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205298.1:integrase >Feature sequence1207 >Feature sequence1208 215 1033 gene locus_tag LOCUS_45850 215 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 1394 2632 gene locus_tag LOCUS_45860 1394 2632 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_45860 >Feature sequence1209 555 974 gene locus_tag LOCUS_45870 555 974 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_45870 1084 2457 gene locus_tag LOCUS_45880 1084 2457 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_45880 >Feature sequence1210 2917 1916 gene locus_tag LOCUS_45890 2917 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 >Feature sequence1211 1454 810 gene locus_tag LOCUS_45900 gene aqpZ 1454 810 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EG9 protein_id gnl|my_center|LOCUS_45900 2799 1609 gene locus_tag LOCUS_45910 2799 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 >Feature sequence1212 >Feature sequence1213 1058 888 gene locus_tag LOCUS_45920 1058 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 1073 1282 gene locus_tag LOCUS_45930 1073 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 1478 1984 gene locus_tag LOCUS_45940 1478 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 <2915 1999 gene locus_tag LOCUS_45950 <2915 1999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964024.1:flagellar motor protein MotB >Feature sequence1214 <2915 972 gene locus_tag LOCUS_45960 <2915 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020246.1:tetratricopeptide repeat protein >Feature sequence1215 2501 651 gene locus_tag LOCUS_45970 2501 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 >Feature sequence1216 1036 392 gene locus_tag LOCUS_45980 1036 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 1624 1061 gene locus_tag LOCUS_45990 1624 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 >Feature sequence1217 <1 909 gene locus_tag LOCUS_46000 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229635.1:3-hydroxyacyl-CoA dehydrogenase 1824 1000 gene locus_tag LOCUS_46010 1824 1000 CDS product glyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706576.1 protein_id gnl|my_center|LOCUS_46010 >Feature sequence1218 1306 602 gene locus_tag LOCUS_46020 1306 602 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013524.1 protein_id gnl|my_center|LOCUS_46020 1660 2430 gene locus_tag LOCUS_46030 1660 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 >Feature sequence1219 1003 2181 gene locus_tag LOCUS_46040 1003 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 >Feature sequence1220 1072 1419 gene locus_tag LOCUS_46050 1072 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 1419 1775 gene locus_tag LOCUS_46060 1419 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036007.1 protein_id gnl|my_center|LOCUS_46060 >Feature sequence1221 567 337 gene locus_tag LOCUS_46070 567 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 461 1684 gene locus_tag LOCUS_46080 461 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 2452 1721 gene locus_tag LOCUS_46090 2452 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 >Feature sequence1222 <1 1445 gene locus_tag LOCUS_46100 <1 1445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JIH9:50S ribosomal protein L7/L12 1662 2639 gene locus_tag LOCUS_46110 1662 2639 CDS product N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122374.1 protein_id gnl|my_center|LOCUS_46110 >Feature sequence1223 2026 125 gene locus_tag LOCUS_46120 2026 125 CDS product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_46120 2131 2649 gene locus_tag LOCUS_46130 2131 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 >Feature sequence1224 1920 280 gene locus_tag LOCUS_46140 1920 280 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_46140 2770 1970 gene locus_tag LOCUS_46150 2770 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 >Feature sequence1225 <1 605 gene locus_tag LOCUS_46160 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92WJ7:histidine kinase 685 2463 gene locus_tag LOCUS_46170 685 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 >Feature sequence1226 788 961 gene locus_tag LOCUS_46180 788 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 992 1744 gene locus_tag LOCUS_46190 992 1744 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230452.1 protein_id gnl|my_center|LOCUS_46190 1776 2174 gene locus_tag LOCUS_46200 1776 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 >Feature sequence1227 >Feature sequence1228 <1 1023 gene locus_tag LOCUS_46210 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I4G8:arachidonate 15-lipoxygenase 1132 2694 gene locus_tag LOCUS_46220 1132 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 >Feature sequence1229 >Feature sequence1230 561 1928 gene locus_tag LOCUS_46230 561 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 >Feature sequence1231 488 1606 gene locus_tag LOCUS_46240 gene gap 488 1606 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67161 protein_id gnl|my_center|LOCUS_46240 >Feature sequence1232 <1 528 gene locus_tag LOCUS_46250 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RX92:MEMO1 family protein 515 1138 gene locus_tag LOCUS_46260 515 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 >Feature sequence1233 1783 878 gene locus_tag LOCUS_46270 1783 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 <2879 1844 gene locus_tag LOCUS_46280 <2879 1844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789707.1:acyl-CoA dehydrogenase >Feature sequence1234 2635 299 gene locus_tag LOCUS_46290 2635 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 >Feature sequence1235 832 119 gene locus_tag LOCUS_46300 832 119 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_46300 2436 862 gene locus_tag LOCUS_46310 2436 862 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_46310 >Feature sequence1236 1598 1341 gene locus_tag LOCUS_46320 1598 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 2798 1641 gene locus_tag LOCUS_46330 2798 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_46330 >Feature sequence1237 <1 714 gene locus_tag LOCUS_46340 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259373.1:histidine kinase 977 1180 gene locus_tag LOCUS_46350 977 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 1268 2605 gene locus_tag LOCUS_46360 1268 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 >Feature sequence1238 1980 1009 gene locus_tag LOCUS_46370 1980 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 >Feature sequence1239 605 769 gene locus_tag LOCUS_46380 605 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 2016 823 gene locus_tag LOCUS_46390 2016 823 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_46390 2563 2063 gene locus_tag LOCUS_46400 2563 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 >Feature sequence1240 1589 531 gene locus_tag LOCUS_46410 1589 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 2268 1684 gene locus_tag LOCUS_46420 2268 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 <2870 2368 gene locus_tag LOCUS_46430 <2870 2368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYI5:DNA mismatch repair protein MutS >Feature sequence1241 920 2053 gene locus_tag LOCUS_46440 920 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 >Feature sequence1242 1903 1427 gene locus_tag LOCUS_46450 1903 1427 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_46450 <2867 1903 gene locus_tag LOCUS_46460 <2867 1903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259373.1:histidine kinase >Feature sequence1243 1197 292 gene locus_tag LOCUS_46470 1197 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 >Feature sequence1244 1044 223 gene locus_tag LOCUS_46480 1044 223 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267372.1 protein_id gnl|my_center|LOCUS_46480 1440 2402 gene locus_tag LOCUS_46490 1440 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 >Feature sequence1245 197 1504 gene locus_tag LOCUS_46500 197 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 1558 2214 gene locus_tag LOCUS_46510 1558 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 >Feature sequence1246 300 1538 gene locus_tag LOCUS_46520 300 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 1587 1997 gene locus_tag LOCUS_46530 1587 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 >Feature sequence1247 1032 2159 gene locus_tag LOCUS_46540 1032 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 >Feature sequence1248 <1 1054 gene locus_tag LOCUS_46550 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388093.1:CRISPR-associated helicase/endonuclease Cas3 1051 2595 gene locus_tag LOCUS_46560 1051 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 >Feature sequence1249 597 1454 gene locus_tag LOCUS_46570 597 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 2471 1470 gene locus_tag LOCUS_46580 2471 1470 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705178.1 protein_id gnl|my_center|LOCUS_46580 >Feature sequence1250 3 1463 gene locus_tag LOCUS_46590 3 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 >Feature sequence1251 172 1407 gene locus_tag LOCUS_46600 gene aspC2 172 1407 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_46600 >Feature sequence1252 <1 638 gene locus_tag LOCUS_46610 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NHX4:methionine aminopeptidase 1539 658 gene locus_tag LOCUS_46620 1539 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 1643 2599 gene locus_tag LOCUS_46630 1643 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 >Feature sequence1253 2355 217 gene locus_tag LOCUS_46640 2355 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 >Feature sequence1254 608 2089 gene locus_tag LOCUS_46650 608 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 2120 2419 gene locus_tag LOCUS_46660 2120 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 2438 2695 gene locus_tag LOCUS_46670 2438 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 >Feature sequence1255 <1 553 gene locus_tag LOCUS_46680 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057122.1:two-component hybrid sensor and regulator 657 1346 gene locus_tag LOCUS_46690 657 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530129.1 protein_id gnl|my_center|LOCUS_46690 >Feature sequence1256 1021 1812 gene locus_tag LOCUS_46700 1021 1812 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648703.1 protein_id gnl|my_center|LOCUS_46700 >Feature sequence1257 842 348 gene locus_tag LOCUS_46710 842 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 1364 933 gene locus_tag LOCUS_46720 1364 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 2642 1599 gene locus_tag LOCUS_46730 2642 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 >Feature sequence1258 1404 1727 gene locus_tag LOCUS_46740 gene rplU 1404 1727 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8REI5 protein_id gnl|my_center|LOCUS_46740 1761 2054 gene locus_tag LOCUS_46750 gene rpmA 1761 2054 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60493 protein_id gnl|my_center|LOCUS_46750 >Feature sequence1259 291 1019 gene locus_tag LOCUS_46760 291 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 1016 1501 gene locus_tag LOCUS_46770 1016 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 1498 2421 gene locus_tag LOCUS_46780 1498 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 >Feature sequence1260 510 73 gene locus_tag LOCUS_46790 510 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 778 542 gene locus_tag LOCUS_46800 778 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 1932 817 gene locus_tag LOCUS_46810 1932 817 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257432.1 protein_id gnl|my_center|LOCUS_46810 >Feature sequence1261 1146 391 gene locus_tag LOCUS_46820 1146 391 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460628.1 protein_id gnl|my_center|LOCUS_46820 1495 1199 gene locus_tag LOCUS_46830 1495 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 1684 2037 gene locus_tag LOCUS_46840 1684 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 >Feature sequence1262 69 773 gene locus_tag LOCUS_46850 69 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 1021 2286 gene locus_tag LOCUS_46860 gene tuf 1021 2286 CDS product elongation factor 1-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762152.1 protein_id gnl|my_center|LOCUS_46860 >Feature sequence1263 429 1685 gene locus_tag LOCUS_46870 429 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 1729 2751 gene locus_tag LOCUS_46880 1729 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 >Feature sequence1264 86 1471 gene locus_tag LOCUS_46890 86 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 2727 1489 gene locus_tag LOCUS_46900 2727 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 >Feature sequence1265 346 699 gene locus_tag LOCUS_46910 346 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 780 1397 gene locus_tag LOCUS_46920 780 1397 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_46920 1402 1983 gene locus_tag LOCUS_46930 1402 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 >Feature sequence1266 1031 1690 gene locus_tag LOCUS_46940 1031 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 >Feature sequence1267 <1 2820 gene locus_tag LOCUS_46950 <1 2820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392429.1:serine/threonine protein kinase >Feature sequence1268 62 472 gene locus_tag LOCUS_46960 62 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 1933 512 gene locus_tag LOCUS_46970 1933 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 >Feature sequence1269 862 338 gene locus_tag LOCUS_46980 862 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 2113 1088 gene locus_tag LOCUS_46990 2113 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 >Feature sequence1270 1796 687 gene locus_tag LOCUS_47000 1796 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022099.1 protein_id gnl|my_center|LOCUS_47000 2092 2424 gene locus_tag LOCUS_47010 2092 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 >Feature sequence1271 417 971 gene locus_tag LOCUS_47020 417 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 1542 988 gene locus_tag LOCUS_47030 1542 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 2088 1567 gene locus_tag LOCUS_47040 2088 1567 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038810.1 protein_id gnl|my_center|LOCUS_47040 >Feature sequence1272 845 1417 gene locus_tag LOCUS_47050 845 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 1492 2199 gene locus_tag LOCUS_47060 1492 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 >Feature sequence1273 511 1179 gene locus_tag LOCUS_47070 gene yfcG 511 1179 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071741.1 protein_id gnl|my_center|LOCUS_47070 1807 1205 gene locus_tag LOCUS_47080 1807 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 1884 2798 gene locus_tag LOCUS_47090 1884 2798 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142854.1 protein_id gnl|my_center|LOCUS_47090 >Feature sequence1274 614 90 gene locus_tag LOCUS_47100 614 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 1653 841 gene locus_tag LOCUS_47110 1653 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 2024 2653 gene locus_tag LOCUS_47120 2024 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 >Feature sequence1275 <2810 2284 gene locus_tag LOCUS_47130 <2810 2284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to I3U175:tyrosine recombinase XerC >Feature sequence1276 2397 1474 gene locus_tag LOCUS_47140 2397 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 >Feature sequence1277 <1 1840 gene locus_tag LOCUS_47150 <1 1840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZTG0:error-prone DNA polymerase >Feature sequence1278 >Feature sequence1279 <1 989 gene locus_tag LOCUS_47160 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9XCL6:glutamate--tRNA ligase 1922 1326 gene locus_tag LOCUS_47170 1922 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 <2806 1999 gene locus_tag LOCUS_47180 <2806 1999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098170.1:phosphotransferase family protein >Feature sequence1280 <1 2219 gene locus_tag LOCUS_47190 <1 2219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120545.1:aminopeptidase 2235 2780 gene locus_tag LOCUS_47200 2235 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 >Feature sequence1281 322 1596 gene locus_tag LOCUS_47210 322 1596 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_47210 2469 1612 gene locus_tag LOCUS_47220 2469 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 >Feature sequence1282 1412 1765 gene locus_tag LOCUS_47230 1412 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 1887 2579 gene locus_tag LOCUS_47240 1887 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 >Feature sequence1283 >Feature sequence1284 1151 477 gene locus_tag LOCUS_47250 1151 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 1483 2337 gene locus_tag LOCUS_47260 1483 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 >Feature sequence1285 160 1398 gene locus_tag LOCUS_47270 160 1398 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031138.1 protein_id gnl|my_center|LOCUS_47270 1704 1408 gene locus_tag LOCUS_47280 1704 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 2221 1724 gene locus_tag LOCUS_47290 2221 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 >Feature sequence1286 1199 696 gene locus_tag LOCUS_47300 1199 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 1405 2040 gene locus_tag LOCUS_47310 1405 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 2206 2766 gene locus_tag LOCUS_47320 2206 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 >Feature sequence1287 319 1989 gene locus_tag LOCUS_47330 319 1989 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_47330 >Feature sequence1288 1217 483 gene locus_tag LOCUS_47340 1217 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 1462 2346 gene locus_tag LOCUS_47350 1462 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 >Feature sequence1289 703 1194 gene locus_tag LOCUS_47360 703 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 2393 1425 gene locus_tag LOCUS_47370 2393 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 >Feature sequence1290 1052 3 gene locus_tag LOCUS_47380 1052 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 1642 1187 gene locus_tag LOCUS_47390 1642 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 <2791 1691 gene locus_tag LOCUS_47400 <2791 1691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J431:ATP synthase subunit beta 1 >Feature sequence1291 1321 44 gene locus_tag LOCUS_47410 1321 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 1640 1443 gene locus_tag LOCUS_47420 1640 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 >Feature sequence1292 782 405 gene locus_tag LOCUS_47430 782 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787945.1 protein_id gnl|my_center|LOCUS_47430 2303 903 gene locus_tag LOCUS_47440 gene kamA 2303 903 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226568.1 protein_id gnl|my_center|LOCUS_47440 >Feature sequence1293 16 1665 gene locus_tag LOCUS_47450 16 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 <2783 1772 gene locus_tag LOCUS_47460 <2783 1772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228218.1:sensor histidine kinase >Feature sequence1294 713 2056 gene locus_tag LOCUS_47470 gene gdhA 713 2056 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVJ7 protein_id gnl|my_center|LOCUS_47470 2318 2608 gene locus_tag LOCUS_47480 2318 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 >Feature sequence1295 1502 375 gene locus_tag LOCUS_47490 1502 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 2524 1772 gene locus_tag LOCUS_47500 2524 1772 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_47500 >Feature sequence1296 2552 1404 gene locus_tag LOCUS_47510 2552 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 >Feature sequence1297 783 142 gene locus_tag LOCUS_47520 783 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 2342 1098 gene locus_tag LOCUS_47530 gene serA 2342 1098 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036995.1 