>Feature sequence001 2679 1882 gene locus_tag LOCUS_00010 2679 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 5141 2679 gene locus_tag LOCUS_00020 5141 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5710 5198 gene locus_tag LOCUS_00030 5710 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5812 7104 gene locus_tag LOCUS_00040 5812 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7101 7799 gene locus_tag LOCUS_00050 7101 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8445 7801 gene locus_tag LOCUS_00060 8445 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9488 8496 gene locus_tag LOCUS_00070 9488 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9518 10027 gene locus_tag LOCUS_00080 9518 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10024 11526 gene locus_tag LOCUS_00090 10024 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13066 11504 gene locus_tag LOCUS_00100 13066 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14435 13059 gene locus_tag LOCUS_00110 14435 13059 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_00110 15010 14414 gene locus_tag LOCUS_00120 15010 14414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15352 16956 gene locus_tag LOCUS_00130 gene recN 15352 16956 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH7 protein_id gnl|my_center|LOCUS_00130 16961 17740 gene locus_tag LOCUS_00140 16961 17740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17731 19164 gene locus_tag LOCUS_00150 17731 19164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19312 19485 gene locus_tag LOCUS_00160 19312 19485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19482 20084 gene locus_tag LOCUS_00170 19482 20084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21122 20085 gene locus_tag LOCUS_00180 21122 20085 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403202.1 protein_id gnl|my_center|LOCUS_00180 22960 21119 gene locus_tag LOCUS_00190 gene korA 22960 21119 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_00190 27503 23058 gene locus_tag LOCUS_00200 27503 23058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 28559 27507 gene locus_tag LOCUS_00210 28559 27507 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_00210 29116 28556 gene locus_tag LOCUS_00220 29116 28556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 29980 29174 gene locus_tag LOCUS_00230 29980 29174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30812 30009 gene locus_tag LOCUS_00240 30812 30009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 30971 32110 gene locus_tag LOCUS_00250 30971 32110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 32154 33524 gene locus_tag LOCUS_00260 32154 33524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 34078 33530 gene locus_tag LOCUS_00270 34078 33530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 34113 35273 gene locus_tag LOCUS_00280 34113 35273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 35451 35206 gene locus_tag LOCUS_00290 35451 35206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37023 35524 gene locus_tag LOCUS_00300 37023 35524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 37268 37020 gene locus_tag LOCUS_00310 37268 37020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 38867 37356 gene locus_tag LOCUS_00320 38867 37356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 38971 39627 gene locus_tag LOCUS_00330 38971 39627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 42380 39633 gene locus_tag LOCUS_00340 42380 39633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 42957 42388 gene locus_tag LOCUS_00350 42957 42388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42981 43820 gene locus_tag LOCUS_00360 gene mutM 42981 43820 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XZG5 protein_id gnl|my_center|LOCUS_00360 44553 43810 gene locus_tag LOCUS_00370 44553 43810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 44576 45007 gene locus_tag LOCUS_00380 44576 45007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 45017 45523 gene locus_tag LOCUS_00390 45017 45523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45520 45816 gene locus_tag LOCUS_00400 45520 45816 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522937.1 protein_id gnl|my_center|LOCUS_00400 46861 45806 gene locus_tag LOCUS_00410 gene pfkA 46861 45806 CDS product ATP-dependent 6-phosphofructokinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21777 protein_id gnl|my_center|LOCUS_00410 46943 47128 gene locus_tag LOCUS_00420 46943 47128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 47934 47074 gene locus_tag LOCUS_00430 47934 47074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 48170 47985 gene locus_tag LOCUS_00440 48170 47985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 48093 48413 gene locus_tag LOCUS_00450 48093 48413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 49272 48385 gene locus_tag LOCUS_00460 49272 48385 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_00460 51305 49272 gene locus_tag LOCUS_00470 51305 49272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 51659 51342 gene locus_tag LOCUS_00480 51659 51342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 51710 51856 gene locus_tag LOCUS_00490 51710 51856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 51899 52363 gene locus_tag LOCUS_00500 51899 52363 CDS product pilus assembly-related outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523374.1 protein_id gnl|my_center|LOCUS_00500 52371 52562 gene locus_tag LOCUS_00510 52371 52562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 52608 53414 gene locus_tag LOCUS_00520 52608 53414 CDS product pilus assembly-related, exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523372.1 protein_id gnl|my_center|LOCUS_00520 53414 54853 gene locus_tag LOCUS_00530 53414 54853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 54861 57074 gene locus_tag LOCUS_00540 54861 57074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 57088 58023 gene locus_tag LOCUS_00550 57088 58023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 58931 58026 gene locus_tag LOCUS_00560 58931 58026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 59884 58928 gene locus_tag LOCUS_00570 59884 58928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 61056 59881 gene locus_tag LOCUS_00580 61056 59881 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM0 protein_id gnl|my_center|LOCUS_00580 61717 61064 gene locus_tag LOCUS_00590 61717 61064 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_00590 61780 64332 gene locus_tag LOCUS_00600 61780 64332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 66313 64316 gene locus_tag LOCUS_00610 66313 64316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 67079 66336 gene locus_tag LOCUS_00620 67079 66336 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_00620 67924 67085 gene locus_tag LOCUS_00630 67924 67085 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 protein_id gnl|my_center|LOCUS_00630 68400 67924 gene locus_tag LOCUS_00640 68400 67924 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940359.1 protein_id gnl|my_center|LOCUS_00640 68843 68400 gene locus_tag LOCUS_00650 68843 68400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00650 69552 68860 gene locus_tag LOCUS_00660 69552 68860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 70308 69562 gene locus_tag LOCUS_00670 70308 69562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 71141 70377 gene locus_tag LOCUS_00680 71141 70377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 71347 71138 gene locus_tag LOCUS_00690 71347 71138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 72102 71344 gene locus_tag LOCUS_00700 72102 71344 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702276.1 protein_id gnl|my_center|LOCUS_00700 74317 72116 gene locus_tag LOCUS_00710 74317 72116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 76040 74352 gene locus_tag LOCUS_00720 76040 74352 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_00720 76890 76243 gene locus_tag LOCUS_00730 76890 76243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 77219 76857 gene locus_tag LOCUS_00740 77219 76857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 78737 77442 gene locus_tag LOCUS_00750 78737 77442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 80407 78785 gene locus_tag LOCUS_00760 gene putA 80407 78785 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_00760 82214 80433 gene locus_tag LOCUS_00770 82214 80433 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 protein_id gnl|my_center|LOCUS_00770 82240 82698 gene locus_tag LOCUS_00780 82240 82698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 82695 83945 gene locus_tag LOCUS_00790 82695 83945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 84415 83912 gene locus_tag LOCUS_00800 84415 83912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 85366 84431 gene locus_tag LOCUS_00810 85366 84431 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_00810 85390 87024 gene locus_tag LOCUS_00820 85390 87024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 87079 87843 gene locus_tag LOCUS_00830 87079 87843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 89261 88080 gene locus_tag LOCUS_00840 89261 88080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 89245 89667 gene locus_tag LOCUS_00850 89245 89667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 90350 89631 gene locus_tag LOCUS_00860 90350 89631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 90371 91270 gene locus_tag LOCUS_00870 90371 91270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 92120 91245 gene locus_tag LOCUS_00880 92120 91245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 92569 92123 gene locus_tag LOCUS_00890 92569 92123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 93074 92574 gene locus_tag LOCUS_00900 93074 92574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 94172 93153 gene locus_tag LOCUS_00910 gene gpsA 94172 93153 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61740 protein_id gnl|my_center|LOCUS_00910 95656 94175 gene locus_tag LOCUS_00920 95656 94175 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144273.1 protein_id gnl|my_center|LOCUS_00920 95691 96665 gene locus_tag LOCUS_00930 gene gshB 95691 96665 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN11 protein_id gnl|my_center|LOCUS_00930 96669 97121 gene locus_tag LOCUS_00940 96669 97121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 97325 97945 gene locus_tag LOCUS_00950 gene algU 97325 97945 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_00950 97942 98919 gene locus_tag LOCUS_00960 97942 98919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 99367 99014 gene locus_tag LOCUS_00970 99367 99014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 99248 99688 gene locus_tag LOCUS_00980 99248 99688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 99693 100445 gene locus_tag LOCUS_00990 99693 100445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 100423 101652 gene locus_tag LOCUS_01000 100423 101652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 103225 101642 gene locus_tag LOCUS_01010 103225 101642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 104265 103261 gene locus_tag LOCUS_01020 104265 103261 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084113.1 protein_id gnl|my_center|LOCUS_01020 104287 104892 gene locus_tag LOCUS_01030 104287 104892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 104911 105633 gene locus_tag LOCUS_01040 104911 105633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 106406 105954 gene locus_tag LOCUS_01050 106406 105954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 107917 106403 gene locus_tag LOCUS_01060 107917 106403 CDS product stage V sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_01060 109011 107917 gene locus_tag LOCUS_01070 109011 107917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256855.1 protein_id gnl|my_center|LOCUS_01070 111055 109016 gene locus_tag LOCUS_01080 111055 109016 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_01080 111229 111687 gene locus_tag LOCUS_01090 111229 111687 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021906.1 protein_id gnl|my_center|LOCUS_01090 111687 112619 gene locus_tag LOCUS_01100 gene rfbB 111687 112619 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXP4 protein_id gnl|my_center|LOCUS_01100 112609 113574 gene locus_tag LOCUS_01110 112609 113574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 114491 113610 gene locus_tag LOCUS_01120 114491 113610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 114561 115541 gene locus_tag LOCUS_01130 114561 115541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 115614 116531 gene locus_tag LOCUS_01140 gene lgt 115614 116531 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66627 protein_id gnl|my_center|LOCUS_01140 116556 118850 gene locus_tag LOCUS_01150 116556 118850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 118965 119918 gene locus_tag LOCUS_01160 118965 119918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 120718 119966 gene locus_tag LOCUS_01170 120718 119966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_01170 121633 120797 gene locus_tag LOCUS_01180 121633 120797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 122491 121673 gene locus_tag LOCUS_01190 122491 121673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 >Feature sequence002 114 3086 gene locus_tag LOCUS_01200 114 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 3086 4045 gene locus_tag LOCUS_01210 3086 4045 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932223.1 protein_id gnl|my_center|LOCUS_01210 4033 4677 gene locus_tag LOCUS_01220 4033 4677 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_01220 4749 5804 gene locus_tag LOCUS_01230 4749 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 6257 5808 gene locus_tag LOCUS_01240 6257 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 8850 6211 gene locus_tag LOCUS_01250 8850 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 10234 8843 gene locus_tag LOCUS_01260 10234 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 12074 10353 gene locus_tag LOCUS_01270 12074 10353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 12541 12071 gene locus_tag LOCUS_01280 12541 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 13122 12538 gene locus_tag LOCUS_01290 13122 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 15295 13133 gene locus_tag LOCUS_01300 15295 13133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 16224 15298 gene locus_tag LOCUS_01310 16224 15298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 16595 16221 gene locus_tag LOCUS_01320 16595 16221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 17896 16715 gene locus_tag LOCUS_01330 17896 16715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 18324 17893 gene locus_tag LOCUS_01340 18324 17893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 19382 18327 gene locus_tag LOCUS_01350 19382 18327 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246120.1 protein_id gnl|my_center|LOCUS_01350 20059 19379 gene locus_tag LOCUS_01360 20059 19379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 20058 21722 gene locus_tag LOCUS_01370 20058 21722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 21731 22888 gene locus_tag LOCUS_01380 21731 22888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 23023 24078 gene locus_tag LOCUS_01390 23023 24078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_01390 24750 24313 gene locus_tag LOCUS_01400 24750 24313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 26315 24747 gene locus_tag LOCUS_01410 26315 24747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 26869 26315 gene locus_tag LOCUS_01420 26869 26315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 27792 26869 gene locus_tag LOCUS_01430 27792 26869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 28229 27789 gene locus_tag LOCUS_01440 28229 27789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 28844 28350 gene locus_tag LOCUS_01450 28844 28350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 29165 28974 gene locus_tag LOCUS_01460 29165 28974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 29164 30909 gene locus_tag LOCUS_01470 29164 30909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 31301 30867 gene locus_tag LOCUS_01480 31301 30867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 32187 31309 gene locus_tag LOCUS_01490 32187 31309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 32606 32187 gene locus_tag LOCUS_01500 32606 32187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 35503 32762 gene locus_tag LOCUS_01510 35503 32762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 36179 35523 gene locus_tag LOCUS_01520 36179 35523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 36226 36693 gene locus_tag LOCUS_01530 36226 36693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 37306 36716 gene locus_tag LOCUS_01540 37306 36716 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477632.1 protein_id gnl|my_center|LOCUS_01540 37595 37323 gene locus_tag LOCUS_01550 37595 37323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 37739 39178 gene locus_tag LOCUS_01560 37739 39178 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881190.1 protein_id gnl|my_center|LOCUS_01560 39186 39848 gene locus_tag LOCUS_01570 39186 39848 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 protein_id gnl|my_center|LOCUS_01570 39845 40018 gene locus_tag LOCUS_01580 39845 40018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 40015 40509 gene locus_tag LOCUS_01590 40015 40509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 40512 41855 gene locus_tag LOCUS_01600 40512 41855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 41852 41980 gene locus_tag LOCUS_01610 41852 41980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 42181 44142 gene locus_tag LOCUS_01620 42181 44142 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015537.1 protein_id gnl|my_center|LOCUS_01620 44270 45622 gene locus_tag LOCUS_01630 44270 45622 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_01630 47000 45573 gene locus_tag LOCUS_01640 47000 45573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 47471 47049 gene locus_tag LOCUS_01650 47471 47049 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVF0 protein_id gnl|my_center|LOCUS_01650 47579 47737 gene locus_tag LOCUS_01660 47579 47737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 47738 49006 gene locus_tag LOCUS_01670 gene hemN 47738 49006 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P554 protein_id gnl|my_center|LOCUS_01670 49022 49465 gene locus_tag LOCUS_01680 49022 49465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 49462 49875 gene locus_tag LOCUS_01690 49462 49875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01690 50063 49872 gene locus_tag LOCUS_01700 50063 49872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 51640 50024 gene locus_tag LOCUS_01710 51640 50024 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_01710 51640 52557 gene locus_tag LOCUS_01720 gene ribF 51640 52557 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI3 protein_id gnl|my_center|LOCUS_01720 52551 53375 gene locus_tag LOCUS_01730 gene aroE 52551 53375 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D29 protein_id gnl|my_center|LOCUS_01730 53392 54309 gene locus_tag LOCUS_01740 53392 54309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523363.1 protein_id gnl|my_center|LOCUS_01740 54311 54664 gene locus_tag LOCUS_01750 54311 54664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256413.1 protein_id gnl|my_center|LOCUS_01750 54661 56001 gene locus_tag LOCUS_01760 54661 56001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 56025 56981 gene locus_tag LOCUS_01770 56025 56981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 57002 59188 gene locus_tag LOCUS_01780 57002 59188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 59166 60386 gene locus_tag LOCUS_01790 59166 60386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 60396 61286 gene locus_tag LOCUS_01800 60396 61286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 61280 62179 gene locus_tag LOCUS_01810 61280 62179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 63842 62184 gene locus_tag LOCUS_01820 63842 62184 CDS product 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391777.1 protein_id gnl|my_center|LOCUS_01820 64669 63839 gene locus_tag LOCUS_01830 gene rfbD 64669 63839 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222918.1 protein_id gnl|my_center|LOCUS_01830 64649 66136 gene locus_tag LOCUS_01840 64649 66136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 66158 67870 gene locus_tag LOCUS_01850 66158 67870 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404643.1 protein_id gnl|my_center|LOCUS_01850 67909 68112 gene locus_tag LOCUS_01860 67909 68112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 68224 68529 gene locus_tag LOCUS_01870 gene rplU 68224 68529 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457386.1 protein_id gnl|my_center|LOCUS_01870 68542 68817 gene locus_tag LOCUS_01880 gene rpmA 68542 68817 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8REI3 protein_id gnl|my_center|LOCUS_01880 68826 69839 gene locus_tag LOCUS_01890 gene obg 68826 69839 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Q2 protein_id gnl|my_center|LOCUS_01890 69836 70549 gene locus_tag LOCUS_01900 69836 70549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 70761 71066 gene locus_tag LOCUS_01910 70761 71066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 71494 71051 gene locus_tag LOCUS_01920 71494 71051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 71662 72651 gene locus_tag LOCUS_01930 71662 72651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 72685 73020 gene locus_tag LOCUS_01940 gene crcB 72685 73020 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXV4 protein_id gnl|my_center|LOCUS_01940 73097 73819 gene locus_tag LOCUS_01950 gene pspA 73097 73819 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_01950 73816 74184 gene locus_tag LOCUS_01960 73816 74184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 74181 77219 gene locus_tag LOCUS_01970 74181 77219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 77216 77725 gene locus_tag LOCUS_01980 77216 77725 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024390.1 protein_id gnl|my_center|LOCUS_01980 78797 77715 gene locus_tag LOCUS_01990 78797 77715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 78836 79951 gene locus_tag LOCUS_02000 78836 79951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 79942 81057 gene locus_tag LOCUS_02010 79942 81057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083160.1 protein_id gnl|my_center|LOCUS_02010 81054 82316 gene locus_tag LOCUS_02020 81054 82316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 83946 82273 gene locus_tag LOCUS_02030 83946 82273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 84782 83946 gene locus_tag LOCUS_02040 84782 83946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 85332 84793 gene locus_tag LOCUS_02050 85332 84793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 85417 86610 gene locus_tag LOCUS_02060 85417 86610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 86635 87690 gene locus_tag LOCUS_02070 gene mqnC 86635 87690 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727U7 protein_id gnl|my_center|LOCUS_02070 88876 87698 gene locus_tag LOCUS_02080 88876 87698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 88991 90736 gene locus_tag LOCUS_02090 88991 90736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 90724 91752 gene locus_tag LOCUS_02100 90724 91752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 >Feature sequence003 <1 1064 gene locus_tag LOCUS_02110 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036373.1:histidine kinase 1114 2277 gene locus_tag LOCUS_02120 1114 2277 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242252.1 protein_id gnl|my_center|LOCUS_02120 3138 2290 gene locus_tag LOCUS_02130 3138 2290 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268101.1 protein_id gnl|my_center|LOCUS_02130 3236 5530 gene locus_tag LOCUS_02140 3236 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 5527 6402 gene locus_tag LOCUS_02150 5527 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 6433 8427 gene locus_tag LOCUS_02160 6433 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 8424 10019 gene locus_tag LOCUS_02170 8424 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 10016 10315 gene locus_tag LOCUS_02180 10016 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 10424 11809 gene locus_tag LOCUS_02190 10424 11809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 12107 11934 gene locus_tag LOCUS_02200 12107 11934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 13959 12541 gene locus_tag LOCUS_02210 13959 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_02210 14519 13941 gene locus_tag LOCUS_02220 14519 13941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 15553 14519 gene locus_tag LOCUS_02230 15553 14519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 16399 15563 gene locus_tag LOCUS_02240 16399 15563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142969.1 protein_id gnl|my_center|LOCUS_02240 17034 16384 gene locus_tag LOCUS_02250 gene rpe 17034 16384 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z3 protein_id gnl|my_center|LOCUS_02250 18286 17054 gene locus_tag LOCUS_02260 gene rimK 18286 17054 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 protein_id gnl|my_center|LOCUS_02260 19746 18283 gene locus_tag LOCUS_02270 19746 18283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 19885 19809 gene locus_tag LOCUS_t00010 19885 19809 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19910 20485 gene locus_tag LOCUS_02280 19910 20485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 20495 21709 gene locus_tag LOCUS_02290 20495 21709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 21787 22143 gene locus_tag LOCUS_02300 21787 22143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 22984 22286 gene locus_tag LOCUS_02310 22984 22286 CDS product aminoglycoside 3-N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140487.1 protein_id gnl|my_center|LOCUS_02310 23529 22984 gene locus_tag LOCUS_02320 23529 22984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 23936 23517 gene locus_tag LOCUS_02330 gene fur 23936 23517 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124041.1 protein_id gnl|my_center|LOCUS_02330 26323 23945 gene locus_tag LOCUS_02340 26323 23945 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_02340 27084 26359 gene locus_tag LOCUS_02350 27084 26359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 27501 27100 gene locus_tag LOCUS_02360 27501 27100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 28340 27498 gene locus_tag LOCUS_02370 28340 27498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 31134 28330 gene locus_tag LOCUS_02380 31134 28330 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_02380 32678 31131 gene locus_tag LOCUS_02390 32678 31131 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_02390 32883 34631 gene locus_tag LOCUS_02400 32883 34631 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_009278.2 protein_id gnl|my_center|LOCUS_02400 34639 35070 gene locus_tag LOCUS_02410 34639 35070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184577.1 protein_id gnl|my_center|LOCUS_02410 35067 35534 gene locus_tag LOCUS_02420 35067 35534 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184408.1 protein_id gnl|my_center|LOCUS_02420 35847 35485 gene locus_tag LOCUS_02430 35847 35485 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957285.1 protein_id gnl|my_center|LOCUS_02430 36656 35853 gene locus_tag LOCUS_02440 36656 35853 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776808.1 protein_id gnl|my_center|LOCUS_02440 37894 36656 gene locus_tag LOCUS_02450 37894 36656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 39220 37940 gene locus_tag LOCUS_02460 39220 37940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 39295 40005 gene locus_tag LOCUS_02470 39295 40005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 41728 40019 gene locus_tag LOCUS_02480 41728 40019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 43509 41725 gene locus_tag LOCUS_02490 43509 41725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 44713 43520 gene locus_tag LOCUS_02500 44713 43520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 44754 45593 gene locus_tag LOCUS_02510 44754 45593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 45606 46667 gene locus_tag LOCUS_02520 45606 46667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 47421 46681 gene locus_tag LOCUS_02530 47421 46681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 47405 48154 gene locus_tag LOCUS_02540 47405 48154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 48932 48138 gene locus_tag LOCUS_02550 48932 48138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 49723 48929 gene locus_tag LOCUS_02560 49723 48929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 51243 49780 gene locus_tag LOCUS_02570 51243 49780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 52226 51300 gene locus_tag LOCUS_02580 52226 51300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 52107 53288 gene locus_tag LOCUS_02590 52107 53288 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_02590 53824 53300 gene locus_tag LOCUS_02600 53824 53300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 54417 53821 gene locus_tag LOCUS_02610 54417 53821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 54436 55107 gene locus_tag LOCUS_02620 54436 55107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 55101 63572 gene locus_tag LOCUS_02630 55101 63572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 63569 64381 gene locus_tag LOCUS_02640 63569 64381 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256238.1 protein_id gnl|my_center|LOCUS_02640 64688 64458 gene locus_tag LOCUS_02650 64688 64458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 65864 65034 gene locus_tag LOCUS_02660 65864 65034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 65863 67410 gene locus_tag LOCUS_02670 65863 67410 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461820.1 protein_id gnl|my_center|LOCUS_02670 67407 68240 gene locus_tag LOCUS_02680 67407 68240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190719.1 protein_id gnl|my_center|LOCUS_02680 68242 69993 gene locus_tag LOCUS_02690 68242 69993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 69990 70550 gene locus_tag LOCUS_02700 69990 70550 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_02700 70550 71170 gene locus_tag LOCUS_02710 70550 71170 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337281.1 protein_id gnl|my_center|LOCUS_02710 71940 71200 gene locus_tag LOCUS_02720 71940 71200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 72648 71992 gene locus_tag LOCUS_02730 72648 71992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 73985 72645 gene locus_tag LOCUS_02740 73985 72645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 75402 73906 gene locus_tag LOCUS_02750 75402 73906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 76276 75509 gene locus_tag LOCUS_02760 76276 75509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 77097 76276 gene locus_tag LOCUS_02770 77097 76276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 77912 77094 gene locus_tag LOCUS_02780 77912 77094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 78943 77909 gene locus_tag LOCUS_02790 78943 77909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 80406 78940 gene locus_tag LOCUS_02800 80406 78940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 81695 80403 gene locus_tag LOCUS_02810 81695 80403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 81742 83088 gene locus_tag LOCUS_02820 81742 83088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 83090 84682 gene locus_tag LOCUS_02830 83090 84682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 84667 85608 gene locus_tag LOCUS_02840 84667 85608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 87525 85612 gene locus_tag LOCUS_02850 87525 85612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 88696 87539 gene locus_tag LOCUS_02860 gene aspC 88696 87539 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56232 protein_id gnl|my_center|LOCUS_02860 89527 88718 gene locus_tag LOCUS_02870 89527 88718 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083599.1 protein_id gnl|my_center|LOCUS_02870 89589 90305 gene locus_tag LOCUS_02880 89589 90305 CDS product glutathione amide-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883987.1 protein_id gnl|my_center|LOCUS_02880 90323 90715 gene locus_tag LOCUS_02890 90323 90715 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974361.1 protein_id gnl|my_center|LOCUS_02890 >Feature sequence004 924 1340 gene locus_tag LOCUS_02900 924 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 1341 2015 gene locus_tag LOCUS_02910 1341 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 2025 2648 gene locus_tag LOCUS_02920 2025 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 2645 3592 gene locus_tag LOCUS_02930 2645 3592 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_02930 4146 3595 gene locus_tag LOCUS_02940 4146 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 4281 6371 gene locus_tag LOCUS_02950 gene fusA2 4281 6371 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73NV3 protein_id gnl|my_center|LOCUS_02950 6371 7639 gene locus_tag LOCUS_02960 6371 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 8268 7642 gene locus_tag LOCUS_02970 8268 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 9161 8265 gene locus_tag LOCUS_02980 9161 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 9205 10269 gene locus_tag LOCUS_02990 9205 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 10942 10280 gene locus_tag LOCUS_03000 10942 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 13268 10965 gene locus_tag LOCUS_03010 13268 10965 CDS product penicillin acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227650.1 protein_id gnl|my_center|LOCUS_03010 13231 13704 gene locus_tag LOCUS_03020 13231 13704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 14500 13706 gene locus_tag LOCUS_03030 14500 13706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 15249 14584 gene locus_tag LOCUS_03040 15249 14584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 16094 15243 gene locus_tag LOCUS_03050 16094 15243 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_03050 17461 16094 gene locus_tag LOCUS_03060 17461 16094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 17936 17484 gene locus_tag LOCUS_03070 17936 17484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 17965 20310 gene locus_tag LOCUS_03080 gene mutS2 17965 20310 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHS6 protein_id gnl|my_center|LOCUS_03080 20321 21127 gene locus_tag LOCUS_03090 20321 21127 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338139.1 protein_id gnl|my_center|LOCUS_03090 21935 21093 gene locus_tag LOCUS_03100 21935 21093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 21973 23061 gene locus_tag LOCUS_03110 gene aroC 21973 23061 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_03110 23804 23046 gene locus_tag LOCUS_03120 23804 23046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 25637 23832 gene locus_tag LOCUS_03130 25637 23832 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016545.1 protein_id gnl|my_center|LOCUS_03130 27187 25721 gene locus_tag LOCUS_03140 27187 25721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 28157 27192 gene locus_tag LOCUS_03150 28157 27192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 31081 28154 gene locus_tag LOCUS_03160 31081 28154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 31716 31108 gene locus_tag LOCUS_03170 31716 31108 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_03170 34157 31716 gene locus_tag LOCUS_03180 34157 31716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 36498 34222 gene locus_tag LOCUS_03190 36498 34222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 37154 36495 gene locus_tag LOCUS_03200 37154 36495 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_03200 37172 37645 gene locus_tag LOCUS_03210 37172 37645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 37721 38545 gene locus_tag LOCUS_03220 37721 38545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 38562 39047 gene locus_tag LOCUS_03230 38562 39047 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902983.1 protein_id gnl|my_center|LOCUS_03230 39037 40704 gene locus_tag LOCUS_03240 39037 40704 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013786.1 protein_id gnl|my_center|LOCUS_03240 41359 40736 gene locus_tag LOCUS_03250 41359 40736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 42430 41462 gene locus_tag LOCUS_03260 42430 41462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 45243 42424 gene locus_tag LOCUS_03270 45243 42424 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_03270 47091 45253 gene locus_tag LOCUS_03280 47091 45253 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_03280 47585 47088 gene locus_tag LOCUS_03290 47585 47088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 48754 47579 gene locus_tag LOCUS_03300 48754 47579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 49275 48757 gene locus_tag LOCUS_03310 49275 48757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 49820 49272 gene locus_tag LOCUS_03320 49820 49272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 50568 49825 gene locus_tag LOCUS_03330 50568 49825 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_03330 52512 50581 gene locus_tag LOCUS_03340 gene sdhA 52512 50581 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_03340 53231 52512 gene locus_tag LOCUS_03350 53231 52512 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_03350 55446 53278 gene locus_tag LOCUS_03360 55446 53278 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_03360 57545 55443 gene locus_tag LOCUS_03370 57545 55443 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_03370 58206 57580 gene locus_tag LOCUS_03380 58206 57580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 59237 58215 gene locus_tag LOCUS_03390 59237 58215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 60507 59293 gene locus_tag LOCUS_03400 60507 59293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 60918 60586 gene locus_tag LOCUS_03410 60918 60586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 61151 60918 gene locus_tag LOCUS_03420 61151 60918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 62752 61148 gene locus_tag LOCUS_03430 62752 61148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 64609 62807 gene locus_tag LOCUS_03440 64609 62807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 66016 64676 gene locus_tag LOCUS_03450 66016 64676 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226651.1 protein_id gnl|my_center|LOCUS_03450 66633 66013 gene locus_tag LOCUS_03460 66633 66013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 66735 67415 gene locus_tag LOCUS_03470 66735 67415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 67412 68041 gene locus_tag LOCUS_03480 67412 68041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 68026 68490 gene locus_tag LOCUS_03490 68026 68490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 69897 68491 gene locus_tag LOCUS_03500 69897 68491 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_03500 70756 69917 gene locus_tag LOCUS_03510 gene dapF 70756 69917 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZX7 protein_id gnl|my_center|LOCUS_03510 70792 71535 gene locus_tag LOCUS_03520 gene nadK 70792 71535 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAC5 protein_id gnl|my_center|LOCUS_03520 72505 71543 gene locus_tag LOCUS_03530 72505 71543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 73869 72502 gene locus_tag LOCUS_03540 73869 72502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 76138 73850 gene locus_tag LOCUS_03550 76138 73850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402856.1 protein_id gnl|my_center|LOCUS_03550 76482 76276 gene locus_tag LOCUS_03560 76482 76276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 77266 76532 gene locus_tag LOCUS_03570 77266 76532 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0T4 protein_id gnl|my_center|LOCUS_03570 79026 77527 gene locus_tag LOCUS_03580 79026 77527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 80439 79030 gene locus_tag LOCUS_03590 80439 79030 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LN4 protein_id gnl|my_center|LOCUS_03590 80562 81437 gene locus_tag LOCUS_03600 80562 81437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 82698 81550 gene locus_tag LOCUS_03610 82698 81550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 83627 82695 gene locus_tag LOCUS_03620 gene gshB 83627 82695 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7R6 protein_id gnl|my_center|LOCUS_03620 84903 83641 gene locus_tag LOCUS_03630 gene gltP 84903 83641 CDS product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 protein_id gnl|my_center|LOCUS_03630 86219 84912 gene locus_tag LOCUS_03640 gene mnmE 86219 84912 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RVL1 protein_id gnl|my_center|LOCUS_03640 86371 86216 gene locus_tag LOCUS_03650 86371 86216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence005 143 1009 gene locus_tag LOCUS_03660 143 1009 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114699.1 protein_id gnl|my_center|LOCUS_03660 1019 1738 gene locus_tag LOCUS_03670 1019 1738 CDS product enoyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723876.1 protein_id gnl|my_center|LOCUS_03670 1749 2372 gene locus_tag LOCUS_03680 1749 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 3713 2424 gene locus_tag LOCUS_03690 3713 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 3822 4673 gene locus_tag LOCUS_03700 3822 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 5445 4657 gene locus_tag LOCUS_03710 gene lgt 5445 4657 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1A4 protein_id gnl|my_center|LOCUS_03710 5472 6995 gene locus_tag LOCUS_03720 gene thiC 5472 6995 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7G5 protein_id gnl|my_center|LOCUS_03720 7061 7744 gene locus_tag LOCUS_03730 7061 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 7780 8439 gene locus_tag LOCUS_03740 7780 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 8449 8946 gene locus_tag LOCUS_03750 8449 8946 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A674 protein_id gnl|my_center|LOCUS_03750 8966 9379 gene locus_tag LOCUS_03760 8966 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 9376 10218 gene locus_tag LOCUS_03770 9376 10218 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259544.1 protein_id gnl|my_center|LOCUS_03770 10277 11818 gene locus_tag LOCUS_03780 10277 11818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 12589 11747 gene locus_tag LOCUS_03790 12589 11747 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_03790 12863 12609 gene locus_tag LOCUS_03800 12863 12609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 12998 14245 gene locus_tag LOCUS_03810 12998 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 14242 14457 gene locus_tag LOCUS_03820 14242 14457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 15754 14915 gene locus_tag LOCUS_03830 15754 14915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 17124 15751 gene locus_tag LOCUS_03840 17124 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 22346 17181 gene locus_tag LOCUS_03850 22346 17181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 23824 22343 gene locus_tag LOCUS_03860 23824 22343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 29159 23811 gene locus_tag LOCUS_03870 29159 23811 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_03870 30370 29156 gene locus_tag LOCUS_03880 30370 29156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 31611 30370 gene locus_tag LOCUS_03890 31611 30370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 32042 31608 gene locus_tag LOCUS_03900 32042 31608 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_03900 32834 32052 gene locus_tag LOCUS_03910 32834 32052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 33727 32825 gene locus_tag LOCUS_03920 33727 32825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 33930 33730 gene locus_tag LOCUS_03930 33930 33730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 34608 33940 gene locus_tag LOCUS_03940 34608 33940 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230619.1 protein_id gnl|my_center|LOCUS_03940 36041 34599 gene locus_tag LOCUS_03950 36041 34599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 36160 37107 gene locus_tag LOCUS_03960 36160 37107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 38166 37120 gene locus_tag LOCUS_03970 38166 37120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 38934 38251 gene locus_tag LOCUS_03980 38934 38251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 39750 38944 gene locus_tag LOCUS_03990 39750 38944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 40904 39747 gene locus_tag LOCUS_04000 40904 39747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 43387 40907 gene locus_tag LOCUS_04010 43387 40907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 44098 43400 gene locus_tag LOCUS_04020 44098 43400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 44179 44985 gene locus_tag LOCUS_04030 44179 44985 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259051.1 protein_id gnl|my_center|LOCUS_04030 44995 47010 gene locus_tag LOCUS_04040 44995 47010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 47014 47427 gene locus_tag LOCUS_04050 47014 47427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 47437 48645 gene locus_tag LOCUS_04060 47437 48645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 48754 49224 gene locus_tag LOCUS_04070 48754 49224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 50299 49241 gene locus_tag LOCUS_04080 gene morB 50299 49241 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114006.1 protein_id gnl|my_center|LOCUS_04080 50363 51388 gene locus_tag LOCUS_04090 50363 51388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 52590 51358 gene locus_tag LOCUS_04100 52590 51358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 53130 52603 gene locus_tag LOCUS_04110 53130 52603 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_04110 54460 53120 gene locus_tag LOCUS_04120 54460 53120 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_04120 55875 54457 gene locus_tag LOCUS_04130 55875 54457 CDS product peptidase