protein_id gnl|my_center|LOCUS_47530 >Feature sequence1298 370 858 gene locus_tag LOCUS_47540 370 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 1933 827 gene locus_tag LOCUS_47550 1933 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 >Feature sequence1299 1721 678 gene locus_tag LOCUS_47560 1721 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 >Feature sequence1300 328 594 gene locus_tag LOCUS_47570 328 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 630 1280 gene locus_tag LOCUS_47580 630 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 1289 1822 gene locus_tag LOCUS_47590 1289 1822 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709539.1 protein_id gnl|my_center|LOCUS_47590 >Feature sequence1301 1496 567 gene locus_tag LOCUS_47600 1496 567 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818344.1 protein_id gnl|my_center|LOCUS_47600 1790 2692 gene locus_tag LOCUS_47610 1790 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 >Feature sequence1302 >Feature sequence1303 2415 1543 gene locus_tag LOCUS_47620 2415 1543 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524880.1 protein_id gnl|my_center|LOCUS_47620 >Feature sequence1304 2133 7 gene locus_tag LOCUS_47630 2133 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 2751 2470 gene locus_tag LOCUS_47640 2751 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 >Feature sequence1305 405 1583 gene locus_tag LOCUS_47650 405 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_47650 >Feature sequence1306 1405 428 gene locus_tag LOCUS_47660 1405 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 2523 1402 gene locus_tag LOCUS_47670 2523 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 >Feature sequence1307 720 1403 gene locus_tag LOCUS_47680 720 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 1561 2730 gene locus_tag LOCUS_47690 gene erg3 1561 2730 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_47690 >Feature sequence1308 781 1158 gene locus_tag LOCUS_47700 781 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 >Feature sequence1309 2627 720 gene locus_tag LOCUS_47710 2627 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 >Feature sequence1310 <1 1616 gene locus_tag LOCUS_47720 <1 1616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028766.1:protein kinase 1744 2700 gene locus_tag LOCUS_47730 1744 2700 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_47730 >Feature sequence1311 1332 874 gene locus_tag LOCUS_47740 1332 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 2095 1373 gene locus_tag LOCUS_47750 2095 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 2061 2210 gene locus_tag LOCUS_47760 2061 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 >Feature sequence1312 <1 1122 gene locus_tag LOCUS_47770 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944009.1:RND transporter 1739 1134 gene locus_tag LOCUS_47780 1739 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964027.1 protein_id gnl|my_center|LOCUS_47780 2614 1910 gene locus_tag LOCUS_47790 2614 1910 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_47790 >Feature sequence1313 943 38 gene locus_tag LOCUS_47800 gene accD 943 38 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI4 protein_id gnl|my_center|LOCUS_47800 1172 2311 gene locus_tag LOCUS_47810 gene purM 1172 2311 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7L8 protein_id gnl|my_center|LOCUS_47810 >Feature sequence1314 <1 1673 gene locus_tag LOCUS_47820 <1 1673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118661.1:D-aminoacylase <2735 1645 gene locus_tag LOCUS_47830 <2735 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776955.1:sodium:proline symporter >Feature sequence1315 447 103 gene locus_tag LOCUS_47840 447 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 >Feature sequence1316 1023 2330 gene locus_tag LOCUS_47850 1023 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 >Feature sequence1317 1227 1757 gene locus_tag LOCUS_47860 1227 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 >Feature sequence1318 452 1063 gene locus_tag LOCUS_47870 452 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 1117 2115 gene locus_tag LOCUS_47880 gene miaA 1117 2115 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJG0 protein_id gnl|my_center|LOCUS_47880 >Feature sequence1319 <1 1456 gene locus_tag LOCUS_47890 <1 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071650.1:restriction endonuclease subunit M 1453 2535 gene locus_tag LOCUS_47900 1453 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 >Feature sequence1320 798 1706 gene locus_tag LOCUS_47910 798 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 1917 2492 gene locus_tag LOCUS_47920 1917 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 >Feature sequence1321 32 1114 gene locus_tag LOCUS_47930 32 1114 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_47930 1314 1664 gene locus_tag LOCUS_47940 1314 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_47940 >Feature sequence1322 >Feature sequence1323 249 1640 gene locus_tag LOCUS_47950 249 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 1737 2681 gene locus_tag LOCUS_47960 1737 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 >Feature sequence1324 >Feature sequence1325 <1 800 gene locus_tag LOCUS_47970 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001211849.1:di-heme enzyme >Feature sequence1326 1891 497 gene locus_tag LOCUS_47980 1891 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 1845 2096 gene locus_tag LOCUS_47990 1845 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 >Feature sequence1327 903 115 gene locus_tag LOCUS_48000 903 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 1307 972 gene locus_tag LOCUS_48010 1307 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 1814 1353 gene locus_tag LOCUS_48020 1814 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 >Feature sequence1328 366 647 gene locus_tag LOCUS_48030 366 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 1697 669 gene locus_tag LOCUS_48040 1697 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 1666 2463 gene locus_tag LOCUS_48050 1666 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 >Feature sequence1329 2284 1655 gene locus_tag LOCUS_48060 2284 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 >Feature sequence1330 2105 354 gene locus_tag LOCUS_48070 2105 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120253.1 protein_id gnl|my_center|LOCUS_48070 >Feature sequence1331 1122 1865 gene locus_tag LOCUS_48080 1122 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957581.1 protein_id gnl|my_center|LOCUS_48080 >Feature sequence1332 1770 652 gene locus_tag LOCUS_48090 1770 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 2355 1825 gene locus_tag LOCUS_48100 2355 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 >Feature sequence1333 335 9 gene locus_tag LOCUS_48110 335 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 696 1565 gene locus_tag LOCUS_48120 696 1565 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974235.1 protein_id gnl|my_center|LOCUS_48120 1725 2699 gene locus_tag LOCUS_48130 1725 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 >Feature sequence1334 877 1728 gene locus_tag LOCUS_48140 877 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 >Feature sequence1335 >Feature sequence1336 825 1319 gene locus_tag LOCUS_48150 825 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 >Feature sequence1337 201 1958 gene locus_tag LOCUS_48160 201 1958 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_48160 1971 2609 gene locus_tag LOCUS_48170 1971 2609 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105355.1 protein_id gnl|my_center|LOCUS_48170 >Feature sequence1338 <1 1698 gene locus_tag LOCUS_48180 <1 1698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94461:primosomal protein N' 2348 1797 gene locus_tag LOCUS_48190 2348 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036533.1 protein_id gnl|my_center|LOCUS_48190 >Feature sequence1339 617 1639 gene locus_tag LOCUS_48200 617 1639 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144155.1 protein_id gnl|my_center|LOCUS_48200 2520 1567 gene locus_tag LOCUS_48210 2520 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 >Feature sequence1340 459 1055 gene locus_tag LOCUS_48220 459 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 1106 1633 gene locus_tag LOCUS_48230 1106 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 1630 2286 gene locus_tag LOCUS_48240 1630 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 >Feature sequence1341 1979 1230 gene locus_tag LOCUS_48250 1979 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 >Feature sequence1342 >Feature sequence1343 125 856 gene locus_tag LOCUS_48260 125 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 >Feature sequence1344 >Feature sequence1345 >Feature sequence1346 1548 1159 gene locus_tag LOCUS_48270 1548 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 2041 1649 gene locus_tag LOCUS_48280 2041 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 >Feature sequence1347 389 1381 gene locus_tag LOCUS_48290 gene pyrD 389 1381 CDS product dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB9 protein_id gnl|my_center|LOCUS_48290 1599 2432 gene locus_tag LOCUS_48300 gene psd 1599 2432 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK8 protein_id gnl|my_center|LOCUS_48300 >Feature sequence1348 412 1659 gene locus_tag LOCUS_48310 412 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 >Feature sequence1349 1345 686 gene locus_tag LOCUS_48320 1345 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 >Feature sequence1350 854 1945 gene locus_tag LOCUS_48330 854 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 >Feature sequence1351 1253 783 gene locus_tag LOCUS_48340 gene bfr 1253 783 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2S8 protein_id gnl|my_center|LOCUS_48340 1666 1484 gene locus_tag LOCUS_48350 1666 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 <2668 1913 gene locus_tag LOCUS_48360 <2668 1913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141553.1:peptidase S8 >Feature sequence1352 343 1014 gene locus_tag LOCUS_48370 343 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_48370 1071 2063 gene locus_tag LOCUS_48380 gene yngG 1071 2063 CDS product hydroxymethylglutaryl-CoA lyase YngG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34873 protein_id gnl|my_center|LOCUS_48380 >Feature sequence1353 348 1400 gene locus_tag LOCUS_48390 348 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 1531 1603 gene locus_tag LOCUS_t00950 1531 1603 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2091 1729 gene locus_tag LOCUS_48400 2091 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 >Feature sequence1354 2604 556 gene locus_tag LOCUS_48410 2604 556 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_48410 >Feature sequence1355 1267 329 gene locus_tag LOCUS_48420 1267 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 1695 2600 gene locus_tag LOCUS_48430 1695 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 >Feature sequence1356 281 2356 gene locus_tag LOCUS_48440 281 2356 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_48440 >Feature sequence1357 1660 98 gene locus_tag LOCUS_48450 gene speE1 1660 98 CDS product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 protein_id gnl|my_center|LOCUS_48450 >Feature sequence1358 1535 813 gene locus_tag LOCUS_48460 gene mhpC 1535 813 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639024.1 protein_id gnl|my_center|LOCUS_48460 >Feature sequence1359 2022 802 gene locus_tag LOCUS_48470 2022 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 2414 2097 gene locus_tag LOCUS_48480 2414 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 >Feature sequence1360 2017 854 gene locus_tag LOCUS_48490 2017 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 <2653 2080 gene locus_tag LOCUS_48500 <2653 2080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKU1:gamma-glutamyl phosphate reductase >Feature sequence1361 71 1063 gene locus_tag LOCUS_48510 71 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 1537 1070 gene locus_tag LOCUS_48520 1537 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 >Feature sequence1362 1061 1738 gene locus_tag LOCUS_48530 1061 1738 CDS product biopolymer transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 protein_id gnl|my_center|LOCUS_48530 1735 2160 gene locus_tag LOCUS_48540 1735 2160 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010438282.1 protein_id gnl|my_center|LOCUS_48540 >Feature sequence1363 191 838 gene locus_tag LOCUS_48550 191 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 1150 2553 gene locus_tag LOCUS_48560 1150 2553 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_48560 >Feature sequence1364 >Feature sequence1365 516 322 gene locus_tag LOCUS_48570 516 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 2644 1634 gene locus_tag LOCUS_48580 2644 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 >Feature sequence1366 1896 619 gene locus_tag LOCUS_48590 gene ftsA 1896 619 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E0 protein_id gnl|my_center|LOCUS_48590 >Feature sequence1367 >Feature sequence1368 <1 574 gene locus_tag LOCUS_48600 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UED8:acetyl-coenzyme A synthetase 1097 636 gene locus_tag LOCUS_48610 1097 636 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_48610 2170 1250 gene locus_tag LOCUS_48620 gene dhmA 2170 1250 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A919 protein_id gnl|my_center|LOCUS_48620 2323 2601 gene locus_tag LOCUS_48630 2323 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 >Feature sequence1369 1890 37 gene locus_tag LOCUS_48640 1890 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 1951 2460 gene locus_tag LOCUS_48650 1951 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 >Feature sequence1370 >Feature sequence1371 581 1852 gene locus_tag LOCUS_48660 581 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 1901 2320 gene locus_tag LOCUS_48670 1901 2320 CDS product acetoin utilization protein AcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420573.1 protein_id gnl|my_center|LOCUS_48670 2502 2317 gene locus_tag LOCUS_48680 2502 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 >Feature sequence1372 <1 2546 gene locus_tag LOCUS_48690 <1 2546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403109.1:multidrug transporter AcrB >Feature sequence1373 535 197 gene locus_tag LOCUS_48700 535 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 <2638 539 gene locus_tag LOCUS_48710 <2638 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7TZN3:serine/threonine-protein kinase PknE >Feature sequence1374 1115 2176 gene locus_tag LOCUS_48720 1115 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 >Feature sequence1375 1081 521 gene locus_tag LOCUS_48730 1081 521 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_48730 1963 1247 gene locus_tag LOCUS_48740 1963 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 <2632 2034 gene locus_tag LOCUS_48750 <2632 2034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015368806.1:DNA-binding response regulator >Feature sequence1376 <2631 2128 gene locus_tag LOCUS_48760 <2631 2128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026866.1:oxidoreductase >Feature sequence1377 1932 181 gene locus_tag LOCUS_48770 1932 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 >Feature sequence1378 <1 557 gene locus_tag LOCUS_48780 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003895122.1:C-5 sterol desaturase 2630 561 gene locus_tag LOCUS_48790 2630 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 >Feature sequence1379 1814 2365 gene locus_tag LOCUS_48800 1814 2365 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975315.1 protein_id gnl|my_center|LOCUS_48800 >Feature sequence1380 >Feature sequence1381 1857 1333 gene locus_tag LOCUS_48810 1857 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 <2619 2007 gene locus_tag LOCUS_48820 <2619 2007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894962.1:MBL fold metallo-hydrolase >Feature sequence1382 <1 1297 gene locus_tag LOCUS_48830 <1 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090652.1:fatty-acid--CoA ligase >Feature sequence1383 <2611 580 gene locus_tag LOCUS_48840 <2611 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123208.1:serine/threonine protein kinase >Feature sequence1384 >Feature sequence1385 2384 2067 gene locus_tag LOCUS_48850 2384 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 >Feature sequence1386 987 256 gene locus_tag LOCUS_48860 987 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 >Feature sequence1387 1010 2242 gene locus_tag LOCUS_48870 1010 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 >Feature sequence1388 <1 1380 gene locus_tag LOCUS_48880 <1 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035214612.1:ferredoxin <2607 1463 gene locus_tag LOCUS_48890 <2607 1463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000390637.1:acetyl-CoA acetyltransferase >Feature sequence1389 <1 662 gene locus_tag LOCUS_48900 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74A60:putative ribosome biogenesis GTPase RsgA <2607 685 gene locus_tag LOCUS_48910 <2607 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085075.1:two-component hybrid sensor and regulator >Feature sequence1390 1421 1888 gene locus_tag LOCUS_48920 1421 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 >Feature sequence1391 1859 885 gene locus_tag LOCUS_48930 1859 885 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_48930 2291 1917 gene locus_tag LOCUS_48940 2291 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 >Feature sequence1392 529 1164 gene locus_tag LOCUS_48950 529 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 >Feature sequence1393 988 1530 gene locus_tag LOCUS_48960 988 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 1527 2306 gene locus_tag LOCUS_48970 1527 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 >Feature sequence1394 1909 1127 gene locus_tag LOCUS_48980 1909 1127 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093932.1 protein_id gnl|my_center|LOCUS_48980 >Feature sequence1395 2053 791 gene locus_tag LOCUS_48990 2053 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 >Feature sequence1396 >Feature sequence1397 >Feature sequence1398 1243 266 gene locus_tag LOCUS_49000 1243 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 >Feature sequence1399 <1 885 gene locus_tag LOCUS_49010 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083977.1:acyl-CoA dehydrogenase >Feature sequence1400 532 86 gene locus_tag LOCUS_49020 532 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 1699 782 gene locus_tag LOCUS_49030 1699 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 >Feature sequence1401 224 1084 gene locus_tag LOCUS_49040 224 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 >Feature sequence1402 <1 1081 gene locus_tag LOCUS_49050 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728243.1:formate dehydrogenase 1822 1235 gene locus_tag LOCUS_49060 1822 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 >Feature sequence1403 >Feature sequence1404 749 2530 gene locus_tag LOCUS_49070 gene speE1 749 2530 CDS product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L091 protein_id gnl|my_center|LOCUS_49070 >Feature sequence1405 <1 1394 gene locus_tag LOCUS_49080 <1 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198181.1:glycosyl hydrolase 2251 1391 gene locus_tag LOCUS_49090 2251 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 >Feature sequence1406 <1 1430 gene locus_tag LOCUS_49100 <1 1430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272653.1:bifunctional 3'-5' exonuclease/DNA polymerase >Feature sequence1407 1485 673 gene locus_tag LOCUS_49110 1485 673 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256865.1 protein_id gnl|my_center|LOCUS_49110 2474 1482 gene locus_tag LOCUS_49120 2474 1482 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257671.1 protein_id gnl|my_center|LOCUS_49120 >Feature sequence1408 2281 944 gene locus_tag LOCUS_49130 2281 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 >Feature sequence1409 814 554 gene locus_tag LOCUS_49140 814 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 <2580 811 gene locus_tag LOCUS_49150 <2580 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258027.1:ATPase >Feature sequence1410 1205 630 gene locus_tag LOCUS_49160 1205 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 2369 1215 gene locus_tag LOCUS_49170 2369 1215 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110496.1 protein_id gnl|my_center|LOCUS_49170 >Feature sequence1411 2 667 gene locus_tag LOCUS_49180 2 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 1246 698 gene locus_tag LOCUS_49190 1246 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084136.1 protein_id gnl|my_center|LOCUS_49190 >Feature sequence1412 >Feature sequence1413 1290 1655 gene locus_tag LOCUS_49200 1290 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 >Feature sequence1414 866 795 gene locus_tag LOCUS_t00960 866 795 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <2569 979 gene locus_tag LOCUS_49210 <2569 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028428.1:AMP-dependent synthetase >Feature sequence1415 221 1657 gene locus_tag LOCUS_49220 221 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 2401 1682 gene locus_tag LOCUS_49230 2401 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 >Feature sequence1416 400 1119 gene locus_tag LOCUS_49240 400 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 1215 2066 gene locus_tag LOCUS_49250 1215 2066 CDS product putative epoxide hydrolase EphC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705296.1 protein_id gnl|my_center|LOCUS_49250 >Feature sequence1417 1176 181 gene locus_tag LOCUS_49260 1176 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 1267 1935 gene locus_tag LOCUS_49270 1267 1935 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640623.1 protein_id gnl|my_center|LOCUS_49270 >Feature sequence1418 348 1040 gene locus_tag LOCUS_49280 348 1040 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888162.1 protein_id gnl|my_center|LOCUS_49280 1254 2165 gene locus_tag LOCUS_49290 1254 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 >Feature sequence1419 >Feature sequence1420 36 764 gene locus_tag LOCUS_49300 36 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 826 2142 gene locus_tag LOCUS_49310 826 2142 CDS product putative acetyl-CoA C-acyltransferase (thiolase) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701746.1 protein_id gnl|my_center|LOCUS_49310 >Feature sequence1421 255 1382 gene locus_tag LOCUS_49320 255 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688558.1 protein_id gnl|my_center|LOCUS_49320 1774 1379 gene locus_tag LOCUS_49330 gene dksA 1774 1379 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF1 protein_id gnl|my_center|LOCUS_49330 2516 1926 gene locus_tag LOCUS_49340 2516 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 >Feature sequence1422 501 64 gene locus_tag LOCUS_49350 501 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 652 1782 gene locus_tag LOCUS_49360 652 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 <2562 1824 gene locus_tag LOCUS_49370 <2562 1824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023368.1:ribosome small subunit-dependent GTPase >Feature sequence1423 57 2528 gene locus_tag LOCUS_49380 57 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 >Feature sequence1424 >Feature sequence1425 217 759 gene locus_tag LOCUS_49390 217 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 866 1378 gene locus_tag LOCUS_49400 866 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 1416 2117 gene locus_tag LOCUS_49410 1416 2117 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_49410 >Feature sequence1426 805 1536 gene locus_tag LOCUS_49420 805 1536 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074612.1 protein_id gnl|my_center|LOCUS_49420 >Feature sequence1427 679 62 gene locus_tag LOCUS_49430 679 62 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7S4 protein_id gnl|my_center|LOCUS_49430 837 1823 gene locus_tag LOCUS_49440 837 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 2100 2291 gene locus_tag LOCUS_49450 2100 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 >Feature sequence1428 365 934 gene locus_tag LOCUS_49460 365 934 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_49460 1076 1489 gene locus_tag LOCUS_49470 1076 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 >Feature sequence1429 >Feature sequence1430 157 495 gene locus_tag LOCUS_49480 gene ihfB 157 495 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP8 protein_id gnl|my_center|LOCUS_49480 1125 2531 gene locus_tag LOCUS_49490 gene sthA 1125 2531 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EPQ0 protein_id gnl|my_center|LOCUS_49490 >Feature sequence1431 445 1050 gene locus_tag LOCUS_49500 445 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 >Feature sequence1432 2485 1700 gene locus_tag LOCUS_49510 2485 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 >Feature sequence1433 1748 912 gene locus_tag LOCUS_49520 1748 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 2020 1745 gene locus_tag LOCUS_49530 2020 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 >Feature sequence1434 389 2434 gene locus_tag LOCUS_49540 389 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 >Feature sequence1435 887 243 gene locus_tag LOCUS_49550 887 243 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 protein_id gnl|my_center|LOCUS_49550 >Feature sequence1436 1876 722 gene locus_tag LOCUS_49560 1876 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 >Feature sequence1437 823 1458 gene locus_tag LOCUS_49570 823 1458 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972504.1 protein_id gnl|my_center|LOCUS_49570 2327 1461 gene locus_tag LOCUS_49580 2327 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 >Feature sequence1438 2314 719 gene locus_tag LOCUS_49590 2314 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 >Feature sequence1439 <1 791 gene locus_tag LOCUS_49600 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958545.1:acyl-CoA synthetase 1491 808 gene locus_tag LOCUS_49610 1491 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 2042 1683 gene locus_tag LOCUS_49620 2042 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 >Feature sequence1440 >Feature sequence1441 1008 1595 gene locus_tag LOCUS_49630 1008 1595 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943048.1 protein_id gnl|my_center|LOCUS_49630 >Feature sequence1442 <1 717 gene locus_tag LOCUS_49640 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941139.1:sensor histidine kinase >Feature sequence1443 1233 1646 gene locus_tag LOCUS_49650 1233 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 >Feature sequence1444 2313 1654 gene locus_tag LOCUS_49660 2313 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 >Feature sequence1445 <1 1963 gene locus_tag LOCUS_49670 <1 1963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765636.1:alpha-amylase 2063 2491 gene locus_tag LOCUS_49680 2063 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_49680 >Feature sequence1446 1725 619 gene locus_tag LOCUS_49690 1725 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 2514 1840 gene locus_tag LOCUS_49700 2514 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 >Feature sequence1447 <1 1519 gene locus_tag LOCUS_49710 <1 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404014.1:membrane protein >Feature sequence1448 254 460 gene locus_tag LOCUS_49720 gene rpmI 254 460 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189N0 protein_id gnl|my_center|LOCUS_49720 464 823 gene locus_tag LOCUS_49730 gene rplT 464 823 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIQ0 protein_id gnl|my_center|LOCUS_49730 952 1992 gene locus_tag LOCUS_49740 gene pheS 952 1992 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D00 protein_id gnl|my_center|LOCUS_49740 >Feature sequence1449 <1 1814 gene locus_tag LOCUS_49750 <1 1814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141952.1:polyketide synthase >Feature sequence1450 652 359 gene locus_tag LOCUS_49760 652 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 >Feature sequence1451 392 922 gene locus_tag LOCUS_49770 392 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 1803 973 gene locus_tag LOCUS_49780 gene linX 1803 973 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552055.1 protein_id gnl|my_center|LOCUS_49780 >Feature sequence1452 914 264 gene locus_tag LOCUS_49790 914 264 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403961.1 protein_id gnl|my_center|LOCUS_49790 1728 1117 gene locus_tag LOCUS_49800 1728 1117 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403961.1 protein_id gnl|my_center|LOCUS_49800 >Feature sequence1453 1644 613 gene locus_tag LOCUS_49810 1644 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 2117 1752 gene locus_tag LOCUS_49820 2117 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 2458 2243 gene locus_tag LOCUS_49830 2458 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 >Feature sequence1454 209 427 gene locus_tag LOCUS_49840 209 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 629 1840 gene locus_tag LOCUS_49850 629 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 1892 2446 gene locus_tag LOCUS_49860 1892 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 >Feature sequence1455 1029 424 gene locus_tag LOCUS_49870 1029 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 1298 1140 gene locus_tag LOCUS_49880 1298 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 >Feature sequence1456 772 1038 gene locus_tag LOCUS_49890 772 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 >Feature sequence1457 <1 1118 gene locus_tag LOCUS_49900 <1 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529458.1:histidine kinase 1734 1126 gene locus_tag LOCUS_49910 1734 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 >Feature sequence1458 986 1990 gene locus_tag LOCUS_49920 986 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 >Feature sequence1459 >Feature sequence1460 >Feature sequence1461 >Feature sequence1462 823 1482 gene locus_tag LOCUS_49930 823 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 >Feature sequence1463 1203 361 gene locus_tag LOCUS_49940 1203 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 >Feature sequence1464 >Feature sequence1465 1127 606 gene locus_tag LOCUS_49950 1127 606 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_49950 1364 1942 gene locus_tag LOCUS_49960 1364 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 >Feature sequence1466 2084 1512 gene locus_tag LOCUS_49970 2084 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 >Feature sequence1467 221 1030 gene locus_tag LOCUS_49980 221 1030 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_49980 1392 1090 gene locus_tag LOCUS_49990 1392 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 1439 1678 gene locus_tag LOCUS_50000 1439 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 >Feature sequence1468 475 1665 gene locus_tag LOCUS_50010 475 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 >Feature sequence1469 47 1735 gene locus_tag LOCUS_50020 47 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 >Feature sequence1470 1360 461 gene locus_tag LOCUS_50030 1360 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 1660 1427 gene locus_tag LOCUS_50040 1660 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 1596 2447 gene locus_tag LOCUS_50050 1596 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 >Feature sequence1471 >Feature sequence1472 1915 680 gene locus_tag LOCUS_50060 1915 680 CDS product ser/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195471.1 protein_id gnl|my_center|LOCUS_50060 >Feature sequence1473 1198 761 gene locus_tag LOCUS_50070 1198 761 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 protein_id gnl|my_center|LOCUS_50070 1245 1430 gene locus_tag LOCUS_50080 1245 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 1535 1918 gene locus_tag LOCUS_50090 1535 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 >Feature sequence1474 1368 769 gene locus_tag LOCUS_50100 1368 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 <2467 1394 gene locus_tag LOCUS_50110 <2467 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728359.1:MFS transporter >Feature sequence1475 2089 236 gene locus_tag LOCUS_50120 2089 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 >Feature sequence1476 >Feature sequence1477 >Feature sequence1478 1337 201 gene locus_tag LOCUS_50130 1337 201 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061731.1 protein_id gnl|my_center|LOCUS_50130 2378 1344 gene locus_tag LOCUS_50140 gene wcaG 2378 1344 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067556.1 protein_id gnl|my_center|LOCUS_50140 >Feature sequence1479 <1 506 gene locus_tag LOCUS_50150 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973876.1:DNA mismatch repair protein MutT 992 513 gene locus_tag LOCUS_50160 992 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106151.1 protein_id gnl|my_center|LOCUS_50160 2007 982 gene locus_tag LOCUS_50170 2007 982 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259326.1 protein_id gnl|my_center|LOCUS_50170 2363 2091 gene locus_tag LOCUS_50180 2363 2091 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920730.1 protein_id gnl|my_center|LOCUS_50180 >Feature sequence1480 1292 2365 gene locus_tag LOCUS_50190 gene aao 1292 2365 CDS product amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409545.1 protein_id gnl|my_center|LOCUS_50190 >Feature sequence1481 >Feature sequence1482 <1 1438 gene locus_tag LOCUS_50200 <1 1438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392429.1:serine/threonine protein kinase >Feature sequence1483 <1 659 gene locus_tag LOCUS_50210 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KAW7:homoserine kinase 1067 666 gene locus_tag LOCUS_50220 1067 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 >Feature sequence1484 <1 722 gene locus_tag LOCUS_50230 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482649.1:outer membrane lipoprotein-sorting protein 786 2003 gene locus_tag LOCUS_50240 786 2003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_50240 >Feature sequence1485 <1 1235 gene locus_tag LOCUS_50250 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939648.1:ABC transporter permease 2160 1426 gene locus_tag LOCUS_50260 2160 1426 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416945.1 protein_id gnl|my_center|LOCUS_50260 >Feature sequence1486 1739 42 gene locus_tag LOCUS_50270 1739 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 1948 2301 gene locus_tag LOCUS_50280 1948 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 >Feature sequence1487 >Feature sequence1488 1230 202 gene locus_tag LOCUS_50290 1230 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 2383 1250 gene locus_tag LOCUS_50300 2383 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 >Feature sequence1489 817 1806 gene locus_tag LOCUS_50310 gene xerC 817 1806 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW0 protein_id gnl|my_center|LOCUS_50310 <2444 1817 gene locus_tag LOCUS_50320 <2444 1817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001044441.1:M23 family metallopeptidase >Feature sequence1490 2326 905 gene locus_tag LOCUS_50330 2326 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 >Feature sequence1491 915 193 gene locus_tag LOCUS_50340 915 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 1819 935 gene locus_tag LOCUS_50350 1819 935 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_50350 >Feature sequence1492 1581 316 gene locus_tag LOCUS_50360 1581 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 >Feature sequence1493 <1 610 gene locus_tag LOCUS_50370 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797789.1:isochorismatase <2436 720 gene locus_tag LOCUS_50380 <2436 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933213.1:peptidase M16 >Feature sequence1494 <2436 1358 gene locus_tag LOCUS_50390 <2436 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKW6:ATP-dependent DNA helicase RecG >Feature sequence1495 1123 1650 gene locus_tag LOCUS_50400 1123 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 >Feature sequence1496 1014 2213 gene locus_tag LOCUS_50410 1014 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 >Feature sequence1497 581 75 gene locus_tag LOCUS_50420 gene cheW-2 581 75 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_50420 1138 578 gene locus_tag LOCUS_50430 1138 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 <2430 1186 gene locus_tag LOCUS_50440 <2430 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942862.1:chemotaxis protein CheA >Feature sequence1498 1418 2146 gene locus_tag LOCUS_50450 gene lipB 1418 2146 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLQ3 protein_id gnl|my_center|LOCUS_50450 >Feature sequence1499 78 1052 gene locus_tag LOCUS_50460 78 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 1067 2398 gene locus_tag LOCUS_50470 1067 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 >Feature sequence1500 >Feature sequence1501 <1 565 gene locus_tag LOCUS_50480 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937634.1:exopolysaccharide biosynthesis protein >Feature sequence1502 >Feature sequence1503 1156 1809 gene locus_tag LOCUS_50490 1156 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 <2422 1823 gene locus_tag LOCUS_50500 <2422 1823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258943.1:short-chain dehydrogenase >Feature sequence1504 1770 1270 gene locus_tag LOCUS_50510 1770 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 >Feature sequence1505 >Feature sequence1506 115 996 gene locus_tag LOCUS_50520 115 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 1152 2396 gene locus_tag LOCUS_50530 1152 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 >Feature sequence1507 483 271 gene locus_tag LOCUS_50540 483 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50540 373 1851 gene locus_tag LOCUS_50550 373 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 >Feature sequence1508 >Feature sequence1509 427 1152 gene locus_tag LOCUS_50560 427 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 2049 1156 gene locus_tag LOCUS_50570 2049 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67109 protein_id gnl|my_center|LOCUS_50570 >Feature sequence1510 982 332 gene locus_tag LOCUS_50580 982 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 >Feature sequence1511 55 2259 gene locus_tag LOCUS_50590 55 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 2401 2329 gene locus_tag LOCUS_t00970 2401 2329 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1512 300 2132 gene locus_tag LOCUS_50600 gene recJ 300 2132 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_50600 >Feature sequence1513 >Feature sequence1514 1540 356 gene locus_tag LOCUS_50610 1540 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 2341 1568 gene locus_tag LOCUS_50620 2341 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 >Feature sequence1515 <1 1725 gene locus_tag LOCUS_50630 <1 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085075.1:two-component hybrid sensor and regulator >Feature sequence1516 347 769 gene locus_tag LOCUS_50640 347 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 766 1611 gene locus_tag LOCUS_50650 766 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 1648 1555 gene locus_tag LOCUS_t00980 1648 1555 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1621 2256 gene locus_tag LOCUS_50660 1621 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 >Feature sequence1517 >Feature sequence1518 315 551 gene locus_tag LOCUS_50670 315 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 >Feature sequence1519 1154 471 gene locus_tag LOCUS_50680 1154 471 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390306.1 protein_id gnl|my_center|LOCUS_50680 >Feature sequence1520 >Feature sequence1521 >Feature sequence1522 >Feature sequence1523 >Feature sequence1524 >Feature sequence1525 253 846 gene