U62 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_04130 57589 55964 gene locus_tag LOCUS_04140 57589 55964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 59310 57586 gene locus_tag LOCUS_04150 59310 57586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 61034 59307 gene locus_tag LOCUS_04160 61034 59307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 62033 61035 gene locus_tag LOCUS_04170 62033 61035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_04170 62058 62573 gene locus_tag LOCUS_04180 62058 62573 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942942.1 protein_id gnl|my_center|LOCUS_04180 62574 63242 gene locus_tag LOCUS_04190 62574 63242 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_04190 64218 63226 gene locus_tag LOCUS_04200 64218 63226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 64241 65416 gene locus_tag LOCUS_04210 64241 65416 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_04210 66618 65413 gene locus_tag LOCUS_04220 66618 65413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 70072 66629 gene locus_tag LOCUS_04230 70072 66629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 70119 71327 gene locus_tag LOCUS_04240 70119 71327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 71377 71670 gene locus_tag LOCUS_04250 71377 71670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 73873 71672 gene locus_tag LOCUS_04260 73873 71672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 75678 73879 gene locus_tag LOCUS_04270 75678 73879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 76990 75758 gene locus_tag LOCUS_04280 76990 75758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 77979 76987 gene locus_tag LOCUS_04290 77979 76987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 78653 77976 gene locus_tag LOCUS_04300 78653 77976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 79953 78751 gene locus_tag LOCUS_04310 79953 78751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 81119 80070 gene locus_tag LOCUS_04320 81119 80070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 82466 81168 gene locus_tag LOCUS_04330 82466 81168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 82527 84788 gene locus_tag LOCUS_04340 gene acnA 82527 84788 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence006 <1 1556 gene locus_tag LOCUS_04350 <1 1556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030438.1:DEAD/DEAH box helicase note possible pseudo, internal stop codon 2518 3627 gene locus_tag LOCUS_04360 2518 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 3673 4710 gene locus_tag LOCUS_04370 gene corA 3673 4710 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4E1 protein_id gnl|my_center|LOCUS_04370 4707 7142 gene locus_tag LOCUS_04380 4707 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 8018 7161 gene locus_tag LOCUS_04390 8018 7161 CDS product potassium transporter KefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262214.1 protein_id gnl|my_center|LOCUS_04390 11509 8018 gene locus_tag LOCUS_04400 11509 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 11559 12107 gene locus_tag LOCUS_04410 gene ppa 11559 12107 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S122 protein_id gnl|my_center|LOCUS_04410 12107 12949 gene locus_tag LOCUS_04420 gene mscS-2 12107 12949 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942953.1 protein_id gnl|my_center|LOCUS_04420 12964 13995 gene locus_tag LOCUS_04430 12964 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 14009 14239 gene locus_tag LOCUS_04440 14009 14239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 14249 16756 gene locus_tag LOCUS_04450 14249 16756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 17615 16746 gene locus_tag LOCUS_04460 17615 16746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 17633 18817 gene locus_tag LOCUS_04470 17633 18817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 18818 19657 gene locus_tag LOCUS_04480 18818 19657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 19658 21181 gene locus_tag LOCUS_04490 19658 21181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 21608 21183 gene locus_tag LOCUS_04500 21608 21183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 21721 22491 gene locus_tag LOCUS_04510 21721 22491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 24442 22502 gene locus_tag LOCUS_04520 24442 22502 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888825.1 protein_id gnl|my_center|LOCUS_04520 25276 24515 gene locus_tag LOCUS_04530 gene xthA1 25276 24515 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946386.1 protein_id gnl|my_center|LOCUS_04530 27192 25273 gene locus_tag LOCUS_04540 27192 25273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 27238 29391 gene locus_tag LOCUS_04550 27238 29391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 30223 29399 gene locus_tag LOCUS_04560 30223 29399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 30258 30812 gene locus_tag LOCUS_04570 30258 30812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 30812 31843 gene locus_tag LOCUS_04580 30812 31843 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533426.1 protein_id gnl|my_center|LOCUS_04580 33256 31859 gene locus_tag LOCUS_04590 33256 31859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 34064 33258 gene locus_tag LOCUS_04600 34064 33258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 35380 34061 gene locus_tag LOCUS_04610 35380 34061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 35425 38250 gene locus_tag LOCUS_04620 35425 38250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 40429 38345 gene locus_tag LOCUS_04630 40429 38345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 40495 41802 gene locus_tag LOCUS_04640 40495 41802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227755.1 protein_id gnl|my_center|LOCUS_04640 41799 43190 gene locus_tag LOCUS_04650 41799 43190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 43187 44263 gene locus_tag LOCUS_04660 43187 44263 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_04660 44266 46518 gene locus_tag LOCUS_04670 44266 46518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227758.1 protein_id gnl|my_center|LOCUS_04670 46511 47668 gene locus_tag LOCUS_04680 46511 47668 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227759.1 protein_id gnl|my_center|LOCUS_04680 47668 49314 gene locus_tag LOCUS_04690 47668 49314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 51428 49419 gene locus_tag LOCUS_04700 51428 49419 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_04700 51509 52366 gene locus_tag LOCUS_04710 51509 52366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 52366 53256 gene locus_tag LOCUS_04720 52366 53256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 53268 53699 gene locus_tag LOCUS_04730 53268 53699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 54064 53774 gene locus_tag LOCUS_04740 54064 53774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04740 54349 54101 gene locus_tag LOCUS_04750 54349 54101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 56132 54354 gene locus_tag LOCUS_04760 56132 54354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 56217 56576 gene locus_tag LOCUS_04770 56217 56576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 57417 56584 gene locus_tag LOCUS_04780 57417 56584 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_04780 57803 57414 gene locus_tag LOCUS_04790 57803 57414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 57822 58103 gene locus_tag LOCUS_04800 57822 58103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 60038 58125 gene locus_tag LOCUS_04810 60038 58125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 60037 60363 gene locus_tag LOCUS_04820 60037 60363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 61756 60509 gene locus_tag LOCUS_04830 61756 60509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 62283 61759 gene locus_tag LOCUS_04840 62283 61759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 62334 63323 gene locus_tag LOCUS_04850 62334 63323 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_04850 63333 64013 gene locus_tag LOCUS_04860 63333 64013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225434.1 protein_id gnl|my_center|LOCUS_04860 64013 66094 gene locus_tag LOCUS_04870 64013 66094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038019.1 protein_id gnl|my_center|LOCUS_04870 66088 67515 gene locus_tag LOCUS_04880 66088 67515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 67530 67784 gene locus_tag LOCUS_04890 67530 67784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 68368 67787 gene locus_tag LOCUS_04900 68368 67787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 68461 69015 gene locus_tag LOCUS_04910 68461 69015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 69019 70185 gene locus_tag LOCUS_04920 69019 70185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 70196 71965 gene locus_tag LOCUS_04930 70196 71965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 71965 72681 gene locus_tag LOCUS_04940 71965 72681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 73036 72635 gene locus_tag LOCUS_04950 73036 72635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 73389 73033 gene locus_tag LOCUS_04960 73389 73033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 74092 73382 gene locus_tag LOCUS_04970 74092 73382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 74810 74112 gene locus_tag LOCUS_04980 74810 74112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 74809 75180 gene locus_tag LOCUS_04990 74809 75180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 75191 76258 gene locus_tag LOCUS_05000 75191 76258 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_05000 77180 76245 gene locus_tag LOCUS_05010 77180 76245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 77343 77666 gene locus_tag LOCUS_05020 77343 77666 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687228.1 protein_id gnl|my_center|LOCUS_05020 77720 78607 gene locus_tag LOCUS_05030 77720 78607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 79426 78584 gene locus_tag LOCUS_05040 79426 78584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 80658 79426 gene locus_tag LOCUS_05050 80658 79426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 80747 81946 gene locus_tag LOCUS_05060 80747 81946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence007 2501 828 gene locus_tag LOCUS_05070 2501 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2730 2473 gene locus_tag LOCUS_05080 2730 2473 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q812M8 protein_id gnl|my_center|LOCUS_05080 2906 2727 gene locus_tag LOCUS_05090 2906 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 3229 3074 gene locus_tag LOCUS_05100 gene rpmH 3229 3074 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KR00 protein_id gnl|my_center|LOCUS_05100 3416 4732 gene locus_tag LOCUS_05110 gene dnaA 3416 4732 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG6 protein_id gnl|my_center|LOCUS_05110 5027 6145 gene locus_tag LOCUS_05120 gene dnaN 5027 6145 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H91 protein_id gnl|my_center|LOCUS_05120 6159 7232 gene locus_tag LOCUS_05130 gene recF 6159 7232 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H90 protein_id gnl|my_center|LOCUS_05130 7306 9690 gene locus_tag LOCUS_05140 gene gyrB 7306 9690 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MME2 protein_id gnl|my_center|LOCUS_05140 9701 10693 gene locus_tag LOCUS_05150 gene fabH2 9701 10693 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_05150 10690 11631 gene locus_tag LOCUS_05160 10690 11631 CDS product putative anion transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701164.1 protein_id gnl|my_center|LOCUS_05160 11628 12749 gene locus_tag LOCUS_05170 11628 12749 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_05170 12769 13341 gene locus_tag LOCUS_05180 12769 13341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 13390 13896 gene locus_tag LOCUS_05190 13390 13896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 13906 14382 gene locus_tag LOCUS_05200 13906 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 14470 15681 gene locus_tag LOCUS_05210 14470 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 15691 16137 gene locus_tag LOCUS_05220 15691 16137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 18035 16140 gene locus_tag LOCUS_05230 gene htpG 18035 16140 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61185 protein_id gnl|my_center|LOCUS_05230 18114 18482 gene locus_tag LOCUS_05240 18114 18482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 18466 19071 gene locus_tag LOCUS_05250 18466 19071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 19726 19052 gene locus_tag LOCUS_05260 19726 19052 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250526.1 protein_id gnl|my_center|LOCUS_05260 21903 19723 gene locus_tag LOCUS_05270 21903 19723 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404983.1 protein_id gnl|my_center|LOCUS_05270 21919 23823 gene locus_tag LOCUS_05280 21919 23823 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61404 protein_id gnl|my_center|LOCUS_05280 23931 24470 gene locus_tag LOCUS_05290 23931 24470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 24467 25024 gene locus_tag LOCUS_05300 24467 25024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 25024 25578 gene locus_tag LOCUS_05310 25024 25578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 25584 26153 gene locus_tag LOCUS_05320 25584 26153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 26232 28760 gene locus_tag LOCUS_05330 gene gyrA 26232 28760 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C90 protein_id gnl|my_center|LOCUS_05330 28773 29555 gene locus_tag LOCUS_05340 28773 29555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 29555 30085 gene locus_tag LOCUS_05350 29555 30085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 30121 31710 gene locus_tag LOCUS_05360 30121 31710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 31720 33117 gene locus_tag LOCUS_05370 31720 33117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 33174 34439 gene locus_tag LOCUS_05380 33174 34439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 34533 34853 gene locus_tag LOCUS_05390 34533 34853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 34872 36116 gene locus_tag LOCUS_05400 gene hemL 34872 36116 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHB0 protein_id gnl|my_center|LOCUS_05400 36214 36546 gene locus_tag LOCUS_05410 36214 36546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 36548 37330 gene locus_tag LOCUS_05420 gene atpB 36548 37330 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GB2 protein_id gnl|my_center|LOCUS_05420 37426 37743 gene locus_tag LOCUS_05430 37426 37743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 37839 38660 gene locus_tag LOCUS_05440 37839 38660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 38670 39635 gene locus_tag LOCUS_05450 38670 39635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 39635 40354 gene locus_tag LOCUS_05460 39635 40354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 40381 41040 gene locus_tag LOCUS_05470 40381 41040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 41037 42272 gene locus_tag LOCUS_05480 41037 42272 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227240.1 protein_id gnl|my_center|LOCUS_05480 42269 43210 gene locus_tag LOCUS_05490 42269 43210 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_05490 43223 44134 gene locus_tag LOCUS_05500 gene fcl 43223 44134 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF18 protein_id gnl|my_center|LOCUS_05500 44116 45345 gene locus_tag LOCUS_05510 44116 45345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 46690 45329 gene locus_tag LOCUS_05520 46690 45329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 46734 47402 gene locus_tag LOCUS_05530 46734 47402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 47462 48379 gene locus_tag LOCUS_05540 47462 48379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 48405 48866 gene locus_tag LOCUS_05550 48405 48866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 50537 48891 gene locus_tag LOCUS_05560 50537 48891 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_05560 52222 50534 gene locus_tag LOCUS_05570 52222 50534 CDS product lipid A ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_05570 53965 52223 gene locus_tag LOCUS_05580 gene pepF2 53965 52223 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101855.1 protein_id gnl|my_center|LOCUS_05580 54023 55567 gene locus_tag LOCUS_05590 54023 55567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 58867 55574 gene locus_tag LOCUS_05600 58867 55574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 59878 58898 gene locus_tag LOCUS_05610 59878 58898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 60492 59878 gene locus_tag LOCUS_05620 60492 59878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 60859 60509 gene locus_tag LOCUS_05630 60859 60509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 protein_id gnl|my_center|LOCUS_05630 61590 60874 gene locus_tag LOCUS_05640 61590 60874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 61620 62993 gene locus_tag LOCUS_05650 gene glmU 61620 62993 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMC5 protein_id gnl|my_center|LOCUS_05650 62993 65239 gene locus_tag LOCUS_05660 gene pcrA 62993 65239 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q837V7 protein_id gnl|my_center|LOCUS_05660 65323 66729 gene locus_tag LOCUS_05670 65323 66729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 66836 68635 gene locus_tag LOCUS_05680 66836 68635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 68653 68970 gene locus_tag LOCUS_05690 68653 68970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 68967 69248 gene locus_tag LOCUS_05700 68967 69248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 69245 70531 gene locus_tag LOCUS_05710 gene gatA 69245 70531 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCX3 protein_id gnl|my_center|LOCUS_05710 72348 70525 gene locus_tag LOCUS_05720 gene gspE 72348 70525 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039157.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence008 1101 2288 gene locus_tag LOCUS_05730 1101 2288 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL80 protein_id gnl|my_center|LOCUS_05730 2288 3091 gene locus_tag LOCUS_05740 2288 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 3126 3614 gene locus_tag LOCUS_05750 gene acpP 3126 3614 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYL3 protein_id gnl|my_center|LOCUS_05750 3659 4561 gene locus_tag LOCUS_05760 3659 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 5111 4509 gene locus_tag LOCUS_05770 5111 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 5174 5785 gene locus_tag LOCUS_05780 5174 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 5782 6147 gene locus_tag LOCUS_05790 5782 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 6144 6815 gene locus_tag LOCUS_05800 6144 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 6816 8585 gene locus_tag LOCUS_05810 6816 8585 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404891.1 protein_id gnl|my_center|LOCUS_05810 8575 10293 gene locus_tag LOCUS_05820 8575 10293 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_05820 10290 10985 gene locus_tag LOCUS_05830 10290 10985 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_05830 10998 11975 gene locus_tag LOCUS_05840 10998 11975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 13279 11978 gene locus_tag LOCUS_05850 13279 11978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 13309 16797 gene locus_tag LOCUS_05860 13309 16797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 16816 18162 gene locus_tag LOCUS_05870 gene xdhA 16816 18162 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339408.1 protein_id gnl|my_center|LOCUS_05870 18159 20339 gene locus_tag LOCUS_05880 gene xdhB 18159 20339 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_05880 21419 20325 gene locus_tag LOCUS_05890 21419 20325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 21439 23412 gene locus_tag LOCUS_05900 21439 23412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 24990 23428 gene locus_tag LOCUS_05910 24990 23428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05979 protein_id gnl|my_center|LOCUS_05910 26837 24987 gene locus_tag LOCUS_05920 26837 24987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_05920 28169 26838 gene locus_tag LOCUS_05930 gene miaB 28169 26838 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B44 protein_id gnl|my_center|LOCUS_05930 28223 29113 gene locus_tag LOCUS_05940 28223 29113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 29255 30073 gene locus_tag LOCUS_05950 29255 30073 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_05950 30074 31516 gene locus_tag LOCUS_05960 30074 31516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 31599 31763 gene locus_tag LOCUS_05970 31599 31763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 31802 33820 gene locus_tag LOCUS_05980 31802 33820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_05980 33822 34640 gene locus_tag LOCUS_05990 33822 34640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 34637 35119 gene locus_tag LOCUS_06000 34637 35119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 35543 35121 gene locus_tag LOCUS_06010 35543 35121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 36669 35596 gene locus_tag LOCUS_06020 36669 35596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 37760 36669 gene locus_tag LOCUS_06030 37760 36669 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_06030 37759 39900 gene locus_tag LOCUS_06040 37759 39900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 39903 41399 gene locus_tag LOCUS_06050 39903 41399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 41428 42717 gene locus_tag LOCUS_06060 41428 42717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 42822 43133 gene locus_tag LOCUS_06070 42822 43133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 45116 43137 gene locus_tag LOCUS_06080 45116 43137 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268725.1 protein_id gnl|my_center|LOCUS_06080 45737 45120 gene locus_tag LOCUS_06090 45737 45120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 45885 46139 gene locus_tag LOCUS_06100 45885 46139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 46140 47165 gene locus_tag LOCUS_06110 gene ispB 46140 47165 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094763.1 protein_id gnl|my_center|LOCUS_06110 47884 47171 gene locus_tag LOCUS_06120 47884 47171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 48928 47906 gene locus_tag LOCUS_06130 48928 47906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 50352 49021 gene locus_tag LOCUS_06140 50352 49021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 50423 51391 gene locus_tag LOCUS_06150 gene trpS 50423 51391 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQA4 protein_id gnl|my_center|LOCUS_06150 51565 52638 gene locus_tag LOCUS_06160 51565 52638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 52691 53359 gene locus_tag LOCUS_06170 52691 53359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 54296 53259 gene locus_tag LOCUS_06180 54296 53259 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_06180 55282 54293 gene locus_tag LOCUS_06190 55282 54293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 56189 55275 gene locus_tag LOCUS_06200 56189 55275 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_06200 57409 56186 gene locus_tag LOCUS_06210 57409 56186 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259200.1 protein_id gnl|my_center|LOCUS_06210 57418 58647 gene locus_tag LOCUS_06220 57418 58647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 60077 58644 gene locus_tag LOCUS_06230 gene mpl 60077 58644 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_06230 60664 60041 gene locus_tag LOCUS_06240 60664 60041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941153.1 protein_id gnl|my_center|LOCUS_06240 61341 60661 gene locus_tag LOCUS_06250 61341 60661 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_06250 61446 63686 gene locus_tag LOCUS_06260 61446 63686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 <64357 63699 gene locus_tag LOCUS_06270 <64357 63699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P37565:33 kDa chaperonin >Feature sequence009 1920 193 gene locus_tag LOCUS_06280 1920 193 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942135.1 protein_id gnl|my_center|LOCUS_06280 2090 1917 gene locus_tag LOCUS_06290 2090 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 4089 2107 gene locus_tag LOCUS_06300 4089 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 4490 4086 gene locus_tag LOCUS_06310 4490 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 4783 4496 gene locus_tag LOCUS_06320 4783 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 6531 4780 gene locus_tag LOCUS_06330 6531 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 6565 7467 gene locus_tag LOCUS_06340 6565 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 7464 8339 gene locus_tag LOCUS_06350 7464 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 9643 8315 gene locus_tag LOCUS_06360 9643 8315 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063882.1 protein_id gnl|my_center|LOCUS_06360 9888 9706 gene locus_tag LOCUS_06370 9888 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 10020 10628 gene locus_tag LOCUS_06380 10020 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 12560 10638 gene locus_tag LOCUS_06390 12560 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 13678 12557 gene locus_tag LOCUS_06400 gene yehP 13678 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292789.1 protein_id gnl|my_center|LOCUS_06400 15984 13678 gene locus_tag LOCUS_06410 gene yehM 15984 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33349 protein_id gnl|my_center|LOCUS_06410 17075 15984 gene locus_tag LOCUS_06420 17075 15984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074859.1 protein_id gnl|my_center|LOCUS_06420 17172 20981 gene locus_tag LOCUS_06430 17172 20981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 20991 21560 gene locus_tag LOCUS_06440 20991 21560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 23006 21576 gene locus_tag LOCUS_06450 gene cls-1 23006 21576 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941150.1 protein_id gnl|my_center|LOCUS_06450 24901 23003 gene locus_tag LOCUS_06460 24901 23003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 24934 26394 gene locus_tag LOCUS_06470 24934 26394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 26343 27149 gene locus_tag LOCUS_06480 26343 27149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 27143 27616 gene locus_tag LOCUS_06490 27143 27616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 27613 28299 gene locus_tag LOCUS_06500 27613 28299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 28296 30374 gene locus_tag LOCUS_06510 28296 30374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021631.1 protein_id gnl|my_center|LOCUS_06510 30436 30984 gene locus_tag LOCUS_06520 30436 30984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 31008 32309 gene locus_tag LOCUS_06530 31008 32309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 32341 33231 gene locus_tag LOCUS_06540 32341 33231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 35250 33238 gene locus_tag LOCUS_06550 gene nadE 35250 33238 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_06550 36571 35303 gene locus_tag LOCUS_06560 gene norM 36571 35303 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZS2 protein_id gnl|my_center|LOCUS_06560 37548 36871 gene locus_tag LOCUS_06570 37548 36871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 38148 37555 gene locus_tag LOCUS_06580 38148 37555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 38147 38422 gene locus_tag LOCUS_06590 38147 38422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 38477 38749 gene locus_tag LOCUS_06600 38477 38749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 38734 39483 gene locus_tag LOCUS_06610 38734 39483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 39517 42081 gene locus_tag LOCUS_06620 39517 42081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 43962 42088 gene locus_tag LOCUS_06630 43962 42088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 44879 44100 gene locus_tag LOCUS_06640 44879 44100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 45643 44879 gene locus_tag LOCUS_06650 45643 44879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 48174 45808 gene locus_tag LOCUS_06660 48174 45808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 49376 48297 gene locus_tag LOCUS_06670 49376 48297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 50148 49396 gene locus_tag LOCUS_06680 gene pstB 50148 49396 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7S9 protein_id gnl|my_center|LOCUS_06680 50933 50058 gene locus_tag LOCUS_06690 gene phoT 50933 50058 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4V3 protein_id gnl|my_center|LOCUS_06690 51805 50927 gene locus_tag LOCUS_06700 gene pstA 51805 50927 CDS product phosphate ABC transporter, permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020933.1 protein_id gnl|my_center|LOCUS_06700 52716 51805 gene locus_tag LOCUS_06710 gene pstC 52716 51805 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_06710 53763 52717 gene locus_tag LOCUS_06720 53763 52717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 54646 53765 gene locus_tag LOCUS_06730 54646 53765 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269390.1 protein_id gnl|my_center|LOCUS_06730 56302 54692 gene locus_tag LOCUS_06740 gene phoR 56302 54692 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_06740 56970 56299 gene locus_tag LOCUS_06750 gene phoB 56970 56299 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_06750 57635 56967 gene locus_tag LOCUS_06760 57635 56967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_06760 58108 57665 gene locus_tag LOCUS_06770 58108 57665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880563.1 protein_id gnl|my_center|LOCUS_06770 58161 59216 gene locus_tag LOCUS_06780 58161 59216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 59213 60496 gene locus_tag LOCUS_06790 59213 60496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 60576 61157 gene locus_tag LOCUS_06800 60576 61157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 61154 61399 gene locus_tag LOCUS_06810 61154 61399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 62238 61396 gene locus_tag LOCUS_06820 62238 61396 CDS product C-5 sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224651.1 protein_id gnl|my_center|LOCUS_06820 62726 62235 gene locus_tag LOCUS_06830 62726 62235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 62815 63192 gene locus_tag LOCUS_06840 62815 63192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence010 852 1259 gene locus_tag LOCUS_06850 852 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 1651 1193 gene locus_tag LOCUS_06860 1651 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 3171 1768 gene locus_tag LOCUS_06870 3171 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 3257 3985 gene locus_tag LOCUS_06880 3257 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3985 4515 gene locus_tag LOCUS_06890 3985 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 6033 4528 gene locus_tag LOCUS_06900 6033 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 6930 6037 gene locus_tag LOCUS_06910 6930 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 6943 8397 gene locus_tag LOCUS_06920 6943 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 8394 10316 gene locus_tag LOCUS_06930 8394 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 10321 10815 gene locus_tag LOCUS_06940 10321 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 10815 11300 gene locus_tag LOCUS_06950 10815 11300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 12990 11287 gene locus_tag LOCUS_06960 12990 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 14052 13006 gene locus_tag LOCUS_06970 14052 13006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 14076 14612 gene locus_tag LOCUS_06980 14076 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 14642 15415 gene locus_tag LOCUS_06990 14642 15415 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530891.1 protein_id gnl|my_center|LOCUS_06990 15484 16332 gene locus_tag LOCUS_07000 15484 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 16341 16754 gene locus_tag LOCUS_07010 16341 16754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 16762 17247 gene locus_tag LOCUS_07020 16762 17247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 17391 18116 gene locus_tag LOCUS_07030 17391 18116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 18113 18574 gene locus_tag LOCUS_07040 18113 18574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 19324 18581 gene locus_tag LOCUS_07050 19324 18581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 20579 19311 gene locus_tag LOCUS_07060 20579 19311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 21442 20573 gene locus_tag LOCUS_07070 21442 20573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 21656 21435 gene locus_tag LOCUS_07080 21656 21435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 21681 22103 gene locus_tag LOCUS_07090 21681 22103 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_07090 22100 22600 gene locus_tag LOCUS_07100 22100 22600 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531271.1 protein_id gnl|my_center|LOCUS_07100 22623 23579 gene locus_tag LOCUS_07110 22623 23579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 23997 23587 gene locus_tag LOCUS_07120 23997 23587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140146.1 protein_id gnl|my_center|LOCUS_07120 24832 24044 gene locus_tag LOCUS_07130 24832 24044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 24923 25543 gene locus_tag LOCUS_07140 24923 25543 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_07140 25592 27805 gene locus_tag LOCUS_07150 25592 27805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 28466 27810 gene locus_tag LOCUS_07160 28466 27810 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705644.1 protein_id gnl|my_center|LOCUS_07160 28506 28790 gene locus_tag LOCUS_07170 28506 28790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 29282 28773 gene locus_tag LOCUS_07180 29282 28773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07180 29953 29279 gene locus_tag LOCUS_07190 29953 29279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 30011 31525 gene locus_tag LOCUS_07200 30011 31525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 31522 34224 gene locus_tag LOCUS_07210 31522 34224 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:32578..32580,aa:Sec) note codon on position 353 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_07210 34626 34300 gene locus_tag LOCUS_07220 34626 34300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 34774 37689 gene locus_tag LOCUS_07230 34774 37689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 37712 38245 gene locus_tag LOCUS_07240 37712 38245 CDS product PhnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706207.1 protein_id gnl|my_center|LOCUS_07240 38328 38759 gene locus_tag LOCUS_07250 38328 38759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 38887 40197 gene locus_tag LOCUS_07260 38887 40197 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_07260 40217 41572 gene locus_tag LOCUS_07270 40217 41572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 41569 41934 gene locus_tag LOCUS_07280 41569 41934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 42008 42733 gene locus_tag LOCUS_07290 42008 42733 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_07290 43142 42738 gene locus_tag LOCUS_07300 43142 42738 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088046.1 protein_id gnl|my_center|LOCUS_07300 43470 43135 gene locus_tag LOCUS_07310 43470 43135 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804808.1 protein_id gnl|my_center|LOCUS_07310 43542 44477 gene locus_tag LOCUS_07320 43542 44477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 45385 44480 gene locus_tag LOCUS_07330 45385 44480 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_07330 46158 45385 gene locus_tag LOCUS_07340 46158 45385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 47117 46143 gene locus_tag LOCUS_07350 47117 46143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 47597 47172 gene locus_tag LOCUS_07360 47597 47172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 47896 47594 gene locus_tag LOCUS_07370 47896 47594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 47921 48286 gene locus_tag LOCUS_07380 47921 48286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 48529 49551 gene locus_tag LOCUS_07390 48529 49551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 49548 51161 gene locus_tag LOCUS_07400 49548 51161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 51604 51218 gene locus_tag LOCUS_07410 51604 51218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 53310 51601 gene locus_tag LOCUS_07420 53310 51601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 54575 53298 gene locus_tag LOCUS_07430 54575 53298 CDS product licheninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223397.1 protein_id gnl|my_center|LOCUS_07430 58623 54667 gene locus_tag LOCUS_07440 58623 54667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 58676 59746 gene locus_tag LOCUS_07450 58676 59746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence011 1227 1439 gene locus_tag LOCUS_07460 1227 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 2031 1507 gene locus_tag LOCUS_07470 2031 1507 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124477.1 protein_id gnl|my_center|LOCUS_07470 3031 2024 gene locus_tag LOCUS_07480 3031 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3315 3545 gene locus_tag LOCUS_07490 3315 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4922 3552 gene locus_tag LOCUS_07500 4922 3552 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_07500 5812 4919 gene locus_tag LOCUS_07510 5812 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 6795 5809 gene locus_tag LOCUS_07520 6795 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020451.1 protein_id gnl|my_center|LOCUS_07520 8222 6795 gene locus_tag LOCUS_07530 8222 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 9800 8460 gene locus_tag LOCUS_07540 9800 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 9875 10486 gene locus_tag LOCUS_07550 9875 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 10545 11360 gene locus_tag LOCUS_07560 10545 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 12188 11418 gene locus_tag LOCUS_07570 12188 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 12861 12262 gene locus_tag LOCUS_07580 12861 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404561.1 protein_id gnl|my_center|LOCUS_07580 13123 12893 gene locus_tag LOCUS_07590 13123 12893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 13061 13984 gene locus_tag LOCUS_07600 gene ispB 13061 13984 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261094.1 protein_id gnl|my_center|LOCUS_07600 13984 14673 gene locus_tag LOCUS_07610 gene menG 13984 14673 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4C2 protein_id gnl|my_center|LOCUS_07610 14869 15423 gene locus_tag LOCUS_07620 14869 15423 CDS product phenolic acid decarboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_07620 15420 16550 gene locus_tag LOCUS_07630 gene mqnE 15420 16550 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727U8 protein_id gnl|my_center|LOCUS_07630 16576 17946 gene locus_tag LOCUS_07640 16576 17946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 18227 19255 gene locus_tag LOCUS_07650 18227 19255 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940160.1 protein_id gnl|my_center|LOCUS_07650 19249 20091 gene locus_tag LOCUS_07660 19249 20091 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_07660 23089 20081 gene locus_tag LOCUS_07670 23089 20081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 26460 23131 gene locus_tag LOCUS_07680 26460 23131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 26563 27330 gene locus_tag LOCUS_07690 26563 27330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 27327 27647 gene locus_tag LOCUS_07700 27327 27647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 28764 27631 gene locus_tag LOCUS_07710 28764 27631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 28801 32277 gene locus_tag LOCUS_07720 28801 32277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 32274 34493 gene locus_tag LOCUS_07730 32274 34493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 35402 34503 gene locus_tag LOCUS_07740 35402 34503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 36286 35450 gene locus_tag LOCUS_07750 36286 35450 CDS product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_07750 37317 36325 gene locus_tag LOCUS_07760 37317 36325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 38357 37338 gene locus_tag LOCUS_07770 38357 37338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 39602 38448 gene locus_tag LOCUS_07780 39602 38448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 41458 39599 gene locus_tag LOCUS_07790 41458 39599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 42180 41455 gene locus_tag LOCUS_07800 42180 41455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 43106 42177 gene locus_tag LOCUS_07810 43106 42177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_07810 43179 43631 gene locus_tag LOCUS_07820 43179 43631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 45423 43648 gene locus_tag LOCUS_07830 45423 43648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 46217 45420 gene locus_tag LOCUS_07840 46217 45420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 46991 46227 gene locus_tag LOCUS_07850 46991 46227 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_07850 49522 46988 gene locus_tag LOCUS_07860 49522 46988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 50682 49522 gene locus_tag LOCUS_07870 50682 49522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 50714 52912 gene locus_tag LOCUS_07880 50714 52912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 53796 52876 gene locus_tag LOCUS_07890 53796 52876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 53819 54445 gene locus_tag LOCUS_07900 53819 54445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 54442 54960 gene locus_tag LOCUS_07910 54442 54960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 54960 56636 gene locus_tag LOCUS_07920 54960 56636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 56709 57995 gene locus_tag LOCUS_07930 56709 57995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 58377 58006 gene locus_tag LOCUS_07940 58377 58006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 59177 58374 gene locus_tag LOCUS_07950 59177 58374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 59133 59336 gene locus_tag LOCUS_07960 59133 59336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 59345 59752 gene locus_tag LOCUS_07970 59345 59752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence012 947 2578 gene locus_tag LOCUS_07980 947 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 4105 2582 gene locus_tag LOCUS_07990 4105 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4158 5369 gene locus_tag LOCUS_08000 4158 5369 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_08000 5372 7462 gene locus_tag LOCUS_08010 5372 7462 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_08010 7490 8764 gene locus_tag LOCUS_08020 7490 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 9277 8768 gene locus_tag LOCUS_08030 9277 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 9330 10073 gene locus_tag LOCUS_08040 9330 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 10061 10696 gene locus_tag LOCUS_08050 10061 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 12114 10666 gene locus_tag LOCUS_08060 12114 10666 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_08060 12617 12114 gene locus_tag LOCUS_08070 12617 12114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 12776 13573 gene locus_tag LOCUS_08080 12776 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 13883 13644 gene locus_tag LOCUS_08090 13883 13644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 14244 17189 gene locus_tag LOCUS_08100 14244 17189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 17186 17659 gene locus_tag LOCUS_08110 17186 17659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 17656 19164 gene locus_tag LOCUS_08120 17656 19164 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_08120 19164 20621 gene locus_tag LOCUS_08130 19164 20621 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887940.1 protein_id gnl|my_center|LOCUS_08130 21675 20638 gene locus_tag LOCUS_08140 21675 20638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_08140 21737 22420 gene locus_tag LOCUS_08150 21737 22420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 22436 24055 gene locus_tag LOCUS_08160 22436 24055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 24077 24634 gene locus_tag LOCUS_08170 24077 24634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 25699 24593 gene locus_tag LOCUS_08180 25699 24593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 26904 25687 gene locus_tag LOCUS_08190 26904 25687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 27739 27038 gene locus_tag LOCUS_08200 27739 27038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 27825 29465 gene locus_tag LOCUS_08210 27825 29465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122313.1 protein_id gnl|my_center|LOCUS_08210 29486 30820 gene locus_tag LOCUS_08220 29486 30820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 30863 31450 gene locus_tag LOCUS_08230 30863 31450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 31468 32019 gene locus_tag LOCUS_08240 31468 32019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 33566 32016 gene locus_tag LOCUS_08250 gene paaZ 33566 32016 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223462.1 protein_id gnl|my_center|LOCUS_08250 33625 34716 gene locus_tag LOCUS_08260 33625 34716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 34700 35293 gene locus_tag LOCUS_08270 34700 35293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 35826 35308 gene locus_tag LOCUS_08280 35826 35308 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_08280 35859 36281 gene locus_tag LOCUS_08290 35859 36281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 36406 37944 gene locus_tag LOCUS_08300 36406 37944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 37946 39451 gene locus_tag LOCUS_08310 37946 39451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 39448 40080 gene locus_tag LOCUS_08320 39448 40080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 40080 40670 gene locus_tag LOCUS_08330 40080 40670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 40694 41062 gene locus_tag LOCUS_08340 40694 41062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 41055 41798 gene locus_tag LOCUS_08350 41055 41798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 42441 41800 gene locus_tag LOCUS_08360 42441 41800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 43418 42429 gene locus_tag LOCUS_08370 43418 42429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 44563 43415 gene locus_tag LOCUS_08380 44563 43415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 45450 44560 gene locus_tag LOCUS_08390 45450 44560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 46476 45466 gene locus_tag LOCUS_08400 46476 45466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 46532 48094 gene locus_tag LOCUS_08410 46532 48094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 48124 49794 gene locus_tag LOCUS_08420 48124 49794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 50638 49820 gene locus_tag LOCUS_08430 50638 49820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 51659 50640 gene locus_tag LOCUS_08440 51659 50640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 53365 51641 gene locus_tag LOCUS_08450 53365 51641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 54441 53362 gene locus_tag LOCUS_08460 54441 53362 CDS product mce-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545262.1 protein_id gnl|my_center|LOCUS_08460 55650 54466 gene locus_tag LOCUS_08470 55650 54466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 55679 57238 gene locus_tag LOCUS_08480 gene mviN-1 55679 57238 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938470.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence013 1977 469 gene locus_tag LOCUS_08490 gene lnt 1977 469 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_08490 3146 2049 gene locus_tag LOCUS_08500 3146 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 3918 3169 gene locus_tag LOCUS_08510 3918 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4339 3944 gene locus_tag LOCUS_08520 4339 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 6076 4409 gene locus_tag LOCUS_08530 gene groL 6076 4409 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C7 protein_id gnl|my_center|LOCUS_08530 6367 6080 gene locus_tag LOCUS_08540 gene groS 6367 6080 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AL5 protein_id gnl|my_center|LOCUS_08540 6472 7917 gene locus_tag LOCUS_08550 6472 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 8562 8191 gene locus_tag LOCUS_08560 8562 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 9072 10976 gene locus_tag LOCUS_08570 gene dnaK 9072 10976 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C922 protein_id gnl|my_center|LOCUS_08570 11006 12115 gene locus_tag LOCUS_08580 gene dnaJ 11006 12115 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RX2 protein_id gnl|my_center|LOCUS_08580 12128 13120 gene locus_tag LOCUS_08590 12128 13120 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_08590 13134 14021 gene locus_tag LOCUS_08600 13134 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_08600 14033 14848 gene locus_tag LOCUS_08610 14033 14848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 14841 15830 gene locus_tag LOCUS_08620 14841 15830 CDS product aerotolerance protein BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_08620 15827 17692 gene locus_tag LOCUS_08630 15827 17692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 17706 19283 gene locus_tag LOCUS_08640 17706 19283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 19274 19936 gene locus_tag LOCUS_08650 19274 19936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_08650 19961 20473 gene locus_tag LOCUS_08660 19961 20473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 20490 22079 gene locus_tag LOCUS_08670 20490 22079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 22093 22644 gene locus_tag LOCUS_08680 22093 22644 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081283.1 protein_id gnl|my_center|LOCUS_08680 22601 25276 gene locus_tag LOCUS_08690 22601 25276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 25286 25930 gene locus_tag LOCUS_08700 25286 25930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 25927 26835 gene locus_tag LOCUS_08710 25927 26835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 27514 26837 gene locus_tag LOCUS_08720 gene paaG 27514 26837 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_08720 28132 27524 gene locus_tag LOCUS_08730 28132 27524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 28159 28860 gene locus_tag LOCUS_08740 28159 28860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 30237 28882 gene locus_tag LOCUS_08750 30237 28882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 31384 30230 gene locus_tag LOCUS_08760 31384 30230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 31467 33587 gene locus_tag LOCUS_08770 31467 33587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 33954 33574 gene locus_tag LOCUS_08780 33954 33574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 33953 34678 gene locus_tag LOCUS_08790 33953 34678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 36065 34680 gene locus_tag LOCUS_08800 36065 34680 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_08800 36166 36780 gene locus_tag LOCUS_08810 36166 36780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 38310 36793 gene locus_tag LOCUS_08820 38310 36793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 38858 38307 gene locus_tag LOCUS_08830 38858 38307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 38903 40147 gene locus_tag LOCUS_08840 38903 40147 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_08840 40237 41490 gene locus_tag LOCUS_08850 40237 41490 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_08850 41514 42539 gene locus_tag LOCUS_08860 41514 42539 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XV0 protein_id gnl|my_center|LOCUS_08860 42539 43486 gene locus_tag LOCUS_08870 42539 43486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 43486 44346 gene locus_tag LOCUS_08880 gene pdxA 43486 44346 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2C0 protein_id gnl|my_center|LOCUS_08880 44816 44337 gene locus_tag LOCUS_08890 44816 44337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 45536 44907 gene locus_tag LOCUS_08900 45536 44907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 46227 45625 gene locus_tag LOCUS_08910 46227 45625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 46765 46292 gene locus_tag LOCUS_08920 46765 46292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 47151 46759 gene locus_tag LOCUS_08930 47151 46759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 48779 47148 gene locus_tag LOCUS_08940 gene hflX 48779 47148 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EF3 protein_id gnl|my_center|LOCUS_08940 49929 48787 gene locus_tag LOCUS_08950 49929 48787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence014 892 2475 gene locus_tag LOCUS_08960 892 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 2472 3473 gene locus_tag LOCUS_08970 2472 3473 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_08970 3470 4279 gene locus_tag LOCUS_08980 3470 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_08980 4276 5778 gene locus_tag LOCUS_08990 4276 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 5768 8110 gene locus_tag LOCUS_09000 5768 8110 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121420.1 protein_id gnl|my_center|LOCUS_09000 9297 8626 gene locus_tag LOCUS_09010 9297 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 10154 9294 gene locus_tag LOCUS_09020 10154 9294 CDS product UPF0160 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z862 protein_id gnl|my_center|LOCUS_09020 10196 10657 gene locus_tag LOCUS_09030 10196 10657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 10654 13098 gene locus_tag LOCUS_09040 10654 13098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 13095 14054 gene locus_tag LOCUS_09050 13095 14054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 14054 15628 gene locus_tag LOCUS_09060 14054 15628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 16374 15631 gene locus_tag LOCUS_09070 16374 15631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 16399 17373 gene locus_tag LOCUS_09080 16399 17373 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_09080 17436 18080 gene locus_tag LOCUS_09090 17436 18080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 19058 18084 gene locus_tag LOCUS_09100 19058 18084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 19086 20555 gene locus_tag LOCUS_09110 19086 20555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 20542 20685 gene locus_tag LOCUS_09120 20542 20685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 20685 21161 gene locus_tag LOCUS_09130 20685 21161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 21285 21584 gene locus_tag LOCUS_09140 21285 21584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 21889 21581 gene locus_tag LOCUS_09150 21889 21581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 21954 23318 gene locus_tag LOCUS_09160 21954 23318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09160 23318 24718 gene locus_tag LOCUS_09170 23318 24718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 24718 25641 gene locus_tag LOCUS_09180 gene ilvE 24718 25641 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940455.1 protein_id gnl|my_center|LOCUS_09180 26490 25648 gene locus_tag LOCUS_09190 26490 25648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 26531 28219 gene locus_tag LOCUS_09200 26531 28219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 28222 29073 gene locus_tag LOCUS_09210 28222 29073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 29962 29027 gene locus_tag LOCUS_09220 29962 29027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 31552 29963 gene locus_tag LOCUS_09230 31552 29963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 31628 32524 gene locus_tag LOCUS_09240 31628 32524 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903644.1 protein_id gnl|my_center|LOCUS_09240 32521 33375 gene locus_tag LOCUS_09250 32521 33375 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803702.1 protein_id gnl|my_center|LOCUS_09250 33384 34691 gene locus_tag LOCUS_09260 gene bkdB 33384 34691 CDS product lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1M0 protein_id gnl|my_center|LOCUS_09260 34691 35377 gene locus_tag LOCUS_09270 34691 35377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 35401 36801 gene locus_tag LOCUS_09280 gene pdhD 35401 36801 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEJ5 protein_id gnl|my_center|LOCUS_09280 37323 36808 gene locus_tag LOCUS_09290 37323 36808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 39488 37347 gene locus_tag LOCUS_09300 39488 37347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 39558 41687 gene locus_tag LOCUS_09310 39558 41687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 45677 41703 gene locus_tag LOCUS_09320 45677 41703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence015 2985 1126 gene locus_tag LOCUS_09330 2985 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 4431 3076 gene locus_tag LOCUS_09340 4431 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 5963 4431 gene locus_tag LOCUS_09350 5963 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 6676 5960 gene locus_tag LOCUS_09360 6676 5960 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057314.1 protein_id gnl|my_center|LOCUS_09360 8925 6706 gene locus_tag LOCUS_09370 8925 6706 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_09370 10654 9014 gene locus_tag LOCUS_09380 10654 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 11832 10654 gene locus_tag LOCUS_09390 11832 10654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 13079 11829 gene locus_tag LOCUS_09400 13079 11829 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_09400 13104 14993 gene locus_tag LOCUS_09410 13104 14993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 15007 16005 gene locus_tag LOCUS_09420 15007 16005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 16527 16009 gene locus_tag LOCUS_09430 16527 16009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 16551 17024 gene locus_tag LOCUS_09440 gene moaC 16551 17024 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC52 protein_id gnl|my_center|LOCUS_09440 17424 17005 gene locus_tag LOCUS_09450 17424 17005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 18005 17424 gene locus_tag LOCUS_09460 18005 17424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 19744 18029 gene locus_tag LOCUS_09470 19744 18029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 20967 19669 gene locus_tag LOCUS_09480 20967 19669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 21368 20973 gene locus_tag LOCUS_09490 21368 20973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 21841 21347 gene locus_tag LOCUS_09500 21841 21347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 23284 21851 gene locus_tag LOCUS_09510 23284 21851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 23283 24314 gene locus_tag LOCUS_09520 23283 24314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 24336 26111 gene locus_tag LOCUS_09530 24336 26111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 26119 26793 gene locus_tag LOCUS_09540 26119 26793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09540 27483 26818 gene locus_tag LOCUS_09550 gene udk 27483 26818 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCC8 protein_id gnl|my_center|LOCUS_09550 28385 27480 gene locus_tag LOCUS_09560 28385 27480 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067406.1 protein_id gnl|my_center|LOCUS_09560 28576 31782 gene locus_tag LOCUS_09570 28576 31782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 32282 31752 gene locus_tag LOCUS_09580 32282 31752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 34119 32269 gene locus_tag LOCUS_09590 gene mnmG 34119 32269 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Q4 protein_id gnl|my_center|LOCUS_09590 34941 34162 gene locus_tag LOCUS_09600 34941 34162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 35002 36483 gene locus_tag LOCUS_09610 35002 36483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 36488 37534 gene locus_tag LOCUS_09620 36488 37534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 37544 39277 gene locus_tag LOCUS_09630 37544 39277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 39274 42609 gene locus_tag LOCUS_09640 39274 42609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 42657 43571 gene locus_tag LOCUS_09650 42657 43571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204911.1 protein_id gnl|my_center|LOCUS_09650 43568 44305 gene locus_tag LOCUS_09660 43568 44305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 44416 45351 gene locus_tag LOCUS_09670 44416 45351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 46309 45383 gene locus_tag LOCUS_09680 46309 45383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 47352 46306 gene locus_tag LOCUS_09690 47352 46306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 47375 48304 gene locus_tag LOCUS_09700 47375 48304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529287.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence016 1146 40 gene locus_tag LOCUS_09710 1146 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1177 1821 gene locus_tag LOCUS_09720 1177 1821 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259011.1 protein_id gnl|my_center|LOCUS_09720 3653 1818 gene locus_tag LOCUS_09730 3653 1818 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_09730 4661 3654 gene locus_tag LOCUS_09740 4661 3654 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388760.1 protein_id gnl|my_center|LOCUS_09740 5310 4633 gene locus_tag LOCUS_09750 5310 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 5447 6058 gene locus_tag LOCUS_09760 5447 6058 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_09760 6089 6373 gene locus_tag LOCUS_09770 gene eutM 6089 6373 CDS product ethanolamine utilization protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ABF4 protein_id gnl|my_center|LOCUS_09770 6377 6676 gene locus_tag LOCUS_09780 6377 6676 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549827.1 protein_id gnl|my_center|LOCUS_09780 6669 8072 gene locus_tag LOCUS_09790 gene eutE 6669 8072 CDS product ethanolamine utilization protein EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77445 protein_id gnl|my_center|LOCUS_09790 8074 8643 gene locus_tag LOCUS_09800 8074 8643 CDS product propanediol utilization: polyhedral bodies pduT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815271.1 protein_id gnl|my_center|LOCUS_09800 8653 8925 gene locus_tag LOCUS_09810 8653 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 8922 9212 gene locus_tag LOCUS_09820 8922 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 10318 9209 gene locus_tag LOCUS_09830 10318 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 11490 10318 gene locus_tag LOCUS_09840 11490 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 11530 12237 gene locus_tag LOCUS_09850 11530 12237 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009901.1 protein_id gnl|my_center|LOCUS_09850 12248 13375 gene locus_tag LOCUS_09860 12248 13375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 13372 15327 gene locus_tag LOCUS_09870 13372 15327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 16154 15324 gene locus_tag LOCUS_09880 16154 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 17032 16154 gene locus_tag LOCUS_09890 17032 16154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 17820 17029 gene locus_tag LOCUS_09900 17820 17029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727461.1 protein_id gnl|my_center|LOCUS_09900 18608 17817 gene locus_tag LOCUS_09910 18608 17817 CDS product taurine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114601.1 protein_id gnl|my_center|LOCUS_09910 20266 18608 gene locus_tag LOCUS_09920 20266 18608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 20973 20266 gene locus_tag LOCUS_09930 20973 20266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 21042 22166 gene locus_tag LOCUS_09940 21042 22166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 22965 22144 gene locus_tag LOCUS_09950 gene carH 22965 22144 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53W62 protein_id gnl|my_center|LOCUS_09950 23786 22962 gene locus_tag LOCUS_09960 23786 22962 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388253.1 protein_id gnl|my_center|LOCUS_09960 25270 23783 gene locus_tag LOCUS_09970 gene crtI 25270 23783 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_09970 26217 25267 gene locus_tag LOCUS_09980 26217 25267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 27236 26214 gene locus_tag LOCUS_09990 27236 26214 CDS product putative carotenoid cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RW68 protein_id gnl|my_center|LOCUS_09990 27395 28387 gene locus_tag LOCUS_10000 gene crtC 27395 28387 CDS product hydroxyneurosporene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F723 protein_id gnl|my_center|LOCUS_10000 28384 28977 gene locus_tag LOCUS_10010 28384 28977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 28986 29720 gene locus_tag LOCUS_10020 28986 29720 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_10020 30243 29728 gene locus_tag LOCUS_10030 30243 29728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 31218 30262 gene locus_tag LOCUS_10040 31218 30262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 32388 31222 gene locus_tag LOCUS_10050 32388 31222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 33681 32446 gene locus_tag LOCUS_10060 33681 32446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 34959 33691 gene locus_tag LOCUS_10070 34959 33691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 35030 35656 gene locus_tag LOCUS_10080 35030 35656 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888028.1 protein_id gnl|my_center|LOCUS_10080 36122 35661 gene locus_tag LOCUS_10090 36122 35661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 36145 36909 gene locus_tag LOCUS_10100 36145 36909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 37942 36950 gene locus_tag LOCUS_10110 37942 36950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 38174 40153 gene locus_tag LOCUS_10120 38174 40153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 40170 40949 gene locus_tag LOCUS_10130 40170 40949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 40949 41458 gene locus_tag LOCUS_10140 40949 41458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 41902 41504 gene locus_tag LOCUS_10150 41902 41504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 41973 42049 gene locus_tag LOCUS_t00020 41973 42049 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42111 43292 gene locus_tag LOCUS_10160 42111 43292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 44909 43296 gene locus_tag LOCUS_10170 44909 43296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 46320 44974 gene locus_tag LOCUS_10180 46320 44974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence017 2559 142 gene locus_tag LOCUS_10190 2559 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 3638 2592 gene locus_tag LOCUS_10200 3638 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 4795 3635 gene locus_tag LOCUS_10210 gene yst1E 4795 3635 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173823.1 protein_id gnl|my_center|LOCUS_10210 6099 4855 gene locus_tag LOCUS_10220 6099 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 6274 8118 gene locus_tag LOCUS_10230 6274 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 8118 9368 gene locus_tag LOCUS_10240 8118 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 10608 9337 gene locus_tag LOCUS_10250 10608 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 10720 12144 gene locus_tag LOCUS_10260 10720 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 13522 12149 gene locus_tag LOCUS_10270 13522 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 15180 13519 gene locus_tag LOCUS_10280 15180 13519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 15206 15868 gene locus_tag LOCUS_10290 15206 15868 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_10290 17083 15881 gene locus_tag LOCUS_10300 17083 15881 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_10300 17112 18476 gene locus_tag LOCUS_10310 17112 18476 CDS product carotenoid cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 protein_id gnl|my_center|LOCUS_10310 18473 19660 gene locus_tag LOCUS_10320 gene atoB 18473 19660 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228719.1 protein_id gnl|my_center|LOCUS_10320 19711 20715 gene locus_tag LOCUS_10330 19711 20715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 20975 20676 gene locus_tag LOCUS_10340 20975 20676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 21919 20972 gene locus_tag LOCUS_10350 21919 20972 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995968.1 protein_id gnl|my_center|LOCUS_10350 21944 22669 gene locus_tag LOCUS_10360 21944 22669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 22761 23906 gene locus_tag LOCUS_10370 22761 23906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 23948 24250 gene locus_tag LOCUS_10380 23948 24250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 25021 24254 gene locus_tag LOCUS_10390 25021 24254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 25051 26394 gene locus_tag LOCUS_10400 25051 26394 CDS product sodium:glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056889.1 protein_id gnl|my_center|LOCUS_10400 26384 27085 gene locus_tag LOCUS_10410 26384 27085 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402807.1 protein_id gnl|my_center|LOCUS_10410 27094 27801 gene locus_tag LOCUS_10420 27094 27801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 27822 29381 gene locus_tag LOCUS_10430 27822 29381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 29375 30418 gene locus_tag LOCUS_10440 29375 30418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 30578 31276 gene locus_tag LOCUS_10450 30578 31276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 31863 31243 gene locus_tag LOCUS_10460 31863 31243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 32094 31864 gene locus_tag LOCUS_10470 32094 31864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 33770 32091 gene locus_tag LOCUS_10480 33770 32091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 33775 34437 gene locus_tag LOCUS_10490 33775 34437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 34530 35171 gene locus_tag LOCUS_10500 34530 35171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 35176 35556 gene locus_tag LOCUS_10510 35176 35556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 35553 35855 gene locus_tag LOCUS_10520 35553 35855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 37438 35852 gene locus_tag LOCUS_10530 37438 35852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 37615 37448 gene locus_tag LOCUS_10540 37615 37448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 37589 38467 gene locus_tag LOCUS_10550 37589 38467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 38534 39046 gene locus_tag LOCUS_10560 38534 39046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 39157 40440 gene locus_tag LOCUS_10570 39157 40440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 40825 40412 gene locus_tag LOCUS_10580 40825 40412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 42090 40876 gene locus_tag LOCUS_10590 42090 40876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 42388 43116 gene locus_tag LOCUS_10600 42388 43116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 43561 43124 gene locus_tag LOCUS_10610 43561 43124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 43667 45355 gene locus_tag LOCUS_10620 43667 45355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 45656 45363 gene locus_tag LOCUS_10630 45656 45363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 45973 45656 gene locus_tag LOCUS_10640 45973 45656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence018 683 240 gene locus_tag LOCUS_10650 683 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1087 680 gene locus_tag LOCUS_10660 1087 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1701 1159 gene locus_tag LOCUS_10670 1701 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1727 2170 gene locus_tag LOCUS_10680 1727 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 3093 2173 gene locus_tag LOCUS_10690 3093 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 3394 3101 gene locus_tag LOCUS_10700 3394 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3299 4153 gene locus_tag LOCUS_10710 3299 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 4387 4157 gene locus_tag LOCUS_10720 4387 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 5363 4398 gene locus_tag LOCUS_10730 gene mtnA 5363 4398 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGQ8 protein_id gnl|my_center|LOCUS_10730 6577 5360 gene locus_tag LOCUS_10740 gene hutI 6577 5360 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUU1 protein_id gnl|my_center|LOCUS_10740 6611 7105 gene locus_tag LOCUS_10750 6611 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 8421 7108 gene locus_tag LOCUS_10760 8421 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 9842 8418 gene locus_tag LOCUS_10770 9842 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900628.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10770 12274 9839 gene locus_tag LOCUS_10780 12274 9839 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459887.1 protein_id gnl|my_center|LOCUS_10780 12310 13251 gene locus_tag LOCUS_10790 12310 13251 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_10790 13695 13303 gene locus_tag LOCUS_10800 13695 13303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 16075 13754 gene locus_tag LOCUS_10810 16075 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 16155 18278 gene locus_tag LOCUS_10820 16155 18278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_10820 18295 19728 gene locus_tag LOCUS_10830 18295 19728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 19772 20578 gene locus_tag LOCUS_10840 19772 20578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 20583 21500 gene locus_tag LOCUS_10850 20583 21500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 21491 22996 gene locus_tag LOCUS_10860 21491 22996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 22993 24066 gene locus_tag LOCUS_10870 gene nfrC 22993 24066 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176215.1 protein_id gnl|my_center|LOCUS_10870 25714 24068 gene locus_tag LOCUS_10880 25714 24068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 25887 25714 gene locus_tag LOCUS_10890 25887 25714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 26055 27914 gene locus_tag LOCUS_10900 26055 27914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 27970 28533 gene locus_tag LOCUS_10910 27970 28533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 30581 28563 gene locus_tag LOCUS_10920 30581 28563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 31705 30608 gene locus_tag LOCUS_10930 31705 30608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 31742 32362 gene locus_tag LOCUS_10940 31742 32362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 32362 32763 gene locus_tag LOCUS_10950 32362 32763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 32760 34478 gene locus_tag LOCUS_10960 32760 34478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_10960 34478 35413 gene locus_tag LOCUS_10970 34478 35413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 36041 35418 gene locus_tag LOCUS_10980 36041 35418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 37958 36054 gene locus_tag LOCUS_10990 37958 36054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 37999 38136 gene locus_tag LOCUS_11000 37999 38136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 38267 38719 gene locus_tag LOCUS_11010 38267 38719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11010 39391 38732 gene locus_tag LOCUS_11020 39391 38732 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870432.1 protein_id gnl|my_center|LOCUS_11020 39413 40003 gene locus_tag LOCUS_11030 39413 40003 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_11030 40414 40010 gene locus_tag LOCUS_11040 40414 40010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 40503 41369 gene locus_tag LOCUS_11050 40503 41369 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_11050 41379 42857 gene locus_tag LOCUS_11060 41379 42857 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_11060 42854 43261 gene locus_tag LOCUS_11070 42854 43261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067451.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence019 <1 520 gene locus_tag LOCUS_11080 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PD23:60 kDa chaperonin 1095 592 gene locus_tag LOCUS_11090 1095 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1685 1116 gene locus_tag LOCUS_11100 1685 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 4447 1721 gene locus_tag LOCUS_11110 4447 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 4548 6035 gene locus_tag LOCUS_11120 4548 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 8062 6053 gene locus_tag LOCUS_11130 8062 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 8155 8340 gene locus_tag LOCUS_11140 8155 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 8330 8512 gene locus_tag LOCUS_11150 8330 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 8525 10798 gene locus_tag LOCUS_11160 8525 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11160 10830 11120 gene locus_tag LOCUS_11170 10830 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 11870 11121 gene locus_tag LOCUS_11180 gene pssA 11870 11121 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940239.1 protein_id gnl|my_center|LOCUS_11180 13037 11910 gene locus_tag LOCUS_11190 13037 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 13855 13037 gene locus_tag LOCUS_11200 13855 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 14572 13859 gene locus_tag LOCUS_11210 14572 13859 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_11210 16660 14576 gene locus_tag LOCUS_11220 16660 14576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 17097 16657 gene locus_tag LOCUS_11230 17097 16657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 17478 17098 gene locus_tag LOCUS_11240 17478 17098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 18162 17488 gene locus_tag LOCUS_11250 18162 17488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 19342 18176 gene locus_tag LOCUS_11260 gene gcdH 19342 18176 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224141.1 protein_id gnl|my_center|LOCUS_11260 20836 19379 gene locus_tag LOCUS_11270 20836 19379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 20991 21719 gene locus_tag LOCUS_11280 gene ilvE 20991 21719 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_11280 22173 21673 gene locus_tag LOCUS_11290 22173 21673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 22846 22178 gene locus_tag LOCUS_11300 22846 22178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 22898 24052 gene locus_tag LOCUS_11310 22898 24052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933712.1 protein_id gnl|my_center|LOCUS_11310 24948 24049 gene locus_tag LOCUS_11320 gene ldhA 24948 24049 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880437.1 protein_id gnl|my_center|LOCUS_11320 26165 24945 gene locus_tag LOCUS_11330 26165 24945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 26213 27559 gene locus_tag LOCUS_11340 gene radA 26213 27559 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG1 protein_id gnl|my_center|LOCUS_11340 27598 29379 gene locus_tag LOCUS_11350 27598 29379 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337307.1 protein_id gnl|my_center|LOCUS_11350 29380 29934 gene locus_tag LOCUS_11360 29380 29934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 30769 29885 gene locus_tag LOCUS_11370 30769 29885 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DYV8 protein_id gnl|my_center|LOCUS_11370 32592 30766 gene locus_tag LOCUS_11380 32592 30766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553869.1 protein_id gnl|my_center|LOCUS_11380 33383 32589 gene locus_tag LOCUS_11390 33383 32589 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066916.1 protein_id gnl|my_center|LOCUS_11390 33463 34512 gene locus_tag LOCUS_11400 33463 34512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 35813 34509 gene locus_tag LOCUS_11410 gene pyrC 35813 34509 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ62 protein_id gnl|my_center|LOCUS_11410 36634 35810 gene locus_tag LOCUS_11420 36634 35810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 38091 36634 gene locus_tag LOCUS_11430 38091 36634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 39203 38079 gene locus_tag LOCUS_11440 39203 38079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 40873 39206 gene locus_tag LOCUS_11450 40873 39206 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865256.1 protein_id gnl|my_center|LOCUS_11450 40993 42024 gene locus_tag LOCUS_11460 40993 42024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence020 2010 2366 gene locus_tag LOCUS_11470 2010 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2363 3151 gene locus_tag LOCUS_11480 2363 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 3203 4051 gene locus_tag LOCUS_11490 3203 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 4448 4212 gene locus_tag LOCUS_11500 4448 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 5927 5580 gene locus_tag LOCUS_11510 5927 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 6388 5924 gene locus_tag LOCUS_11520 6388 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 6662 7999 gene locus_tag LOCUS_11530 6662 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 8009 9586 gene locus_tag LOCUS_11540 8009 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 10811 9597 gene locus_tag LOCUS_11550 10811 9597 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_11550 11903 10872 gene locus_tag LOCUS_11560 gene cnrT 11903 10872 CDS product cobalt-nickel-resistance system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205582.1 protein_id gnl|my_center|LOCUS_11560 12468 11947 gene locus_tag LOCUS_11570 gene sigZ 12468 11947 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05409 protein_id gnl|my_center|LOCUS_11570 12893 12465 gene locus_tag LOCUS_11580 12893 12465 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222676.1 protein_id gnl|my_center|LOCUS_11580 13335 12937 gene locus_tag LOCUS_11590 13335 12937 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_11590 13976 13332 gene locus_tag LOCUS_11600 13976 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 14031 14555 gene locus_tag LOCUS_11610 14031 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 14555 15931 gene locus_tag LOCUS_11620 14555 15931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 15928 17568 gene locus_tag LOCUS_11630 15928 17568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 17556 19049 gene locus_tag LOCUS_11640 17556 19049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 21562 19022 gene locus_tag LOCUS_11650 21562 19022 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947857.1 protein_id gnl|my_center|LOCUS_11650 24486 21559 gene locus_tag LOCUS_11660 24486 21559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 25604 24576 gene locus_tag LOCUS_11670 25604 24576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 25668 26474 gene locus_tag LOCUS_11680 25668 26474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 26471 27262 gene locus_tag LOCUS_11690 26471 27262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 27307 27573 gene locus_tag LOCUS_11700 27307 27573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 27604 28059 gene locus_tag LOCUS_11710 27604 28059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 28071 29564 gene locus_tag LOCUS_11720 28071 29564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 29564 29953 gene locus_tag LOCUS_11730 29564 29953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 29961 31211 gene locus_tag LOCUS_11740 29961 31211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 31222 31974 gene locus_tag LOCUS_11750 31222 31974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 31980 32384 gene locus_tag LOCUS_11760 31980 32384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 32394 32840 gene locus_tag LOCUS_11770 32394 32840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 32843 33712 gene locus_tag LOCUS_11780 32843 33712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 34847 33702 gene locus_tag LOCUS_11790 34847 33702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 35722 35015 gene locus_tag LOCUS_11800 35722 35015 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259746.1 protein_id gnl|my_center|LOCUS_11800 37118 35712 gene locus_tag LOCUS_11810 37118 35712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 38612 37137 gene locus_tag LOCUS_11820 38612 37137 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731117.1 protein_id gnl|my_center|LOCUS_11820 40663 38612 gene locus_tag LOCUS_11830 40663 38612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 41463 40663 gene locus_tag LOCUS_11840 41463 40663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 42046 41474 gene locus_tag LOCUS_11850 42046 41474 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHP2 protein_id gnl|my_center|LOCUS_11850 42759 42052 gene locus_tag LOCUS_11860 gene rph 42759 42052 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T93 protein_id gnl|my_center|LOCUS_11860 >Feature sequence021 93 9260 gene locus_tag LOCUS_11870 93 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 9257 9832 gene locus_tag LOCUS_11880 9257 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 9849 10673 gene locus_tag LOCUS_11890 9849 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 11802 10660 gene locus_tag LOCUS_11900 11802 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 12816 11812 gene locus_tag LOCUS_11910 gene rtcA 12816 11812 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XUT2 protein_id gnl|my_center|LOCUS_11910 14057 12816 gene locus_tag LOCUS_11920 gene rtcB 14057 12816 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVK1 protein_id gnl|my_center|LOCUS_11920 14211 14795 gene locus_tag LOCUS_11930 14211 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 14852 15442 gene locus_tag LOCUS_11940 14852 15442 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090769.1 protein_id gnl|my_center|LOCUS_11940 15447 16553 gene locus_tag LOCUS_11950 15447 16553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 17463 16747 gene locus_tag LOCUS_11960 17463 16747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144072.1 protein_id gnl|my_center|LOCUS_11960 18775 17465 gene locus_tag LOCUS_11970 18775 17465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 18774 19853 gene locus_tag LOCUS_11980 18774 19853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 20070 19858 gene locus_tag LOCUS_11990 20070 19858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 21710 20067 gene locus_tag LOCUS_12000 21710 20067 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_12000 24166 21710 gene locus_tag LOCUS_12010 24166 21710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 25569 24211 gene locus_tag LOCUS_12020 25569 24211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 26192 25566 gene locus_tag LOCUS_12030 26192 25566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 26456 29197 gene locus_tag LOCUS_12040 26456 29197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 29208 30074 gene locus_tag LOCUS_12050 29208 30074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 30076 31023 gene locus_tag LOCUS_12060 30076 31023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 32506 31037 gene locus_tag LOCUS_12070 32506 31037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 33811 32618 gene locus_tag LOCUS_12080 33811 32618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 34563 33808 gene locus_tag LOCUS_12090 34563 33808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 35990 34569 gene locus_tag LOCUS_12100 35990 34569 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258512.1 protein_id gnl|my_center|LOCUS_12100 36170 37321 gene locus_tag LOCUS_12110 gene tgt-1 36170 37321 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DZ0 protein_id gnl|my_center|LOCUS_12110 37318 37746 gene locus_tag LOCUS_12120 37318 37746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 38857 37739 gene locus_tag LOCUS_12130 38857 37739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 39417 38857 gene locus_tag LOCUS_12140 39417 38857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 40115 39417 gene locus_tag LOCUS_12150 40115 39417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 40907 40125 gene locus_tag LOCUS_12160 40907 40125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 41303 40935 gene locus_tag LOCUS_12170 41303 40935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 41368 41847 gene locus_tag LOCUS_12180 41368 41847 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180281.1 protein_id gnl|my_center|LOCUS_12180 41852 41937 gene locus_tag LOCUS_t00030 41852 41937 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 42014 42101 gene locus_tag LOCUS_t00040 42014 42101 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence022 220 1104 gene locus_tag LOCUS_12190 220 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1173 2219 gene locus_tag LOCUS_12200 1173 2219 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143424.1 protein_id gnl|my_center|LOCUS_12200 2201 3787 gene locus_tag LOCUS_12210 2201 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 3833 5179 gene locus_tag LOCUS_12220 3833 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 6648 5173 gene locus_tag LOCUS_12230 6648 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 6676 7839 gene locus_tag LOCUS_12240 6676 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 7902 9119 gene locus_tag LOCUS_12250 7902 9119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 9714 9109 gene locus_tag LOCUS_12260 9714 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 9748 10488 gene locus_tag LOCUS_12270 9748 10488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 10507 10962 gene locus_tag LOCUS_12280 10507 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 10959 11618 gene locus_tag LOCUS_12290 10959 11618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 11615 12379 gene locus_tag LOCUS_12300 11615 12379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 12376 13095 gene locus_tag LOCUS_12310 12376 13095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 13102 14502 gene locus_tag LOCUS_12320 13102 14502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 14496 15296 gene locus_tag LOCUS_12330 14496 15296 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_12330 16871 15315 gene locus_tag LOCUS_12340 16871 15315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 18571 16898 gene locus_tag LOCUS_12350 18571 16898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 18705 18568 gene locus_tag LOCUS_12360 18705 18568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 18727 19548 gene locus_tag LOCUS_12370 18727 19548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 19536 21470 gene locus_tag LOCUS_12380 19536 21470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 23127 21400 gene locus_tag LOCUS_12390 23127 21400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 23135 26401 gene locus_tag LOCUS_12400 23135 26401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 26422 28263 gene locus_tag LOCUS_12410 26422 28263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 28263 29456 gene locus_tag LOCUS_12420 28263 29456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 29450 29851 gene locus_tag LOCUS_12430 29450 29851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 29848 30903 gene locus_tag LOCUS_12440 29848 30903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 30894 31670 gene locus_tag LOCUS_12450 30894 31670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 31667 33241 gene locus_tag LOCUS_12460 31667 