locus_tag LOCUS_50690 253 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 2011 866 gene locus_tag LOCUS_50700 2011 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 >Feature sequence1526 >Feature sequence1527 39 878 gene locus_tag LOCUS_50710 39 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 972 2036 gene locus_tag LOCUS_50720 972 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 >Feature sequence1528 <1 1458 gene locus_tag LOCUS_50730 <1 1458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257124.1:hybrid sensor histidine kinase/response regulator >Feature sequence1529 >Feature sequence1530 1662 2297 gene locus_tag LOCUS_50740 1662 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 >Feature sequence1531 588 1028 gene locus_tag LOCUS_50750 588 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 1028 1423 gene locus_tag LOCUS_50760 1028 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 <2382 1449 gene locus_tag LOCUS_50770 <2382 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121952.1:membrane protein >Feature sequence1532 877 1941 gene locus_tag LOCUS_50780 877 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 2033 2335 gene locus_tag LOCUS_50790 2033 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 >Feature sequence1533 <1 1755 gene locus_tag LOCUS_50800 <1 1755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943733.1:DNA translocase FtsK >Feature sequence1534 185 931 gene locus_tag LOCUS_50810 185 931 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268356.1 protein_id gnl|my_center|LOCUS_50810 931 1440 gene locus_tag LOCUS_50820 931 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 >Feature sequence1535 715 1569 gene locus_tag LOCUS_50830 715 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 >Feature sequence1536 >Feature sequence1537 <2372 1209 gene locus_tag LOCUS_50840 <2372 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088351.1:NADPH:quinone oxidoreductase >Feature sequence1538 3 467 gene locus_tag LOCUS_50850 3 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 1952 501 gene locus_tag LOCUS_50860 1952 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 >Feature sequence1539 906 124 gene locus_tag LOCUS_50870 906 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 >Feature sequence1540 394 1581 gene locus_tag LOCUS_50880 394 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705473.1 protein_id gnl|my_center|LOCUS_50880 >Feature sequence1541 145 1380 gene locus_tag LOCUS_50890 145 1380 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_50890 1380 2120 gene locus_tag LOCUS_50900 1380 2120 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 protein_id gnl|my_center|LOCUS_50900 >Feature sequence1542 186 830 gene locus_tag LOCUS_50910 186 830 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_50910 827 1939 gene locus_tag LOCUS_50920 827 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 1936 2292 gene locus_tag LOCUS_50930 1936 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 >Feature sequence1543 4 76 gene locus_tag LOCUS_t00990 4 76 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 119 192 gene locus_tag LOCUS_t01000 119 192 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 618 1496 gene locus_tag LOCUS_50940 618 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 1493 1870 gene locus_tag LOCUS_50950 1493 1870 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406684.1 protein_id gnl|my_center|LOCUS_50950 >Feature sequence1544 >Feature sequence1545 1483 404 gene locus_tag LOCUS_50960 1483 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 <2366 1518 gene locus_tag LOCUS_50970 <2366 1518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203595.1:alginate O-acetyltransferase >Feature sequence1546 2261 1332 gene locus_tag LOCUS_50980 2261 1332 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_50980 >Feature sequence1547 720 169 gene locus_tag LOCUS_50990 720 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 1823 717 gene locus_tag LOCUS_51000 1823 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 >Feature sequence1548 >Feature sequence1549 >Feature sequence1550 >Feature sequence1551 869 39 gene locus_tag LOCUS_51010 869 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 2227 869 gene locus_tag LOCUS_51020 2227 869 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SMG8 protein_id gnl|my_center|LOCUS_51020 >Feature sequence1552 <1 997 gene locus_tag LOCUS_51030 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0Q0:2-heptyl-3-hydroxy-4(1H)-quinolone synthase <2360 1064 gene locus_tag LOCUS_51040 <2360 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WHT5:putative zinc protease >Feature sequence1553 983 759 gene locus_tag LOCUS_51050 983 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 2007 1273 gene locus_tag LOCUS_51060 2007 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 >Feature sequence1554 1342 2163 gene locus_tag LOCUS_51070 1342 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091835.1 protein_id gnl|my_center|LOCUS_51070 >Feature sequence1555 789 1589 gene locus_tag LOCUS_51080 789 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 >Feature sequence1556 1078 461 gene locus_tag LOCUS_51090 1078 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 >Feature sequence1557 >Feature sequence1558 <2357 934 gene locus_tag LOCUS_51100 <2357 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204518.1:polyketide synthase note possible pseudo, frameshifted >Feature sequence1559 >Feature sequence1560 <2356 1284 gene locus_tag LOCUS_51110 <2356 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WIB1:phospholipase C 3 >Feature sequence1561 974 768 gene locus_tag LOCUS_51120 974 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 1311 2045 gene locus_tag LOCUS_51130 1311 2045 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 protein_id gnl|my_center|LOCUS_51130 >Feature sequence1562 477 298 gene locus_tag LOCUS_51140 477 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 1061 594 gene locus_tag LOCUS_51150 1061 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 >Feature sequence1563 7 513 gene locus_tag LOCUS_51160 7 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 1153 533 gene locus_tag LOCUS_51170 1153 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 1368 2105 gene locus_tag LOCUS_51180 1368 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 >Feature sequence1564 <1 1239 gene locus_tag LOCUS_51190 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250730.1:oligopeptide transporter, OPT family 1236 1763 gene locus_tag LOCUS_51200 1236 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 >Feature sequence1565 >Feature sequence1566 764 1705 gene locus_tag LOCUS_51210 764 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 >Feature sequence1567 >Feature sequence1568 >Feature sequence1569 383 1207 gene locus_tag LOCUS_51220 383 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 >Feature sequence1570 >Feature sequence1571 2088 1096 gene locus_tag LOCUS_51230 2088 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 >Feature sequence1572 >Feature sequence1573 282 854 gene locus_tag LOCUS_51240 282 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 1418 1083 gene locus_tag LOCUS_51250 1418 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530008.1 protein_id gnl|my_center|LOCUS_51250 >Feature sequence1574 1413 2153 gene locus_tag LOCUS_51260 gene phoU 1413 2153 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH75 protein_id gnl|my_center|LOCUS_51260 >Feature sequence1575 50 1027 gene locus_tag LOCUS_51270 50 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 1121 1909 gene locus_tag LOCUS_51280 1121 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 protein_id gnl|my_center|LOCUS_51280 >Feature sequence1576 49 1584 gene locus_tag LOCUS_51290 49 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 2036 1659 gene locus_tag LOCUS_51300 2036 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 >Feature sequence1577 1562 468 gene locus_tag LOCUS_51310 1562 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 >Feature sequence1578 773 1420 gene locus_tag LOCUS_51320 773 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 >Feature sequence1579 1278 2048 gene locus_tag LOCUS_51330 1278 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957581.1 protein_id gnl|my_center|LOCUS_51330 >Feature sequence1580 193 345 gene locus_tag LOCUS_51340 193 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 2109 490 gene locus_tag LOCUS_51350 2109 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 >Feature sequence1581 7 996 gene locus_tag LOCUS_51360 7 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 <2322 1164 gene locus_tag LOCUS_51370 <2322 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031173.1:MBL fold metallo-hydrolase >Feature sequence1582 234 716 gene locus_tag LOCUS_51380 234 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 >Feature sequence1583 <1 685 gene locus_tag LOCUS_51390 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103576.1:hybrid sensor histidine kinase/response regulator 829 1278 gene locus_tag LOCUS_51400 829 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 >Feature sequence1584 353 2023 gene locus_tag LOCUS_51410 353 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 >Feature sequence1585 266 1159 gene locus_tag LOCUS_51420 266 1159 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113086.1 protein_id gnl|my_center|LOCUS_51420 >Feature sequence1586 1820 2266 gene locus_tag LOCUS_51430 1820 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 >Feature sequence1587 >Feature sequence1588 1465 257 gene locus_tag LOCUS_51440 1465 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 <2312 1462 gene locus_tag LOCUS_51450 <2312 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029095.1:ATPase >Feature sequence1589 611 108 gene locus_tag LOCUS_51460 611 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 1627 731 gene locus_tag LOCUS_51470 1627 731 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123806.1 protein_id gnl|my_center|LOCUS_51470 >Feature sequence1590 193 987 gene locus_tag LOCUS_51480 193 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 >Feature sequence1591 1346 156 gene locus_tag LOCUS_51490 1346 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 <2308 1471 gene locus_tag LOCUS_51500 <2308 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O25728:putative beta-lactamase HcpC >Feature sequence1592 22 1377 gene locus_tag LOCUS_51510 22 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 >Feature sequence1593 756 1487 gene locus_tag LOCUS_51520 756 1487 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_51520 >Feature sequence1594 >Feature sequence1595 1972 1259 gene locus_tag LOCUS_51530 1972 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 >Feature sequence1596 502 1470 gene locus_tag LOCUS_51540 502 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 2160 1507 gene locus_tag LOCUS_51550 2160 1507 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140681.1 protein_id gnl|my_center|LOCUS_51550 >Feature sequence1597 40 1092 gene locus_tag LOCUS_51560 40 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 1697 1089 gene locus_tag LOCUS_51570 1697 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 >Feature sequence1598 292 2007 gene locus_tag LOCUS_51580 292 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 >Feature sequence1599 469 1764 gene locus_tag LOCUS_51590 469 1764 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888358.1 protein_id gnl|my_center|LOCUS_51590 >Feature sequence1600 >Feature sequence1601 >Feature sequence1602 >Feature sequence1603 <1 1848 gene locus_tag LOCUS_51600 <1 1848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:cation transporter >Feature sequence1604 <1 1328 gene locus_tag LOCUS_51610 <1 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258464.1:alkaline phosphatase >Feature sequence1605 >Feature sequence1606 1239 823 gene locus_tag LOCUS_51620 1239 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 >Feature sequence1607 <1 1391 gene locus_tag LOCUS_51630 <1 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964024.1:flagellar motor protein MotB >Feature sequence1608 <1 1394 gene locus_tag LOCUS_51640 <1 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941974.1:acetoacetate metabolism regulatory protein AtoC >Feature sequence1609 73 435 gene locus_tag LOCUS_51650 73 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 432 878 gene locus_tag LOCUS_51660 432 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 875 1678 gene locus_tag LOCUS_51670 gene fabG 875 1678 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 protein_id gnl|my_center|LOCUS_51670 >Feature sequence1610 756 361 gene locus_tag LOCUS_51680 756 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 979 1770 gene locus_tag LOCUS_51690 979 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 >Feature sequence1611 >Feature sequence1612 878 1876 gene locus_tag LOCUS_51700 878 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 >Feature sequence1613 201 923 gene locus_tag LOCUS_51710 201 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 920 1570 gene locus_tag LOCUS_51720 920 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 >Feature sequence1614 <1 1881 gene locus_tag LOCUS_51730 <1 1881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057122.1:two-component hybrid sensor and regulator >Feature sequence1615 >Feature sequence1616 >Feature sequence1617 1495 632 gene locus_tag LOCUS_51740 1495 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 >Feature sequence1618 1256 633 gene locus_tag LOCUS_51750 1256 633 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223682.1 protein_id gnl|my_center|LOCUS_51750 2274 1423 gene locus_tag LOCUS_51760 2274 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 >Feature sequence1619 1164 874 gene locus_tag LOCUS_51770 1164 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 >Feature sequence1620 >Feature sequence1621 >Feature sequence1622 >Feature sequence1623 >Feature sequence1624 343 657 gene locus_tag LOCUS_51780 343 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 969 1505 gene locus_tag LOCUS_51790 969 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 >Feature sequence1625 664 1146 gene locus_tag LOCUS_51800 664 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 >Feature sequence1626 914 372 gene locus_tag LOCUS_51810 914 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 1581 1024 gene locus_tag LOCUS_51820 1581 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 >Feature sequence1627 <2264 1122 gene locus_tag LOCUS_51830 <2264 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920988.1:pectate lyase >Feature sequence1628 >Feature sequence1629 415 1218 gene locus_tag LOCUS_51840 415 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 1318 1467 gene locus_tag LOCUS_51850 1318 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 >Feature sequence1630 1009 2040 gene locus_tag LOCUS_51860 gene selD 1009 2040 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ4 protein_id gnl|my_center|LOCUS_51860 >Feature sequence1631 1853 129 gene locus_tag LOCUS_51870 1853 129 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_51870 >Feature sequence1632 689 366 gene locus_tag LOCUS_51880 689 366 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256442.1 protein_id gnl|my_center|LOCUS_51880 >Feature sequence1633 <1 947 gene locus_tag LOCUS_51890 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011069641.1:guanylate cyclase 1124 1606 gene locus_tag LOCUS_51900 1124 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 >Feature sequence1634 491 1105 gene locus_tag LOCUS_51910 491 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 >Feature sequence1635 <1 1610 gene locus_tag LOCUS_51920 <1 1610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143091.1:serine hydrolase >Feature sequence1636 >Feature sequence1637 >Feature sequence1638 190 1398 gene locus_tag LOCUS_51930 190 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 >Feature sequence1639 >Feature sequence1640 <2245 794 gene locus_tag LOCUS_51940 <2245 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404983.1:Na-K-Cl cotransporter >Feature sequence1641 1778 384 gene locus_tag LOCUS_51950 1778 384 CDS product monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 protein_id gnl|my_center|LOCUS_51950 >Feature sequence1642 81 893 gene locus_tag LOCUS_51960 81 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 1815 934 gene locus_tag LOCUS_51970 1815 934 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_51970 >Feature sequence1643 >Feature sequence1644 28 215 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttcttggaagcggtcttcttcttgg 362 1192 gene locus_tag LOCUS_51980 362 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 1729 1235 gene locus_tag LOCUS_51990 1729 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 >Feature sequence1645 41 283 gene locus_tag LOCUS_52000 41 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 280 1830 gene locus_tag LOCUS_52010 280 1830 CDS product His-Xaa-Ser system radical SAM maturase HxsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479204.1 protein_id gnl|my_center|LOCUS_52010 >Feature sequence1646 >Feature sequence1647 <2235 1642 gene locus_tag LOCUS_52020 <2235 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64WS3:aminomethyltransferase >Feature sequence1648 613 1206 gene locus_tag LOCUS_52030 613 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459288.1 protein_id gnl|my_center|LOCUS_52030 1193 2059 gene locus_tag LOCUS_52040 1193 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 >Feature sequence1649 486 94 gene locus_tag LOCUS_52050 486 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 1248 826 gene locus_tag LOCUS_52060 1248 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 >Feature sequence1650 >Feature sequence1651 <1 547 gene locus_tag LOCUS_52070 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143363.1:glutathione-dependent reductase 564 812 gene locus_tag LOCUS_52080 564 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 <2221 841 gene locus_tag LOCUS_52090 <2221 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918909.1:penicillin amidase >Feature sequence1652 >Feature sequence1653 825 1874 gene locus_tag LOCUS_52100 825 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 >Feature sequence1654 1465 599 gene locus_tag LOCUS_52110 1465 599 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973401.1 protein_id gnl|my_center|LOCUS_52110 >Feature sequence1655 >Feature sequence1656 1757 603 gene locus_tag LOCUS_52120 1757 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 >Feature sequence1657 339 1388 gene locus_tag LOCUS_52130 339 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 1402 1632 gene locus_tag LOCUS_52140 1402 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 >Feature sequence1658 89 1420 gene locus_tag LOCUS_52150 89 1420 CDS product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877143.1 protein_id gnl|my_center|LOCUS_52150 >Feature sequence1659 <2209 934 gene locus_tag LOCUS_52160 <2209 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962644.1:peptidase M28 >Feature sequence1660 1900 683 gene locus_tag LOCUS_52170 1900 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 >Feature sequence1661 1322 318 gene locus_tag LOCUS_52180 1322 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121418.1 protein_id gnl|my_center|LOCUS_52180 <2207 1380 gene locus_tag LOCUS_52190 <2207 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121417.1:ATPase AAA >Feature sequence1662 252 719 gene locus_tag LOCUS_52200 252 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 790 1527 gene locus_tag LOCUS_52210 790 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 1895 1551 gene locus_tag LOCUS_52220 1895 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 >Feature sequence1663 2183 336 gene locus_tag LOCUS_52230 gene ggt 2183 336 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089891.1 protein_id gnl|my_center|LOCUS_52230 >Feature sequence1664 1758 874 gene locus_tag LOCUS_52240 gene dinD 1758 874 CDS product DNA-damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052162.1 protein_id gnl|my_center|LOCUS_52240 >Feature sequence1665 1788 781 gene locus_tag LOCUS_52250 1788 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 >Feature sequence1666 >Feature sequence1667 101 1528 gene locus_tag LOCUS_52260 gene rsmB 101 1528 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z4 protein_id gnl|my_center|LOCUS_52260 1632 2114 gene locus_tag LOCUS_52270 1632 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 >Feature sequence1668 1635 859 gene locus_tag LOCUS_52280 1635 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_52280 >Feature sequence1669 <1 1379 gene locus_tag LOCUS_52290 <1 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117742.1:cysteine proteinase >Feature sequence1670 1340 609 gene locus_tag LOCUS_52300 1340 609 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030956.1 protein_id gnl|my_center|LOCUS_52300 1820 1398 gene locus_tag LOCUS_52310 1820 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 >Feature sequence1671 1234 404 gene locus_tag LOCUS_52320 1234 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 >Feature sequence1672 >Feature sequence1673 139 927 gene locus_tag LOCUS_52330 139 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 <2191 958 gene locus_tag LOCUS_52340 <2191 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940909.1:RNA-binding transcriptional accessory protein >Feature sequence1674 <1 754 gene locus_tag LOCUS_52350 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942684.1:acetoacetate metabolism regulatory protein AtoC 767 1603 gene locus_tag LOCUS_52360 767 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 >Feature sequence1675 504 1508 gene locus_tag LOCUS_52370 504 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 >Feature sequence1676 565 1194 gene locus_tag LOCUS_52380 565 1194 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676633.1 protein_id gnl|my_center|LOCUS_52380 1191 1820 gene locus_tag LOCUS_52390 1191 1820 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027478.1 protein_id gnl|my_center|LOCUS_52390 >Feature sequence1677 >Feature sequence1678 333 1364 gene locus_tag LOCUS_52400 333 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 2048 1383 gene locus_tag LOCUS_52410 2048 1383 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769904.1 protein_id gnl|my_center|LOCUS_52410 >Feature sequence1679 759 1499 gene locus_tag LOCUS_52420 gene ate1 759 1499 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UET6 protein_id gnl|my_center|LOCUS_52420 >Feature sequence1680 2077 1349 gene locus_tag LOCUS_52430 2077 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 >Feature sequence1681 <2184 1441 gene locus_tag LOCUS_52440 <2184 1441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010908854.1:polyketide synthase >Feature sequence1682 >Feature sequence1683 >Feature sequence1684 >Feature sequence1685 >Feature sequence1686 >Feature sequence1687 >Feature sequence1688 >Feature sequence1689 493 717 gene locus_tag LOCUS_52450 493 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 1517 651 gene locus_tag LOCUS_52460 1517 651 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227488.1 protein_id gnl|my_center|LOCUS_52460 >Feature sequence1690 825 241 gene locus_tag LOCUS_52470 825 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 2175 937 gene locus_tag LOCUS_52480 2175 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 >Feature sequence1691 >Feature sequence1692 <1 1554 gene locus_tag LOCUS_52490 <1 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020246.1:tetratricopeptide repeat protein 1565 1924 gene locus_tag LOCUS_52500 1565 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 >Feature sequence1693 45 1889 gene locus_tag LOCUS_52510 45 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 >Feature sequence1694 >Feature sequence1695 354 1 gene locus_tag LOCUS_52520 354 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 >Feature sequence1696 <1 671 gene locus_tag LOCUS_52530 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963740.1:2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase 915 1709 gene locus_tag LOCUS_52540 915 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 >Feature sequence1697 <1 961 gene locus_tag LOCUS_52550 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971461.1:integrase 2124 1615 gene locus_tag LOCUS_52560 2124 1615 CDS product molecular chaperone Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_52560 >Feature sequence1698 263 769 gene locus_tag LOCUS_52570 263 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 >Feature sequence1699 906 1226 gene locus_tag LOCUS_52580 906 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 >Feature sequence1700 595 1425 gene locus_tag LOCUS_52590 595 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 <2163 1497 gene locus_tag LOCUS_52600 <2163 1497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000870126.1:NADPH:quinone oxidoreductase >Feature sequence1701 1051 197 gene locus_tag LOCUS_52610 1051 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 1202 1029 gene locus_tag LOCUS_52620 1202 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 >Feature sequence1702 560 1138 gene locus_tag LOCUS_52630 560 1138 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_52630 1203 1994 gene locus_tag LOCUS_52640 1203 1994 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947852.1 protein_id gnl|my_center|LOCUS_52640 >Feature sequence1703 1579 629 gene locus_tag LOCUS_52650 1579 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 >Feature sequence1704 935 630 gene locus_tag LOCUS_52660 935 630 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943600.1 protein_id gnl|my_center|LOCUS_52660 1204 2007 gene locus_tag LOCUS_52670 gene pcaD 1204 2007 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_52670 >Feature sequence1705 324 1973 gene locus_tag LOCUS_52680 324 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 >Feature sequence1706 1000 383 gene locus_tag LOCUS_52690 1000 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 >Feature sequence1707 >Feature sequence1708 >Feature sequence1709 >Feature sequence1710 1115 177 gene locus_tag LOCUS_52700 gene cysD 1115 177 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ4 protein_id gnl|my_center|LOCUS_52700 <2159 1469 gene locus_tag LOCUS_52710 <2159 1469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122379.1:nucleotidyltransferase >Feature sequence1711 1029 1862 gene locus_tag LOCUS_52720 1029 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 >Feature sequence1712 263 841 gene locus_tag LOCUS_52730 263 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 939 1730 gene locus_tag LOCUS_52740 939 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 >Feature sequence1713 <1 1236 gene locus_tag LOCUS_52750 <1 1236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814074.1:peptidase M16 1289 2077 gene locus_tag LOCUS_52760 1289 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 >Feature sequence1714 469 1737 gene locus_tag LOCUS_52770 469 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 >Feature sequence1715 <1 1433 gene locus_tag LOCUS_52780 <1 1433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020246.1:tetratricopeptide repeat protein >Feature sequence1716 1677 1051 gene locus_tag LOCUS_52790 1677 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 >Feature sequence1717 528 232 gene locus_tag LOCUS_52800 528 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404971.1 protein_id gnl|my_center|LOCUS_52800 629 1198 gene locus_tag LOCUS_52810 629 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 1208 2143 gene locus_tag LOCUS_52820 1208 2143 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532571.1 protein_id gnl|my_center|LOCUS_52820 >Feature sequence1718 1294 302 gene locus_tag LOCUS_52830 1294 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 >Feature sequence1719 1943 228 gene locus_tag LOCUS_52840 gene lnt 1943 228 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_52840 >Feature sequence1720 <1 579 gene locus_tag LOCUS_52850 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6MU89:peptide chain release factor 1 746 1579 gene locus_tag LOCUS_52860 746 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 2049 1597 gene locus_tag LOCUS_52870 2049 1597 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_52870 >Feature sequence1721 1602 520 gene locus_tag LOCUS_52880 1602 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 >Feature sequence1722 245 1576 gene locus_tag LOCUS_52890 245 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 >Feature sequence1723 310 2004 gene locus_tag LOCUS_52900 310 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 >Feature sequence1724 <1 1878 gene locus_tag LOCUS_52910 <1 1878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001305829.1:iron reductase >Feature sequence1725 <1 1983 gene locus_tag LOCUS_52920 <1 1983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000200580.1:hemolysin >Feature sequence1726 >Feature sequence1727 <1 1543 gene locus_tag LOCUS_52930 <1 1543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899914.1:alkyldihydroxyacetonephosphate synthase >Feature sequence1728 952 50 gene locus_tag LOCUS_52940 952 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 926 1747 gene locus_tag LOCUS_52950 926 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 >Feature sequence1729 416 1489 gene locus_tag LOCUS_52960 416 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 >Feature sequence1730 <1 1053 gene locus_tag LOCUS_52970 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003588621.1:DNA polymerase III subunit delta' >Feature sequence1731 >Feature sequence1732 >Feature sequence1733 372 1121 gene locus_tag LOCUS_52980 372 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 1204 2004 gene locus_tag LOCUS_52990 1204 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 >Feature sequence1734 <1 569 gene locus_tag LOCUS_53000 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZPD4:RNA polymerase sigma factor 670 1260 gene locus_tag LOCUS_53010 670 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 >Feature sequence1735 201 464 gene locus_tag LOCUS_53020 201 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 1439 465 gene locus_tag LOCUS_53030 1439 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 >Feature sequence1736 >Feature sequence1737 1698 187 gene locus_tag LOCUS_53040 1698 187 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064509.1 protein_id gnl|my_center|LOCUS_53040 >Feature sequence1738 356 1354 gene locus_tag LOCUS_53050 356 1354 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141472.1 protein_id gnl|my_center|LOCUS_53050 >Feature sequence1739 >Feature sequence1740 >Feature sequence1741 >Feature sequence1742 >Feature sequence1743 78 425 gene locus_tag LOCUS_53060 78 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 1278 556 gene locus_tag LOCUS_53070 1278 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 1823 1380 gene locus_tag LOCUS_53080 1823 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098308.1 protein_id gnl|my_center|LOCUS_53080 >Feature sequence1744 1411 500 gene locus_tag LOCUS_53090 1411 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 2023 1421 gene locus_tag LOCUS_53100 2023 1421 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531541.1 protein_id gnl|my_center|LOCUS_53100 >Feature sequence1745 <1 780 gene locus_tag LOCUS_53110 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259445.1:TIGR00374 family protein 864 1376 gene locus_tag LOCUS_53120 864 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 >Feature sequence1746 >Feature sequence1747 742 119 gene locus_tag LOCUS_53130 742 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 <2131 862 gene locus_tag LOCUS_53140 <2131 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WIY7:putative NTE family protein >Feature sequence1748 >Feature sequence1749 517 1344 gene locus_tag LOCUS_53150 517 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 1479 1796 gene locus_tag LOCUS_53160 1479 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 >Feature sequence1750 1353 817 gene locus_tag LOCUS_53170 1353 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 1579 1914 gene locus_tag LOCUS_53180 1579 1914 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DV9 protein_id gnl|my_center|LOCUS_53180 >Feature sequence1751 871 1269 gene locus_tag LOCUS_53190 871 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 <2128 1300 gene locus_tag LOCUS_53200 <2128 1300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104446.1:filamentous hemagglutinin >Feature sequence1752 <1 1212 gene locus_tag LOCUS_53210 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030902.1:nitrate reductase >Feature sequence1753 1741 1962 gene locus_tag LOCUS_53220 1741 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 >Feature sequence1754 <2124 784 gene locus_tag LOCUS_53230 <2124 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204799.1:two-component sensor histidine kinase >Feature sequence1755 >Feature sequence1756 479 1090 gene locus_tag LOCUS_53240 479 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 1107 1634 gene locus_tag LOCUS_53250 1107 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 >Feature sequence1757 447 121 gene locus_tag LOCUS_53260 447 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 631 1740 gene locus_tag LOCUS_53270 631 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 >Feature sequence1758 1568 390 gene locus_tag LOCUS_53280 gene proB 1568 390 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ7 protein_id gnl|my_center|LOCUS_53280 >Feature sequence1759 856 191 gene locus_tag LOCUS_53290 856 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 1801 905 gene locus_tag LOCUS_53300 1801 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 >Feature sequence1760 >Feature sequence1761 >Feature sequence1762 44 2074 gene locus_tag LOCUS_53310 44 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 >Feature sequence1763 963 232 gene locus_tag LOCUS_53320 963 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 917 1417 gene locus_tag LOCUS_53330 917 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 >Feature sequence1764 >Feature sequence1765 568 1056 gene locus_tag LOCUS_53340 568 1056 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_53340 >Feature sequence1766 >Feature sequence1767 401 760 gene locus_tag LOCUS_53350 401 760 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942666.1 protein_id gnl|my_center|LOCUS_53350 785 1252 gene locus_tag LOCUS_53360 gene aroQ 785 1252 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QJ9 protein_id gnl|my_center|LOCUS_53360 1290 1772 gene locus_tag LOCUS_53370 1290 1772 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687267.1 protein_id gnl|my_center|LOCUS_53370 >Feature sequence1768 >Feature sequence1769 206 1996 gene locus_tag LOCUS_53380 206 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 >Feature sequence1770 182 1891 gene locus_tag LOCUS_53390 182 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 >Feature sequence1771 1958 507 gene locus_tag LOCUS_53400 1958 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 >Feature sequence1772 <2103 1419 gene locus_tag LOCUS_53410 <2103 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730315.1:ABC transporter ATP-binding protein >Feature sequence1773 1210 335 gene locus_tag LOCUS_53420 1210 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 >Feature sequence1774 <1 2067 gene locus_tag LOCUS_53430 <1 2067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000844448.1:peptidase M14 >Feature sequence1775 <1 1811 gene locus_tag LOCUS_53440 <1 1811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943837.1:peptidase >Feature sequence1776 1738 392 gene locus_tag LOCUS_53450 1738 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 2045 1854 gene locus_tag LOCUS_53460 2045 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 >Feature sequence1777 519 106 gene locus_tag LOCUS_53470 519 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 1371 721 gene locus_tag LOCUS_53480 1371 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 1491 1865 gene locus_tag LOCUS_53490 1491 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 >Feature sequence1778 >Feature sequence1779 1763 1575 gene locus_tag LOCUS_53500 1763 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 >Feature sequence1780 364 600 gene locus_tag LOCUS_53510 364 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 603 1397 gene locus_tag LOCUS_53520 603 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 >Feature sequence1781 <2097 954 gene locus_tag LOCUS_53530 <2097 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940636.1:acetoacetate metabolism regulatory protein AtoC >Feature sequence1782 >Feature sequence1783 658 1818 gene locus_tag LOCUS_53540 658 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 >Feature sequence1784 <1 948 gene locus_tag LOCUS_53550 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74E53:dual-specificity RNA methyltransferase RlmN >Feature sequence1785 1296 2036 gene locus_tag LOCUS_53560 1296 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 >Feature sequence1786 925 407 gene locus_tag LOCUS_53570 925 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 1666 932 gene locus_tag LOCUS_53580 1666 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 >Feature sequence1787 238 1779 gene locus_tag LOCUS_53590 238 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 >Feature sequence1788 <1 1162 gene locus_tag LOCUS_53600 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962582.1:fatty acid desaturase 1180 1731 gene locus_tag LOCUS_53610 gene ppa 1180 1731 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S122 protein_id gnl|my_center|LOCUS_53610 >Feature sequence1789 >Feature sequence1790 2005 1454 gene locus_tag LOCUS_53620 2005 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 >Feature sequence1791 >Feature sequence1792 1031 955 gene locus_tag LOCUS_t01010 1031 955 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1793 <1 783 gene locus_tag LOCUS_53630 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061131.1:phosphate-binding protein >Feature sequence1794 2014 704 gene locus_tag LOCUS_53640 2014 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_53640 >Feature sequence1795 467 147 gene locus_tag LOCUS_53650 467 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 1746 484 gene locus_tag LOCUS_53660 1746 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 >Feature sequence1796 720 1169 gene locus_tag LOCUS_53670 720 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 >Feature sequence1797 <1 786 gene locus_tag LOCUS_53680 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205720.1:carbohydrate kinase >Feature sequence1798 <1 594 gene locus_tag LOCUS_53690 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525453.1:LysR family transcriptional regulator 1482 847 gene locus_tag LOCUS_53700 1482 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 <2082 1520 gene locus_tag LOCUS_53710 <2082 1520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLM1:chorismate synthase >Feature sequence1799 >Feature sequence1800 <1 1148 gene locus_tag LOCUS_53720 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001012297.1:carboxylic ester hydrolase >Feature sequence1801 <2079 1414 gene locus_tag LOCUS_53730 <2079 1414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140940.1:peptidase U32 >Feature sequence1802 384 1685 gene locus_tag LOCUS_53740 gene gltA 384 1685 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBF3 protein_id gnl|my_center|LOCUS_53740 >Feature sequence1803 375 1928 gene locus_tag LOCUS_53750 375 1928 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640463.1 protein_id gnl|my_center|LOCUS_53750 >Feature sequence1804 1010 480 gene locus_tag LOCUS_53760 1010 480 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327748.1 protein_id gnl|my_center|LOCUS_53760 1529 1035 gene locus_tag LOCUS_53770 1529 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 >Feature