33241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 33220 34722 gene locus_tag LOCUS_12470 33220 34722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 35755 34607 gene locus_tag LOCUS_12480 35755 34607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 36597 35740 gene locus_tag LOCUS_12490 36597 35740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 37208 36585 gene locus_tag LOCUS_12500 37208 36585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 37395 38534 gene locus_tag LOCUS_12510 37395 38534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 38531 39856 gene locus_tag LOCUS_12520 38531 39856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 39850 41421 gene locus_tag LOCUS_12530 39850 41421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence023 662 216 gene locus_tag LOCUS_12540 gene ccmE 662 216 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIG4 protein_id gnl|my_center|LOCUS_12540 1467 766 gene locus_tag LOCUS_12550 gene ccmC 1467 766 CDS product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_12550 2126 1464 gene locus_tag LOCUS_12560 gene cycW 2126 1464 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30964 protein_id gnl|my_center|LOCUS_12560 2851 2123 gene locus_tag LOCUS_12570 2851 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 3650 2928 gene locus_tag LOCUS_12580 3650 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 4210 4283 gene locus_tag LOCUS_t00050 4210 4283 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6318 4639 gene locus_tag LOCUS_12590 6318 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 6387 7841 gene locus_tag LOCUS_12600 6387 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 7841 8863 gene locus_tag LOCUS_12610 7841 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338923.1 protein_id gnl|my_center|LOCUS_12610 8860 9756 gene locus_tag LOCUS_12620 8860 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 11652 9811 gene locus_tag LOCUS_12630 gene cysN 11652 9811 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNW6 protein_id gnl|my_center|LOCUS_12630 12606 11695 gene locus_tag LOCUS_12640 gene cysD 12606 11695 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_12640 12694 13320 gene locus_tag LOCUS_12650 12694 13320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 13317 14564 gene locus_tag LOCUS_12660 13317 14564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 14570 15835 gene locus_tag LOCUS_12670 gene bioA 14570 15835 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728P4 protein_id gnl|my_center|LOCUS_12670 15845 17524 gene locus_tag LOCUS_12680 15845 17524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 18325 17528 gene locus_tag LOCUS_12690 18325 17528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016290.1 protein_id gnl|my_center|LOCUS_12690 19167 18322 gene locus_tag LOCUS_12700 19167 18322 CDS product putative 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701652.1 protein_id gnl|my_center|LOCUS_12700 19185 19823 gene locus_tag LOCUS_12710 gene ydeI 19185 19823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 protein_id gnl|my_center|LOCUS_12710 21023 19824 gene locus_tag LOCUS_12720 21023 19824 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889312.1 protein_id gnl|my_center|LOCUS_12720 21064 21507 gene locus_tag LOCUS_12730 21064 21507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 21597 22247 gene locus_tag LOCUS_12740 21597 22247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 22359 24116 gene locus_tag LOCUS_12750 22359 24116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 24727 24161 gene locus_tag LOCUS_12760 24727 24161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 26598 24724 gene locus_tag LOCUS_12770 26598 24724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 27365 26595 gene locus_tag LOCUS_12780 27365 26595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 29394 27355 gene locus_tag LOCUS_12790 29394 27355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 31133 29391 gene locus_tag LOCUS_12800 31133 29391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 31750 31133 gene locus_tag LOCUS_12810 31750 31133 CDS product OmpA/MotB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393242.1 protein_id gnl|my_center|LOCUS_12810 32469 31753 gene locus_tag LOCUS_12820 32469 31753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 33102 32470 gene locus_tag LOCUS_12830 33102 32470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 34064 33099 gene locus_tag LOCUS_12840 34064 33099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 35245 34055 gene locus_tag LOCUS_12850 35245 34055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 35883 35242 gene locus_tag LOCUS_12860 35883 35242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 36642 35884 gene locus_tag LOCUS_12870 36642 35884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 37496 36672 gene locus_tag LOCUS_12880 37496 36672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 38449 37574 gene locus_tag LOCUS_12890 38449 37574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 39549 39921 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgacaccgacggcgacggc >Feature sequence024 2071 491 gene locus_tag LOCUS_12900 2071 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2160 2624 gene locus_tag LOCUS_12910 2160 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 2624 3283 gene locus_tag LOCUS_12920 2624 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3292 3738 gene locus_tag LOCUS_12930 3292 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 3735 4832 gene locus_tag LOCUS_12940 3735 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 4871 5362 gene locus_tag LOCUS_12950 4871 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 6463 5369 gene locus_tag LOCUS_12960 6463 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 6519 7130 gene locus_tag LOCUS_12970 6519 7130 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114215.1 protein_id gnl|my_center|LOCUS_12970 8094 7096 gene locus_tag LOCUS_12980 8094 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 8149 10512 gene locus_tag LOCUS_12990 8149 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 11513 10515 gene locus_tag LOCUS_13000 11513 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 15121 11516 gene locus_tag LOCUS_13010 15121 11516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 17125 15200 gene locus_tag LOCUS_13020 17125 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 17143 19686 gene locus_tag LOCUS_13030 17143 19686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 19698 21293 gene locus_tag LOCUS_13040 19698 21293 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933296.1 protein_id gnl|my_center|LOCUS_13040 21290 22291 gene locus_tag LOCUS_13050 21290 22291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 22258 24456 gene locus_tag LOCUS_13060 22258 24456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 24453 24623 gene locus_tag LOCUS_13070 24453 24623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 25200 24559 gene locus_tag LOCUS_13080 25200 24559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 25844 25197 gene locus_tag LOCUS_13090 25844 25197 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072086.1 protein_id gnl|my_center|LOCUS_13090 25844 26599 gene locus_tag LOCUS_13100 25844 26599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 27703 26603 gene locus_tag LOCUS_13110 27703 26603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 30351 27703 gene locus_tag LOCUS_13120 gene polA 30351 27703 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704214.1 protein_id gnl|my_center|LOCUS_13120 32191 30365 gene locus_tag LOCUS_13130 32191 30365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 32194 33801 gene locus_tag LOCUS_13140 32194 33801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 35518 33791 gene locus_tag LOCUS_13150 35518 33791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 35552 36364 gene locus_tag LOCUS_13160 35552 36364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 36364 37008 gene locus_tag LOCUS_13170 36364 37008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 37008 37442 gene locus_tag LOCUS_13180 37008 37442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 38095 37439 gene locus_tag LOCUS_13190 38095 37439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 38976 38230 gene locus_tag LOCUS_13200 38976 38230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 39635 38976 gene locus_tag LOCUS_13210 39635 38976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence025 1449 2762 gene locus_tag LOCUS_13220 gene selA 1449 2762 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFK3 protein_id gnl|my_center|LOCUS_13220 2762 3613 gene locus_tag LOCUS_13230 2762 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 3610 4515 gene locus_tag LOCUS_13240 gene rluD 3610 4515 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H11 protein_id gnl|my_center|LOCUS_13240 5572 4541 gene locus_tag LOCUS_13250 5572 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 6721 5669 gene locus_tag LOCUS_13260 6721 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 7079 6816 gene locus_tag LOCUS_13270 7079 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 8329 7088 gene locus_tag LOCUS_13280 8329 7088 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940536.1 protein_id gnl|my_center|LOCUS_13280 8389 9168 gene locus_tag LOCUS_13290 8389 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 9940 9173 gene locus_tag LOCUS_13300 gene speA 9940 9173 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_13300 11010 9991 gene locus_tag LOCUS_13310 11010 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 13744 11111 gene locus_tag LOCUS_13320 gene alaS 13744 11111 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQW7 protein_id gnl|my_center|LOCUS_13320 14868 13777 gene locus_tag LOCUS_13330 gene pilT-1 14868 13777 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_13330 15943 14900 gene locus_tag LOCUS_13340 gene recA 15943 14900 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I84 protein_id gnl|my_center|LOCUS_13340 17265 16030 gene locus_tag LOCUS_13350 17265 16030 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GV1 protein_id gnl|my_center|LOCUS_13350 17726 17292 gene locus_tag LOCUS_13360 17726 17292 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHZ7 protein_id gnl|my_center|LOCUS_13360 19783 17795 gene locus_tag LOCUS_13370 19783 17795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 21939 19927 gene locus_tag LOCUS_13380 21939 19927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 23602 21953 gene locus_tag LOCUS_13390 23602 21953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 23830 25542 gene locus_tag LOCUS_13400 23830 25542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 25529 26422 gene locus_tag LOCUS_13410 25529 26422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 26416 28005 gene locus_tag LOCUS_13420 26416 28005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 28026 28610 gene locus_tag LOCUS_13430 28026 28610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 28615 29673 gene locus_tag LOCUS_13440 28615 29673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 29670 30500 gene locus_tag LOCUS_13450 29670 30500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 30497 31723 gene locus_tag LOCUS_13460 30497 31723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582516.1 protein_id gnl|my_center|LOCUS_13460 31720 33585 gene locus_tag LOCUS_13470 31720 33585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 33582 34313 gene locus_tag LOCUS_13480 33582 34313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 35004 34288 gene locus_tag LOCUS_13490 35004 34288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 36187 35009 gene locus_tag LOCUS_13500 36187 35009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 36267 36989 gene locus_tag LOCUS_13510 36267 36989 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_13510 37034 38416 gene locus_tag LOCUS_13520 37034 38416 CDS product UDP-phosphate galactose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence026 <1 730 gene locus_tag LOCUS_13530 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34893:putative enoyl-CoA hydratase/isomerase YngF 748 1065 gene locus_tag LOCUS_13540 748 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1062 2102 gene locus_tag LOCUS_13550 1062 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 2547 2065 gene locus_tag LOCUS_13560 2547 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 4687 2558 gene locus_tag LOCUS_13570 4687 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 6324 4672 gene locus_tag LOCUS_13580 gene glpA 6324 4672 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZR9 protein_id gnl|my_center|LOCUS_13580 8704 6344 gene locus_tag LOCUS_13590 8704 6344 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_13590 11026 8714 gene locus_tag LOCUS_13600 gene recQ 11026 8714 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122787.1 protein_id gnl|my_center|LOCUS_13600 11087 11875 gene locus_tag LOCUS_13610 gene fdhD 11087 11875 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DEF2 protein_id gnl|my_center|LOCUS_13610 11872 13356 gene locus_tag LOCUS_13620 11872 13356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 14034 13318 gene locus_tag LOCUS_13630 14034 13318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 14543 14055 gene locus_tag LOCUS_13640 14543 14055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 14582 14992 gene locus_tag LOCUS_13650 14582 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 16182 14995 gene locus_tag LOCUS_13660 16182 14995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 17130 16192 gene locus_tag LOCUS_13670 17130 16192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 17174 18340 gene locus_tag LOCUS_13680 17174 18340 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_13680 18337 20292 gene locus_tag LOCUS_13690 18337 20292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 20292 21152 gene locus_tag LOCUS_13700 20292 21152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090797.1 protein_id gnl|my_center|LOCUS_13700 21175 22968 gene locus_tag LOCUS_13710 21175 22968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 26278 22970 gene locus_tag LOCUS_13720 26278 22970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 27787 26279 gene locus_tag LOCUS_13730 27787 26279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 28372 27797 gene locus_tag LOCUS_13740 28372 27797 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761840.1 protein_id gnl|my_center|LOCUS_13740 29127 28369 gene locus_tag LOCUS_13750 gene lep 29127 28369 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA30 protein_id gnl|my_center|LOCUS_13750 30395 29136 gene locus_tag LOCUS_13760 30395 29136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 31567 30392 gene locus_tag LOCUS_13770 31567 30392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 31595 33088 gene locus_tag LOCUS_13780 31595 33088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 33085 33816 gene locus_tag LOCUS_13790 33085 33816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669374.1 protein_id gnl|my_center|LOCUS_13790 33813 34280 gene locus_tag LOCUS_13800 33813 34280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 34277 35032 gene locus_tag LOCUS_13810 34277 35032 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_13810 35025 35825 gene locus_tag LOCUS_13820 35025 35825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_13820 36634 35822 gene locus_tag LOCUS_13830 36634 35822 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339275.1 protein_id gnl|my_center|LOCUS_13830 36669 37070 gene locus_tag LOCUS_13840 36669 37070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 37055 38182 gene locus_tag LOCUS_13850 37055 38182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence027 88 2064 gene locus_tag LOCUS_13860 88 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2061 3077 gene locus_tag LOCUS_13870 2061 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3074 3691 gene locus_tag LOCUS_13880 3074 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3701 4198 gene locus_tag LOCUS_13890 3701 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 4423 5001 gene locus_tag LOCUS_13900 4423 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 4998 7166 gene locus_tag LOCUS_13910 4998 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 7184 7972 gene locus_tag LOCUS_13920 7184 7972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 7972 8769 gene locus_tag LOCUS_13930 7972 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 8773 9045 gene locus_tag LOCUS_13940 8773 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 10377 9100 gene locus_tag LOCUS_13950 10377 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 11263 10418 gene locus_tag LOCUS_13960 11263 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 11891 11367 gene locus_tag LOCUS_13970 11891 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 13165 11918 gene locus_tag LOCUS_13980 13165 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 14758 13175 gene locus_tag LOCUS_13990 14758 13175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 15737 14796 gene locus_tag LOCUS_14000 15737 14796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 16091 15759 gene locus_tag LOCUS_14010 16091 15759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 16687 16091 gene locus_tag LOCUS_14020 16687 16091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 17521 16697 gene locus_tag LOCUS_14030 17521 16697 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 protein_id gnl|my_center|LOCUS_14030 17520 18086 gene locus_tag LOCUS_14040 17520 18086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 18918 18076 gene locus_tag LOCUS_14050 18918 18076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 21230 18918 gene locus_tag LOCUS_14060 21230 18918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 22494 21298 gene locus_tag LOCUS_14070 22494 21298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 23306 22494 gene locus_tag LOCUS_14080 23306 22494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703681.1 protein_id gnl|my_center|LOCUS_14080 23367 24536 gene locus_tag LOCUS_14090 23367 24536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 24980 24543 gene locus_tag LOCUS_14100 24980 24543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 25387 24977 gene locus_tag LOCUS_14110 25387 24977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 25806 25390 gene locus_tag LOCUS_14120 25806 25390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 26354 25806 gene locus_tag LOCUS_14130 26354 25806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 26412 27707 gene locus_tag LOCUS_14140 26412 27707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 27723 28406 gene locus_tag LOCUS_14150 27723 28406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 28403 28747 gene locus_tag LOCUS_14160 28403 28747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 28744 29568 gene locus_tag LOCUS_14170 28744 29568 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808328.1 protein_id gnl|my_center|LOCUS_14170 29593 29964 gene locus_tag LOCUS_14180 29593 29964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 29961 31679 gene locus_tag LOCUS_14190 29961 31679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 31676 33085 gene locus_tag LOCUS_14200 31676 33085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 33103 33294 gene locus_tag LOCUS_14210 33103 33294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 33294 33539 gene locus_tag LOCUS_14220 33294 33539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 33592 34935 gene locus_tag LOCUS_14230 33592 34935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 34938 35786 gene locus_tag LOCUS_14240 gene dapA 34938 35786 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AX2 protein_id gnl|my_center|LOCUS_14240 35771 36451 gene locus_tag LOCUS_14250 gene dapB 35771 36451 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI48 protein_id gnl|my_center|LOCUS_14250 36739 36473 gene locus_tag LOCUS_14260 36739 36473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence028 101 28 gene locus_tag LOCUS_t00060 101 28 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1069 152 gene locus_tag LOCUS_14270 1069 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1118 3238 gene locus_tag LOCUS_14280 1118 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 4532 3243 gene locus_tag LOCUS_14290 4532 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 4551 5465 gene locus_tag LOCUS_14300 4551 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 5511 6203 gene locus_tag LOCUS_14310 gene phoB 5511 6203 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_14310 6204 7520 gene locus_tag LOCUS_14320 6204 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 8073 7483 gene locus_tag LOCUS_14330 8073 7483 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_14330 8103 8774 gene locus_tag LOCUS_14340 8103 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 8765 9682 gene locus_tag LOCUS_14350 8765 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 9695 10117 gene locus_tag LOCUS_14360 9695 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 10114 11151 gene locus_tag LOCUS_14370 10114 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 11148 13349 gene locus_tag LOCUS_14380 11148 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 14042 13422 gene locus_tag LOCUS_14390 14042 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 16953 14107 gene locus_tag LOCUS_14400 16953 14107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 17172 20030 gene locus_tag LOCUS_14410 gene mrcA 17172 20030 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_14410 20030 20446 gene locus_tag LOCUS_14420 20030 20446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 20447 21202 gene locus_tag LOCUS_14430 20447 21202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 21251 23542 gene locus_tag LOCUS_14440 21251 23542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 24847 23546 gene locus_tag LOCUS_14450 24847 23546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112779.1 protein_id gnl|my_center|LOCUS_14450 25803 24844 gene locus_tag LOCUS_14460 25803 24844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_14460 26753 25800 gene locus_tag LOCUS_14470 26753 25800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104956.1 protein_id gnl|my_center|LOCUS_14470 28363 26753 gene locus_tag LOCUS_14480 28363 26753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 protein_id gnl|my_center|LOCUS_14480 29315 28353 gene locus_tag LOCUS_14490 29315 28353 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 protein_id gnl|my_center|LOCUS_14490 29998 29312 gene locus_tag LOCUS_14500 29998 29312 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 protein_id gnl|my_center|LOCUS_14500 30094 30705 gene locus_tag LOCUS_14510 30094 30705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 30715 32610 gene locus_tag LOCUS_14520 30715 32610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 32610 33422 gene locus_tag LOCUS_14530 32610 33422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 33424 33942 gene locus_tag LOCUS_14540 gene hpt 33424 33942 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_14540 33939 34319 gene locus_tag LOCUS_14550 33939 34319 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_14550 <35420 34324 gene locus_tag LOCUS_14560 <35420 34324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941112.1:ribonuclease D >Feature sequence029 1371 706 gene locus_tag LOCUS_14570 1371 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1403 1828 gene locus_tag LOCUS_14580 1403 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 3131 1821 gene locus_tag LOCUS_14590 gene aspC 3131 1821 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A0S0 protein_id gnl|my_center|LOCUS_14590 3212 6115 gene locus_tag LOCUS_14600 3212 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 6112 7932 gene locus_tag LOCUS_14610 6112 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 7955 8797 gene locus_tag LOCUS_14620 7955 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 9401 8790 gene locus_tag LOCUS_14630 9401 8790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 9461 10261 gene locus_tag LOCUS_14640 9461 10261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 10261 11121 gene locus_tag LOCUS_14650 10261 11121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 11836 11102 gene locus_tag LOCUS_14660 11836 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 11902 12711 gene locus_tag LOCUS_14670 11902 12711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 13552 12686 gene locus_tag LOCUS_14680 13552 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727868.1 protein_id gnl|my_center|LOCUS_14680 14199 13555 gene locus_tag LOCUS_14690 14199 13555 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_14690 14857 14222 gene locus_tag LOCUS_14700 14857 14222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 14873 15589 gene locus_tag LOCUS_14710 gene aat 14873 15589 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BN2 protein_id gnl|my_center|LOCUS_14710 15602 17269 gene locus_tag LOCUS_14720 15602 17269 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_14720 18092 17280 gene locus_tag LOCUS_14730 18092 17280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 18680 18102 gene locus_tag LOCUS_14740 18680 18102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 18967 18695 gene locus_tag LOCUS_14750 18967 18695 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CL55 protein_id gnl|my_center|LOCUS_14750 18980 19591 gene locus_tag LOCUS_14760 18980 19591 CDS product putative HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67443 protein_id gnl|my_center|LOCUS_14760 19618 20484 gene locus_tag LOCUS_14770 19618 20484 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524880.1 protein_id gnl|my_center|LOCUS_14770 20481 22076 gene locus_tag LOCUS_14780 gene accD2 20481 22076 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900245.1 protein_id gnl|my_center|LOCUS_14780 22115 22522 gene locus_tag LOCUS_14790 22115 22522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14790 22494 23858 gene locus_tag LOCUS_14800 22494 23858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14800 26063 23862 gene locus_tag LOCUS_14810 26063 23862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_14810 27076 26129 gene locus_tag LOCUS_14820 27076 26129 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089280.1 protein_id gnl|my_center|LOCUS_14820 27729 27073 gene locus_tag LOCUS_14830 27729 27073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 27778 28452 gene locus_tag LOCUS_14840 27778 28452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 28937 28425 gene locus_tag LOCUS_14850 28937 28425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 29809 28934 gene locus_tag LOCUS_14860 29809 28934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 29834 30997 gene locus_tag LOCUS_14870 29834 30997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 30994 33243 gene locus_tag LOCUS_14880 30994 33243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 33823 33224 gene locus_tag LOCUS_14890 33823 33224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 34566 33820 gene locus_tag LOCUS_14900 34566 33820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 <35298 34584 gene locus_tag LOCUS_14910 <35298 34584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584159.1:Crp/Fnr family transcriptional regulator >Feature sequence030 5363 738 gene locus_tag LOCUS_14920 5363 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 7797 5401 gene locus_tag LOCUS_14930 7797 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 8672 7797 gene locus_tag LOCUS_14940 8672 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 8714 10930 gene locus_tag LOCUS_14950 8714 10930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 10997 11827 gene locus_tag LOCUS_14960 10997 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 12443 12733 gene locus_tag LOCUS_14970 12443 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 13111 12776 gene locus_tag LOCUS_14980 13111 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 14006 13167 gene locus_tag LOCUS_14990 14006 13167 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106521.1 protein_id gnl|my_center|LOCUS_14990 14864 14016 gene locus_tag LOCUS_15000 14864 14016 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726830.1 protein_id gnl|my_center|LOCUS_15000 15079 16425 gene locus_tag LOCUS_15010 gene tnaA 15079 16425 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1V4 protein_id gnl|my_center|LOCUS_15010 17698 16403 gene locus_tag LOCUS_15020 17698 16403 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460649.1 protein_id gnl|my_center|LOCUS_15020 19031 17601 gene locus_tag LOCUS_15030 19031 17601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 19369 19028 gene locus_tag LOCUS_15040 19369 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 20220 19537 gene locus_tag LOCUS_15050 20220 19537 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_15050 21620 20217 gene locus_tag LOCUS_15060 gene lpdA-4 21620 20217 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941969.1 protein_id gnl|my_center|LOCUS_15060 22008 21676 gene locus_tag LOCUS_15070 22008 21676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 22263 22018 gene locus_tag LOCUS_15080 22263 22018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 22335 23483 gene locus_tag LOCUS_15090 22335 23483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 24513 23488 gene locus_tag LOCUS_15100 24513 23488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 27628 24593 gene locus_tag LOCUS_15110 27628 24593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 28751 27642 gene locus_tag LOCUS_15120 28751 27642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 30117 28732 gene locus_tag LOCUS_15130 30117 28732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 30231 31220 gene locus_tag LOCUS_15140 30231 31220 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385771.1 protein_id gnl|my_center|LOCUS_15140 31217 32818 gene locus_tag LOCUS_15150 31217 32818 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729220.1 protein_id gnl|my_center|LOCUS_15150 32811 33731 gene locus_tag LOCUS_15160 32811 33731 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228819.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence031 <1 4526 gene locus_tag LOCUS_15170 <1 4526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815440.1:translocation/assembly module TamB 4977 4534 gene locus_tag LOCUS_15180 4977 4534 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933367.1 protein_id gnl|my_center|LOCUS_15180 5023 5508 gene locus_tag LOCUS_15190 5023 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 7104 5524 gene locus_tag LOCUS_15200 7104 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 7145 8614 gene locus_tag LOCUS_15210 7145 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 9648 8617 gene locus_tag LOCUS_15220 9648 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 9685 10845 gene locus_tag LOCUS_15230 9685 10845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 12190 10829 gene locus_tag LOCUS_15240 gene argH 12190 10829 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817C7 protein_id gnl|my_center|LOCUS_15240 12238 14412 gene locus_tag LOCUS_15250 12238 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 16660 14390 gene locus_tag LOCUS_15260 16660 14390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 17106 16657 gene locus_tag LOCUS_15270 17106 16657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 18444 17212 gene locus_tag LOCUS_15280 gene argG 18444 17212 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDE0 protein_id gnl|my_center|LOCUS_15280 18838 18455 gene locus_tag LOCUS_15290 gene argR 18838 18455 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDE1 protein_id gnl|my_center|LOCUS_15290 20391 18982 gene locus_tag LOCUS_15300 20391 18982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 20492 21655 gene locus_tag LOCUS_15310 20492 21655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 21680 23464 gene locus_tag LOCUS_15320 21680 23464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 24508 23468 gene locus_tag LOCUS_15330 24508 23468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 25113 24505 gene locus_tag LOCUS_15340 25113 24505 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809919.1 protein_id gnl|my_center|LOCUS_15340 25928 25110 gene locus_tag LOCUS_15350 25928 25110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 26277 25984 gene locus_tag LOCUS_15360 26277 25984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 26161 27141 gene locus_tag LOCUS_15370 26161 27141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 27142 28131 gene locus_tag LOCUS_15380 27142 28131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 30014 28107 gene locus_tag LOCUS_15390 30014 28107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 31933 30092 gene locus_tag LOCUS_15400 31933 30092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 32820 31930 gene locus_tag LOCUS_15410 32820 31930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 33603 32842 gene locus_tag LOCUS_15420 33603 32842 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHQ1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence032 230 24 gene locus_tag LOCUS_15430 230 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1805 234 gene locus_tag LOCUS_15440 1805 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1905 2534 gene locus_tag LOCUS_15450 1905 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2535 3587 gene locus_tag LOCUS_15460 2535 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 6599 3597 gene locus_tag LOCUS_15470 6599 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 6844 6611 gene locus_tag LOCUS_15480 6844 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 7252 6854 gene locus_tag LOCUS_15490 7252 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 7420 8079 gene locus_tag LOCUS_15500 7420 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 8813 8097 gene locus_tag LOCUS_15510 8813 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 9481 8891 gene locus_tag LOCUS_15520 9481 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 10542 9796 gene locus_tag LOCUS_15530 10542 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105094.1 protein_id gnl|my_center|LOCUS_15530 10596 12698 gene locus_tag LOCUS_15540 10596 12698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 12695 13009 gene locus_tag LOCUS_15550 12695 13009 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPZ1 protein_id gnl|my_center|LOCUS_15550 13009 13626 gene locus_tag LOCUS_15560 13009 13626 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458897.1 protein_id gnl|my_center|LOCUS_15560 14952 13588 gene locus_tag LOCUS_15570 14952 13588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 15142 14942 gene locus_tag LOCUS_15580 15142 14942 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_15580 16230 15139 gene locus_tag LOCUS_15590 gene pilT 16230 15139 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_15590 16229 16831 gene locus_tag LOCUS_15600 gene rluA 16229 16831 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSW3 protein_id gnl|my_center|LOCUS_15600 16828 18330 gene locus_tag LOCUS_15610 16828 18330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 20904 18334 gene locus_tag LOCUS_15620 gene ppc 20904 18334 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV3 protein_id gnl|my_center|LOCUS_15620 20942 22735 gene locus_tag LOCUS_15630 20942 22735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 22774 23169 gene locus_tag LOCUS_15640 22774 23169 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810899.1 protein_id gnl|my_center|LOCUS_15640 23148 24323 gene locus_tag LOCUS_15650 gene ywaD 23148 24323 CDS product aminopeptidase YwaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25152 protein_id gnl|my_center|LOCUS_15650 25264 24464 gene locus_tag LOCUS_15660 25264 24464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 25282 25668 gene locus_tag LOCUS_15670 25282 25668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706317.1 protein_id gnl|my_center|LOCUS_15670 26875 25658 gene locus_tag LOCUS_15680 26875 25658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 28299 26875 gene locus_tag LOCUS_15690 28299 26875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 28619 30190 gene locus_tag LOCUS_15700 28619 30190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 30201 31037 gene locus_tag LOCUS_15710 30201 31037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 32800 31043 gene locus_tag LOCUS_15720 gene pilB 32800 31043 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_15720 32956 33693 gene locus_tag LOCUS_15730 32956 33693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 34386 34108 gene locus_tag LOCUS_15740 34386 34108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence033 2515 1004 gene locus_tag LOCUS_15750 gene rpoN 2515 1004 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ1 protein_id gnl|my_center|LOCUS_15750 4244 2589 gene locus_tag LOCUS_15760 gene pyrG 4244 2589 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY3 protein_id gnl|my_center|LOCUS_15760 4891 4241 gene locus_tag LOCUS_15770 gene kdsB 4891 4241 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPI7 protein_id gnl|my_center|LOCUS_15770 5322 4930 gene locus_tag LOCUS_15780 gene rpsI 5322 4930 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY3 protein_id gnl|my_center|LOCUS_15780 5776 5333 gene locus_tag LOCUS_15790 gene rplM 5776 5333 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFT2 protein_id gnl|my_center|LOCUS_15790 7466 5862 gene locus_tag LOCUS_15800 7466 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 7634 7930 gene locus_tag LOCUS_15810 7634 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 8715 7927 gene locus_tag LOCUS_15820 gene truA 8715 7927 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87016 protein_id gnl|my_center|LOCUS_15820 11096 8682 gene locus_tag LOCUS_15830 11096 8682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 12204 11206 gene locus_tag LOCUS_15840 gene asd 12204 11206 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815923.1 protein_id gnl|my_center|LOCUS_15840 12452 12237 gene locus_tag LOCUS_15850 12452 12237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 13082 12474 gene locus_tag LOCUS_15860 13082 12474 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968552.1 protein_id gnl|my_center|LOCUS_15860 14770 13079 gene locus_tag LOCUS_15870 14770 13079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 15571 14771 gene locus_tag LOCUS_15880 gene cdsA 15571 14771 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_15880 16299 15571 gene locus_tag LOCUS_15890 16299 15571 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_15890 16862 16299 gene locus_tag LOCUS_15900 gene frr 16862 16299 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P81101 protein_id gnl|my_center|LOCUS_15900 17612 16887 gene locus_tag LOCUS_15910 gene pyrH 17612 16887 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW2 protein_id gnl|my_center|LOCUS_15910 18260 17613 gene locus_tag LOCUS_15920 gene tsf 18260 17613 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61333 protein_id gnl|my_center|LOCUS_15920 19105 18290 gene locus_tag LOCUS_15930 gene rpsB 19105 18290 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW1 protein_id gnl|my_center|LOCUS_15930 19301 19675 gene locus_tag LOCUS_15940 19301 19675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 22786 19703 gene locus_tag LOCUS_15950 gene secA 22786 19703 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLX5 protein_id gnl|my_center|LOCUS_15950 23800 22826 gene locus_tag LOCUS_15960 23800 22826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 24578 23817 gene locus_tag LOCUS_15970 24578 23817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 26027 24657 gene locus_tag LOCUS_15980 26027 24657 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 protein_id gnl|my_center|LOCUS_15980 27527 26079 gene locus_tag LOCUS_15990 27527 26079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 28291 27524 gene locus_tag LOCUS_16000 gene rsmA 28291 27524 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C12 protein_id gnl|my_center|LOCUS_16000 29256 28288 gene locus_tag LOCUS_16010 gene tsaD 29256 28288 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQW9 protein_id gnl|my_center|LOCUS_16010 32904 29296 gene locus_tag LOCUS_16020 32904 29296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence034 2201 645 gene locus_tag LOCUS_16030 2201 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2638 2189 gene locus_tag LOCUS_16040 2638 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 2831 3406 gene locus_tag LOCUS_16050 gene rpsD 2831 3406 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RSJ7 protein_id gnl|my_center|LOCUS_16050 3417 3608 gene locus_tag LOCUS_16060 gene rpmG 3417 3608 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH99 protein_id gnl|my_center|LOCUS_16060 3676 4128 gene locus_tag LOCUS_16070 gene recX 3676 4128 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPG2 protein_id gnl|my_center|LOCUS_16070 4116 4808 gene locus_tag LOCUS_16080 4116 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 5845 4802 gene locus_tag LOCUS_16090 5845 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 6400 9186 gene locus_tag LOCUS_16100 gene nrdA 6400 9186 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_16100 9353 10399 gene locus_tag LOCUS_16110 9353 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 10409 10897 gene locus_tag LOCUS_16120 10409 10897 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118368.1 protein_id gnl|my_center|LOCUS_16120 10897 11175 gene locus_tag LOCUS_16130 10897 11175 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_16130 11172 11492 gene locus_tag LOCUS_16140 11172 11492 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_16140 11482 12009 gene locus_tag LOCUS_16150 11482 12009 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328224.1 protein_id gnl|my_center|LOCUS_16150 12006 12461 gene locus_tag LOCUS_16160 12006 12461 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_16160 12461 12685 gene locus_tag LOCUS_16170 12461 12685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 12685 13047 gene locus_tag LOCUS_16180 12685 13047 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_16180 13040 14512 gene locus_tag LOCUS_16190 13040 14512 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_16190 14509 15972 gene locus_tag LOCUS_16200 14509 15972 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_16200 15972 16262 gene locus_tag LOCUS_16210 15972 16262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 16262 17989 gene locus_tag LOCUS_16220 16262 17989 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_16220 18765 17980 gene locus_tag LOCUS_16230 18765 17980 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903881.1 protein_id gnl|my_center|LOCUS_16230 19534 18767 gene locus_tag LOCUS_16240 19534 18767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 20334 19642 gene locus_tag LOCUS_16250 20334 19642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 20878 20345 gene locus_tag LOCUS_16260 20878 20345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 21681 20878 gene locus_tag LOCUS_16270 21681 20878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 22672 21815 gene locus_tag LOCUS_16280 22672 21815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 25758 22846 gene locus_tag LOCUS_16290 25758 22846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 26790 25840 gene locus_tag LOCUS_16300 gene etfA 26790 25840 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_16300 27594 26800 gene locus_tag LOCUS_16310 27594 26800 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_16310 28230 27634 gene locus_tag LOCUS_16320 28230 27634 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817154.1 protein_id gnl|my_center|LOCUS_16320 29541 28315 gene locus_tag LOCUS_16330 29541 28315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 30410 29517 gene locus_tag LOCUS_16340 30410 29517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 32035 30407 gene locus_tag LOCUS_16350 32035 30407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 32502 32032 gene locus_tag LOCUS_16360 32502 32032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 33062 32613 gene locus_tag LOCUS_16370 33062 32613 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583242.1 protein_id gnl|my_center|LOCUS_16370 <34043 33272 gene locus_tag LOCUS_16380 <34043 33272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942141.1:acetoacetate metabolism regulatory protein AtoC >Feature sequence035 12 800 gene locus_tag LOCUS_16390 12 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 797 1264 gene locus_tag LOCUS_16400 797 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1261 2724 gene locus_tag LOCUS_16410 1261 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 2765 5380 gene locus_tag LOCUS_16420 2765 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 5384 5620 gene locus_tag LOCUS_16430 5384 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 6168 5605 gene locus_tag LOCUS_16440 6168 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 6318 7253 gene locus_tag LOCUS_16450 6318 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 7275 8537 gene locus_tag LOCUS_16460 7275 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 8534 9802 gene locus_tag LOCUS_16470 gene pgi 8534 9802 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DK5 protein_id gnl|my_center|LOCUS_16470 9898 12066 gene locus_tag LOCUS_16480 gene glnA 9898 12066 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933078.1 protein_id gnl|my_center|LOCUS_16480 12087 13067 gene locus_tag LOCUS_16490 12087 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 13079 14062 gene locus_tag LOCUS_16500 13079 14062 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_16500 14059 14943 gene locus_tag LOCUS_16510 14059 14943 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141423.1 protein_id gnl|my_center|LOCUS_16510 15925 14933 gene locus_tag LOCUS_16520 15925 14933 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_16520 16671 15922 gene locus_tag LOCUS_16530 16671 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974348.1 protein_id gnl|my_center|LOCUS_16530 16837 18336 gene locus_tag LOCUS_16540 16837 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 19134 18343 gene locus_tag LOCUS_16550 19134 18343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 19601 19170 gene locus_tag LOCUS_16560 