sequence1805 986 96 gene locus_tag LOCUS_53780 986 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 <2079 1208 gene locus_tag LOCUS_53790 <2079 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 >Feature sequence1806 19 438 gene locus_tag LOCUS_53800 19 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 >Feature sequence1807 >Feature sequence1808 1 264 gene locus_tag LOCUS_53810 1 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 261 602 gene locus_tag LOCUS_53820 261 602 CDS product DOPA 4,5-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719728.1 protein_id gnl|my_center|LOCUS_53820 669 1415 gene locus_tag LOCUS_53830 669 1415 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968127.1 protein_id gnl|my_center|LOCUS_53830 >Feature sequence1809 1636 788 gene locus_tag LOCUS_53840 1636 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 >Feature sequence1810 380 105 gene locus_tag LOCUS_53850 380 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 518 1765 gene locus_tag LOCUS_53860 518 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 >Feature sequence1811 1987 1016 gene locus_tag LOCUS_53870 1987 1016 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258627.1 protein_id gnl|my_center|LOCUS_53870 >Feature sequence1812 263 1018 gene locus_tag LOCUS_53880 263 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088188.1 protein_id gnl|my_center|LOCUS_53880 >Feature sequence1813 178 1398 gene locus_tag LOCUS_53890 gene tuf 178 1398 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R603 protein_id gnl|my_center|LOCUS_53890 >Feature sequence1814 530 697 gene locus_tag LOCUS_53900 530 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 1626 706 gene locus_tag LOCUS_53910 1626 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 >Feature sequence1815 >Feature sequence1816 1025 1690 gene locus_tag LOCUS_53920 1025 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 >Feature sequence1817 <1 1042 gene locus_tag LOCUS_53930 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084016.1:cytochrome c oxidase subunit III 1177 1674 gene locus_tag LOCUS_53940 1177 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 >Feature sequence1818 >Feature sequence1819 3 1520 gene locus_tag LOCUS_53950 3 1520 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_53950 >Feature sequence1820 >Feature sequence1821 217 555 gene locus_tag LOCUS_53960 217 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 1310 564 gene locus_tag LOCUS_53970 gene nth 1310 564 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_53970 >Feature sequence1822 1535 780 gene locus_tag LOCUS_53980 1535 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 >Feature sequence1823 >Feature sequence1824 >Feature sequence1825 <1 1014 gene locus_tag LOCUS_53990 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533124.1:asparagine synthase (glutamine-hydrolyzing) 1648 965 gene locus_tag LOCUS_54000 1648 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 >Feature sequence1826 <1 1819 gene locus_tag LOCUS_54010 <1 1819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037381.1:glutaryl-7-ACA acylase >Feature sequence1827 <2048 52 gene locus_tag LOCUS_54020 <2048 52 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97IC2:putative serine/threonine-protein kinase >Feature sequence1828 582 2003 gene locus_tag LOCUS_54030 582 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54030 >Feature sequence1829 843 382 gene locus_tag LOCUS_54040 843 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_54040 916 1290 gene locus_tag LOCUS_54050 916 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 >Feature sequence1830 <2044 196 gene locus_tag LOCUS_54060 <2044 196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000200580.1:hemolysin >Feature sequence1831 >Feature sequence1832 >Feature sequence1833 <1 703 gene locus_tag LOCUS_54070 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KGD3:phosphatidate cytidylyltransferase >Feature sequence1834 >Feature sequence1835 1666 335 gene locus_tag LOCUS_54080 1666 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 >Feature sequence1836 <1 1036 gene locus_tag LOCUS_54090 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003693.1:hybrid sensor histidine kinase/response regulator >Feature sequence1837 170 1246 gene locus_tag LOCUS_54100 170 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 >Feature sequence1838 856 1491 gene locus_tag LOCUS_54110 856 1491 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920264.1 protein_id gnl|my_center|LOCUS_54110 >Feature sequence1839 >Feature sequence1840 >Feature sequence1841 <1 1626 gene locus_tag LOCUS_54120 <1 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085075.1:two-component hybrid sensor and regulator >Feature sequence1842 1147 74 gene locus_tag LOCUS_54130 1147 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 >Feature sequence1843 <1 758 gene locus_tag LOCUS_54140 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706561.1:membrane protein 782 1864 gene locus_tag LOCUS_54150 782 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 >Feature sequence1844 1657 647 gene locus_tag LOCUS_54160 1657 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 >Feature sequence1845 <1 828 gene locus_tag LOCUS_54170 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941480.1:RND transporter 913 1536 gene locus_tag LOCUS_54180 913 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 >Feature sequence1846 177 788 gene locus_tag LOCUS_54190 177 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 1845 856 gene locus_tag LOCUS_54200 gene oxyR 1845 856 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945934.1 protein_id gnl|my_center|LOCUS_54200 >Feature sequence1847 >Feature sequence1848 >Feature sequence1849 1362 1931 gene locus_tag LOCUS_54210 gene rpoE 1362 1931 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_54210 >Feature sequence1850 335 1054 gene locus_tag LOCUS_54220 335 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 1129 1202 gene locus_tag LOCUS_t01020 1129 1202 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1851 <2013 986 gene locus_tag LOCUS_54230 <2013 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UFZ7:histidine kinase >Feature sequence1852 731 1747 gene locus_tag LOCUS_54240 731 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 >Feature sequence1853 1 396 gene locus_tag LOCUS_54250 1 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 986 393 gene locus_tag LOCUS_54260 986 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 >Feature sequence1854 >Feature sequence1855 423 85 gene locus_tag LOCUS_54270 423 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 >Feature sequence1856 347 505 gene locus_tag LOCUS_54280 347 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 576 1868 gene locus_tag LOCUS_54290 576 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 >Feature sequence1857 >Feature sequence1858 1684 1409 gene locus_tag LOCUS_54300 1684 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 1758 1943 gene locus_tag LOCUS_54310 1758 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 >Feature sequence1859 <1 799 gene locus_tag LOCUS_54320 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KIN9:formate--tetrahydrofolate ligase 1551 805 gene locus_tag LOCUS_54330 1551 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 >Feature sequence1860 >Feature sequence1861 1852 1217 gene locus_tag LOCUS_54340 1852 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 >Feature sequence1862 >Feature sequence1863 508 137 gene locus_tag LOCUS_54350 508 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 1633 512 gene locus_tag LOCUS_54360 1633 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 >Feature sequence1864 1137 1712 gene locus_tag LOCUS_54370 gene def 1137 1712 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93LE9 protein_id gnl|my_center|LOCUS_54370 >Feature sequence1865 >Feature sequence1866 429 794 gene locus_tag LOCUS_54380 429 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 >Feature sequence1867 >Feature sequence1868 515 1714 gene locus_tag LOCUS_54390 gene murE 515 1714 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--LD-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY79 protein_id gnl|my_center|LOCUS_54390 >Feature sequence1869 33 728 gene locus_tag LOCUS_54400 33 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 1109 1672 gene locus_tag LOCUS_54410 1109 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 >Feature sequence1870 749 495 gene locus_tag LOCUS_54420 gene rpmE2 749 495 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FMB6 protein_id gnl|my_center|LOCUS_54420 1066 761 gene locus_tag LOCUS_54430 gene rpsN 1066 761 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PB08 protein_id gnl|my_center|LOCUS_54430 <1997 1192 gene locus_tag LOCUS_54440 <1997 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DB4:pseudouridine synthase >Feature sequence1871 <1996 1299 gene locus_tag LOCUS_54450 <1996 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004598076.1:multidrug ABC transporter substrate-binding protein >Feature sequence1872 >Feature sequence1873 >Feature sequence1874 574 1479 gene locus_tag LOCUS_54460 574 1479 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972568.1 protein_id gnl|my_center|LOCUS_54460 >Feature sequence1875 1154 285 gene locus_tag LOCUS_54470 1154 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 >Feature sequence1876 <1 778 gene locus_tag LOCUS_54480 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B0B7R5:ribonuclease Z 817 1929 gene locus_tag LOCUS_54490 817 1929 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482750.1 protein_id gnl|my_center|LOCUS_54490 >Feature sequence1877 <1989 648 gene locus_tag LOCUS_54500 <1989 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020246.1:tetratricopeptide repeat protein >Feature sequence1878 <1 944 gene locus_tag LOCUS_54510 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5HXP7:chromosomal replication initiator protein DnaA >Feature sequence1879 >Feature sequence1880 904 1575 gene locus_tag LOCUS_54520 904 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 >Feature sequence1881 <1 807 gene locus_tag LOCUS_54530 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P5F4:S-formylglutathione hydrolase 993 1793 gene locus_tag LOCUS_54540 993 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 >Feature sequence1882 1983 1513 gene locus_tag LOCUS_54550 1983 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54550 >Feature sequence1883 1983 1438 gene locus_tag LOCUS_54560 1983 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54560 >Feature sequence1884 1179 118 gene locus_tag LOCUS_54570 1179 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 >Feature sequence1885 >Feature sequence1886 <1980 1178 gene locus_tag LOCUS_54580 <1980 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66679:riboflavin biosynthesis protein RibBA >Feature sequence1887 >Feature sequence1888 1295 342 gene locus_tag LOCUS_54590 1295 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 >Feature sequence1889 100 843 gene locus_tag LOCUS_54600 100 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 >Feature sequence1890 >Feature sequence1891 903 1280 gene locus_tag LOCUS_54610 903 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 >Feature sequence1892 148 558 gene locus_tag LOCUS_54620 148 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 >Feature sequence1893 >Feature sequence1894 >Feature sequence1895 >Feature sequence1896 1108 350 gene locus_tag LOCUS_54630 1108 350 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_54630 >Feature sequence1897 291 1181 gene locus_tag LOCUS_54640 291 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 >Feature sequence1898 1201 95 gene locus_tag LOCUS_54650 1201 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 >Feature sequence1899 1919 492 gene locus_tag LOCUS_54660 1919 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 >Feature sequence1900 >Feature sequence1901 >Feature sequence1902 <1967 231 gene locus_tag LOCUS_54670 <1967 231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92WJ7:histidine kinase >Feature sequence1903 >Feature sequence1904 1190 132 gene locus_tag LOCUS_54680 1190 132 CDS product putative lipase/esterase LipN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704000.1 protein_id gnl|my_center|LOCUS_54680 >Feature sequence1905 811 23 gene locus_tag LOCUS_54690 gene rpoE 811 23 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222410.1 protein_id gnl|my_center|LOCUS_54690 1620 913 gene locus_tag LOCUS_54700 1620 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 >Feature sequence1906 1109 468 gene locus_tag LOCUS_54710 1109 468 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030543.1 protein_id gnl|my_center|LOCUS_54710 >Feature sequence1907 1203 253 gene locus_tag LOCUS_54720 1203 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 >Feature sequence1908 603 163 gene locus_tag LOCUS_54730 603 163 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_54730 >Feature sequence1909 >Feature sequence1910 174 19 gene locus_tag LOCUS_54740 174 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 243 1217 gene locus_tag LOCUS_54750 243 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 1584 1222 gene locus_tag LOCUS_54760 1584 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54760 >Feature sequence1911 136 873 gene locus_tag LOCUS_54770 136 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 >Feature sequence1912 263 979 gene locus_tag LOCUS_54780 gene kdpE 263 979 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196450.1 protein_id gnl|my_center|LOCUS_54780 >Feature sequence1913 349 807 gene locus_tag LOCUS_54790 349 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 >Feature sequence1914 1705 1523 gene locus_tag LOCUS_54800 1705 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 >Feature sequence1915 974 153 gene locus_tag LOCUS_54810 974 153 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 protein_id gnl|my_center|LOCUS_54810 >Feature sequence1916 1690 230 gene locus_tag LOCUS_54820 1690 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 >Feature sequence1917 1137 520 gene locus_tag LOCUS_54830 1137 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 >Feature sequence1918 687 301 gene locus_tag LOCUS_54840 687 301 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887079.1 protein_id gnl|my_center|LOCUS_54840 1136 684 gene locus_tag LOCUS_54850 1136 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 >Feature sequence1919 >Feature sequence1920 >Feature sequence1921 >Feature sequence1922 >Feature sequence1923 >Feature sequence1924 967 65 gene locus_tag LOCUS_54860 967 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 >Feature sequence1925 >Feature sequence1926 1065 295 gene locus_tag LOCUS_54870 1065 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 >Feature sequence1927 <1 1274 gene locus_tag LOCUS_54880 <1 1274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071650.1:restriction endonuclease subunit M >Feature sequence1928 233 829 gene locus_tag LOCUS_54890 233 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 <1944 843 gene locus_tag LOCUS_54900 <1944 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037551.1:X-Pro dipeptidase >Feature sequence1929 168 1388 gene locus_tag LOCUS_54910 gene iscS 168 1388 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SN1 protein_id gnl|my_center|LOCUS_54910 1437 1823 gene locus_tag LOCUS_54920 gene iscU 1437 1823 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57074 protein_id gnl|my_center|LOCUS_54920 >Feature sequence1930 631 347 gene locus_tag LOCUS_54930 631 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 1801 737 gene locus_tag LOCUS_54940 gene asd 1801 737 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0J8 protein_id gnl|my_center|LOCUS_54940 >Feature sequence1931 >Feature sequence1932 471 1520 gene locus_tag LOCUS_54950 471 1520 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_54950 >Feature sequence1933 1109 480 gene locus_tag LOCUS_54960 1109 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 >Feature sequence1934 >Feature sequence1935 1645 404 gene locus_tag LOCUS_54970 1645 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206711.1 protein_id gnl|my_center|LOCUS_54970 >Feature sequence1936 <1931 1383 gene locus_tag LOCUS_54980 <1931 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011921869.1:diphosphomevalonate decarboxylase >Feature sequence1937 1419 163 gene locus_tag LOCUS_54990 gene argD2 1419 163 CDS product acetylornithine aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882K8 protein_id gnl|my_center|LOCUS_54990 >Feature sequence1938 1472 564 gene locus_tag LOCUS_55000 1472 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 >Feature sequence1939 >Feature sequence1940 1127 228 gene locus_tag LOCUS_55010 1127 228 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089293.1 protein_id gnl|my_center|LOCUS_55010 >Feature sequence1941 <1 806 gene locus_tag LOCUS_55020 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107277.1:beta-N-acetylhexosaminidase 1301 921 gene locus_tag LOCUS_55030 1301 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 >Feature sequence1942 573 85 gene locus_tag LOCUS_55040 573 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 >Feature sequence1943 >Feature sequence1944 199 1365 gene locus_tag LOCUS_55050 199 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404168.1 protein_id gnl|my_center|LOCUS_55050 >Feature sequence1945 283 504 gene locus_tag LOCUS_55060 283 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 590 1279 gene locus_tag LOCUS_55070 590 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 >Feature sequence1946 >Feature sequence1947 80 1153 gene locus_tag LOCUS_55080 gene tilS 80 1153 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8I6 protein_id gnl|my_center|LOCUS_55080 >Feature sequence1948 300 611 gene locus_tag LOCUS_55090 300 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 1798 620 gene locus_tag LOCUS_55100 1798 620 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085052.1 protein_id gnl|my_center|LOCUS_55100 >Feature sequence1949 >Feature sequence1950 >Feature sequence1951 1499 588 gene locus_tag LOCUS_55110 1499 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 1911 1756 gene locus_tag LOCUS_55120 1911 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 >Feature sequence1952 373 152 gene locus_tag LOCUS_55130 373 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 1432 458 gene locus_tag LOCUS_55140 1432 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 >Feature sequence1953 1382 132 gene locus_tag LOCUS_55150 1382 132 CDS product aminotransferase V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_55150 >Feature sequence1954 1197 1892 gene locus_tag LOCUS_55160 1197 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 >Feature sequence1955 2 319 gene locus_tag LOCUS_55170 2 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 683 384 gene locus_tag LOCUS_55180 683 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 628 897 gene locus_tag LOCUS_55190 628 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 949 1404 gene locus_tag LOCUS_55200 949 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 >Feature sequence1956 51 833 gene locus_tag LOCUS_55210 51 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 915 1727 gene locus_tag LOCUS_55220 915 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_55220 >Feature sequence1957 >Feature sequence1958 133 1170 gene locus_tag LOCUS_55230 133 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 >Feature sequence1959 <1 612 gene locus_tag LOCUS_55240 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q73QY2:flavin-dependent thymidylate synthase 625 1545 gene locus_tag LOCUS_55250 gene dhaA 625 1545 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222141.1 protein_id gnl|my_center|LOCUS_55250 >Feature sequence1960 <1 863 gene locus_tag LOCUS_55260 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SLG6:methylenetetrahydrofolate reductase 894 1772 gene locus_tag LOCUS_55270 894 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 >Feature sequence1961 1397 843 gene locus_tag LOCUS_55280 gene atpH 1397 843 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY3 protein_id gnl|my_center|LOCUS_55280 >Feature sequence1962 1 351 gene locus_tag LOCUS_55290 1 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 >Feature sequence1963 799 452 gene locus_tag LOCUS_55300 799 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 >Feature sequence1964 >Feature sequence1965 1508 735 gene locus_tag LOCUS_55310 1508 735 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222836.1 protein_id gnl|my_center|LOCUS_55310 >Feature sequence1966 >Feature sequence1967 126 434 gene locus_tag LOCUS_55320 126 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 <1893 736 gene locus_tag LOCUS_55330 <1893 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921047.1:carbamoyl-phosphate-synthetase >Feature sequence1968 598 41 gene locus_tag LOCUS_55340 598 41 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4D4 protein_id gnl|my_center|LOCUS_55340 1556 642 gene locus_tag LOCUS_55350 1556 642 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_55350 >Feature sequence1969 1634 1041 gene locus_tag LOCUS_55360 1634 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 >Feature sequence1970 273 452 gene locus_tag LOCUS_55370 273 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 1045 590 gene locus_tag LOCUS_55380 1045 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 1557 1261 gene locus_tag LOCUS_55390 1557 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 >Feature sequence1971 1620 892 gene locus_tag LOCUS_55400 1620 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 >Feature sequence1972 >Feature sequence1973 1833 295 gene locus_tag LOCUS_55410 1833 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 >Feature sequence1974 109 588 gene locus_tag LOCUS_55420 109 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 >Feature sequence1975 194 1633 gene locus_tag LOCUS_55430 gene dur3 194 1633 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124139.1 protein_id gnl|my_center|LOCUS_55430 >Feature sequence1976 >Feature sequence1977 1611 970 gene locus_tag LOCUS_55440 gene glpF6 1611 970 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102173.1 protein_id gnl|my_center|LOCUS_55440 >Feature sequence1978 <1 792 gene locus_tag LOCUS_55450 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804143.1:esterase 853 1848 gene locus_tag LOCUS_55460 853 1848 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705178.1 protein_id gnl|my_center|LOCUS_55460 >Feature sequence1979 1544 138 gene locus_tag LOCUS_55470 1544 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55470 >Feature sequence1980 57 659 gene locus_tag LOCUS_55480 57 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55480 1690 656 gene locus_tag LOCUS_55490 1690 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 >Feature sequence1981 >Feature sequence1982 978 13 gene locus_tag LOCUS_55500 978 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 >Feature sequence1983 1533 919 gene locus_tag LOCUS_55510 1533 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55510 >Feature sequence1984 >Feature sequence1985 378 632 gene locus_tag LOCUS_55520 378 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55520 679 1521 gene locus_tag LOCUS_55530 gene paaG 679 1521 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225713.1 protein_id gnl|my_center|LOCUS_55530 >Feature sequence1986 1752 409 gene locus_tag LOCUS_55540 1752 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 >Feature sequence1987 >Feature sequence1988 <1 985 gene locus_tag LOCUS_55550 <1 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000626143.1:ABC-F family ATPase 1469 993 gene locus_tag LOCUS_55560 1469 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 >Feature sequence1989 1784 366 gene locus_tag LOCUS_55570 1784 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 >Feature sequence1990 <1861 530 gene locus_tag LOCUS_55580 <1861 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 >Feature sequence1991 340 972 gene locus_tag LOCUS_55590 340 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 >Feature sequence1992 <1 861 gene locus_tag LOCUS_55600 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391533.1:glycerophosphodiester phosphodiesterase 1549 869 gene locus_tag LOCUS_55610 1549 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55610 >Feature sequence1993 622 266 gene locus_tag LOCUS_55620 622 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 1505 693 gene locus_tag LOCUS_55630 1505 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 >Feature sequence1994 517 1182 gene locus_tag LOCUS_55640 517 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 >Feature sequence1995 <1855 299 gene locus_tag LOCUS_55650 <1855 299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117689.1:helicase >Feature sequence1996 <1854 940 gene locus_tag LOCUS_55660 <1854 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888316.1:ABC transporter substrate-binding protein >Feature sequence1997 >Feature sequence1998 462 812 gene locus_tag LOCUS_55670 462 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 >Feature sequence1999 863 84 gene locus_tag LOCUS_55680 863 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 1851 1054 gene locus_tag LOCUS_55690 1851 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 >Feature sequence2000 669 1661 gene locus_tag LOCUS_55700 669 1661 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903696.1 protein_id gnl|my_center|LOCUS_55700 >Feature sequence2001 1384 440 gene locus_tag LOCUS_55710 1384 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 >Feature sequence2002 >Feature sequence2003 >Feature sequence2004 >Feature sequence2005 >Feature sequence2006 <1 1486 gene locus_tag LOCUS_55720 <1 1486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258902.1:L,D-transpeptidase >Feature sequence2007 213 1823 gene locus_tag LOCUS_55730 213 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 >Feature sequence2008 1068 640 gene locus_tag LOCUS_55740 1068 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 >Feature sequence2009 <1 1563 gene locus_tag LOCUS_55750 <1 1563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P53528:ATP-dependent DNA helicase UvrD2 >Feature sequence2010 1524 1090 gene locus_tag LOCUS_55760 1524 1090 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_55760 >Feature sequence2011 55 879 gene locus_tag LOCUS_55770 55 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 882 1784 gene locus_tag LOCUS_55780 882 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 >Feature sequence2012 >Feature sequence2013 757 1638 gene locus_tag LOCUS_55790 757 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 >Feature sequence2014 1458 1030 gene locus_tag LOCUS_55800 1458 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 >Feature sequence2015 >Feature sequence2016 >Feature sequence2017 225 674 gene locus_tag LOCUS_55810 225 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 671 1324 gene locus_tag LOCUS_55820 671 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 >Feature sequence2018 138 1649 gene locus_tag LOCUS_55830 138 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 >Feature sequence2019 >Feature sequence2020 1573 788 gene locus_tag LOCUS_55840 1573 788 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768246.1 protein_id gnl|my_center|LOCUS_55840 >Feature sequence2021 <1826 137 gene locus_tag LOCUS_55850 <1826 137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250730.1:oligopeptide transporter, OPT family >Feature sequence2022 413 72 gene locus_tag LOCUS_55860 413 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 1517 438 gene locus_tag LOCUS_55870 gene prfA 1517 438 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B1 protein_id gnl|my_center|LOCUS_55870 >Feature sequence2023 1766 33 gene locus_tag LOCUS_55880 1766 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 >Feature sequence2024 <1825 351 gene locus_tag LOCUS_55890 <1825 351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708133.1:adenylate cyclase >Feature sequence2025 >Feature sequence2026 923 507 gene locus_tag LOCUS_55900 923 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 1714 1043 gene locus_tag LOCUS_55910 1714 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 >Feature sequence2027 >Feature sequence2028 >Feature sequence2029 >Feature sequence2030 1189 446 gene locus_tag LOCUS_55920 1189 446 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719486.1 protein_id gnl|my_center|LOCUS_55920 <1819 1186 gene locus_tag LOCUS_55930 <1819 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528609.1:amino acid decarboxylase >Feature sequence2031 >Feature sequence2032 >Feature sequence2033 >Feature sequence2034 4 1041 gene locus_tag LOCUS_55940 4 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 1235 1615 gene locus_tag LOCUS_55950 1235 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 >Feature sequence2035 414 1049 gene locus_tag LOCUS_55960 414 1049 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265523.1 protein_id gnl|my_center|LOCUS_55960 >Feature sequence2036 1395 271 gene locus_tag LOCUS_55970 1395 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 >Feature sequence2037 >Feature sequence2038 >Feature sequence2039 >Feature sequence2040 >Feature sequence2041 2 439 gene locus_tag LOCUS_55980 2 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 788 468 gene locus_tag LOCUS_55990 788 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 <1809 886 gene locus_tag LOCUS_56000 <1809 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705358.1:cystathionine beta-synthase >Feature sequence2042 1660 365 gene locus_tag LOCUS_56010 1660 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 >Feature sequence2043 >Feature sequence2044 >Feature sequence2045 511 1371 gene locus_tag LOCUS_56020 511 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 >Feature sequence2046 155 532 gene locus_tag LOCUS_56030 155 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 631 1269 gene locus_tag LOCUS_56040 631 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 >Feature sequence2047 464 1324 gene locus_tag LOCUS_56050 464 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_56050 >Feature sequence2048 >Feature sequence2049 1014 277 gene locus_tag LOCUS_56060 1014 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 >Feature sequence2050 >Feature sequence2051 <1798 685 gene locus_tag LOCUS_56070 <1798 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92LK0:dihydrolipoyl dehydrogenase >Feature sequence2052 1280 72 gene locus_tag LOCUS_56080 1280 72 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457387.1 protein_id gnl|my_center|LOCUS_56080 1796 1527 gene locus_tag LOCUS_56090 1796 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56090 >Feature sequence2053 100 1146 gene locus_tag LOCUS_56100 gene cdh 100 1146 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035475.1 protein_id gnl|my_center|LOCUS_56100 <1796 1160 gene locus_tag LOCUS_56110 <1796 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255965.1:protein kinase >Feature sequence2054 >Feature sequence2055 900 13 gene locus_tag LOCUS_56120 900 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56120 >Feature sequence2056 >Feature sequence2057 >Feature sequence2058 865 1137 gene locus_tag LOCUS_56130 gene rpsT 865 1137 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AZ3 protein_id gnl|my_center|LOCUS_56130 1499 1203 gene locus_tag LOCUS_56140 1499 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 >Feature sequence2059 1224 1613 gene locus_tag LOCUS_56150 gene apaG 1224 1613 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VU61 protein_id gnl|my_center|LOCUS_56150 >Feature sequence2060 671 9 gene locus_tag LOCUS_56160 671 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 >Feature sequence2061 >Feature sequence2062 881 642 gene locus_tag LOCUS_56170 881 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56170 793 1626 gene locus_tag LOCUS_56180 793 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 >Feature sequence2063 114 542 gene locus_tag LOCUS_56190 114 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 <1787 548 gene locus_tag LOCUS_56200 <1787 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404983.1:Na-K-Cl cotransporter >Feature sequence2064 441 701 gene locus_tag LOCUS_56210 441 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 1523 708 gene locus_tag LOCUS_56220 1523 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 >Feature sequence2065 796 1635 gene locus_tag LOCUS_56230 796 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 >Feature sequence2066 87 677 gene locus_tag LOCUS_56240 87 677 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036053.1 protein_id gnl|my_center|LOCUS_56240 >Feature sequence2067 354 998 gene locus_tag LOCUS_56250 354 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56250 1067 1564 gene locus_tag LOCUS_56260 1067 1564 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973393.1 protein_id gnl|my_center|LOCUS_56260 >Feature sequence2068 <1 648 gene locus_tag LOCUS_56270 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057291.1:peroxiredoxin 1437 1075 gene locus_tag LOCUS_56280 1437 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 >Feature sequence2069 >Feature sequence2070 >Feature sequence2071 1279 1461 gene locus_tag LOCUS_56290 1279 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 >Feature sequence2072 >Feature sequence2073 >Feature sequence2074 >Feature sequence2075 >Feature sequence2076 342 1247 gene locus_tag LOCUS_56300 342 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 1410 1688 gene locus_tag LOCUS_56310 1410 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56310 >Feature sequence2077 >Feature sequence2078 >Feature sequence2079 >Feature sequence2080 >Feature sequence2081 695 330 gene locus_tag LOCUS_56320 695 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 >Feature sequence2082 >Feature sequence2083 159 620 gene locus_tag LOCUS_56330 159 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56330 >Feature sequence2084 <1 768 gene locus_tag LOCUS_56340 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to I7FK74:DNA helicase >Feature sequence2085 >Feature sequence2086 <1768 388 gene locus_tag LOCUS_56350 <1768 388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391295.1:magnesium-protoporphyrin IX monomethyl ester cyclase >Feature sequence2087 830 1711 gene locus_tag LOCUS_56360 830 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 >Feature sequence2088 <1 640 gene locus_tag LOCUS_56370 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I4G8:arachidonate 15-lipoxygenase <1763 659 gene locus_tag LOCUS_56380 <1763 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I4G8:arachidonate 15-lipoxygenase >Feature sequence2089 268 1389 gene locus_tag LOCUS_56390 268 1389 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228182.1 protein_id gnl|my_center|LOCUS_56390 >Feature sequence2090 850 1662 gene locus_tag LOCUS_56400 850 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 >Feature sequence2091 <1759 994 gene locus_tag LOCUS_56410 <1759 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001289749.1:alpha/beta hydrolase >Feature sequence2092 660 1301 gene locus_tag LOCUS_56420 660 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 >Feature sequence2093 1644 724 gene locus_tag LOCUS_56430 1644 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56430 >Feature sequence2094 <1 1588 gene locus_tag LOCUS_56440 <1 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase 836 742 gene locus_tag LOCUS_t01030 836 742 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2095 <1 1351 gene locus_tag LOCUS_56450 <1 1351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257389.1:cytochrome P450 >Feature sequence2096 <1 907 gene locus_tag LOCUS_56460 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545777.1:adenylate/guanylate cyclase domain-containing protein <1756 956 gene locus_tag LOCUS_56470 <1756 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224376.1:alpha/beta hydrolase >Feature sequence2097 1755 871 gene locus_tag LOCUS_56480 1755 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56480 >Feature sequence2098 1272 634 gene locus_tag LOCUS_56490 gene rpoE 1272 634 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222027.1 protein_id gnl|my_center|LOCUS_56490 >Feature sequence2099 513 313 gene locus_tag LOCUS_56500 513 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 >Feature sequence2100 490 1125 gene locus_tag LOCUS_56510 490 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 >Feature sequence2101 >Feature sequence2102 <1 519 gene locus_tag LOCUS_56520 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KFZ5:GMP synthase [glutamine-hydrolyzing] 529 1656 gene locus_tag LOCUS_56530 gene ruvB 529 1656 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTT6 protein_id gnl|my_center|LOCUS_56530 >Feature sequence2103 <1750 697 gene locus_tag LOCUS_56540 <1750 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072084.1:cold-active zinc metallopeptidase M1 family protein >Feature sequence2104 1636 1220 gene locus_tag LOCUS_56550 1636 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 >Feature sequence2105 302 1231 gene locus_tag LOCUS_56560 302 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 <1744 1218 gene locus_tag LOCUS_56570 <1744 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089359.1:MATE family efflux transporter >Feature sequence2106 241 909 gene locus_tag LOCUS_56580 241 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 >Feature sequence2107 <1 817 gene locus_tag LOCUS_56590 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769647.1:electron transfer flavoprotein subunit alpha >Feature sequence2108 >Feature sequence2109 >Feature sequence2110 >Feature sequence2111 <1739 757 gene locus_tag LOCUS_56600 <1739 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0R2:alkane 1-monooxygenase 1 >Feature sequence2112 >Feature sequence2113 263 1147 gene locus_tag LOCUS_56610 263 1147 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660680.1 protein_id gnl|my_center|LOCUS_56610 1194 1421 gene locus_tag LOCUS_56620 1194 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56620 1418 1636 gene locus_tag LOCUS_56630 1418 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56630 >Feature sequence2114 >Feature sequence2115 434 916 gene locus_tag LOCUS_56640 434 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 >Feature sequence2116 >Feature sequence2117 >Feature sequence2118 >Feature sequence2119 206 1309 gene locus_tag LOCUS_56650 206 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 >Feature sequence2120 1093 464 gene locus_tag LOCUS_56660 1093 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 >Feature sequence2121 97 1254 gene locus_tag LOCUS_56670 97 1254 CDS product rRNA (guanine-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887559.1 protein_id gnl|my_center|LOCUS_56670 >Feature sequence2122 <1731 464 gene locus_tag LOCUS_56680 <1731 464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056474.1:diguanylate cyclase >Feature sequence2123 <1730 391 gene locus_tag LOCUS_56690 <1730 391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387899.1:leucyl aminopeptidase >Feature sequence2124 205 669 gene locus_tag LOCUS_56700 205 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56700 >Feature sequence2125 1728 1330 gene locus_tag LOCUS_56710 1728 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 >Feature sequence2126 1432 566 gene locus_tag LOCUS_56720 1432 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 >Feature sequence2127 325 792 gene locus_tag LOCUS_56730 325 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 1211 786 gene locus_tag LOCUS_56740 1211 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 1568 1269 gene locus_tag LOCUS_56750 1568 1269 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PF1 protein_id gnl|my_center|LOCUS_56750 >Feature sequence2128 1237 140 gene locus_tag LOCUS_56760 1237 140 CDS product peptidase C45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257273.1 