19601 19170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 19613 20908 gene locus_tag LOCUS_16570 19613 20908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 20918 22777 gene locus_tag LOCUS_16580 20918 22777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 23552 22761 gene locus_tag LOCUS_16590 23552 22761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 24844 23552 gene locus_tag LOCUS_16600 24844 23552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 25185 24844 gene locus_tag LOCUS_16610 25185 24844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 25293 25688 gene locus_tag LOCUS_16620 25293 25688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 29076 25678 gene locus_tag LOCUS_16630 29076 25678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 31700 29073 gene locus_tag LOCUS_16640 31700 29073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 32086 31799 gene locus_tag LOCUS_16650 32086 31799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 <33486 32089 gene locus_tag LOCUS_16660 <33486 32089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747K3:UvrABC system protein B >Feature sequence036 480 2036 gene locus_tag LOCUS_16670 480 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 3612 2044 gene locus_tag LOCUS_16680 3612 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 6151 3656 gene locus_tag LOCUS_16690 6151 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 6897 6148 gene locus_tag LOCUS_16700 6897 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 7913 6891 gene locus_tag LOCUS_16710 gene bioF 7913 6891 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MX1 protein_id gnl|my_center|LOCUS_16710 8907 7891 gene locus_tag LOCUS_16720 gene bioB 8907 7891 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT7 protein_id gnl|my_center|LOCUS_16720 9753 8959 gene locus_tag LOCUS_16730 9753 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 10652 9765 gene locus_tag LOCUS_16740 10652 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 11047 10751 gene locus_tag LOCUS_16750 11047 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 11068 12183 gene locus_tag LOCUS_16760 11068 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 12192 12404 gene locus_tag LOCUS_16770 12192 12404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 12791 12645 gene locus_tag LOCUS_16780 12791 12645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 13414 12881 gene locus_tag LOCUS_16790 13414 12881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 13492 16185 gene locus_tag LOCUS_16800 13492 16185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 16816 16232 gene locus_tag LOCUS_16810 16816 16232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 16960 17241 gene locus_tag LOCUS_16820 16960 17241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 19966 17252 gene locus_tag LOCUS_16830 19966 17252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 20820 19963 gene locus_tag LOCUS_16840 20820 19963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 21680 20817 gene locus_tag LOCUS_16850 21680 20817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 22151 21708 gene locus_tag LOCUS_16860 22151 21708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 22669 22148 gene locus_tag LOCUS_16870 22669 22148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 22789 24111 gene locus_tag LOCUS_16880 22789 24111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 24140 24376 gene locus_tag LOCUS_16890 24140 24376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 24385 25341 gene locus_tag LOCUS_16900 24385 25341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 25522 26358 gene locus_tag LOCUS_16910 gene selD 25522 26358 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:A8MHJ6 protein_id gnl|my_center|LOCUS_16910 27035 26376 gene locus_tag LOCUS_16920 27035 26376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16920 27681 27301 gene locus_tag LOCUS_16930 27681 27301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 28172 27681 gene locus_tag LOCUS_16940 28172 27681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 28258 29154 gene locus_tag LOCUS_16950 28258 29154 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_16950 29347 29225 gene locus_tag LOCUS_16960 29347 29225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 30369 29344 gene locus_tag LOCUS_16970 30369 29344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 30656 30366 gene locus_tag LOCUS_16980 30656 30366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 32568 30757 gene locus_tag LOCUS_16990 32568 30757 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence037 <1 2027 gene locus_tag LOCUS_17000 <1 2027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RFP4:elongation factor G 2778 1993 gene locus_tag LOCUS_17010 2778 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 2802 5039 gene locus_tag LOCUS_17020 2802 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 7238 4977 gene locus_tag LOCUS_17030 7238 4977 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537861.1 protein_id gnl|my_center|LOCUS_17030 8005 7238 gene locus_tag LOCUS_17040 8005 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 10059 8002 gene locus_tag LOCUS_17050 10059 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 10964 10056 gene locus_tag LOCUS_17060 10964 10056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121742.1 protein_id gnl|my_center|LOCUS_17060 11932 10961 gene locus_tag LOCUS_17070 gene moxR 11932 10961 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_17070 13481 11940 gene locus_tag LOCUS_17080 13481 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 16488 13489 gene locus_tag LOCUS_17090 16488 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 18016 16526 gene locus_tag LOCUS_17100 18016 16526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 19362 18013 gene locus_tag LOCUS_17110 19362 18013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 20813 19362 gene locus_tag LOCUS_17120 20813 19362 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942685.1 protein_id gnl|my_center|LOCUS_17120 20882 21511 gene locus_tag LOCUS_17130 20882 21511 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_17130 21916 21530 gene locus_tag LOCUS_17140 21916 21530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 22387 21926 gene locus_tag LOCUS_17150 22387 21926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 22671 22384 gene locus_tag LOCUS_17160 22671 22384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 23162 22743 gene locus_tag LOCUS_17170 23162 22743 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388847.1 protein_id gnl|my_center|LOCUS_17170 23809 23159 gene locus_tag LOCUS_17180 23809 23159 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_17180 23859 24890 gene locus_tag LOCUS_17190 23859 24890 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892860.1 protein_id gnl|my_center|LOCUS_17190 25092 25955 gene locus_tag LOCUS_17200 25092 25955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 27360 25969 gene locus_tag LOCUS_17210 27360 25969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 30190 27374 gene locus_tag LOCUS_17220 gene gcvP1 30190 27374 CDS product glycine dehydrogenase (decarboxylating) 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I137 protein_id gnl|my_center|LOCUS_17220 30575 30192 gene locus_tag LOCUS_17230 gene gcvH 30575 30192 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_17230 31671 30592 gene locus_tag LOCUS_17240 31671 30592 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_17240 32518 31682 gene locus_tag LOCUS_17250 gene folD 32518 31682 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U6 protein_id gnl|my_center|LOCUS_17250 >Feature sequence038 2755 1061 gene locus_tag LOCUS_17260 2755 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 3551 2757 gene locus_tag LOCUS_17270 3551 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 4804 3593 gene locus_tag LOCUS_17280 4804 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 6564 4792 gene locus_tag LOCUS_17290 6564 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 8020 6578 gene locus_tag LOCUS_17300 8020 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 9557 8058 gene locus_tag LOCUS_17310 9557 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 11296 9554 gene locus_tag LOCUS_17320 11296 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 12369 11374 gene locus_tag LOCUS_17330 12369 11374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 14248 12770 gene locus_tag LOCUS_17340 14248 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 16902 14245 gene locus_tag LOCUS_17350 16902 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 18427 16916 gene locus_tag LOCUS_17360 18427 16916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 19776 18433 gene locus_tag LOCUS_17370 19776 18433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 19803 20186 gene locus_tag LOCUS_17380 19803 20186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 20493 20191 gene locus_tag LOCUS_17390 20493 20191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 21547 20486 gene locus_tag LOCUS_17400 gene serC 21547 20486 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HGI0 protein_id gnl|my_center|LOCUS_17400 22752 21547 gene locus_tag LOCUS_17410 22752 21547 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1C1 protein_id gnl|my_center|LOCUS_17410 27364 22775 gene locus_tag LOCUS_17420 27364 22775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 27438 28580 gene locus_tag LOCUS_17430 27438 28580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 30012 28597 gene locus_tag LOCUS_17440 30012 28597 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058287.1 protein_id gnl|my_center|LOCUS_17440 30011 31552 gene locus_tag LOCUS_17450 30011 31552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 31601 32380 gene locus_tag LOCUS_17460 31601 32380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence039 634 1917 gene locus_tag LOCUS_17470 634 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 3855 1924 gene locus_tag LOCUS_17480 gene speA 3855 1924 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY6 protein_id gnl|my_center|LOCUS_17480 4802 3855 gene locus_tag LOCUS_17490 gene dys1 4802 3855 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118343.1 protein_id gnl|my_center|LOCUS_17490 5778 4804 gene locus_tag LOCUS_17500 gene speB 5778 4804 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_17500 5927 6784 gene locus_tag LOCUS_17510 5927 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 6781 8259 gene locus_tag LOCUS_17520 6781 8259 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_17520 8259 8765 gene locus_tag LOCUS_17530 8259 8765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 8768 9259 gene locus_tag LOCUS_17540 8768 9259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 9319 11586 gene locus_tag LOCUS_17550 9319 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 11664 12824 gene locus_tag LOCUS_17560 11664 12824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 13979 12831 gene locus_tag LOCUS_17570 13979 12831 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818337.1 protein_id gnl|my_center|LOCUS_17570 14468 14058 gene locus_tag LOCUS_17580 gene dksA 14468 14058 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG2 protein_id gnl|my_center|LOCUS_17580 15235 14543 gene locus_tag LOCUS_17590 15235 14543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 16332 15232 gene locus_tag LOCUS_17600 16332 15232 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479643.1 protein_id gnl|my_center|LOCUS_17600 16885 16286 gene locus_tag LOCUS_17610 16885 16286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063877.1 protein_id gnl|my_center|LOCUS_17610 17316 16882 gene locus_tag LOCUS_17620 17316 16882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 17439 18788 gene locus_tag LOCUS_17630 17439 18788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 18836 20743 gene locus_tag LOCUS_17640 18836 20743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 20740 22554 gene locus_tag LOCUS_17650 20740 22554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_17650 22567 24069 gene locus_tag LOCUS_17660 22567 24069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 24152 26335 gene locus_tag LOCUS_17670 24152 26335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 26385 28646 gene locus_tag LOCUS_17680 26385 28646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 28643 29665 gene locus_tag LOCUS_17690 28643 29665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 29675 31990 gene locus_tag LOCUS_17700 29675 31990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence040 1065 2999 gene locus_tag LOCUS_17710 1065 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 3090 3015 gene locus_tag LOCUS_t00070 3090 3015 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3168 3095 gene locus_tag LOCUS_t00080 3168 3095 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4429 3206 gene locus_tag LOCUS_17720 gene purA 4429 3206 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q725K9 protein_id gnl|my_center|LOCUS_17720 5509 4466 gene locus_tag LOCUS_17730 5509 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 6463 5513 gene locus_tag LOCUS_17740 gene xerC 6463 5513 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P550 protein_id gnl|my_center|LOCUS_17740 6477 9188 gene locus_tag LOCUS_17750 gene topA 6477 9188 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJV1 protein_id gnl|my_center|LOCUS_17750 9491 9189 gene locus_tag LOCUS_17760 9491 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 10431 9469 gene locus_tag LOCUS_17770 10431 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 11553 10492 gene locus_tag LOCUS_17780 11553 10492 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943187.1 protein_id gnl|my_center|LOCUS_17780 12300 11620 gene locus_tag LOCUS_17790 12300 11620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 12643 12341 gene locus_tag LOCUS_17800 12643 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_17800 15405 12652 gene locus_tag LOCUS_17810 15405 12652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 16073 15537 gene locus_tag LOCUS_17820 16073 15537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 17404 16097 gene locus_tag LOCUS_17830 gene nusA 17404 16097 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT5 protein_id gnl|my_center|LOCUS_17830 17921 17394 gene locus_tag LOCUS_17840 gene rimP 17921 17394 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJM9 protein_id gnl|my_center|LOCUS_17840 18849 18016 gene locus_tag LOCUS_17850 18849 18016 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932324.1 protein_id gnl|my_center|LOCUS_17850 19598 18846 gene locus_tag LOCUS_17860 19598 18846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 19691 20815 gene locus_tag LOCUS_17870 19691 20815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_17870 21063 20839 gene locus_tag LOCUS_17880 21063 20839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 23138 21603 gene locus_tag LOCUS_17890 23138 21603 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_17890 24257 23187 gene locus_tag LOCUS_17900 24257 23187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 24565 25530 gene locus_tag LOCUS_17910 24565 25530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 26722 25586 gene locus_tag LOCUS_17920 26722 25586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 28024 26903 gene locus_tag LOCUS_17930 28024 26903 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_17930 28827 28075 gene locus_tag LOCUS_17940 28827 28075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 29850 28936 gene locus_tag LOCUS_17950 gene ddl 29850 28936 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D8 protein_id gnl|my_center|LOCUS_17950 30689 29847 gene locus_tag LOCUS_17960 gene murB 30689 29847 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61435 protein_id gnl|my_center|LOCUS_17960 32049 30682 gene locus_tag LOCUS_17970 gene murC 32049 30682 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61679 protein_id gnl|my_center|LOCUS_17970 >Feature sequence041 1786 596 gene locus_tag LOCUS_17980 gene rocD 1786 596 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HM32 protein_id gnl|my_center|LOCUS_17980 1822 3336 gene locus_tag LOCUS_17990 1822 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 3333 4232 gene locus_tag LOCUS_18000 3333 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 5306 4242 gene locus_tag LOCUS_18010 5306 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 5407 7044 gene locus_tag LOCUS_18020 5407 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 8174 7050 gene locus_tag LOCUS_18030 8174 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_18030 8294 11410 gene locus_tag LOCUS_18040 8294 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 11453 12499 gene locus_tag LOCUS_18050 11453 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 13592 12666 gene locus_tag LOCUS_18060 13592 12666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 13608 14315 gene locus_tag LOCUS_18070 13608 14315 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_18070 14329 14667 gene locus_tag LOCUS_18080 14329 14667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 14816 15562 gene locus_tag LOCUS_18090 14816 15562 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066948.1 protein_id gnl|my_center|LOCUS_18090 16223 15663 gene locus_tag LOCUS_18100 16223 15663 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_18100 16257 18401 gene locus_tag LOCUS_18110 16257 18401 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_18110 18425 22036 gene locus_tag LOCUS_18120 18425 22036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 22117 23625 gene locus_tag LOCUS_18130 22117 23625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 25390 23636 gene locus_tag LOCUS_18140 25390 23636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 26160 25393 gene locus_tag LOCUS_18150 26160 25393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057314.1 protein_id gnl|my_center|LOCUS_18150 27062 26157 gene locus_tag LOCUS_18160 27062 26157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_18160 27140 31288 gene locus_tag LOCUS_18170 27140 31288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence042 303 1211 gene locus_tag LOCUS_18180 303 1211 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230079.1 protein_id gnl|my_center|LOCUS_18180 1220 1600 gene locus_tag LOCUS_18190 gene ptpS 1220 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 protein_id gnl|my_center|LOCUS_18190 1597 2421 gene locus_tag LOCUS_18200 1597 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390629.1 protein_id gnl|my_center|LOCUS_18200 2414 3949 gene locus_tag LOCUS_18210 2414 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18210 4788 3916 gene locus_tag LOCUS_18220 4788 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 5947 4793 gene locus_tag LOCUS_18230 5947 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 7970 5976 gene locus_tag LOCUS_18240 7970 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 8181 9215 gene locus_tag LOCUS_18250 8181 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 9294 10142 gene locus_tag LOCUS_18260 9294 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 10272 11108 gene locus_tag LOCUS_18270 10272 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 11105 11809 gene locus_tag LOCUS_18280 11105 11809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 14280 11818 gene locus_tag LOCUS_18290 14280 11818 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763369.1 protein_id gnl|my_center|LOCUS_18290 14300 14653 gene locus_tag LOCUS_18300 14300 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 14739 15458 gene locus_tag LOCUS_18310 14739 15458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 15455 16660 gene locus_tag LOCUS_18320 15455 16660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 16641 17333 gene locus_tag LOCUS_18330 16641 17333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523242.1 protein_id gnl|my_center|LOCUS_18330 17333 18526 gene locus_tag LOCUS_18340 17333 18526 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481724.1 protein_id gnl|my_center|LOCUS_18340 18527 19741 gene locus_tag LOCUS_18350 18527 19741 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066363.1 protein_id gnl|my_center|LOCUS_18350 19756 20484 gene locus_tag LOCUS_18360 19756 20484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 20511 20972 gene locus_tag LOCUS_18370 20511 20972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 20985 21833 gene locus_tag LOCUS_18380 20985 21833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 21830 22780 gene locus_tag LOCUS_18390 21830 22780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 22777 23487 gene locus_tag LOCUS_18400 22777 23487 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074690.1 protein_id gnl|my_center|LOCUS_18400 23424 24905 gene locus_tag LOCUS_18410 23424 24905 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018377.1 protein_id gnl|my_center|LOCUS_18410 24915 25325 gene locus_tag LOCUS_18420 24915 25325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 25394 26098 gene locus_tag LOCUS_18430 25394 26098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 26792 26064 gene locus_tag LOCUS_18440 26792 26064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 27642 26773 gene locus_tag LOCUS_18450 27642 26773 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_18450 28076 27639 gene locus_tag LOCUS_18460 28076 27639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 28979 28113 gene locus_tag LOCUS_18470 28979 28113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_18470 29820 28969 gene locus_tag LOCUS_18480 29820 28969 CDS product FAD-binding molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530704.1 protein_id gnl|my_center|LOCUS_18480 <31289 29820 gene locus_tag LOCUS_18490 <31289 29820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969633.1:dehydrogenase >Feature sequence043 1733 3391 gene locus_tag LOCUS_18500 gene cshA 1733 3391 CDS product DEAD-box ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHF7 protein_id gnl|my_center|LOCUS_18500 3474 3911 gene locus_tag LOCUS_18510 3474 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 3911 5722 gene locus_tag LOCUS_18520 3911 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 7134 5752 gene locus_tag LOCUS_18530 7134 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 7738 7154 gene locus_tag LOCUS_18540 7738 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 8123 7773 gene locus_tag LOCUS_18550 8123 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 9398 8127 gene locus_tag LOCUS_18560 9398 8127 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120681.1 protein_id gnl|my_center|LOCUS_18560 11032 9410 gene locus_tag LOCUS_18570 11032 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 12021 11029 gene locus_tag LOCUS_18580 12021 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 12656 12018 gene locus_tag LOCUS_18590 12656 12018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 12699 14762 gene locus_tag LOCUS_18600 12699 14762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 14762 16156 gene locus_tag LOCUS_18610 14762 16156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 16348 16166 gene locus_tag LOCUS_18620 16348 16166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 17670 16348 gene locus_tag LOCUS_18630 17670 16348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 17822 18856 gene locus_tag LOCUS_18640 17822 18856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 18856 19371 gene locus_tag LOCUS_18650 18856 19371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 19569 20954 gene locus_tag LOCUS_18660 19569 20954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 20972 21823 gene locus_tag LOCUS_18670 20972 21823 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409654.1 protein_id gnl|my_center|LOCUS_18670 21833 23275 gene locus_tag LOCUS_18680 21833 23275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 23934 23338 gene locus_tag LOCUS_18690 23934 23338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 23966 25225 gene locus_tag LOCUS_18700 23966 25225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 25984 25142 gene locus_tag LOCUS_18710 25984 25142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 27261 25981 gene locus_tag LOCUS_18720 27261 25981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 28196 27258 gene locus_tag LOCUS_18730 28196 27258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 28258 28698 gene locus_tag LOCUS_18740 28258 28698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 29914 28703 gene locus_tag LOCUS_18750 29914 28703 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence044 1097 366 gene locus_tag LOCUS_18760 1097 366 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_18760 1115 2674 gene locus_tag LOCUS_18770 1115 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05979 protein_id gnl|my_center|LOCUS_18770 3349 2696 gene locus_tag LOCUS_18780 3349 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 3417 3788 gene locus_tag LOCUS_18790 3417 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 3788 4183 gene locus_tag LOCUS_18800 3788 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 4240 5181 gene locus_tag LOCUS_18810 4240 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 5190 5906 gene locus_tag LOCUS_18820 5190 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 6514 5894 gene locus_tag LOCUS_18830 6514 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 7024 6524 gene locus_tag LOCUS_18840 7024 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933623.1 protein_id gnl|my_center|LOCUS_18840 7487 7035 gene locus_tag LOCUS_18850 7487 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 7955 7497 gene locus_tag LOCUS_18860 7955 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 8147 8359 gene locus_tag LOCUS_18870 8147 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 8416 8895 gene locus_tag LOCUS_18880 gene bfr 8416 8895 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2S8 protein_id gnl|my_center|LOCUS_18880 8930 9622 gene locus_tag LOCUS_18890 8930 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 9632 10498 gene locus_tag LOCUS_18900 gene dhmA2 9632 10498 CDS product haloalkane dehalogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMS1 protein_id gnl|my_center|LOCUS_18900 11912 10473 gene locus_tag LOCUS_18910 11912 10473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 11933 12934 gene locus_tag LOCUS_18920 11933 12934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 13006 13986 gene locus_tag LOCUS_18930 13006 13986 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902838.1 protein_id gnl|my_center|LOCUS_18930 15121 14159 gene locus_tag LOCUS_18940 15121 14159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 15190 16374 gene locus_tag LOCUS_18950 15190 16374 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812553.1 protein_id gnl|my_center|LOCUS_18950 16386 17003 gene locus_tag LOCUS_18960 16386 17003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 17025 19331 gene locus_tag LOCUS_18970 17025 19331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 19328 20251 gene locus_tag LOCUS_18980 19328 20251 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141439.1 protein_id gnl|my_center|LOCUS_18980 20356 23232 gene locus_tag LOCUS_18990 20356 23232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 24195 23452 gene locus_tag LOCUS_19000 24195 23452 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202330.1 protein_id gnl|my_center|LOCUS_19000 25710 24208 gene locus_tag LOCUS_19010 25710 24208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 28514 25710 gene locus_tag LOCUS_19020 28514 25710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 30078 28573 gene locus_tag LOCUS_19030 gene hutH 30078 28573 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCB3 protein_id gnl|my_center|LOCUS_19030 30510 30100 gene locus_tag LOCUS_19040 30510 30100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence045 885 10 gene locus_tag LOCUS_19050 885 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1466 882 gene locus_tag LOCUS_19060 1466 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 3765 1477 gene locus_tag LOCUS_19070 3765 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 4263 3829 gene locus_tag LOCUS_19080 4263 3829 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102967.1 protein_id gnl|my_center|LOCUS_19080 5366 4374 gene locus_tag LOCUS_19090 5366 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 5739 7340 gene locus_tag LOCUS_19100 5739 7340 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530640.1 protein_id gnl|my_center|LOCUS_19100 7812 7348 gene locus_tag LOCUS_19110 7812 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 7811 10801 gene locus_tag LOCUS_19120 7811 10801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 10842 11189 gene locus_tag LOCUS_19130 10842 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 12026 11193 gene locus_tag LOCUS_19140 12026 11193 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLZ4 protein_id gnl|my_center|LOCUS_19140 12085 14199 gene locus_tag LOCUS_19150 12085 14199 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119290.1 protein_id gnl|my_center|LOCUS_19150 14350 15072 gene locus_tag LOCUS_19160 14350 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 15142 16026 gene locus_tag LOCUS_19170 15142 16026 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_19170 16516 16010 gene locus_tag LOCUS_19180 16516 16010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 18389 16569 gene locus_tag LOCUS_19190 18389 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 18440 19129 gene locus_tag LOCUS_19200 18440 19129 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014388.1 protein_id gnl|my_center|LOCUS_19200 19631 19107 gene locus_tag LOCUS_19210 19631 19107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 19659 19949 gene locus_tag LOCUS_19220 19659 19949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 21446 20079 gene locus_tag LOCUS_19230 gene cls-2 21446 20079 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_19230 22491 21610 gene locus_tag LOCUS_19240 22491 21610 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929840.1 protein_id gnl|my_center|LOCUS_19240 22579 23397 gene locus_tag LOCUS_19250 22579 23397 CDS product retinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402797.1 protein_id gnl|my_center|LOCUS_19250 24282 23407 gene locus_tag LOCUS_19260 24282 23407 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086768.1 protein_id gnl|my_center|LOCUS_19260 24345 24803 gene locus_tag LOCUS_19270 24345 24803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 25771 24800 gene locus_tag LOCUS_19280 25771 24800 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_19280 25822 26349 gene locus_tag LOCUS_19290 25822 26349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 26406 26705 gene locus_tag LOCUS_19300 26406 26705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 26820 27728 gene locus_tag LOCUS_19310 26820 27728 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706153.1 protein_id gnl|my_center|LOCUS_19310 27857 28735 gene locus_tag LOCUS_19320 27857 28735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 29628 28849 gene locus_tag LOCUS_19330 29628 28849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 29689 30261 gene locus_tag LOCUS_19340 29689 30261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence046 780 322 gene locus_tag LOCUS_19350 780 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 937 1542 gene locus_tag LOCUS_19360 937 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 1560 7184 gene locus_tag LOCUS_19370 gene uvrA 1560 7184 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV4 protein_id gnl|my_center|LOCUS_19370 7181 8284 gene locus_tag LOCUS_19380 7181 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 9653 8262 gene locus_tag LOCUS_19390 9653 8262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 11365 9644 gene locus_tag LOCUS_19400 11365 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 11937 11362 gene locus_tag LOCUS_19410 11937 11362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 12462 12013 gene locus_tag LOCUS_19420 12462 12013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 12545 13567 gene locus_tag LOCUS_19430 12545 13567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 14741 13569 gene locus_tag LOCUS_19440 14741 13569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 14740 15147 gene locus_tag LOCUS_19450 14740 15147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 17828 15114 gene locus_tag LOCUS_19460 17828 15114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 18439 17828 gene locus_tag LOCUS_19470 18439 17828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 19974 18451 gene locus_tag LOCUS_19480 19974 18451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 20833 19961 gene locus_tag LOCUS_19490 20833 19961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 22590 20836 gene locus_tag LOCUS_19500 22590 20836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 23875 22658 gene locus_tag LOCUS_19510 23875 22658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 24439 23882 gene locus_tag LOCUS_19520 24439 23882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 24588 24418 gene locus_tag LOCUS_19530 24588 24418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 25858 24596 gene locus_tag LOCUS_19540 25858 24596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 26872 25874 gene locus_tag LOCUS_19550 26872 25874 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHD2 protein_id gnl|my_center|LOCUS_19550 28098 26872 gene locus_tag LOCUS_19560 gene nqrF 28098 26872 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6X5 protein_id gnl|my_center|LOCUS_19560 28725 28108 gene locus_tag LOCUS_19570 gene nqrE 28725 28108 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_19570 29372 28728 gene locus_tag LOCUS_19580 gene nqrD 29372 28728 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA9 protein_id gnl|my_center|LOCUS_19580 30151 29369 gene locus_tag LOCUS_19590 gene nqrC 30151 29369 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA8 protein_id gnl|my_center|LOCUS_19590 <30875 30141 gene locus_tag LOCUS_19600 <30875 30141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KHC7:Na(+)-translocating NADH-quinone reductase subunit B >Feature sequence047 318 79 gene locus_tag LOCUS_19610 318 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 414 1532 gene locus_tag LOCUS_19620 414 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 3146 1878 gene locus_tag LOCUS_19630 3146 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 4405 3143 gene locus_tag LOCUS_19640 4405 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 5454 4927 gene locus_tag LOCUS_19650 5454 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 5968 5483 gene locus_tag LOCUS_19660 5968 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 6725 6009 gene locus_tag LOCUS_19670 6725 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 8056 6716 gene locus_tag LOCUS_19680 8056 6716 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_19680 8101 10911 gene locus_tag LOCUS_19690 gene sucA 8101 10911 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367672.1 protein_id gnl|my_center|LOCUS_19690 10908 12065 gene locus_tag LOCUS_19700 gene sucB 10908 12065 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ87 protein_id gnl|my_center|LOCUS_19700 13152 12211 gene locus_tag LOCUS_19710 13152 12211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 14422 13211 gene locus_tag LOCUS_19720 14422 13211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 14822 18058 gene locus_tag LOCUS_19730 14822 18058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 18058 18318 gene locus_tag LOCUS_19740 18058 18318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 18315 19166 gene locus_tag LOCUS_19750 18315 19166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 19342 19151 gene locus_tag LOCUS_19760 19342 19151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 19465 20196 gene locus_tag LOCUS_19770 19465 20196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 20206 21462 gene locus_tag LOCUS_19780 20206 21462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 21459 22214 gene locus_tag LOCUS_19790 21459 22214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 22382 23221 gene locus_tag LOCUS_19800 22382 23221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 23237 23428 gene locus_tag LOCUS_19810 23237 23428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 23465 24151 gene locus_tag LOCUS_19820 23465 24151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 24169 25290 gene locus_tag LOCUS_19830 24169 25290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 25947 25300 gene locus_tag LOCUS_19840 25947 25300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 26797 25952 gene locus_tag LOCUS_19850 26797 25952 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_19850 26815 28248 gene locus_tag LOCUS_19860 26815 28248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 28249 28614 gene locus_tag LOCUS_19870 28249 28614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 28668 29189 gene locus_tag LOCUS_19880 28668 29189 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 protein_id gnl|my_center|LOCUS_19880 29186 29548 gene locus_tag LOCUS_19890 29186 29548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 30340 29552 gene locus_tag LOCUS_19900 30340 29552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence048 1849 503 gene locus_tag LOCUS_19910 1849 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1885 2139 gene locus_tag LOCUS_19920 1885 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2147 4366 gene locus_tag LOCUS_19930 2147 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 4407 5312 gene locus_tag LOCUS_19940 4407 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 5312 6988 gene locus_tag LOCUS_19950 5312 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 6985 7512 gene locus_tag LOCUS_19960 6985 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 7834 7535 gene locus_tag LOCUS_19970 7834 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 9307 7853 gene locus_tag LOCUS_19980 9307 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 10633 9437 gene locus_tag LOCUS_19990 10633 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 10751 11164 gene locus_tag LOCUS_20000 gene dksA 10751 11164 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG2 protein_id gnl|my_center|LOCUS_20000 11966 11169 gene locus_tag LOCUS_20010 11966 11169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 12033 12575 gene locus_tag LOCUS_20020 12033 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 12632 14536 gene locus_tag LOCUS_20030 12632 14536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 14533 15624 gene locus_tag LOCUS_20040 gene pilT-3 14533 15624 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_20040 15695 17104 gene locus_tag LOCUS_20050 15695 17104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 17101 17376 gene locus_tag LOCUS_20060 17101 17376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 18887 17373 gene locus_tag LOCUS_20070 18887 17373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 18951 20399 gene locus_tag LOCUS_20080 18951 20399 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_20080 20409 22088 gene locus_tag LOCUS_20090 20409 22088 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114865.1 protein_id gnl|my_center|LOCUS_20090 23109 22078 gene locus_tag LOCUS_20100 23109 22078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 24415 23201 gene locus_tag LOCUS_20110 24415 23201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 24344 25186 gene locus_tag LOCUS_20120 24344 25186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 27173 25188 gene locus_tag LOCUS_20130 27173 25188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 28611 27205 gene locus_tag LOCUS_20140 28611 27205 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_20140 29418 28660 gene locus_tag LOCUS_20150 29418 28660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 30293 29472 gene locus_tag LOCUS_20160 30293 29472 CDS product adenine nucleotide alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence049 2707 572 gene locus_tag LOCUS_20170 2707 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 4318 3422 gene locus_tag LOCUS_20180 4318 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 4909 4334 gene locus_tag LOCUS_20190 4909 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 4985 5299 gene locus_tag LOCUS_20200 4985 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 6761 5310 gene locus_tag LOCUS_20210 6761 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 7081 6764 gene locus_tag LOCUS_20220 7081 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 8115 7078 gene locus_tag LOCUS_20230 8115 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 8360 9244 gene locus_tag LOCUS_20240 8360 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 9898 9263 gene locus_tag LOCUS_20250 9898 9263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 9929 10201 gene locus_tag LOCUS_20260 9929 10201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 10198 10575 gene locus_tag LOCUS_20270 10198 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 10575 11078 gene locus_tag LOCUS_20280 10575 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 11080 12111 gene locus_tag LOCUS_20290 11080 12111 CDS product GeoRSP system radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943534.1 protein_id gnl|my_center|LOCUS_20290 12144 14972 gene locus_tag LOCUS_20300 12144 14972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 16118 15048 gene locus_tag LOCUS_20310 16118 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 16585 16115 gene locus_tag LOCUS_20320 16585 16115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 16982 16626 gene locus_tag LOCUS_20330 16982 16626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 17374 16982 gene locus_tag LOCUS_20340 17374 16982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 17415 17771 gene locus_tag LOCUS_20350 17415 17771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 18960 17752 gene locus_tag LOCUS_20360 18960 17752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 19472 19002 gene locus_tag LOCUS_20370 19472 19002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 21027 19459 gene locus_tag LOCUS_20380 21027 19459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 21197 21532 gene locus_tag LOCUS_20390 21197 21532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 21523 22317 gene locus_tag LOCUS_20400 21523 22317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 23216 22290 gene locus_tag LOCUS_20410 23216 22290 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258990.1 protein_id gnl|my_center|LOCUS_20410 23719 23273 gene locus_tag LOCUS_20420 23719 23273 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_20420 23718 25823 gene locus_tag LOCUS_20430 23718 25823 CDS product copper-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_20430 27538 25820 gene locus_tag LOCUS_20440 27538 25820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 28338 27535 gene locus_tag LOCUS_20450 28338 27535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 28369 29526 gene locus_tag LOCUS_20460 28369 29526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence050 2600 4231 gene locus_tag LOCUS_20470 2600 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 protein_id gnl|my_center|LOCUS_20470 4730 6352 gene locus_tag LOCUS_20480 4730 6352 CDS product reverse transcriptase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_20480 9147 6376 gene locus_tag LOCUS_20490 9147 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 10291 9161 gene locus_tag LOCUS_20500 10291 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 11982 10279 gene locus_tag LOCUS_20510 11982 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 12021 13307 gene locus_tag LOCUS_20520 gene apeB 12021 13307 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ3 protein_id gnl|my_center|LOCUS_20520 14249 13311 gene locus_tag LOCUS_20530 14249 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 15205 14390 gene locus_tag LOCUS_20540 15205 14390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 18417 15232 gene locus_tag LOCUS_20550 18417 15232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 18441 19136 gene locus_tag LOCUS_20560 18441 19136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 20467 19124 gene locus_tag LOCUS_20570 20467 19124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 20745 20461 gene locus_tag LOCUS_20580 20745 20461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 20659 22161 gene locus_tag LOCUS_20590 20659 22161 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412946.1 protein_id gnl|my_center|LOCUS_20590 22615 22163 gene locus_tag LOCUS_20600 22615 22163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 22866 22612 gene locus_tag LOCUS_20610 22866 22612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 23870 22935 gene locus_tag LOCUS_20620 23870 22935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 25795 23870 gene locus_tag LOCUS_20630 25795 23870 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_20630 26305 25808 gene locus_tag LOCUS_20640 26305 25808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 26846 26415 gene locus_tag LOCUS_20650 26846 26415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 26882 27211 gene locus_tag LOCUS_20660 26882 27211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 27256 28011 gene locus_tag LOCUS_20670 27256 28011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 28027 28500 gene locus_tag LOCUS_20680 28027 28500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 <30089 28461 gene locus_tag LOCUS_20690 <30089 28461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969251.1:ATP-dependent Clp protease ATP-binding subunit ClpA >Feature sequence051 98 1117 gene locus_tag LOCUS_20700 98 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 1114 2178 gene locus_tag LOCUS_20710 1114 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2897 2172 gene locus_tag LOCUS_20720 2897 2172 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705617.1 protein_id gnl|my_center|LOCUS_20720 2970 3950 gene locus_tag LOCUS_20730 2970 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_20730 3969 4997 gene locus_tag LOCUS_20740 3969 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528797.1 protein_id gnl|my_center|LOCUS_20740 4997 5908 gene locus_tag LOCUS_20750 4997 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027021.1 