protein_id gnl|my_center|LOCUS_56760 >Feature sequence2129 1476 49 gene locus_tag LOCUS_56770 gene glmM 1476 49 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C70 protein_id gnl|my_center|LOCUS_56770 >Feature sequence2130 >Feature sequence2131 >Feature sequence2132 >Feature sequence2133 >Feature sequence2134 <1717 133 gene locus_tag LOCUS_56780 <1717 133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003124441.1:two-component sensor >Feature sequence2135 >Feature sequence2136 >Feature sequence2137 >Feature sequence2138 <1715 360 gene locus_tag LOCUS_56790 <1715 360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404450.1:lipase >Feature sequence2139 685 1080 gene locus_tag LOCUS_56800 685 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 >Feature sequence2140 >Feature sequence2141 715 203 gene locus_tag LOCUS_56810 715 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 1300 800 gene locus_tag LOCUS_56820 1300 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56820 >Feature sequence2142 >Feature sequence2143 243 641 gene locus_tag LOCUS_56830 243 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 <1713 681 gene locus_tag LOCUS_56840 <1713 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001700789.1:putative serine/threonine-protein kinase PknB >Feature sequence2144 376 1074 gene locus_tag LOCUS_56850 376 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 >Feature sequence2145 >Feature sequence2146 1153 1368 gene locus_tag LOCUS_56860 1153 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 >Feature sequence2147 894 133 gene locus_tag LOCUS_56870 894 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 >Feature sequence2148 1483 818 gene locus_tag LOCUS_56880 1483 818 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJK9 protein_id gnl|my_center|LOCUS_56880 >Feature sequence2149 >Feature sequence2150 478 1536 gene locus_tag LOCUS_56890 478 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 >Feature sequence2151 >Feature sequence2152 1577 384 gene locus_tag LOCUS_56900 1577 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 >Feature sequence2153 >Feature sequence2154 >Feature sequence2155 >Feature sequence2156 467 1492 gene locus_tag LOCUS_56910 467 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 >Feature sequence2157 >Feature sequence2158 >Feature sequence2159 >Feature sequence2160 1197 1388 gene locus_tag LOCUS_56920 1197 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56920 >Feature sequence2161 <1 1696 gene locus_tag LOCUS_56930 <1 1696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205184.1:oxygenase >Feature sequence2162 >Feature sequence2163 322 1344 gene locus_tag LOCUS_56940 322 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56940 >Feature sequence2164 1532 501 gene locus_tag LOCUS_56950 1532 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 >Feature sequence2165 >Feature sequence2166 961 1422 gene locus_tag LOCUS_56960 961 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 >Feature sequence2167 >Feature sequence2168 >Feature sequence2169 >Feature sequence2170 793 140 gene locus_tag LOCUS_56970 793 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 1035 1493 gene locus_tag LOCUS_56980 1035 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 >Feature sequence2171 >Feature sequence2172 1045 773 gene locus_tag LOCUS_56990 1045 773 CDS product hydrogenase assembly protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 protein_id gnl|my_center|LOCUS_56990 1682 1017 gene locus_tag LOCUS_57000 1682 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57000 >Feature sequence2173 <1 1257 gene locus_tag LOCUS_57010 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143678.1:lignostilbene alpha-beta-dioxygenase >Feature sequence2174 <1 686 gene locus_tag LOCUS_57020 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001192277.1:NAD(+) synthase 1574 711 gene locus_tag LOCUS_57030 1574 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57030 >Feature sequence2175 >Feature sequence2176 <1 835 gene locus_tag LOCUS_57040 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393447.1:putative selenate reductase subunit YgfK >Feature sequence2177 115 489 gene locus_tag LOCUS_57050 115 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 1678 497 gene locus_tag LOCUS_57060 1678 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 >Feature sequence2178 334 1095 gene locus_tag LOCUS_57070 334 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_57070 <1680 1121 gene locus_tag LOCUS_57080 <1680 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339537.1:BtpA protein >Feature sequence2179 136 1302 gene locus_tag LOCUS_57090 136 1302 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114117.1 protein_id gnl|my_center|LOCUS_57090 >Feature sequence2180 160 819 gene locus_tag LOCUS_57100 160 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 >Feature sequence2181 610 1587 gene locus_tag LOCUS_57110 gene dnaJ 610 1587 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_57110 >Feature sequence2182 368 1207 gene locus_tag LOCUS_57120 368 1207 CDS product D-xylose reductase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947778.1 protein_id gnl|my_center|LOCUS_57120 1232 1450 gene locus_tag LOCUS_57130 1232 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57130 >Feature sequence2183 1419 154 gene locus_tag LOCUS_57140 1419 154 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085418.1 protein_id gnl|my_center|LOCUS_57140 >Feature sequence2184 467 754 gene locus_tag LOCUS_57150 467 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57150 >Feature sequence2185 1132 509 gene locus_tag LOCUS_57160 1132 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 >Feature sequence2186 518 1558 gene locus_tag LOCUS_57170 518 1558 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920014.1 protein_id gnl|my_center|LOCUS_57170 >Feature sequence2187 >Feature sequence2188 1379 312 gene locus_tag LOCUS_57180 1379 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 >Feature sequence2189 >Feature sequence2190 468 1577 gene locus_tag LOCUS_57190 468 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57190 >Feature sequence2191 >Feature sequence2192 769 1458 gene locus_tag LOCUS_57200 769 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57200 >Feature sequence2193 630 1592 gene locus_tag LOCUS_57210 630 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 >Feature sequence2194 >Feature sequence2195 >Feature sequence2196 >Feature sequence2197 752 237 gene locus_tag LOCUS_57220 752 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 <1658 752 gene locus_tag LOCUS_57230 <1658 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640165.1:2-hydroxychromene-2-carboxylate isomerase >Feature sequence2198 >Feature sequence2199 <1 779 gene locus_tag LOCUS_57240 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118330.1:TIGR02453 family protein 1478 843 gene locus_tag LOCUS_57250 1478 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57250 >Feature sequence2200 <1 1480 gene locus_tag LOCUS_57260 <1 1480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259373.1:histidine kinase >Feature sequence2201 244 858 gene locus_tag LOCUS_57270 gene kptA 244 858 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBX9 protein_id gnl|my_center|LOCUS_57270 >Feature sequence2202 >Feature sequence2203 >Feature sequence2204 150 1070 gene locus_tag LOCUS_57280 150 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 1060 1524 gene locus_tag LOCUS_57290 1060 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57290 >Feature sequence2205 >Feature sequence2206 431 24 gene locus_tag LOCUS_57300 431 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57300 >Feature sequence2207 1469 105 gene locus_tag LOCUS_57310 1469 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 >Feature sequence2208 559 1581 gene locus_tag LOCUS_57320 559 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57320 >Feature sequence2209 >Feature sequence2210 >Feature sequence2211 1408 998 gene locus_tag LOCUS_57330 1408 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 >Feature sequence2212 <1 1334 gene locus_tag LOCUS_57340 <1 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089025.1:long-chain-acyl-CoA synthetase >Feature sequence2213 129 1103 gene locus_tag LOCUS_57350 129 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 >Feature sequence2214 >Feature sequence2215 >Feature sequence2216 277 1479 gene locus_tag LOCUS_57360 277 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 >Feature sequence2217 >Feature sequence2218 36 398 gene locus_tag LOCUS_57370 36 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57370 412 615 gene locus_tag LOCUS_57380 412 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 >Feature sequence2219 750 265 gene locus_tag LOCUS_57390 750 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57390 >Feature sequence2220 55 708 gene locus_tag LOCUS_57400 55 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 >Feature sequence2221 >Feature sequence2222 >Feature sequence2223 >Feature sequence2224 1376 1077 gene locus_tag LOCUS_57410 1376 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 >Feature sequence2225 <1 792 gene locus_tag LOCUS_57420 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WCD8:glutamyl-tRNA(Gln) amidotransferase subunit A 789 1628 gene locus_tag LOCUS_57430 789 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57430 >Feature sequence2226 >Feature sequence2227 <1628 379 gene locus_tag LOCUS_57440 <1628 379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F063:GTPase HflX >Feature sequence2228 317 1294 gene locus_tag LOCUS_57450 317 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57450 1578 1219 gene locus_tag LOCUS_57460 1578 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57460 >Feature sequence2229 729 94 gene locus_tag LOCUS_57470 729 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 1284 898 gene locus_tag LOCUS_57480 1284 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57480 >Feature sequence2230 54 428 gene locus_tag LOCUS_57490 54 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57490 552 902 gene locus_tag LOCUS_57500 552 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57500 >Feature sequence2231 1093 1302 gene locus_tag LOCUS_57510 1093 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 >Feature sequence2232 >Feature sequence2233 1409 675 gene locus_tag LOCUS_57520 1409 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 >Feature sequence2234 >Feature sequence2235 1412 117 gene locus_tag LOCUS_57530 1412 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 >Feature sequence2236 1618 926 gene locus_tag LOCUS_57540 1618 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 >Feature sequence2237 >Feature sequence2238 >Feature sequence2239 >Feature sequence2240 180 719 gene locus_tag LOCUS_57550 180 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 >Feature sequence2241 1198 1533 gene locus_tag LOCUS_57560 1198 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 >Feature sequence2242 >Feature sequence2243 543 1340 gene locus_tag LOCUS_57570 543 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 >Feature sequence2244 458 159 gene locus_tag LOCUS_57580 458 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57580 >Feature sequence2245 333 953 gene locus_tag LOCUS_57590 333 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57590 >Feature sequence2246 >Feature sequence2247 1220 756 gene locus_tag LOCUS_57600 1220 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57600 1604 1368 gene locus_tag LOCUS_57610 1604 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57610 >Feature sequence2248 >Feature sequence2249 >Feature sequence2250 >Feature sequence2251 >Feature sequence2252 <1601 446 gene locus_tag LOCUS_57620 <1601 446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583661.1:2-alkenal reductase >Feature sequence2253 820 182 gene locus_tag LOCUS_57630 820 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57630 <1600 833 gene locus_tag LOCUS_57640 <1600 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339002.1:LysR family transcriptional regulator >Feature sequence2254 >Feature sequence2255 <1 737 gene locus_tag LOCUS_57650 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256399.1:ABC transporter permease >Feature sequence2256 >Feature sequence2257 >Feature sequence2258 377 1051 gene locus_tag LOCUS_57660 377 1051 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073315.1 protein_id gnl|my_center|LOCUS_57660 >Feature sequence2259 >Feature sequence2260 >Feature sequence2261 >Feature sequence2262 658 846 gene locus_tag LOCUS_57670 658 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57670 937 1314 gene locus_tag LOCUS_57680 937 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57680 1311 1502 gene locus_tag LOCUS_57690 1311 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57690 >Feature sequence2263 >Feature sequence2264 >Feature sequence2265 >Feature sequence2266 >Feature sequence2267 <1581 427 gene locus_tag LOCUS_57700 <1581 427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880848.1:rhomboid family intramembrane serine protease >Feature sequence2268 332 916 gene locus_tag LOCUS_57710 332 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 >Feature sequence2269 1287 763 gene locus_tag LOCUS_57720 1287 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 >Feature sequence2270 452 87 gene locus_tag LOCUS_57730 452 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 >Feature sequence2271 313 134 gene locus_tag LOCUS_57740 313 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 >Feature sequence2272 >Feature sequence2273 <1 793 gene locus_tag LOCUS_57750 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939406.1:hybrid sensor histidine kinase/response regulator <1578 812 gene locus_tag LOCUS_57760 <1578 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256390.1:protein kinase >Feature sequence2274 >Feature sequence2275 1420 980 gene locus_tag LOCUS_57770 1420 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 >Feature sequence2276 1540 569 gene locus_tag LOCUS_57780 1540 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 >Feature sequence2277 <1574 677 gene locus_tag LOCUS_57790 <1574 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WH03:carbamoyl-phosphate synthase small chain >Feature sequence2278 1266 703 gene locus_tag LOCUS_57800 1266 703 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809919.1 protein_id gnl|my_center|LOCUS_57800 >Feature sequence2279 >Feature sequence2280 >Feature sequence2281 1359 217 gene locus_tag LOCUS_57810 1359 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57810 >Feature sequence2282 >Feature sequence2283 >Feature sequence2284 >Feature sequence2285 128 619 gene locus_tag LOCUS_57820 128 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 1185 622 gene locus_tag LOCUS_57830 gene orn 1185 622 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV17 protein_id gnl|my_center|LOCUS_57830 >Feature sequence2286 >Feature sequence2287 624 40 gene locus_tag LOCUS_57840 624 40 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 protein_id gnl|my_center|LOCUS_57840 508 732 gene locus_tag LOCUS_57850 508 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 >Feature sequence2288 >Feature sequence2289 >Feature sequence2290 >Feature sequence2291 389 1126 gene locus_tag LOCUS_57860 389 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57860 >Feature sequence2292 302 706 gene locus_tag LOCUS_57870 302 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 1472 708 gene locus_tag LOCUS_57880 1472 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57880 >Feature sequence2293 403 1116 gene locus_tag LOCUS_57890 403 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 >Feature sequence2294 >Feature sequence2295 >Feature sequence2296 >Feature sequence2297 >Feature sequence2298 >Feature sequence2299 >Feature sequence2300 95 1078 gene locus_tag LOCUS_57900 95 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57900 >Feature sequence2301 <1 551 gene locus_tag LOCUS_57910 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000796029.1:histidine kinase >Feature sequence2302 1479 826 gene locus_tag LOCUS_57920 1479 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57920 >Feature sequence2303 639 151 gene locus_tag LOCUS_57930 639 151 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_57930 >Feature sequence2304 >Feature sequence2305 >Feature sequence2306 >Feature sequence2307 <1 821 gene locus_tag LOCUS_57940 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001018468.1:sodium:proline symporter >Feature sequence2308 1200 1273 gene locus_tag LOCUS_t01040 1200 1273 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1368 1441 gene locus_tag LOCUS_t01050 1368 1441 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2309 >Feature sequence2310 >Feature sequence2311 >Feature sequence2312 759 1076 gene locus_tag LOCUS_57950 759 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 >Feature sequence2313 >Feature sequence2314 >Feature sequence2315 >Feature sequence2316 607 1074 gene locus_tag LOCUS_57960 607 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 >Feature sequence2317 339 1301 gene locus_tag LOCUS_57970 339 1301 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706832.1 protein_id gnl|my_center|LOCUS_57970 >Feature sequence2318 <1535 870 gene locus_tag LOCUS_57980 <1535 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SIH7:NAD-dependent protein deacylase >Feature sequence2319 >Feature sequence2320 >Feature sequence2321 246 551 gene locus_tag LOCUS_57990 246 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 1324 548 gene locus_tag LOCUS_58000 1324 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 >Feature sequence2322 >Feature sequence2323 >Feature sequence2324 >Feature sequence2325 711 448 gene locus_tag LOCUS_58010 711 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 <1528 881 gene locus_tag LOCUS_58020 <1528 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074378.1:integrase >Feature sequence2326 >Feature sequence2327 602 814 gene locus_tag LOCUS_58030 602 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58030 >Feature sequence2328 <1527 834 gene locus_tag LOCUS_58040 <1527 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941639.1:ATPase AAA >Feature sequence2329 >Feature sequence2330 757 1515 gene locus_tag LOCUS_58050 757 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58050 >Feature sequence2331 105 590 gene locus_tag LOCUS_58060 105 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 802 1119 gene locus_tag LOCUS_58070 802 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58070 >Feature sequence2332 >Feature sequence2333 215 658 gene locus_tag LOCUS_58080 215 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 >Feature sequence2334 >Feature sequence2335 201 764 gene locus_tag LOCUS_58090 201 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 >Feature sequence2336 549 857 gene locus_tag LOCUS_58100 549 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 >Feature sequence2337 >Feature sequence2338 >Feature sequence2339 >Feature sequence2340 >Feature sequence2341 >Feature sequence2342 >Feature sequence2343 >Feature sequence2344 >Feature sequence2345 >Feature sequence2346 >Feature sequence2347 343 840 gene locus_tag LOCUS_58110 343 840 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93J09 protein_id gnl|my_center|LOCUS_58110 1420 980 gene locus_tag LOCUS_58120 1420 980 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770885.1 protein_id gnl|my_center|LOCUS_58120 >Feature sequence2348 1221 157 gene locus_tag LOCUS_58130 1221 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58130 >Feature sequence2349 1465 383 gene locus_tag LOCUS_58140 1465 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58140 >Feature sequence2350 >Feature sequence2351 <1506 37 gene locus_tag LOCUS_58150 <1506 37 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402897.1:ATPase >Feature sequence2352 >Feature sequence2353 1502 645 gene locus_tag LOCUS_58160 1502 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58160 >Feature sequence2354