protein_id gnl|my_center|LOCUS_20750 6615 5926 gene locus_tag LOCUS_20760 6615 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 7016 6642 gene locus_tag LOCUS_20770 7016 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 7292 7047 gene locus_tag LOCUS_20780 7292 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 9178 7292 gene locus_tag LOCUS_20790 9178 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 9774 9178 gene locus_tag LOCUS_20800 9774 9178 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087753.1 protein_id gnl|my_center|LOCUS_20800 9864 10514 gene locus_tag LOCUS_20810 9864 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141416.1 protein_id gnl|my_center|LOCUS_20810 13278 10546 gene locus_tag LOCUS_20820 13278 10546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 13279 15378 gene locus_tag LOCUS_20830 13279 15378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 16401 15454 gene locus_tag LOCUS_20840 16401 15454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 16780 16436 gene locus_tag LOCUS_20850 16780 16436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 17826 16804 gene locus_tag LOCUS_20860 gene pheS 17826 16804 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG3 protein_id gnl|my_center|LOCUS_20860 18881 17823 gene locus_tag LOCUS_20870 gene dsbG 18881 17823 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_20870 22347 18907 gene locus_tag LOCUS_20880 22347 18907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 22246 22737 gene locus_tag LOCUS_20890 22246 22737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 23932 22706 gene locus_tag LOCUS_20900 23932 22706 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_20900 24044 25978 gene locus_tag LOCUS_20910 24044 25978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 27814 26174 gene locus_tag LOCUS_20920 27814 26174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 27786 28661 gene locus_tag LOCUS_20930 27786 28661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence052 1776 511 gene locus_tag LOCUS_20940 1776 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2129 1767 gene locus_tag LOCUS_20950 2129 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2501 2130 gene locus_tag LOCUS_20960 2501 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2908 2501 gene locus_tag LOCUS_20970 2908 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 2889 4739 gene locus_tag LOCUS_20980 2889 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 4787 5566 gene locus_tag LOCUS_20990 4787 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 5566 6738 gene locus_tag LOCUS_21000 5566 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 6754 7461 gene locus_tag LOCUS_21010 6754 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 8979 7591 gene locus_tag LOCUS_21020 8979 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 10189 9035 gene locus_tag LOCUS_21030 10189 9035 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_21030 10284 10757 gene locus_tag LOCUS_21040 10284 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 11491 10814 gene locus_tag LOCUS_21050 11491 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 12490 11741 gene locus_tag LOCUS_21060 12490 11741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 15123 12484 gene locus_tag LOCUS_21070 15123 12484 CDS product B12-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_21070 15096 16052 gene locus_tag LOCUS_21080 15096 16052 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405402.1 protein_id gnl|my_center|LOCUS_21080 16049 16651 gene locus_tag LOCUS_21090 16049 16651 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_21090 16648 18642 gene locus_tag LOCUS_21100 16648 18642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 19720 18632 gene locus_tag LOCUS_21110 19720 18632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 19719 20942 gene locus_tag LOCUS_21120 19719 20942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 22767 20947 gene locus_tag LOCUS_21130 gene glmS 22767 20947 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG38 protein_id gnl|my_center|LOCUS_21130 24413 22776 gene locus_tag LOCUS_21140 24413 22776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 24997 24410 gene locus_tag LOCUS_21150 24997 24410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 24997 25893 gene locus_tag LOCUS_21160 24997 25893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 25890 26354 gene locus_tag LOCUS_21170 gene coaD 25890 26354 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYP6 protein_id gnl|my_center|LOCUS_21170 27483 26371 gene locus_tag LOCUS_21180 27483 26371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 28822 27476 gene locus_tag LOCUS_21190 28822 27476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 <29580 28964 gene locus_tag LOCUS_21200 <29580 28964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227863.1:peptidase >Feature sequence053 44 802 gene locus_tag LOCUS_21210 gene hisF 44 802 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW2 protein_id gnl|my_center|LOCUS_21210 834 1685 gene locus_tag LOCUS_21220 834 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058043.1 protein_id gnl|my_center|LOCUS_21220 1725 3389 gene locus_tag LOCUS_21230 1725 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 3689 3435 gene locus_tag LOCUS_21240 3689 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 4825 3791 gene locus_tag LOCUS_21250 4825 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 4860 7790 gene locus_tag LOCUS_21260 4860 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 8775 7816 gene locus_tag LOCUS_21270 gene trxB 8775 7816 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ75 protein_id gnl|my_center|LOCUS_21270 9148 8867 gene locus_tag LOCUS_21280 9148 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 9050 9925 gene locus_tag LOCUS_21290 gene queG 9050 9925 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UFC0 protein_id gnl|my_center|LOCUS_21290 9918 10256 gene locus_tag LOCUS_21300 9918 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 10253 11962 gene locus_tag LOCUS_21310 10253 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 12604 11963 gene locus_tag LOCUS_21320 12604 11963 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_21320 13365 12622 gene locus_tag LOCUS_21330 13365 12622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 15022 13373 gene locus_tag LOCUS_21340 gene ggtA 15022 13373 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_21340 16004 15033 gene locus_tag LOCUS_21350 16004 15033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 16646 16005 gene locus_tag LOCUS_21360 16646 16005 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_21360 17014 16643 gene locus_tag LOCUS_21370 17014 16643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 18006 17011 gene locus_tag LOCUS_21380 18006 17011 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123698.1 protein_id gnl|my_center|LOCUS_21380 18064 19095 gene locus_tag LOCUS_21390 18064 19095 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_21390 19092 19811 gene locus_tag LOCUS_21400 19092 19811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 19811 20284 gene locus_tag LOCUS_21410 19811 20284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 20314 21696 gene locus_tag LOCUS_21420 20314 21696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 23651 21693 gene locus_tag LOCUS_21430 23651 21693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 23737 25140 gene locus_tag LOCUS_21440 23737 25140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 25124 26179 gene locus_tag LOCUS_21450 25124 26179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 26424 26176 gene locus_tag LOCUS_21460 26424 26176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 27350 26496 gene locus_tag LOCUS_21470 27350 26496 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_21470 27485 27409 gene locus_tag LOCUS_t00090 27485 27409 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 28047 27499 gene locus_tag LOCUS_21480 28047 27499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939730.1 protein_id gnl|my_center|LOCUS_21480 28654 28049 gene locus_tag LOCUS_21490 28654 28049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 29007 28657 gene locus_tag LOCUS_21500 29007 28657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence054 <1 884 gene locus_tag LOCUS_21510 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240285.1:adenosylhomocysteinase 881 1537 gene locus_tag LOCUS_21520 881 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 1546 2019 gene locus_tag LOCUS_21530 gene sixA 1546 2019 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918414.1 protein_id gnl|my_center|LOCUS_21530 2012 2818 gene locus_tag LOCUS_21540 2012 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 2818 3615 gene locus_tag LOCUS_21550 2818 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 3615 5831 gene locus_tag LOCUS_21560 3615 5831 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 protein_id gnl|my_center|LOCUS_21560 5828 6844 gene locus_tag LOCUS_21570 5828 6844 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338853.1 protein_id gnl|my_center|LOCUS_21570 6829 7326 gene locus_tag LOCUS_21580 6829 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 7323 7661 gene locus_tag LOCUS_21590 7323 7661 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140931.1 protein_id gnl|my_center|LOCUS_21590 7672 8016 gene locus_tag LOCUS_21600 7672 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 8495 8013 gene locus_tag LOCUS_21610 8495 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 9514 8495 gene locus_tag LOCUS_21620 9514 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 10175 9576 gene locus_tag LOCUS_21630 gene algU 10175 9576 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_21630 12762 10186 gene locus_tag LOCUS_21640 gene polA 12762 10186 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FR5 protein_id gnl|my_center|LOCUS_21640 13415 12780 gene locus_tag LOCUS_21650 13415 12780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 13450 14589 gene locus_tag LOCUS_21660 gene ivd 13450 14589 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202093.1 protein_id gnl|my_center|LOCUS_21660 15253 14567 gene locus_tag LOCUS_21670 15253 14567 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258454.1 protein_id gnl|my_center|LOCUS_21670 15225 15527 gene locus_tag LOCUS_21680 15225 15527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 16399 15539 gene locus_tag LOCUS_21690 gene hemC 16399 15539 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AV0 protein_id gnl|my_center|LOCUS_21690 17670 16396 gene locus_tag LOCUS_21700 gene hemA 17670 16396 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJZ3 protein_id gnl|my_center|LOCUS_21700 18470 17670 gene locus_tag LOCUS_21710 18470 17670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 19844 18474 gene locus_tag LOCUS_21720 19844 18474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 20019 20345 gene locus_tag LOCUS_21730 gene trxA 20019 20345 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D3 protein_id gnl|my_center|LOCUS_21730 21290 20373 gene locus_tag LOCUS_21740 21290 20373 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_21740 21383 22438 gene locus_tag LOCUS_21750 gene mreB-1 21383 22438 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_21750 22455 23927 gene locus_tag LOCUS_21760 22455 23927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 23946 28331 gene locus_tag LOCUS_21770 23946 28331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence055 3042 259 gene locus_tag LOCUS_21780 3042 259 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_21780 4730 3042 gene locus_tag LOCUS_21790 4730 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 5564 4731 gene locus_tag LOCUS_21800 5564 4731 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066417.1 protein_id gnl|my_center|LOCUS_21800 7096 5564 gene locus_tag LOCUS_21810 7096 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 8028 7093 gene locus_tag LOCUS_21820 8028 7093 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331193.1 protein_id gnl|my_center|LOCUS_21820 9692 8025 gene locus_tag LOCUS_21830 9692 8025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 10714 9689 gene locus_tag LOCUS_21840 10714 9689 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_21840 12053 10707 gene locus_tag LOCUS_21850 12053 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 12808 12149 gene locus_tag LOCUS_21860 12808 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 13715 12834 gene locus_tag LOCUS_21870 13715 12834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 14647 13805 gene locus_tag LOCUS_21880 14647 13805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 16041 14662 gene locus_tag LOCUS_21890 16041 14662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 16637 16038 gene locus_tag LOCUS_21900 16637 16038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 18108 16720 gene locus_tag LOCUS_21910 18108 16720 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_21910 19103 18108 gene locus_tag LOCUS_21920 19103 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 19154 19549 gene locus_tag LOCUS_21930 19154 19549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 19546 19965 gene locus_tag LOCUS_21940 19546 19965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099253.1 protein_id gnl|my_center|LOCUS_21940 19992 21347 gene locus_tag LOCUS_21950 19992 21347 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546144.1 protein_id gnl|my_center|LOCUS_21950 21344 21838 gene locus_tag LOCUS_21960 21344 21838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 21868 22845 gene locus_tag LOCUS_21970 21868 22845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 22842 23549 gene locus_tag LOCUS_21980 22842 23549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 23546 24310 gene locus_tag LOCUS_21990 23546 24310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 25189 24320 gene locus_tag LOCUS_22000 25189 24320 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BQ0 protein_id gnl|my_center|LOCUS_22000 27959 25332 gene locus_tag LOCUS_22010 gene clpB 27959 25332 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHJ8 protein_id gnl|my_center|LOCUS_22010 28049 28504 gene locus_tag LOCUS_22020 28049 28504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence056 1112 1744 gene locus_tag LOCUS_22030 1112 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 3440 1992 gene locus_tag LOCUS_22040 3440 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 4976 3444 gene locus_tag LOCUS_22050 gene ilvG 4976 3444 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z376 protein_id gnl|my_center|LOCUS_22050 5310 4993 gene locus_tag LOCUS_22060 5310 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 5356 5670 gene locus_tag LOCUS_22070 5356 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 5677 6462 gene locus_tag LOCUS_22080 5677 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 6468 6779 gene locus_tag LOCUS_22090 6468 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 6776 7519 gene locus_tag LOCUS_22100 6776 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 7522 7980 gene locus_tag LOCUS_22110 7522 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 7971 9473 gene locus_tag LOCUS_22120 7971 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 9555 10064 gene locus_tag LOCUS_22130 9555 10064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 10106 10798 gene locus_tag LOCUS_22140 10106 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 11348 10806 gene locus_tag LOCUS_22150 11348 10806 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NUA5 protein_id gnl|my_center|LOCUS_22150 11446 12330 gene locus_tag LOCUS_22160 11446 12330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 12449 13069 gene locus_tag LOCUS_22170 12449 13069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 13072 13830 gene locus_tag LOCUS_22180 13072 13830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 13818 14684 gene locus_tag LOCUS_22190 13818 14684 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_22190 15115 14672 gene locus_tag LOCUS_22200 15115 14672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 15152 15811 gene locus_tag LOCUS_22210 15152 15811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 17002 15818 gene locus_tag LOCUS_22220 17002 15818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 18439 17012 gene locus_tag LOCUS_22230 18439 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 19119 18436 gene locus_tag LOCUS_22240 19119 18436 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008542552.1 protein_id gnl|my_center|LOCUS_22240 20760 19141 gene locus_tag LOCUS_22250 20760 19141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 21917 20760 gene locus_tag LOCUS_22260 21917 20760 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038470.1 protein_id gnl|my_center|LOCUS_22260 23308 21917 gene locus_tag LOCUS_22270 23308 21917 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038469.1 protein_id gnl|my_center|LOCUS_22270 23336 24535 gene locus_tag LOCUS_22280 23336 24535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 24544 25458 gene locus_tag LOCUS_22290 24544 25458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 25486 26496 gene locus_tag LOCUS_22300 25486 26496 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246120.1 protein_id gnl|my_center|LOCUS_22300 27042 26458 gene locus_tag LOCUS_22310 27042 26458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 27882 27085 gene locus_tag LOCUS_22320 27882 27085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence057 2156 759 gene locus_tag LOCUS_22330 2156 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 5128 2156 gene locus_tag LOCUS_22340 5128 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 5720 5136 gene locus_tag LOCUS_22350 5720 5136 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA2 protein_id gnl|my_center|LOCUS_22350 6808 5750 gene locus_tag LOCUS_22360 6808 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 8074 6818 gene locus_tag LOCUS_22370 8074 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 8094 9944 gene locus_tag LOCUS_22380 8094 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 9973 10884 gene locus_tag LOCUS_22390 9973 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 13432 10895 gene locus_tag LOCUS_22400 13432 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 13462 15282 gene locus_tag LOCUS_22410 13462 15282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 15279 16088 gene locus_tag LOCUS_22420 15279 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 17639 16311 gene locus_tag LOCUS_22430 17639 16311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 18195 17629 gene locus_tag LOCUS_22440 18195 17629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 19724 18195 gene locus_tag LOCUS_22450 19724 18195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 21013 19721 gene locus_tag LOCUS_22460 21013 19721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 21012 24299 gene locus_tag LOCUS_22470 21012 24299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 24404 24976 gene locus_tag LOCUS_22480 24404 24976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 24991 26328 gene locus_tag LOCUS_22490 24991 26328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 26842 26336 gene locus_tag LOCUS_22500 26842 26336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 28314 26842 gene locus_tag LOCUS_22510 28314 26842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence058 1971 1279 gene locus_tag LOCUS_22520 1971 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966295.1 protein_id gnl|my_center|LOCUS_22520 2016 3389 gene locus_tag LOCUS_22530 2016 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 3398 4498 gene locus_tag LOCUS_22540 3398 4498 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088351.1 protein_id gnl|my_center|LOCUS_22540 4535 6262 gene locus_tag LOCUS_22550 4535 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 6304 7902 gene locus_tag LOCUS_22560 6304 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 8497 7907 gene locus_tag LOCUS_22570 8497 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 9165 8494 gene locus_tag LOCUS_22580 9165 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 9252 11246 gene locus_tag LOCUS_22590 9252 11246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 11254 11910 gene locus_tag LOCUS_22600 11254 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 11907 13154 gene locus_tag LOCUS_22610 11907 13154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 13144 14061 gene locus_tag LOCUS_22620 13144 14061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 14061 15365 gene locus_tag LOCUS_22630 14061 15365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 16540 15362 gene locus_tag LOCUS_22640 16540 15362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 16608 17267 gene locus_tag LOCUS_22650 16608 17267 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_22650 17264 18478 gene locus_tag LOCUS_22660 17264 18478 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_22660 18471 19721 gene locus_tag LOCUS_22670 18471 19721 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_22670 19721 20779 gene locus_tag LOCUS_22680 19721 20779 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_22680 20784 21476 gene locus_tag LOCUS_22690 20784 21476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 21476 23284 gene locus_tag LOCUS_22700 21476 23284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 23275 23787 gene locus_tag LOCUS_22710 23275 23787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 23804 24334 gene locus_tag LOCUS_22720 23804 24334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 24945 24331 gene locus_tag LOCUS_22730 24945 24331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 25460 24945 gene locus_tag LOCUS_22740 25460 24945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 25810 26691 gene locus_tag LOCUS_22750 25810 26691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence059 2379 334 gene locus_tag LOCUS_22760 2379 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 3662 2367 gene locus_tag LOCUS_22770 3662 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 4770 3706 gene locus_tag LOCUS_22780 4770 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 5149 4772 gene locus_tag LOCUS_22790 5149 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 5299 5718 gene locus_tag LOCUS_22800 5299 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 5726 7939 gene locus_tag LOCUS_22810 5726 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 7936 10584 gene locus_tag LOCUS_22820 7936 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 10584 11693 gene locus_tag LOCUS_22830 10584 11693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 11680 12759 gene locus_tag LOCUS_22840 11680 12759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 12750 13754 gene locus_tag LOCUS_22850 12750 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 14712 13738 gene locus_tag LOCUS_22860 14712 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 16483 14714 gene locus_tag LOCUS_22870 16483 14714 CDS product oligopeptide transporter, OPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224746.1 protein_id gnl|my_center|LOCUS_22870 17152 16538 gene locus_tag LOCUS_22880 17152 16538 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403989.1 protein_id gnl|my_center|LOCUS_22880 17924 17163 gene locus_tag LOCUS_22890 gene thiG 17924 17163 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FL9 protein_id gnl|my_center|LOCUS_22890 18002 18475 gene locus_tag LOCUS_22900 18002 18475 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_22900 18499 18795 gene locus_tag LOCUS_22910 18499 18795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 18800 19417 gene locus_tag LOCUS_22920 18800 19417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 19417 19695 gene locus_tag LOCUS_22930 19417 19695 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_22930 19692 20261 gene locus_tag LOCUS_22940 19692 20261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 21213 20248 gene locus_tag LOCUS_22950 gene ansA 21213 20248 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A963 protein_id gnl|my_center|LOCUS_22950 21513 21217 gene locus_tag LOCUS_22960 21513 21217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 21854 21495 gene locus_tag LOCUS_22970 21854 21495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 21935 23068 gene locus_tag LOCUS_22980 21935 23068 CDS product LPS biosynthesis protein RfbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876009.1 protein_id gnl|my_center|LOCUS_22980 23065 24690 gene locus_tag LOCUS_22990 23065 24690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 24762 26051 gene locus_tag LOCUS_23000 24762 26051 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_23000 26784 26074 gene locus_tag LOCUS_23010 26784 26074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 27512 26808 gene locus_tag LOCUS_23020 27512 26808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence060 959 18 gene locus_tag LOCUS_23030 959 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 1513 941 gene locus_tag LOCUS_23040 1513 941 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL24 protein_id gnl|my_center|LOCUS_23040 1565 3565 gene locus_tag LOCUS_23050 gene dnaK 1565 3565 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963795.1 protein_id gnl|my_center|LOCUS_23050 3570 4049 gene locus_tag LOCUS_23060 3570 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 4053 5687 gene locus_tag LOCUS_23070 gene dnaK 4053 5687 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK6 protein_id gnl|my_center|LOCUS_23070 5783 7738 gene locus_tag LOCUS_23080 5783 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 7741 8577 gene locus_tag LOCUS_23090 7741 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 8611 8684 gene locus_tag LOCUS_t00100 8611 8684 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9010 8744 gene locus_tag LOCUS_23100 9010 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 10491 9007 gene locus_tag LOCUS_23110 10491 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 10966 10517 gene locus_tag LOCUS_23120 10966 10517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 11037 11918 gene locus_tag LOCUS_23130 11037 11918 CDS product 3-oxoadipate enol-lactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405393.1 protein_id gnl|my_center|LOCUS_23130 12327 11872 gene locus_tag LOCUS_23140 12327 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 14825 12324 gene locus_tag LOCUS_23150 gene recG 14825 12324 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DJ0 protein_id gnl|my_center|LOCUS_23150 15385 14906 gene locus_tag LOCUS_23160 gene greA 15385 14906 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV46 protein_id gnl|my_center|LOCUS_23160 15555 16742 gene locus_tag LOCUS_23170 gene pyrB 15555 16742 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FS3 protein_id gnl|my_center|LOCUS_23170 16739 17287 gene locus_tag LOCUS_23180 16739 17287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 17307 17717 gene locus_tag LOCUS_23190 17307 17717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 19536 17722 gene locus_tag LOCUS_23200 gene lepA 19536 17722 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XVZ3 protein_id gnl|my_center|LOCUS_23200 20855 19554 gene locus_tag LOCUS_23210 gene ugd 20855 19554 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_23210 21012 21290 gene locus_tag LOCUS_23220 21012 21290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 22295 21294 gene locus_tag LOCUS_23230 22295 21294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 22365 23066 gene locus_tag LOCUS_23240 22365 23066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 23143 23352 gene locus_tag LOCUS_23250 23143 23352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 24249 23416 gene locus_tag LOCUS_23260 24249 23416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 24284 24370 gene locus_tag LOCUS_t00110 24284 24370 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24462 26279 gene locus_tag LOCUS_23270 gene dnaK 24462 26279 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_23270 <28061 26369 gene locus_tag LOCUS_23280 <28061 26369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001890295.1:peptidase M16 >Feature sequence061 2 454 gene locus_tag LOCUS_23290 2 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 451 2268 gene locus_tag LOCUS_23300 451 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 2285 2728 gene locus_tag LOCUS_23310 2285 2728 CDS product putative phenylacetic acid degradation-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703153.1 protein_id gnl|my_center|LOCUS_23310 2737 3840 gene locus_tag LOCUS_23320 2737 3840 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_23320 3896 6346 gene locus_tag LOCUS_23330 gene lon 3896 6346 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2J0 protein_id gnl|my_center|LOCUS_23330 6346 7818 gene locus_tag LOCUS_23340 gene accC 6346 7818 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_23340 7809 8315 gene locus_tag LOCUS_23350 7809 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23350 9130 8312 gene locus_tag LOCUS_23360 9130 8312 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_23360 9023 9349 gene locus_tag LOCUS_23370 9023 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 11298 9244 gene locus_tag LOCUS_23380 11298 9244 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920232.1 protein_id gnl|my_center|LOCUS_23380 12560 11346 gene locus_tag LOCUS_23390 12560 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 13375 12557 gene locus_tag LOCUS_23400 gene tatC 13375 12557 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D88 protein_id gnl|my_center|LOCUS_23400 13767 13372 gene locus_tag LOCUS_23410 13767 13372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 13890 14672 gene locus_tag LOCUS_23420 13890 14672 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405474.1 protein_id gnl|my_center|LOCUS_23420 15704 14673 gene locus_tag LOCUS_23430 15704 14673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 17183 15711 gene locus_tag LOCUS_23440 17183 15711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 17443 17207 gene locus_tag LOCUS_23450 17443 17207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 18057 17443 gene locus_tag LOCUS_23460 18057 17443 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259729.1 protein_id gnl|my_center|LOCUS_23460 18133 18486 gene locus_tag LOCUS_23470 18133 18486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 18528 19007 gene locus_tag LOCUS_23480 18528 19007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 19004 19621 gene locus_tag LOCUS_23490 19004 19621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 20445 19561 gene locus_tag LOCUS_23500 20445 19561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 20495 20911 gene locus_tag LOCUS_23510 20495 20911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 20960 21166 gene locus_tag LOCUS_23520 gene rpsR 20960 21166 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBX4 protein_id gnl|my_center|LOCUS_23520 21177 21950 gene locus_tag LOCUS_23530 21177 21950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 21947 22831 gene locus_tag LOCUS_23540 21947 22831 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_23540 23023 23274 gene locus_tag LOCUS_23550 23023 23274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 23309 24565 gene locus_tag LOCUS_23560 23309 24565 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_23560 24568 25122 gene locus_tag LOCUS_23570 24568 25122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 25119 26285 gene locus_tag LOCUS_23580 25119 26285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 26540 26328 gene locus_tag LOCUS_23590 26540 26328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 27889 26537 gene locus_tag LOCUS_23600 27889 26537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence062 1482 100 gene locus_tag LOCUS_23610 1482 100 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_23610 3677 1488 gene locus_tag LOCUS_23620 3677 1488 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_23620 3781 4173 gene locus_tag LOCUS_23630 3781 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 4214 4930 gene locus_tag LOCUS_23640 4214 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 5002 5502 gene locus_tag LOCUS_23650 5002 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 5530 6546 gene locus_tag LOCUS_23660 5530 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 6543 8060 gene locus_tag LOCUS_23670 6543 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 8060 9262 gene locus_tag LOCUS_23680 8060 9262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 9296 10330 gene locus_tag LOCUS_23690 9296 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 11345 10335 gene locus_tag LOCUS_23700 11345 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 11612 11394 gene locus_tag LOCUS_23710 11612 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 12400 12041 gene locus_tag LOCUS_23720 12400 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 13744 12452 gene locus_tag LOCUS_23730 13744 12452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 13759 14607 gene locus_tag LOCUS_23740 13759 14607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 14644 15084 gene locus_tag LOCUS_23750 14644 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016620.1 protein_id gnl|my_center|LOCUS_23750 15081 15980 gene locus_tag LOCUS_23760 15081 15980 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888319.1 protein_id gnl|my_center|LOCUS_23760 16459 16034 gene locus_tag LOCUS_23770 16459 16034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 16570 16950 gene locus_tag LOCUS_23780 16570 16950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 18961 16973 gene locus_tag LOCUS_23790 18961 16973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 20036 19011 gene locus_tag LOCUS_23800 20036 19011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040337.1 protein_id gnl|my_center|LOCUS_23800 20383 20036 gene locus_tag LOCUS_23810 20383 20036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 21057 20383 gene locus_tag LOCUS_23820 21057 20383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 23423 21249 gene locus_tag LOCUS_23830 23423 21249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 24872 23424 gene locus_tag LOCUS_23840 24872 23424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 25543 24872 gene locus_tag LOCUS_23850 25543 24872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence063 1578 997 gene locus_tag LOCUS_23860 1578 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056142.1 protein_id gnl|my_center|LOCUS_23860 1608 2186 gene locus_tag LOCUS_23870 1608 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 2391 2158 gene locus_tag LOCUS_23880 2391 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 3005 2388 gene locus_tag LOCUS_23890 3005 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 5599 3002 gene locus_tag LOCUS_23900 5599 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 6780 5680 gene locus_tag LOCUS_23910 6780 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 6819 7265 gene locus_tag LOCUS_23920 6819 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 7262 8731 gene locus_tag LOCUS_23930 7262 8731 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950408.1 protein_id gnl|my_center|LOCUS_23930 9395 8691 gene locus_tag LOCUS_23940 9395 8691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 9418 10182 gene locus_tag LOCUS_23950 9418 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 10192 10932 gene locus_tag LOCUS_23960 10192 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 10994 12169 gene locus_tag LOCUS_23970 10994 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 12782 12171 gene locus_tag LOCUS_23980 12782 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 12887 13294 gene locus_tag LOCUS_23990 12887 13294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 13291 13692 gene locus_tag LOCUS_24000 13291 13692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 13956 19295 gene locus_tag LOCUS_24010 13956 19295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 19321 20817 gene locus_tag LOCUS_24020 19321 20817 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWJ8 protein_id gnl|my_center|LOCUS_24020 20826 21692 gene locus_tag LOCUS_24030 20826 21692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 23049 21682 gene locus_tag LOCUS_24040 23049 21682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 23100 24680 gene locus_tag LOCUS_24050 23100 24680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 25016 24681 gene locus_tag LOCUS_24060 25016 24681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 25010 25843 gene locus_tag LOCUS_24070 25010 25843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 25874 27418 gene locus_tag LOCUS_24080 25874 27418 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_24080 >Feature sequence064 788 495 gene locus_tag LOCUS_24090 788 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2054 879 gene locus_tag LOCUS_24100 2054 879 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_24100 3083 2064 gene locus_tag LOCUS_24110 3083 2064 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903126.1 protein_id gnl|my_center|LOCUS_24110 3528 3118 gene locus_tag LOCUS_24120 3528 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 4490 3528 gene locus_tag LOCUS_24130 4490 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 4563 5474 gene locus_tag LOCUS_24140 4563 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 5464 6810 gene locus_tag LOCUS_24150 5464 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 6881 7993 gene locus_tag LOCUS_24160 6881 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 9279 7996 gene locus_tag LOCUS_24170 9279 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 9309 9701 gene locus_tag LOCUS_24180 9309 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392153.1 protein_id gnl|my_center|LOCUS_24180 9721 10320 gene locus_tag LOCUS_24190 9721 10320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 11070 10324 gene locus_tag LOCUS_24200 11070 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 11137 12765 gene locus_tag LOCUS_24210 11137 12765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 15107 12762 gene locus_tag LOCUS_24220 15107 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 15464 15138 gene locus_tag LOCUS_24230 15464 15138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 15529 16428 gene locus_tag LOCUS_24240 15529 16428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 16892 16425 gene locus_tag LOCUS_24250 16892 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701361.1 protein_id gnl|my_center|LOCUS_24250 18512 16893 gene locus_tag LOCUS_24260 18512 16893 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730149.1 protein_id gnl|my_center|LOCUS_24260 19413 18505 gene locus_tag LOCUS_24270 19413 18505 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_24270 19937 19410 gene locus_tag LOCUS_24280 19937 19410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 21610 19925 gene locus_tag LOCUS_24290 gene ksdD 21610 19925 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4S9 protein_id gnl|my_center|LOCUS_24290 21689 22546 gene locus_tag LOCUS_24300 21689 22546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 22543 23682 gene locus_tag LOCUS_24310 22543 23682 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 protein_id gnl|my_center|LOCUS_24310 23682 24455 gene locus_tag LOCUS_24320 23682 24455 CDS product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088038.1 protein_id gnl|my_center|LOCUS_24320 24452 25264 gene locus_tag LOCUS_24330 24452 25264 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228947.1 protein_id gnl|my_center|LOCUS_24330 25257 26009 gene locus_tag LOCUS_24340 25257 26009 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_24340 26006 26875 gene locus_tag LOCUS_24350 gene mhpF 26006 26875 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQH3 protein_id gnl|my_center|LOCUS_24350 >Feature sequence065 322 1383 gene locus_tag LOCUS_24360 322 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 1440 3380 gene locus_tag LOCUS_24370 gene dnaK 1440 3380 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H59 protein_id gnl|my_center|LOCUS_24370 3433 4497 gene locus_tag LOCUS_24380 gene dnaJ 3433 4497 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H58 protein_id gnl|my_center|LOCUS_24380 4509 6476 gene locus_tag LOCUS_24390 4509 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 6493 7347 gene locus_tag LOCUS_24400 gene thiL 6493 7347 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3K2 protein_id gnl|my_center|LOCUS_24400 7365 8585 gene locus_tag LOCUS_24410 7365 8585 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_24410 8582 9829 gene locus_tag LOCUS_24420 8582 9829 CDS product gliding motility protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583682.1 protein_id gnl|my_center|LOCUS_24420 10973 9837 gene locus_tag LOCUS_24430 10973 9837 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083260.1 protein_id gnl|my_center|LOCUS_24430 11036 11512 gene locus_tag LOCUS_24440 11036 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 11594 13375 gene locus_tag LOCUS_24450 gene dnaK 11594 13375 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94317 protein_id gnl|my_center|LOCUS_24450 13380 14165 gene locus_tag LOCUS_24460 gene trmJ 13380 14165 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CI4 protein_id gnl|my_center|LOCUS_24460 14562 14188 gene locus_tag LOCUS_24470 14562 14188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 15317 14724 gene locus_tag LOCUS_24480 15317 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 15338 16618 gene locus_tag LOCUS_24490 15338 16618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 17288 16587 gene locus_tag LOCUS_24500 17288 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 17287 18078 gene locus_tag LOCUS_24510 17287 18078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 18893 18066 gene locus_tag LOCUS_24520 18893 18066 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227777.1 protein_id gnl|my_center|LOCUS_24520 18917 20752 gene locus_tag LOCUS_24530 18917 20752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 22195 20759 gene locus_tag LOCUS_24540 22195 20759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 27561 22177 gene locus_tag LOCUS_24550 27561 22177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence066 643 128 gene locus_tag LOCUS_24560 643 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 688 852 gene locus_tag LOCUS_24570 688 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 901 1164 gene locus_tag LOCUS_24580 901 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 1325 2254 gene locus_tag LOCUS_24590 1325 2254 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921475.1 protein_id gnl|my_center|LOCUS_24590 2400 2257 gene locus_tag LOCUS_24600 2400 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 4085 2565 gene locus_tag LOCUS_24610 4085 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 4084 5610 gene locus_tag LOCUS_24620 4084 5610 CDS product peptidase U62 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_24620 5603 6898 gene locus_tag LOCUS_24630 5603 6898 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_24630 6898 8850 gene locus_tag LOCUS_24640 6898 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 9500 8847 gene locus_tag LOCUS_24650 gene sfsA 9500 8847 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61664 protein_id gnl|my_center|LOCUS_24650 11611 9530 gene locus_tag LOCUS_24660 11611 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 11683 12255 gene locus_tag LOCUS_24670 gene plsY 11683 12255 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MF83 protein_id gnl|my_center|LOCUS_24670 12265 13323 gene locus_tag LOCUS_24680 12265 13323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 13330 14679 gene locus_tag LOCUS_24690 13330 14679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 15222 14692 gene locus_tag LOCUS_24700 15222 14692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 15267 18023 gene locus_tag LOCUS_24710 15267 18023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 19542 18067 gene locus_tag LOCUS_24720 19542 18067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 20576 19569 gene locus_tag LOCUS_24730 20576 19569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 20726 20577 gene locus_tag LOCUS_24740 20726 20577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 20875 22170 gene locus_tag LOCUS_24750 gene asnS 20875 22170 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA97 protein_id gnl|my_center|LOCUS_24750 22894 22712 gene locus_tag LOCUS_24760 22894 22712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 23422 23192 gene locus_tag LOCUS_24770 23422 23192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 23544 23459 gene locus_tag LOCUS_t00120 23544 23459 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23646 24107 gene locus_tag LOCUS_24780 23646 24107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 24644 24111 gene locus_tag LOCUS_24790 gene lspA 24644 24111 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK54 protein_id gnl|my_center|LOCUS_24790 25905 24661 gene locus_tag LOCUS_24800 25905 24661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 26528 25944 gene locus_tag LOCUS_24810 gene lspA 26528 25944 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AR4 protein_id gnl|my_center|LOCUS_24810 >Feature sequence067 1028 585 gene locus_tag LOCUS_24820 1028 585 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775709.1 protein_id gnl|my_center|LOCUS_24820 2353 1025 gene locus_tag LOCUS_24830 2353 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 4497 2371 gene locus_tag LOCUS_24840 4497 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 4623 6863 gene locus_tag LOCUS_24850 4623 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 6860 8212 gene locus_tag LOCUS_24860 6860 8212 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_24860 8218 10047 gene locus_tag LOCUS_24870 8218 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 11527 9971 gene locus_tag LOCUS_24880 11527 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 12823 11540 gene locus_tag LOCUS_24890 12823 11540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 12991 14289 gene locus_tag LOCUS_24900 12991 14289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 15127 14294 gene locus_tag LOCUS_24910 15127 14294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 15178 16617 gene locus_tag LOCUS_24920 15178 16617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 17938 16625 gene locus_tag LOCUS_24930 17938 16625 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_24930 18744 17935 gene locus_tag LOCUS_24940 18744 17935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 18895 19926 gene locus_tag LOCUS_24950 18895 19926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 20074 21168 gene locus_tag LOCUS_24960 20074 21168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 21219 22295 gene locus_tag LOCUS_24970 21219 22295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056738.1 protein_id gnl|my_center|LOCUS_24970 22310 23767 gene locus_tag LOCUS_24980 22310 23767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 23767 24660 gene locus_tag LOCUS_24990 23767 24660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 24645 25763 gene locus_tag LOCUS_25000 24645 25763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 25754 26647 gene locus_tag LOCUS_25010 25754 26647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence068 <1 2370 gene locus_tag LOCUS_25020 <1 2370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258185.1:peptidase S45 2370 3194 gene locus_tag LOCUS_25030 2370 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 4992 3175 gene locus_tag LOCUS_25040 4992 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 10571 4989 gene locus_tag LOCUS_25050 10571 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 11014 10598 gene locus_tag LOCUS_25060 11014 10598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 11125 13989 gene locus_tag LOCUS_25070 11125 13989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 14431 13958 gene locus_tag LOCUS_25080 14431 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 14420 14809 gene locus_tag LOCUS_25090 14420 14809 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071479.1 protein_id gnl|my_center|LOCUS_25090 14908 15618 gene locus_tag LOCUS_25100 14908 15618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 15730 16701 gene locus_tag LOCUS_25110 15730 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 17183 16698 gene locus_tag LOCUS_25120 gene yneN 17183 16698 CDS product thioredoxin-like protein YneN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31820 protein_id gnl|my_center|LOCUS_25120 17469 18734 gene locus_tag LOCUS_25130 17469 18734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919844.1 protein_id gnl|my_center|LOCUS_25130 18737 19819 gene locus_tag LOCUS_25140 18737 19819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090158.1 protein_id gnl|my_center|LOCUS_25140 21499 19823 gene locus_tag LOCUS_25150 21499 19823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 23271 21484 gene locus_tag LOCUS_25160 23271 21484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 24029 23268 gene locus_tag LOCUS_25170 24029 23268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 25582 24170 gene locus_tag LOCUS_25180 25582 24170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 26335 25592 gene locus_tag LOCUS_25190 26335 25592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 >Feature sequence069 1686 2198 gene locus_tag LOCUS_25200 1686 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 3105 2203 gene locus_tag LOCUS_25210 3105 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 4067 3216 gene locus_tag LOCUS_25220 4067 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 4567 4115 gene locus_tag LOCUS_25230 4567 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 6775 4577 gene locus_tag LOCUS_25240 6775 4577 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404701.1 protein_id gnl|my_center|LOCUS_25240 7820 6801 gene locus_tag LOCUS_25250 7820 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 7898 9211 gene locus_tag LOCUS_25260 7898 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 9247 10161 gene locus_tag LOCUS_25270 9247 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 11338 10154 gene locus_tag LOCUS_25280 11338 10154 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_25280 11386 11958 gene locus_tag LOCUS_25290 11386 11958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 11960 12535 gene locus_tag LOCUS_25300 11960 12535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 12581 13021 gene locus_tag LOCUS_25310 12581 13021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 13090 14694 gene locus_tag LOCUS_25320 13090 14694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 15785 14691 gene locus_tag LOCUS_25330 15785 14691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 16411 15782 gene locus_tag LOCUS_25340 16411 15782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 16468 17982 gene locus_tag LOCUS_25350 gene gpmI 16468 17982 CDS product putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59173 protein_id gnl|my_center|LOCUS_25350 17979 18974 gene locus_tag LOCUS_25360 17979 18974 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_25360 19010 19675 gene locus_tag LOCUS_25370 19010 19675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 19757 22471 gene locus_tag LOCUS_25380 19757 22471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 23954 22431 gene locus_tag LOCUS_25390 23954 22431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 24565 23951 gene locus_tag LOCUS_25400 24565 23951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence070 380 304 gene locus_tag LOCUS_t00130 380 304 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1095 442 gene locus_tag LOCUS_25410 1095 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 1238 1546 gene locus_tag LOCUS_25420 1238 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 1628 2149 gene locus_tag LOCUS_25430 1628 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 2217 2876 gene locus_tag LOCUS_25440 2217 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 2924 3595 gene locus_tag LOCUS_25450 2924 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 3605 4693 gene locus_tag LOCUS_25460 3605 4693 CDS product UPF0256 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F309 protein_id gnl|my_center|LOCUS_25460 4726 5193 gene locus_tag LOCUS_25470 4726 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 6317 5226 gene locus_tag LOCUS_25480 6317 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 6362 7276 gene locus_tag LOCUS_25490 6362 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 7276 10605 gene locus_tag LOCUS_25500 gene mfd 7276 10605 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEK2 protein_id gnl|my_center|LOCUS_25500 11246 10584 gene locus_tag LOCUS_25510 11246 10584 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071744.1 protein_id gnl|my_center|LOCUS_25510 11288 12202 gene locus_tag LOCUS_25520 11288 12202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 12315 12187 gene locus_tag LOCUS_25530 12315 12187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 13256 12312 gene locus_tag LOCUS_25540 13256 12312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 13817 13257 gene locus_tag LOCUS_25550 13817 13257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 15277 13814 gene locus_tag LOCUS_25560 gene glpK 15277 13814 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749I1 protein_id gnl|my_center|LOCUS_25560 15331 16464 gene locus_tag LOCUS_25570 gene rlmN 15331 16464 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E53 protein_id gnl|my_center|LOCUS_25570 16495 17352 gene locus_tag LOCUS_25580 gene mtnP 16495 17352 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E52 protein_id gnl|my_center|LOCUS_25580 17362 18081 gene locus_tag LOCUS_25590 17362 18081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 18078 18464 gene locus_tag LOCUS_25600 18078 18464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 18481 19839 gene locus_tag LOCUS_25610 gene mgtE 18481 19839 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0I3 protein_id gnl|my_center|LOCUS_25610 19836 20546 gene locus_tag LOCUS_25620 gene recO 19836 20546 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FM9 protein_id gnl|my_center|LOCUS_25620 20790 20554 gene locus_tag LOCUS_25630 20790 20554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 20918 20739 gene locus_tag LOCUS_25640 20918 20739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 21263 20976 gene locus_tag LOCUS_25650 21263 20976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 21394 21320 gene locus_tag LOCUS_t00140 21394 21320 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 23000 21612 gene locus_tag LOCUS_25660 23000 21612 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_25660 25451 23001 gene locus_tag LOCUS_25670 25451 23001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence071 206 1237 gene locus_tag LOCUS_25680 206 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 1883 1251 gene locus_tag LOCUS_25690 1883 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 3709 1913 gene locus_tag LOCUS_25700 3709 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 5060 3756 gene locus_tag LOCUS_25710 5060 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 5097 5882 gene locus_tag LOCUS_25720 5097 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_25720 5943 9269 gene locus_tag LOCUS_25730 5943 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 10053 9283 gene locus_tag LOCUS_25740 10053 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 10110 11069 gene locus_tag LOCUS_25750 10110 11069 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123806.1 protein_id gnl|my_center|LOCUS_25750 12121 11072 gene locus_tag LOCUS_25760 12121 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 12182 14164 gene locus_tag LOCUS_25770 12182 14164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 14167 14853 gene locus_tag LOCUS_25780 14167 14853 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356531.1 protein_id gnl|my_center|LOCUS_25780 14850 16262 gene locus_tag LOCUS_25790 14850 16262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 16255 17073 gene locus_tag LOCUS_25800 16255 17073 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262260.1 protein_id gnl|my_center|LOCUS_25800 17101 19095 gene locus_tag LOCUS_25810 17101 19095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 19086 21050 gene locus_tag LOCUS_25820 19086 21050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 21933 21037 gene locus_tag LOCUS_25830 21933 21037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 22910 21909 gene locus_tag LOCUS_25840 gene fbp 22910 21909 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AZ9 protein_id gnl|my_center|LOCUS_25840 23153 25024 gene locus_tag LOCUS_25850 23153 25024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence072 123 1157 gene locus_tag LOCUS_25860 123 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1312 1154 gene locus_tag LOCUS_25870 1312 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 1306 3816 gene locus_tag LOCUS_25880 1306 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 4804 3740 gene locus_tag LOCUS_25890 4804 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 5814 4801 gene locus_tag LOCUS_25900 5814 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 5895 6287 gene locus_tag LOCUS_25910 5895 6287 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_25910 6302 9802 gene locus_tag LOCUS_25920 6302 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 9803 10897 gene locus_tag LOCUS_25930 9803 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 10900 11832 gene locus_tag LOCUS_25940 10900 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 11836 12339 gene locus_tag LOCUS_25950 11836 12339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 12336 13730 gene locus_tag LOCUS_25960 12336 13730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 13740 15368 gene locus_tag LOCUS_25970 13740 15368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 16006 15365 gene locus_tag LOCUS_25980 16006 15365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 16611 16015 gene locus_tag LOCUS_25990 16611 16015 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963558.1 protein_id gnl|my_center|LOCUS_25990 16641 17186 gene locus_tag LOCUS_26000 16641 17186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 17219 18001 gene locus_tag LOCUS_26010 17219 18001 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_26010 18916 18005 gene locus_tag LOCUS_26020 18916 18005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 20352 18940 gene locus_tag LOCUS_26030 gene purF 20352 18940 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51342 protein_id gnl|my_center|LOCUS_26030 20751 20395 gene locus_tag LOCUS_26040 20751 20395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 21363 20776 gene locus_tag LOCUS_26050 21363 20776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 21440 21982 gene locus_tag LOCUS_26060 21440 21982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 21985 23421 gene locus_tag LOCUS_26070 21985 23421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 23712 23437 gene locus_tag LOCUS_26080 23712 23437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 24583 23723 gene locus_tag LOCUS_26090 24583 23723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 25119 24574 gene locus_tag LOCUS_26100 25119 24574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 25319 25119 gene locus_tag LOCUS_26110 25319 25119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence073 198 2033 gene locus_tag LOCUS_26120 198 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 2743 2036 gene locus_tag LOCUS_26130 2743 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 3513 2740 gene locus_tag LOCUS_26140 3513 2740 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104155.1 protein_id gnl|my_center|LOCUS_26140 3647 5770 gene locus_tag LOCUS_26150 3647 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 5801 7765 gene locus_tag LOCUS_26160 5801 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 7796 8932 gene locus_tag LOCUS_26170 7796 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 8929 10032 gene locus_tag LOCUS_26180 8929 10032 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403941.1 protein_id gnl|my_center|LOCUS_26180 10067 10333 gene locus_tag LOCUS_26190 10067 10333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 10421 10603 gene locus_tag LOCUS_26200 10421 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 10635 11423 gene locus_tag LOCUS_26210 10635 11423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 11516 11854 gene locus_tag LOCUS_26220 11516 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 12130 11906 gene locus_tag LOCUS_26230 12130 11906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 13459 12986 gene locus_tag LOCUS_26240 13459 12986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 13521 15266 gene locus_tag LOCUS_26250 13521 15266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 15269 16288 gene locus_tag LOCUS_26260 15269 16288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 16800 16297 gene locus_tag LOCUS_26270 16800 16297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 16818 17174 gene locus_tag LOCUS_26280 16818 17174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 18531 17152 gene locus_tag LOCUS_26290 18531 17152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 18641 18886 gene locus_tag LOCUS_26300 18641 18886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 18879 19469 gene locus_tag LOCUS_26310 18879 19469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 19469 20140 gene locus_tag LOCUS_26320 19469 20140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 20663 20163 gene locus_tag LOCUS_26330 20663 20163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 20806 22467 gene locus_tag LOCUS_26340 20806 22467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 24452 22428 gene locus_tag LOCUS_26350 24452 22428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 25248 24382 gene locus_tag LOCUS_26360 25248 24382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence074 318 815 gene locus_tag LOCUS_26370 318 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 877 1755 gene locus_tag LOCUS_26380 877 1755 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_26380 1755 2333 gene locus_tag LOCUS_26390 1755 2333 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_26390 2330 2980 gene locus_tag LOCUS_26400 2330 2980 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 protein_id gnl|my_center|LOCUS_26400 2991 4421 gene locus_tag LOCUS_26410 2991 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 4951 4712 gene locus_tag LOCUS_26420 4951 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 6542 5007 gene locus_tag LOCUS_26430 6542 5007 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730076.1 protein_id gnl|my_center|LOCUS_26430 6576 7361 gene locus_tag LOCUS_26440 gene paaG 6576 7361 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 protein_id gnl|my_center|LOCUS_26440 7358 8098 gene locus_tag LOCUS_26450 7358 8098 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_26450 8095 8760 gene locus_tag LOCUS_26460 8095 8760 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_26460 8769 9842 gene locus_tag LOCUS_26470 8769 9842 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225238.1 protein_id gnl|my_center|LOCUS_26470 9835 10686 gene locus_tag LOCUS_26480 gene paaG 9835 10686 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 protein_id gnl|my_center|LOCUS_26480 10683 11837 gene locus_tag LOCUS_26490 10683 11837 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701347.1 protein_id gnl|my_center|LOCUS_26490 11834 12733 gene locus_tag LOCUS_26500 11834 12733 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701346.1 protein_id gnl|my_center|LOCUS_26500 12726 13877 gene locus_tag LOCUS_26510 gene atoB 12726 13877 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_26510 13894 15954 gene locus_tag LOCUS_26520 13894 15954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 15951 16682 gene locus_tag LOCUS_26530 gene fabG 15951 16682 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_26530 16679 17404 gene locus_tag LOCUS_26540 16679 17404 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419313.1 protein_id gnl|my_center|LOCUS_26540 17401 18306 gene locus_tag LOCUS_26550 17401 18306 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_26550 18303 19397 gene locus_tag LOCUS_26560 18303 19397 CDS product putative 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704889.1 protein_id gnl|my_center|LOCUS_26560 19407 20975 gene locus_tag LOCUS_26570 gene betA 19407 20975 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225958.1 protein_id gnl|my_center|LOCUS_26570 20994 21407 gene locus_tag LOCUS_26580 20994 21407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 22114 21641 gene locus_tag LOCUS_26590 22114 21641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 22296 22075 gene locus_tag LOCUS_26600 22296 22075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 22507 23199 gene locus_tag LOCUS_26610 22507 23199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 24363 23452 gene locus_tag LOCUS_26620 24363 23452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 25211 24381 gene locus_tag LOCUS_26630 gene pqqB 25211 24381 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHG4 protein_id gnl|my_center|LOCUS_26630 25622 25215 gene locus_tag LOCUS_26640 25622 25215 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057722.1 protein_id gnl|my_center|LOCUS_26640 >Feature sequence075 533 219 gene locus_tag LOCUS_26650 533 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1585 581 gene locus_tag LOCUS_26660 1585 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 1662 3329 gene locus_tag LOCUS_26670 1662 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 3411 5804 gene locus_tag LOCUS_26680 3411 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 5805 6278 gene locus_tag LOCUS_26690 5805 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 6288 7295 gene locus_tag LOCUS_26700 6288 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 7292 8731 gene locus_tag LOCUS_26710 7292 8731 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_26710 8741 10084 gene locus_tag LOCUS_26720 8741 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 10484 10077 gene locus_tag LOCUS_26730 10484 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 10596 11096 gene locus_tag LOCUS_26740 10596 11096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 11100 12839 gene locus_tag LOCUS_26750 11100 12839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 12996 13178 gene locus_tag LOCUS_26760 12996 13178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 14400 13501 gene locus_tag LOCUS_26770 gene thyX 14400 13501 CDS product flavin-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9L5 protein_id gnl|my_center|LOCUS_26770 14465 15601 gene locus_tag LOCUS_26780 14465 15601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 16900 15602 gene locus_tag LOCUS_26790 16900 15602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 17086 16919 gene locus_tag LOCUS_26800 17086 16919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 17653 17108 gene locus_tag LOCUS_26810 17653 17108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 18624 17683 gene locus_tag LOCUS_26820 18624 17683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 19104 18628 gene locus_tag LOCUS_26830 19104 18628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 19203 20726 gene locus_tag LOCUS_26840 19203 20726 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_26840 20753 24310 gene locus_tag LOCUS_26850 20753 24310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 24328 25017 gene locus_tag LOCUS_26860 24328 25017 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_26860 >Feature sequence076 1167 121 gene locus_tag LOCUS_26870 gene pqqE 1167 121 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZR7 protein_id gnl|my_center|LOCUS_26870 1706 1203 gene locus_tag LOCUS_26880 1706 1203 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942963.1 protein_id gnl|my_center|LOCUS_26880 1801 2685 gene locus_tag LOCUS_26890 1801 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704818.1 protein_id gnl|my_center|LOCUS_26890 3446 2712 gene locus_tag LOCUS_26900 3446 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 4513 3455 gene locus_tag LOCUS_26910 4513 3455 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_26910 4562 5695 gene locus_tag LOCUS_26920 4562 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 5695 6174 gene locus_tag LOCUS_26930 5695 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 6171 6860 gene locus_tag LOCUS_26940 6171 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 7316 6921 gene locus_tag LOCUS_26950 gene fbp 7316 6921 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63J95 protein_id gnl|my_center|LOCUS_26950 7294 7830 gene locus_tag LOCUS_26960 7294 7830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 9373 7841 gene locus_tag LOCUS_26970 9373 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 9920 9387 gene locus_tag LOCUS_26980 9920 9387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 10453 9929 gene locus_tag LOCUS_26990 10453 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 10532 11446 gene locus_tag LOCUS_27000 10532 11446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 12341 11430 gene locus_tag LOCUS_27010 gene hemH 12341 11430 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747F5 protein_id gnl|my_center|LOCUS_27010 13375 12365 gene locus_tag LOCUS_27020 gene hemE 13375 12365 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V23 protein_id gnl|my_center|LOCUS_27020 15123 13375 gene locus_tag LOCUS_27030 15123 13375 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141921.1 protein_id gnl|my_center|LOCUS_27030 15776 15120 gene locus_tag LOCUS_27040 15776 15120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 15838 16587 gene locus_tag LOCUS_27050 15838 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 16588 17355 gene locus_tag LOCUS_27060 16588 17355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 17371 18030 gene locus_tag LOCUS_27070 17371 18030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 18832 18038 gene locus_tag LOCUS_27080 18832 18038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 19214 18867 gene locus_tag LOCUS_27090 19214 18867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 19254 20027 gene locus_tag LOCUS_27100 19254 20027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 20027 20212 gene locus_tag LOCUS_27110 20027 20212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 20274 21938 gene locus_tag LOCUS_27120 20274 21938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 21935 22933 gene locus_tag LOCUS_27130 21935 22933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 22937 24397 gene locus_tag LOCUS_27140 22937 24397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 >Feature sequence077 870 3080 gene locus_tag LOCUS_27150 870 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 3090 3863 gene locus_tag LOCUS_27160 gene norQ 3090 3863 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086000.1 protein_id gnl|my_center|LOCUS_27160 3860 5476 gene locus_tag LOCUS_27170 3860 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 5636 7039 gene locus_tag LOCUS_27180 5636 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 9656 7026 gene locus_tag LOCUS_27190 9656 7026 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403080.1 protein_id gnl|my_center|LOCUS_27190 10264 9635 gene locus_tag LOCUS_27200 10264 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 12646 10274 gene locus_tag LOCUS_27210 12646 10274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 13455 12643 gene locus_tag LOCUS_27220 gene norQ 13455 12643 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707561.1 protein_id gnl|my_center|LOCUS_27220 13489 14739 gene locus_tag LOCUS_27230 13489 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_27230 14760 15707 gene locus_tag LOCUS_27240 gene nadA 14760 15707 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_27240 16292 15726 gene locus_tag LOCUS_27250 16292 15726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 17278 16289 gene locus_tag LOCUS_27260 gene prs 17278 16289 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMC4 protein_id gnl|my_center|LOCUS_27260 17303 18796 gene locus_tag LOCUS_27270 17303 18796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 18807 19331 gene locus_tag LOCUS_27280 18807 19331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058286.1 protein_id gnl|my_center|LOCUS_27280 19328 19933 gene locus_tag LOCUS_27290 19328 19933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528995.1 protein_id gnl|my_center|LOCUS_27290 19930 21411 gene locus_tag LOCUS_27300 19930 21411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 21408 22547 gene locus_tag LOCUS_27310 21408 22547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 22544 22888 gene locus_tag LOCUS_27320 22544 22888 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_27320 24157 22940 gene locus_tag LOCUS_27330 24157 22940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 25182 24160 gene locus_tag LOCUS_27340 25182 24160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 >Feature sequence078 53 787 gene locus_tag LOCUS_27350 53 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 1033 788 gene locus_tag LOCUS_27360 1033 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 1171 1043 gene locus_tag LOCUS_27370 1171 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 1878 1171 gene locus_tag LOCUS_27380 1878 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 2267 1890 gene locus_tag LOCUS_27390 2267 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2686 2264 gene locus_tag LOCUS_27400 2686 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 3057 2683 gene locus_tag LOCUS_27410 3057 2683 CDS product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O53478 protein_id gnl|my_center|LOCUS_27410 4496 3075 gene locus_tag LOCUS_27420 4496 3075 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223099.1 protein_id gnl|my_center|LOCUS_27420 4905 4507 gene locus_tag LOCUS_27430 4905 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27430 6416 4902 gene locus_tag LOCUS_27440 6416 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 7468 6413 gene locus_tag LOCUS_27450 7468 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118452.1 protein_id gnl|my_center|LOCUS_27450 7493 7957 gene locus_tag LOCUS_27460 7493 7957 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103491.1 protein_id gnl|my_center|LOCUS_27460 9116 7962 gene locus_tag LOCUS_27470 9116 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 9309 10196 gene locus_tag LOCUS_27480 9309 10196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 10193 11296 gene locus_tag LOCUS_27490 gene purA 10193 11296 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDZ7 protein_id gnl|my_center|LOCUS_27490 11336 11458 gene locus_tag LOCUS_27500 11336 11458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 12422 11469 gene locus_tag LOCUS_27510 12422 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 12640 12422 gene locus_tag LOCUS_27520 12640 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 13284 12637 gene locus_tag LOCUS_27530 13284 12637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 13471 13767 gene locus_tag LOCUS_27540 13471 13767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 13764 14132 gene locus_tag LOCUS_27550 13764 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 14724 14125 gene locus_tag LOCUS_27560 14724 14125 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_27560 15258 14764 gene locus_tag LOCUS_27570 15258 14764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 15326 16003 gene locus_tag LOCUS_27580 15326 16003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 16474 15980 gene locus_tag LOCUS_27590 16474 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 17616 16471 gene locus_tag LOCUS_27600 17616 16471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_27600 18068 17736 gene locus_tag LOCUS_27610 18068 17736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 18456 18013 gene locus_tag LOCUS_27620 18456 18013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 19385 18498 gene locus_tag LOCUS_27630 19385 18498 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731536.1 protein_id gnl|my_center|LOCUS_27630 19514 20185 gene locus_tag LOCUS_27640 19514 20185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 20248 20913 gene locus_tag LOCUS_27650 20248 20913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 20914 21375 gene locus_tag LOCUS_27660 20914 21375 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814454.1 protein_id gnl|my_center|LOCUS_27660 21372 21680 gene locus_tag LOCUS_27670 21372 21680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 21731 22690 gene locus_tag LOCUS_27680 21731 22690 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_27680 22690 23979 gene locus_tag LOCUS_27690 22690 23979 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_27690 23976 24599 gene locus_tag LOCUS_27700 23976 24599 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943590.1 protein_id gnl|my_center|LOCUS_27700 >Feature sequence079 853 2016 gene locus_tag LOCUS_27710 853 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 2013 4004 gene locus_tag LOCUS_27720 2013 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 4094 5803 gene locus_tag LOCUS_27730 4094 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 6119 5949 gene locus_tag LOCUS_27740 6119 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 7967 6267 gene locus_tag LOCUS_27750 7967 6267 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490750.1 protein_id gnl|my_center|LOCUS_27750 8088 9566 gene locus_tag LOCUS_27760 8088 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 9579 10037 gene locus_tag LOCUS_27770 9579 10037 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545060.1 protein_id gnl|my_center|LOCUS_27770 10069 10893 gene locus_tag LOCUS_27780 10069 10893 CDS product PHP-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_27780 11370 10909 gene locus_tag LOCUS_27790 gene sixA 11370 10909 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222279.1 protein_id gnl|my_center|LOCUS_27790 11690 11385 gene locus_tag LOCUS_27800 11690 11385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 12185 11766 gene locus_tag LOCUS_27810 12185 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 12217 12927 gene locus_tag LOCUS_27820 12217 12927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 12936 15119 gene locus_tag LOCUS_27830 12936 15119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 15116 15865 gene locus_tag LOCUS_27840 15116 15865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27840 15862 17115 gene locus_tag LOCUS_27850 15862 17115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 17457 17146 gene locus_tag LOCUS_27860 17457 17146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 17864 17460 gene locus_tag LOCUS_27870 17864 17460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 17882 18301 gene locus_tag LOCUS_27880 17882 18301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 18472 19155 gene locus_tag LOCUS_27890 18472 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 19173 20354 gene locus_tag LOCUS_27900 19173 20354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 20380 21396 gene locus_tag LOCUS_27910 20380 21396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 24574 21371 gene locus_tag LOCUS_27920 24574 21371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 >Feature sequence080 1099 608 gene locus_tag LOCUS_27930 1099 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 2952 1099 gene locus_tag LOCUS_27940 2952 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 2975 3643 gene locus_tag LOCUS_27950 2975 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 3662 6004 gene locus_tag LOCUS_27960 3662 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 9081 6139 gene locus_tag LOCUS_27970 9081 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 9336 10394 gene locus_tag LOCUS_27980 9336 10394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 10400 11605 gene locus_tag LOCUS_27990 10400 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 11631 12467 gene locus_tag LOCUS_28000 gene mqnD 11631 12467 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66654 protein_id gnl|my_center|LOCUS_28000 13187 12468 gene locus_tag LOCUS_28010 13187 12468 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941299.1 protein_id gnl|my_center|LOCUS_28010 13225 14046 gene locus_tag LOCUS_28020 13225 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 15033 14050 gene locus_tag LOCUS_28030 15033 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703860.1 protein_id gnl|my_center|LOCUS_28030 15132 16940 gene locus_tag LOCUS_28040 15132 16940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 17948 16953 gene locus_tag LOCUS_28050 gene add 17948 16953 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186V5 protein_id gnl|my_center|LOCUS_28050 18434 17979 gene locus_tag LOCUS_28060 18434 17979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 19237 18431 gene locus_tag LOCUS_28070 19237 18431 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970849.1 protein_id gnl|my_center|LOCUS_28070 19313 19885 gene locus_tag LOCUS_28080 19313 19885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 19942 20487 gene locus_tag LOCUS_28090 19942 20487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 20492 21184 gene locus_tag LOCUS_28100 20492 21184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 21181 22698 gene locus_tag LOCUS_28110 21181 22698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 22732 23073 gene locus_tag LOCUS_28120 22732 23073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 24384 23074 gene locus_tag LOCUS_28130 gene pepP 24384 23074 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206099.1 protein_id gnl|my_center|LOCUS_28130 >Feature sequence081 2160 1582 gene locus_tag LOCUS_28140 2160 1582 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258555.1 protein_id gnl|my_center|LOCUS_28140 2259 3578 gene locus_tag LOCUS_28150 2259 3578 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728106.1 protein_id gnl|my_center|LOCUS_28150 3664 4554 gene locus_tag LOCUS_28160 3664 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 4622 6325 gene locus_tag LOCUS_28170 4622 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 6400 7335 gene locus_tag LOCUS_28180 6400 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 7542 8429 gene locus_tag LOCUS_28190 7542 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 8485 8898 gene locus_tag LOCUS_28200 8485 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 9003 9584 gene locus_tag LOCUS_28210 9003 9584 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_28210 9584 10279 gene locus_tag LOCUS_28220 9584 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415118.1 protein_id gnl|my_center|LOCUS_28220 10574 10269 gene locus_tag LOCUS_28230 10574 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 12612 10618 gene locus_tag LOCUS_28240 12612 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 13069 12617 gene locus_tag LOCUS_28250 13069 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 13229 15235 gene locus_tag LOCUS_28260 13229 15235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 15374 15189 gene locus_tag LOCUS_28270 15374 15189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 15396 16238 gene locus_tag LOCUS_28280 15396 16238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 18103 16229 gene locus_tag LOCUS_28290 18103 16229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 19695 18100 gene locus_tag LOCUS_28300 19695 18100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 20821 19706 gene locus_tag LOCUS_28310 20821 19706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 <24174 20823 gene locus_tag LOCUS_28320 <24174 20823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KDA7:nuclease SbcCD subunit C >Feature sequence082 1289 270 gene locus_tag LOCUS_28330 1289 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1380 1595 gene locus_tag LOCUS_28340 1380 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 1614 2588 gene locus_tag LOCUS_28350 gene queA 1614 2588 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3H6 protein_id gnl|my_center|LOCUS_28350 2596 3708 gene locus_tag LOCUS_28360 gene tgt-2 2596 3708 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X3 protein_id gnl|my_center|LOCUS_28360 3698 4036 gene locus_tag LOCUS_28370 gene yajC 3698 4036 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545404.1 protein_id gnl|my_center|LOCUS_28370 4033 5790 gene locus_tag LOCUS_28380 gene secD 4033 5790 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIG9 protein_id gnl|my_center|LOCUS_28380 5801 6985 gene locus_tag LOCUS_28390 5801 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28390 7036 7326 gene locus_tag LOCUS_28400 gene ihfB-1 7036 7326 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_28400 7326 7910 gene locus_tag LOCUS_28410 7326 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 7926 9284 gene locus_tag LOCUS_28420 7926 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_28420 9386 10012 gene locus_tag LOCUS_28430 gene rlmB 9386 10012 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG60 protein_id gnl|my_center|LOCUS_28430 11142 10009 gene locus_tag LOCUS_28440 11142 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 12536 11244 gene locus_tag LOCUS_28450 gene gshA 12536 11244 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338651.1 protein_id gnl|my_center|LOCUS_28450 12572 13144 gene locus_tag LOCUS_28460 12572 13144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 14221 13157 gene locus_tag LOCUS_28470 14221 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 14220 14957 gene locus_tag LOCUS_28480 14220 14957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 14954 15472 gene locus_tag LOCUS_28490 14954 15472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 16337 15453 gene locus_tag LOCUS_28500 gene gpsA 16337 15453 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62F47 protein_id gnl|my_center|LOCUS_28500 17902 16334 gene locus_tag LOCUS_28510 17902 16334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 18029 18544 gene locus_tag LOCUS_28520 18029 18544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 18584 18937 gene locus_tag LOCUS_28530 gene apaG 18584 18937 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VU61 protein_id gnl|my_center|LOCUS_28530 18947 20008 gene locus_tag LOCUS_28540 18947 20008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 20028 21836 gene locus_tag LOCUS_28550 20028 21836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 21846 22598 gene locus_tag LOCUS_28560 21846 22598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 23604 22603 gene locus_tag LOCUS_28570 23604 22603 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920875.1 protein_id gnl|my_center|LOCUS_28570 <24158 23592 gene locus_tag LOCUS_28580 <24158 23592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PAT3:thiopurine S-methyltransferase >Feature sequence083 426 247 gene locus_tag LOCUS_28590 426 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 726 505 gene locus_tag LOCUS_28600 726 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 801 1694 gene locus_tag LOCUS_28610 801 1694 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973579.1 protein_id gnl|my_center|LOCUS_28610 2233 1778 gene locus_tag LOCUS_28620 2233 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 2962 2342 gene locus_tag LOCUS_28630 2962 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 2945 3919 gene locus_tag LOCUS_28640 2945 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 3947 4546 gene locus_tag LOCUS_28650 3947 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 5217 4528 gene locus_tag LOCUS_28660 5217 4528 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_28660 5757 5269 gene locus_tag LOCUS_28670 5757 5269 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WM6 protein_id gnl|my_center|LOCUS_28670 7184 5757 gene locus_tag LOCUS_28680 7184 5757 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038655.1 protein_id gnl|my_center|LOCUS_28680 9011 7203 gene locus_tag LOCUS_28690 9011 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 10167 9016 gene locus_tag LOCUS_28700 10167 9016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 11264 10164 gene locus_tag LOCUS_28710 11264 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 11995 11303 gene locus_tag LOCUS_28720 11995 11303 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_28720 13229 12006 gene locus_tag LOCUS_28730 13229 12006 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_28730 14524 13226 gene locus_tag LOCUS_28740 14524 13226 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_28740 15812 14535 gene locus_tag LOCUS_28750 15812 14535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 16557 15847 gene locus_tag LOCUS_28760 16557 15847 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_28760 17174 16554 gene locus_tag LOCUS_28770 17174 16554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 18552 17308 gene locus_tag LOCUS_28780 18552 17308 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979323.1 protein_id gnl|my_center|LOCUS_28780 19760 18552 gene locus_tag LOCUS_28790 gene paaJ 19760 18552 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390637.1 protein_id gnl|my_center|LOCUS_28790 18681 18754 gene locus_tag LOCUS_t00150 18681 18754 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 19799 21157 gene locus_tag LOCUS_28800 19799 21157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 21154 22671 gene locus_tag LOCUS_28810 gene mdsA 21154 22671 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121930.1 protein_id gnl|my_center|LOCUS_28810 23713 22673 gene locus_tag LOCUS_28820 23713 22673 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868467.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence084 769 290 gene locus_tag LOCUS_28830 769 290 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887233.1 protein_id gnl|my_center|LOCUS_28830 790 1107 gene locus_tag LOCUS_28840 790 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 1104 2216 gene locus_tag LOCUS_28850 1104 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 2231 3868 gene locus_tag LOCUS_28860 2231 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 5246 3813 gene locus_tag LOCUS_28870 5246 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 6157 5246 gene locus_tag LOCUS_28880 6157 5246 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_28880 6205 6390 gene locus_tag LOCUS_28890 6205 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 6408 8162 gene locus_tag LOCUS_28900 gene oadA 6408 8162 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932515.1 protein_id gnl|my_center|LOCUS_28900 8159 9292 gene locus_tag LOCUS_28910 8159 9292 CDS product glutaconyl-CoA decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_28910 9294 10145 gene locus_tag LOCUS_28920 9294 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 10178 10648 gene locus_tag LOCUS_28930 10178 10648 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944499.1 protein_id gnl|my_center|LOCUS_28930 12073 10844 gene locus_tag LOCUS_28940 12073 10844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 12121 12858 gene locus_tag LOCUS_28950 12121 12858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 12855 13172 gene locus_tag LOCUS_28960 12855 13172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 13688 13188 gene locus_tag LOCUS_28970 13688 13188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 14553 13693 gene locus_tag LOCUS_28980 gene ubiA 14553 13693 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804089.1 protein_id gnl|my_center|LOCUS_28980 14450 16087 gene locus_tag LOCUS_28990 gene lap 14450 16087 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZQ8 protein_id gnl|my_center|LOCUS_28990 16096 16806 gene locus_tag LOCUS_29000 16096 16806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 16803 17096 gene locus_tag LOCUS_29010 16803 17096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 17104 17316 gene locus_tag LOCUS_29020 17104 17316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 18635 17319 gene locus_tag LOCUS_29030 18635 17319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 19462 18632 gene locus_tag LOCUS_29040 19462 18632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 20339 19497 gene locus_tag LOCUS_29050 20339 19497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 20897 20403 gene locus_tag LOCUS_29060 20897 20403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 22204 20894 gene locus_tag LOCUS_29070 22204 20894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence085 801 28 gene locus_tag LOCUS_29080 801 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887695.1 protein_id gnl|my_center|LOCUS_29080 1472 798 gene locus_tag LOCUS_29090 1472 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 3100 1472 gene locus_tag LOCUS_29100 3100 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 3380 3117 gene locus_tag LOCUS_29110 3380 3117 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222118.1 protein_id gnl|my_center|LOCUS_29110 3613 3335 gene locus_tag LOCUS_29120 3613 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 3501 5039 gene locus_tag LOCUS_29130 3501 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 7664 5043 gene locus_tag LOCUS_29140 7664 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 8515 7661 gene locus_tag LOCUS_29150 8515 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 9600 8512 gene locus_tag LOCUS_29160 9600 8512 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL80 protein_id gnl|my_center|LOCUS_29160 10288 9641 gene locus_tag LOCUS_29170 10288 9641 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038464.1 protein_id gnl|my_center|LOCUS_29170 11028 10285 gene locus_tag LOCUS_29180 11028 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 11065 11394 gene locus_tag LOCUS_29190 11065 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 11391 13010 gene locus_tag LOCUS_29200 11391 13010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 13881 13234 gene locus_tag LOCUS_29210 13881 13234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 13921 14496 gene locus_tag LOCUS_29220 13921 14496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 15707 15015 gene locus_tag LOCUS_29230 15707 15015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 17785 15704 gene locus_tag LOCUS_29240 17785 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 18504 17782 gene locus_tag LOCUS_29250 18504 17782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 18523 19557 gene locus_tag LOCUS_29260 18523 19557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 20288 19527 gene locus_tag LOCUS_29270 20288 19527 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403573.1 protein_id gnl|my_center|LOCUS_29270 21007 20288 gene locus_tag LOCUS_29280 21007 20288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 21048 21782 gene locus_tag LOCUS_29290 21048 21782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 22453 21743 gene locus_tag LOCUS_29300 22453 21743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 22579 22827 gene locus_tag LOCUS_29310 22579 22827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 22914 23405 gene locus_tag LOCUS_29320 22914 23405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 >Feature sequence086 831 1754 gene locus_tag LOCUS_29330 831 1754 CDS product UDP-glucose 4-epimerase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_29330 1751 2620 gene locus_tag LOCUS_29340 1751 2620 CDS product sulfatase modifying factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888137.1 protein_id gnl|my_center|LOCUS_29340 6172 2648 gene locus_tag LOCUS_29350 6172 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 7132 6323 gene locus_tag LOCUS_29360 7132 6323 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_29360 7580 7146 gene locus_tag LOCUS_29370 7580 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 8122 7580 gene locus_tag LOCUS_29380 8122 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 8161 8940 gene locus_tag LOCUS_29390 8161 8940 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267274.1 protein_id gnl|my_center|LOCUS_29390 8931 9911 gene locus_tag LOCUS_29400 8931 9911 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031746.1 protein_id gnl|my_center|LOCUS_29400 9904 10797 gene locus_tag LOCUS_29410 gene accD 9904 10797 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VC83 protein_id gnl|my_center|LOCUS_29410 10836 12014 gene locus_tag LOCUS_29420 gene folC 10836 12014 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141076.1 protein_id gnl|my_center|LOCUS_29420 12404 12030 gene locus_tag LOCUS_29430 12404 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 12763 12404 gene locus_tag LOCUS_29440 12763 12404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 13266 12760 gene locus_tag LOCUS_29450 13266 12760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 13324 14334 gene locus_tag LOCUS_29460 gene fliC 13324 14334 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748G4 protein_id gnl|my_center|LOCUS_29460 14493 15416 gene locus_tag LOCUS_29470 14493 15416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 15566 16393 gene locus_tag LOCUS_29480 gene fliC 15566 16393 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748G4 protein_id gnl|my_center|LOCUS_29480 16496 17821 gene locus_tag LOCUS_29490 gene fliD 16496 17821 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA8 protein_id gnl|my_center|LOCUS_29490 17830 18183 gene locus_tag LOCUS_29500 17830 18183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 18186 18479 gene locus_tag LOCUS_29510 18186 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 18511 19029 gene locus_tag LOCUS_29520 18511 19029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 19001 19573 gene locus_tag LOCUS_29530 19001 19573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 19570 21717 gene locus_tag LOCUS_29540 19570 21717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 21729 22250 gene locus_tag LOCUS_29550 21729 22250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 22376 22732 gene locus_tag LOCUS_29560 22376 22732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 22741 23130 gene locus_tag LOCUS_29570 22741 23130 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X185 protein_id gnl|my_center|LOCUS_29570 >Feature sequence087 497 57 gene locus_tag LOCUS_29580 497 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 496 867 gene locus_tag LOCUS_29590 496 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 1164 871 gene locus_tag LOCUS_29600 1164 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 2104 1133 gene locus_tag LOCUS_29610 2104 1133 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229548.1 protein_id gnl|my_center|LOCUS_29610 2156 2518 gene locus_tag LOCUS_29620 2156 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 2515 3387 gene locus_tag LOCUS_29630 2515 3387 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367933.1 protein_id gnl|my_center|LOCUS_29630 3384 3863 gene locus_tag LOCUS_29640 3384 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 4871 3864 gene locus_tag LOCUS_29650 4871 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 5392 4865 gene locus_tag LOCUS_29660 5392 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 5409 6137 gene locus_tag LOCUS_29670 5409 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389315.1 protein_id gnl|my_center|LOCUS_29670 7010 6180 gene locus_tag LOCUS_29680 7010 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 7585 7007 gene locus_tag LOCUS_29690 7585 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 8274 7582 gene locus_tag LOCUS_29700 8274 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 9474 8284 gene locus_tag LOCUS_29710 9474 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 9496 11187 gene locus_tag LOCUS_29720 9496 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 11188 12006 gene locus_tag LOCUS_29730 11188 12006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 12021 13703 gene locus_tag LOCUS_29740 12021 13703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 15298 13700 gene locus_tag LOCUS_29750 15298 13700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 16179 15307 gene locus_tag LOCUS_29760 16179 15307 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_29760 17014 16190 gene locus_tag LOCUS_29770 17014 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 17193 18272 gene locus_tag LOCUS_29780 17193 18272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 18907 18269 gene locus_tag LOCUS_29790 18907 18269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 18906 20597 gene locus_tag LOCUS_29800 18906 20597 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_29800 20807 20601 gene locus_tag LOCUS_29810 20807 20601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 21601 20804 gene locus_tag LOCUS_29820 21601 20804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 21650 22582 gene locus_tag LOCUS_29830 21650 22582 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268875.1 protein_id gnl|my_center|LOCUS_29830 >Feature sequence088 3619 2057 gene locus_tag LOCUS_29840 3619 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141838.1 protein_id gnl|my_center|LOCUS_29840 4428 3616 gene locus_tag LOCUS_29850 4428 3616 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817032.1 protein_id gnl|my_center|LOCUS_29850 5228 4437 gene locus_tag LOCUS_29860 5228 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 6628 5333 gene locus_tag LOCUS_29870 6628 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 6652 7560 gene locus_tag LOCUS_29880 gene glk 6652 7560 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHY9 protein_id gnl|my_center|LOCUS_29880 7623 8966 gene locus_tag LOCUS_29890 7623 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 9005 9424 gene locus_tag LOCUS_29900 9005 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 11288 9591 gene locus_tag LOCUS_29910 11288 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 13382 11661 gene locus_tag LOCUS_29920 13382 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 13493 14125 gene locus_tag LOCUS_29930 13493 14125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 14825 14148 gene locus_tag LOCUS_29940 14825 14148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 14865 15968 gene locus_tag LOCUS_29950 14865 15968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 15965 16546 gene locus_tag LOCUS_29960 15965 16546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 17192 16698 gene locus_tag LOCUS_29970 17192 16698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 17652 17254 gene locus_tag LOCUS_29980 17652 17254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 19833 17713 gene locus_tag LOCUS_29990 19833 17713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 20540 19830 gene locus_tag LOCUS_30000 20540 19830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 21313 20549 gene locus_tag LOCUS_30010 21313 20549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 21353 22228 gene locus_tag LOCUS_30020 21353 22228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 22282 23040 gene locus_tag LOCUS_30030 22282 23040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 >Feature sequence089 32 334 gene locus_tag LOCUS_30040 32 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 726 331 gene locus_tag LOCUS_30050 gene atpC 726 331 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05434 protein_id gnl|my_center|LOCUS_30050 2162 729 gene locus_tag LOCUS_30060 gene atpD 2162 729 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY0 protein_id gnl|my_center|LOCUS_30060 3098 2172 gene locus_tag LOCUS_30070 gene atpG 3098 2172 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY1 protein_id gnl|my_center|LOCUS_30070 4658 3129 gene locus_tag LOCUS_30080 gene atpA 4658 3129 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY2 protein_id gnl|my_center|LOCUS_30080 5231 4668 gene locus_tag LOCUS_30090 gene atpH 5231 4668 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY3 protein_id gnl|my_center|LOCUS_30090 5787 5224 gene locus_tag LOCUS_30100 5787 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 6278 5784 gene locus_tag LOCUS_30110 6278 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 6695 6429 gene locus_tag LOCUS_30120 6695 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 7315 6692 gene locus_tag LOCUS_30130 7315 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 7739 7335 gene locus_tag LOCUS_30140 7739 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 8644 7790 gene locus_tag LOCUS_30150 8644 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 8570 8761 gene locus_tag LOCUS_30160 8570 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 11337 8785 gene locus_tag LOCUS_30170 11337 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 11667 11407 gene locus_tag LOCUS_30180 11667 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 11872 11705 gene locus_tag LOCUS_30190 11872 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 11873 12094 gene locus_tag LOCUS_30200 11873 12094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 12143 12913 gene locus_tag LOCUS_30210 12143 12913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 12997 14712 gene locus_tag LOCUS_30220 12997 14712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 15559 14687 gene locus_tag LOCUS_30230 15559 14687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 16613 15933 gene locus_tag LOCUS_30240 16613 15933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 18221 16659 gene locus_tag LOCUS_30250 18221 16659 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143047.1 protein_id gnl|my_center|LOCUS_30250 20221 18251 gene locus_tag LOCUS_30260 20221 18251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 20102 20728 gene locus_tag LOCUS_30270 20102 20728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 21150 20722 gene locus_tag LOCUS_30280 21150 20722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 21723 21175 gene locus_tag LOCUS_30290 21723 21175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 21792 22727 gene locus_tag LOCUS_30300 21792 22727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 >Feature sequence090 440 138 gene locus_tag LOCUS_30310 440 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 454 1050 gene locus_tag LOCUS_30320 454 1050 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084056.1 protein_id gnl|my_center|LOCUS_30320 1060 1305 gene locus_tag LOCUS_30330 1060 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 1410 1979 gene locus_tag LOCUS_30340 1410 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 2021 3712 gene locus_tag LOCUS_30350 gene argS 2021 3712 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RG14 protein_id gnl|my_center|LOCUS_30350 3709 4821 gene locus_tag LOCUS_30360 3709 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 4818 5213 gene locus_tag LOCUS_30370 4818 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 5210 6856 gene locus_tag LOCUS_30380 5210 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 6886 9363 gene locus_tag LOCUS_30390 6886 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 10593 9352 gene locus_tag LOCUS_30400 10593 9352 CDS product GDL motif peptide-associated radical SAM/SPASM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200682.1 protein_id gnl|my_center|LOCUS_30400 10949 10593 gene locus_tag LOCUS_30410 10949 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 11066 12712 gene locus_tag LOCUS_30420 11066 12712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 12754 14049 gene locus_tag LOCUS_30430 12754 14049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 14055 14399 gene locus_tag LOCUS_30440 14055 14399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 14809 14375 gene locus_tag LOCUS_30450 14809 14375 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583173.1 protein_id gnl|my_center|LOCUS_30450 15406 14816 gene locus_tag LOCUS_30460 15406 14816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 16308 15457 gene locus_tag LOCUS_30470 16308 15457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 16339 18114 gene locus_tag LOCUS_30480 16339 18114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 18119 18763 gene locus_tag LOCUS_30490 18119 18763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 18790 19737 gene locus_tag LOCUS_30500 18790 19737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 19737 20414 gene locus_tag LOCUS_30510 19737 20414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 20468 22111 gene locus_tag LOCUS_30520 20468 22111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 22742 22014 gene locus_tag LOCUS_30530 22742 22014 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 protein_id gnl|my_center|LOCUS_30530 >Feature sequence091 2605 803 gene locus_tag LOCUS_30540 2605 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84087 protein_id gnl|my_center|LOCUS_30540 2671 3582 gene locus_tag LOCUS_30550 2671 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 3583 6675 gene locus_tag LOCUS_30560 3583 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 7267 6626 gene locus_tag LOCUS_30570 7267 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 9352 7334 gene locus_tag LOCUS_30580 9352 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 9300 10736 gene locus_tag LOCUS_30590 9300 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 11266 10742 gene locus_tag LOCUS_30600 11266 10742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 12279 11254 gene locus_tag LOCUS_30610 12279 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 13793 12279 gene locus_tag LOCUS_30620 13793 12279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 13808 15487 gene locus_tag LOCUS_30630 13808 15487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 15484 18144 gene locus_tag LOCUS_30640 15484 18144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 18855 18112 gene locus_tag LOCUS_30650 18855 18112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 19486 18947 gene locus_tag LOCUS_30660 19486 18947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 19485 20177 gene locus_tag LOCUS_30670 19485 20177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 21069 20140 gene locus_tag LOCUS_30680 21069 20140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 21457 21053 gene locus_tag LOCUS_30690 21457 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 21516 22271 gene locus_tag LOCUS_30700 21516 22271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 >Feature sequence092 2548 1691 gene locus_tag LOCUS_30710 2548 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 3810 2563 gene locus_tag LOCUS_30720 3810 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 5123 3807 gene locus_tag LOCUS_30730 5123 3807 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403690.1 protein_id gnl|my_center|LOCUS_30730 5638 5186 gene locus_tag LOCUS_30740 5638 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 6160 5699 gene locus_tag LOCUS_30750 6160 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 7112 6249 gene locus_tag LOCUS_30760 7112 6249 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_30760 9202 7112 gene locus_tag LOCUS_30770 9202 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 10173 9199 gene locus_tag LOCUS_30780 10173 9199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066646.1 protein_id gnl|my_center|LOCUS_30780 10274 10939 gene locus_tag LOCUS_30790 10274 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 11955 10996 gene locus_tag LOCUS_30800 11955 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 13643 11955 gene locus_tag LOCUS_30810 13643 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 15682 13640 gene locus_tag LOCUS_30820 15682 13640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 19350 15679 gene locus_tag LOCUS_30830 19350 15679 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258114.1 protein_id gnl|my_center|LOCUS_30830 19526 19338 gene locus_tag LOCUS_30840 19526 19338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 >Feature sequence093 1083 1382 gene locus_tag LOCUS_30850 1083 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 1382 2086 gene locus_tag LOCUS_30860 1382 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 2723 2076 gene locus_tag LOCUS_30870 2723 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 3395 2739 gene locus_tag LOCUS_30880 3395 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 3479 4222 gene locus_tag LOCUS_30890 3479 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 4238 5560 gene locus_tag LOCUS_30900 4238 5560 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_30900 5868 5551 gene locus_tag LOCUS_30910 5868 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 5949 7325 gene locus_tag LOCUS_30920 5949 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 7322 8368 gene locus_tag LOCUS_30930 7322 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 8365 9741 gene locus_tag LOCUS_30940 8365 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 9741 10841 gene locus_tag LOCUS_30950 9741 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 10851 12215 gene locus_tag LOCUS_30960 10851 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_30960 13168 12212 gene locus_tag LOCUS_30970 13168 12212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 13192 14982 gene locus_tag LOCUS_30980 13192 14982 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878377.1 protein_id gnl|my_center|LOCUS_30980 15023 16246 gene locus_tag LOCUS_30990 15023 16246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 16628 16194 gene locus_tag LOCUS_31000 16628 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 16876 16655 gene locus_tag LOCUS_31010 16876 16655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 18476 16893 gene locus_tag LOCUS_31020 18476 16893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 19002 18478 gene locus_tag LOCUS_31030 19002 18478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 20085 19096 gene locus_tag LOCUS_31040 20085 19096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 20150 22039 gene locus_tag LOCUS_31050 20150 22039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 >Feature sequence094 <1 1170 gene locus_tag LOCUS_31060 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K0MDQ3:cysteine desulfurase IscS 1205 1588 gene locus_tag LOCUS_31070 gene iscU 1205 1588 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ33 protein_id gnl|my_center|LOCUS_31070 1591 1923 gene locus_tag LOCUS_31080 gene sufA 1591 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32113 protein_id gnl|my_center|LOCUS_31080 1930 2481 gene locus_tag LOCUS_31090 1930 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 2515 4308 gene locus_tag LOCUS_31100 gene hscA 2515 4308 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXG7 protein_id gnl|my_center|LOCUS_31100 4451 5137 gene locus_tag LOCUS_31110 4451 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 6587 5103 gene locus_tag LOCUS_31120 6587 5103 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978555.1 protein_id gnl|my_center|LOCUS_31120 6602 8722 gene locus_tag LOCUS_31130 6602 8722 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268962.1 protein_id gnl|my_center|LOCUS_31130 8745 9368 gene locus_tag LOCUS_31140 8745 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 9362 11269 gene locus_tag LOCUS_31150 9362 11269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 11266 12003 gene locus_tag LOCUS_31160 11266 12003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 13977 12010 gene locus_tag LOCUS_31170 13977 12010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 14006 14932 gene locus_tag LOCUS_31180 14006 14932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 15340 14933 gene locus_tag LOCUS_31190 15340 14933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 16519 15350 gene locus_tag LOCUS_31200 16519 15350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 17784 16522 gene locus_tag LOCUS_31210 17784 16522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 18576 17794 gene locus_tag LOCUS_31220 18576 17794 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_31220 19406 18579 gene locus_tag LOCUS_31230 19406 18579 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H76 protein_id gnl|my_center|LOCUS_31230 19467 19871 gene locus_tag LOCUS_31240 19467 19871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 19868 20731 gene locus_tag LOCUS_31250 19868 20731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 >Feature sequence095 1455 25 gene locus_tag LOCUS_31260 1455 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 2625 1588 gene locus_tag LOCUS_31270 2625 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 2666 4123 gene locus_tag LOCUS_31280 2666 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 5585 4134 gene locus_tag LOCUS_31290 5585 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 6520 5582 gene locus_tag LOCUS_31300 6520 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 7225 6521 gene locus_tag LOCUS_31310 7225 6521 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327800.1 protein_id gnl|my_center|LOCUS_31310 7346 9316 gene locus_tag LOCUS_31320 7346 9316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 9885 9319 gene locus_tag LOCUS_31330 9885 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 9954 10508 gene locus_tag LOCUS_31340 9954 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 10499 11020 gene locus_tag LOCUS_31350 10499 11020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 11798 10989 gene locus_tag LOCUS_31360 11798 10989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 12643 11795 gene locus_tag LOCUS_31370 12643 11795 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UB8 protein_id gnl|my_center|LOCUS_31370 12667 13329 gene locus_tag LOCUS_31380 12667 13329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 13329 14672 gene locus_tag LOCUS_31390 13329 14672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 14672 15556 gene locus_tag LOCUS_31400 14672 15556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 16489 15563 gene locus_tag LOCUS_31410 16489 15563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 19383 16504 gene locus_tag LOCUS_31420 19383 16504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 21747 19426 gene locus_tag LOCUS_31430 gene lon 21747 19426 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGB5 protein_id gnl|my_center|LOCUS_31430 >Feature sequence096 738 2678 gene locus_tag LOCUS_31440 738 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 3325 2693 gene locus_tag LOCUS_31450 3325 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 3267 6617 gene locus_tag LOCUS_31460 3267 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 6846 6598 gene locus_tag LOCUS_31470 6846 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 8185 6899 gene locus_tag LOCUS_31480 8185 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 8850 8203 gene locus_tag LOCUS_31490 8850 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 9290 8847 gene locus_tag LOCUS_31500 gene rpoE 9290 8847 CDS product ECF RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYV6 protein_id gnl|my_center|LOCUS_31500 9925 9368 gene locus_tag LOCUS_31510 9925 9368 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5A2 protein_id gnl|my_center|LOCUS_31510 9950 10963 gene locus_tag LOCUS_31520 gene rsgA 9950 10963 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFS8 protein_id gnl|my_center|LOCUS_31520 10980 11840 gene locus_tag LOCUS_31530 10980 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 11893 15168 gene locus_tag LOCUS_31540 gene recC 11893 15168 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CY8 protein_id gnl|my_center|LOCUS_31540 15165 18836 gene locus_tag LOCUS_31550 gene recB 15165 18836 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ58 protein_id gnl|my_center|LOCUS_31550 18830 20644 gene locus_tag LOCUS_31560 gene recD 18830 20644 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CY6 protein_id gnl|my_center|LOCUS_31560 20641 21855 gene locus_tag LOCUS_31570 gene sbcD 20641 21855 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMP7 protein_id gnl|my_center|LOCUS_31570 >Feature sequence097 161 667 gene locus_tag LOCUS_31580 161 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 1775 702 gene locus_tag LOCUS_31590 1775 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 3535 1856 gene locus_tag LOCUS_31600 3535 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 4656 3532 gene locus_tag LOCUS_31610 4656 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932129.1 protein_id gnl|my_center|LOCUS_31610 5758 4649 gene locus_tag LOCUS_31620 5758 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932129.1 protein_id gnl|my_center|LOCUS_31620 6651 5737 gene locus_tag LOCUS_31630 6651 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 7046 6642 gene locus_tag LOCUS_31640 7046 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 7069 8424 gene locus_tag LOCUS_31650 7069 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 8505 9431 gene locus_tag LOCUS_31660 8505 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 9431 11938 gene locus_tag LOCUS_31670 gene xcpQ 9431 11938 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_31670 11938 13626 gene locus_tag LOCUS_31680 gene gspE 11938 13626 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940996.1 protein_id gnl|my_center|LOCUS_31680 13628 14866 gene locus_tag LOCUS_31690 gene gspF 13628 14866 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_31690 14878 15297 gene locus_tag LOCUS_31700 gene gspG 14878 15297 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_31700 15377 16132 gene locus_tag LOCUS_31710 15377 16132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 16135 16788 gene locus_tag LOCUS_31720 16135 16788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 16788 17618 gene locus_tag LOCUS_31730 16788 17618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 17615 18880 gene locus_tag LOCUS_31740 17615 18880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 18883 20529 gene locus_tag LOCUS_31750 18883 20529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 20529 21116 gene locus_tag LOCUS_31760 20529 21116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 >Feature sequence098 2084 231 gene locus_tag LOCUS_31770 2084 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 3774 2053 gene locus_tag LOCUS_31780 gene pilB 3774 2053 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_31780 4585 3845 gene locus_tag LOCUS_31790 4585 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 5141 4575 gene locus_tag LOCUS_31800 5141 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 5049 5975 gene locus_tag LOCUS_31810 5049 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 7596 5965 gene locus_tag LOCUS_31820 7596 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 8488 7616 gene locus_tag LOCUS_31830 8488 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 8503 8982 gene locus_tag LOCUS_31840 8503 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 9845 8991 gene locus_tag LOCUS_31850 9845 8991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 11174 9891 gene locus_tag LOCUS_31860 11174 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 13428 11176 gene locus_tag LOCUS_31870 13428 11176 CDS product inter-alpha-trypsin inhibitor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122418.1 protein_id gnl|my_center|LOCUS_31870 13531 14379 gene locus_tag LOCUS_31880 13531 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 14376 15152 gene locus_tag LOCUS_31890 14376 15152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 15162 15644 gene locus_tag LOCUS_31900 15162 15644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 15754 16788 gene locus_tag LOCUS_31910 15754 16788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 17942 16794 gene locus_tag LOCUS_31920 17942 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 17966 19315 gene locus_tag LOCUS_31930 17966 19315 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_31930 21841 19340 gene locus_tag LOCUS_31940 21841 19340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 >Feature sequence099 2070 1252 gene locus_tag LOCUS_31950 gene map 2070 1252 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX4 protein_id gnl|my_center|LOCUS_31950 3821 2070 gene locus_tag LOCUS_31960 3821 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 3874 6660 gene locus_tag LOCUS_31970 3874 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 8372 6603 gene locus_tag LOCUS_31980 8372 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 8597 9136 gene locus_tag LOCUS_31990 8597 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 9911 9492 gene locus_tag LOCUS_32000 9911 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 10032 10268 gene locus_tag LOCUS_32010 10032 10268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 11154 10273 gene locus_tag LOCUS_32020 11154 10273 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 protein_id gnl|my_center|LOCUS_32020 11977 11195 gene locus_tag LOCUS_32030 11977 11195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 12537 11977 gene locus_tag LOCUS_32040 12537 11977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 12896 12666 gene locus_tag LOCUS_32050 12896 12666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 13491 12925 gene locus_tag LOCUS_32060 13491 12925 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200970.1 protein_id gnl|my_center|LOCUS_32060 13528 13902 gene locus_tag LOCUS_32070 13528 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 14709 13903 gene locus_tag LOCUS_32080 14709 13903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 17318 14706 gene locus_tag LOCUS_32090 17318 14706 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_32090 17336 18526 gene locus_tag LOCUS_32100 17336 18526 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGZ5 protein_id gnl|my_center|LOCUS_32100 18526 18975 gene locus_tag LOCUS_32110 18526 18975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 19038 19649 gene locus_tag LOCUS_32120 19038 19649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 19807 19646 gene locus_tag LOCUS_32130 19807 19646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 20561 20121 gene locus_tag LOCUS_32140 20561 20121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 21054 20605 gene locus_tag LOCUS_32150 21054 20605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 21458 21054 gene locus_tag LOCUS_32160 21458 21054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974119.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence100 <1 509 gene locus_tag LOCUS_32170 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MES4:pseudouridine synthase 2631 460 gene locus_tag LOCUS_32180 2631 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 2554 2742 gene locus_tag LOCUS_32190 2554 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 2739 4439 gene locus_tag LOCUS_32200 2739 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 5241 4417 gene locus_tag LOCUS_32210 5241 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 6506 5343 gene locus_tag LOCUS_32220 gene tdh 6506 5343 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBM6 protein_id gnl|my_center|LOCUS_32220 6785 6516 gene locus_tag LOCUS_32230 6785 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 6667 7776 gene locus_tag LOCUS_32240 6667 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_32240 10712 8235 gene locus_tag LOCUS_32250 10712 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 11408 10872 gene locus_tag LOCUS_32260 11408 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 11598 12542 gene locus_tag LOCUS_32270 11598 12542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 12542 13900 gene locus_tag LOCUS_32280 12542 13900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 16595 13920 gene locus_tag LOCUS_32290 16595 13920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 18119 16656 gene locus_tag LOCUS_32300 18119 16656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 19868 18183 gene locus_tag LOCUS_32310 19868 18183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 20491 19865 gene locus_tag LOCUS_32320 20491 19865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 >Feature sequence101 371 1594 gene locus_tag LOCUS_32330 371 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 2552 1596 gene locus_tag LOCUS_32340 2552 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 3533 2562 gene locus_tag LOCUS_32350 3533 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 3750 6311 gene locus_tag LOCUS_32360 3750 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 7495 6335 gene locus_tag LOCUS_32370 7495 6335 CDS product Na+ ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140055.1 protein_id gnl|my_center|LOCUS_32370 8217 7492 gene locus_tag LOCUS_32380 8217 7492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140056.1 protein_id gnl|my_center|LOCUS_32380 9509 8214 gene locus_tag LOCUS_32390 9509 8214 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_32390 9734 10366 gene locus_tag LOCUS_32400 9734 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 10363 12210 gene locus_tag LOCUS_32410 10363 12210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 12210 13529 gene locus_tag LOCUS_32420 12210 13529 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 protein_id gnl|my_center|LOCUS_32420 13533 14822 gene locus_tag LOCUS_32430 13533 14822 CDS product putative acetyl-CoA C-acyltransferase (thiolase) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701746.1 protein_id gnl|my_center|LOCUS_32430 14879 15760 gene locus_tag LOCUS_32440 14879 15760 CDS product phosphopeptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543833.1 protein_id gnl|my_center|LOCUS_32440 15886 16317 gene locus_tag LOCUS_32450 15886 16317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 16757 16470 gene locus_tag LOCUS_32460 16757 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 16783 18450 gene locus_tag LOCUS_32470 16783 18450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 >Feature sequence102 2586 1561 gene locus_tag LOCUS_32480 2586 1561 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027325.1 protein_id gnl|my_center|LOCUS_32480 3223 2627 gene locus_tag LOCUS_32490 3223 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 3385 3792 gene locus_tag LOCUS_32500 3385 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 4880 3873 gene locus_tag LOCUS_32510 4880 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 5611 4946 gene locus_tag LOCUS_32520 5611 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 6061 5633 gene locus_tag LOCUS_32530 6061 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 6491 6096 gene locus_tag LOCUS_32540 6491 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 6907 6521 gene locus_tag LOCUS_32550 6907 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 protein_id gnl|my_center|LOCUS_32550 6962 7573 gene locus_tag LOCUS_32560 6962 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 7608 8717 gene locus_tag LOCUS_32570 7608 8717 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223974.1 protein_id gnl|my_center|LOCUS_32570 8710 10161 gene locus_tag LOCUS_32580 8710 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 10176 10883 gene locus_tag LOCUS_32590 10176 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 10880 11320 gene locus_tag LOCUS_32600 10880 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 12246 11326 gene locus_tag LOCUS_32610 12246 11326 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119887.1 protein_id gnl|my_center|LOCUS_32610 12281 13345 gene locus_tag LOCUS_32620 12281 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 14703 13360 gene locus_tag LOCUS_32630 14703 13360 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203961.1 protein_id gnl|my_center|LOCUS_32630 15969 14713 gene locus_tag LOCUS_32640 15969 14713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 16042 16953 gene locus_tag LOCUS_32650 16042 16953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989559.1 protein_id gnl|my_center|LOCUS_32650 16953 17753 gene locus_tag LOCUS_32660 16953 17753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 17771 19132 gene locus_tag LOCUS_32670 17771 19132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence103 2048 1380 gene locus_tag LOCUS_32680 gene yggS 2048 1380 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_32680 2605 2045 gene locus_tag LOCUS_32690 gene yhdE 2605 2045 CDS product Maf-like protein YceF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MLG0 protein_id gnl|my_center|LOCUS_32690 3075 2602 gene locus_tag LOCUS_32700 3075 2602 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_32700 3620 3072 gene locus_tag LOCUS_32710 3620 3072 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634004.1 protein_id gnl|my_center|LOCUS_32710 8236 3617 gene locus_tag LOCUS_32720 8236 3617 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458266.1 protein_id gnl|my_center|LOCUS_32720 8184 8342 gene locus_tag LOCUS_32730 8184 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 9268 8390 gene locus_tag LOCUS_32740 9268 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 9295 10590 gene locus_tag LOCUS_32750 9295 10590 CDS product Zn-dependent protease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265953.1 protein_id gnl|my_center|LOCUS_32750 13588 10607 gene locus_tag LOCUS_32760 13588 10607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 14018 13620 gene locus_tag LOCUS_32770 14018 13620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 14101 15471 gene locus_tag LOCUS_32780 14101 15471 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 protein_id gnl|my_center|LOCUS_32780 15471 16967 gene locus_tag LOCUS_32790 15471 16967 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_32790 16964 17803 gene locus_tag LOCUS_32800 16964 17803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 17819 19057 gene locus_tag LOCUS_32810 17819 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 19511 19065 gene locus_tag LOCUS_32820 19511 19065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 19583 20221 gene locus_tag LOCUS_32830 19583 20221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 20305 20799 gene locus_tag LOCUS_32840 20305 20799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 >Feature sequence104 637 71 gene locus_tag LOCUS_32850 637 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 1590 643 gene locus_tag LOCUS_32860 1590 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 1671 2726 gene locus_tag LOCUS_32870 gene pks11 1671 2726 CDS product alpha-pyrone synthesis polyketide synthase-like Pks11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VEU7 protein_id gnl|my_center|LOCUS_32870 2726 3289 gene locus_tag LOCUS_32880 2726 3289 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031817.1 protein_id gnl|my_center|LOCUS_32880 3286 3525 gene locus_tag LOCUS_32890 3286 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 3518 5206 gene locus_tag LOCUS_32900 3518 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 5203 6189 gene locus_tag LOCUS_32910 5203 6189 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727207.1 protein_id gnl|my_center|LOCUS_32910 6687 6247 gene locus_tag LOCUS_32920 6687 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 7911 6709 gene locus_tag LOCUS_32930 7911 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 8750 7908 gene locus_tag LOCUS_32940 8750 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 10705 8747 gene locus_tag LOCUS_32950 10705 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 10756 11439 gene locus_tag LOCUS_32960 10756 11439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 12026 11433 gene locus_tag LOCUS_32970 12026 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 12298 11948 gene locus_tag LOCUS_32980 12298 11948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 13019 12291 gene locus_tag LOCUS_32990 13019 12291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 14636 13020 gene locus_tag LOCUS_33000 14636 13020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 17064 14674 gene locus_tag LOCUS_33010 17064 14674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 17241 19613 gene locus_tag LOCUS_33020 17241 19613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 19623 20279 gene locus_tag LOCUS_33030 gene fabG 19623 20279 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 protein_id gnl|my_center|LOCUS_33030 20311 20700 gene locus_tag LOCUS_33040 20311 20700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 >Feature sequence105 <1 859 gene locus_tag LOCUS_33050 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968355.1:aminomethyltransferase 856 2445 gene locus_tag LOCUS_33060 856 2445 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_33060 2442 3788 gene locus_tag LOCUS_33070 2442 3788 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031630.1 protein_id gnl|my_center|LOCUS_33070 4104 3781 gene locus_tag LOCUS_33080 4104 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 6249 4132 gene locus_tag LOCUS_33090 6249 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 7112 6243 gene locus_tag LOCUS_33100 7112 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 8428 7121 gene locus_tag LOCUS_33110 8428 7121 CDS product EscN/YscN/HrcN family type III secretion system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_33110 9081 8425 gene locus_tag LOCUS_33120 9081 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 10098 9088 gene locus_tag LOCUS_33130 gene fliG 10098 9088 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1K0 protein_id gnl|my_center|LOCUS_33130 11627 10110 gene locus_tag LOCUS_33140 gene fliF 11627 10110 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGK2 protein_id gnl|my_center|LOCUS_33140 12561 11677 gene locus_tag LOCUS_33150 12561 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 13646 12570 gene locus_tag LOCUS_33160 13646 12570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 14611 13643 gene locus_tag LOCUS_33170 14611 13643 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_33170 16071 14611 gene locus_tag LOCUS_33180 16071 14611 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107901.1 protein_id gnl|my_center|LOCUS_33180 16868 16068 gene locus_tag LOCUS_33190 16868 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 17752 16886 gene locus_tag LOCUS_33200 17752 16886 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYG1 protein_id gnl|my_center|LOCUS_33200 19998 17749 gene locus_tag LOCUS_33210 19998 17749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 >Feature sequence106 <1 1478 gene locus_tag LOCUS_33220 <1 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002387383.1:serine/threonine protein kinase 2257 1475 gene locus_tag LOCUS_33230 2257 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 2250 2762 gene locus_tag LOCUS_33240 2250 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 2823 3785 gene locus_tag LOCUS_33250 2823 3785 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461474.1 protein_id gnl|my_center|LOCUS_33250 3782 4393 gene locus_tag LOCUS_33260 gene purN 3782 4393 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB5 protein_id gnl|my_center|LOCUS_33260 4450 5346 gene locus_tag LOCUS_33270 gene ctaA 4450 5346 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087694.1 protein_id gnl|my_center|LOCUS_33270 5343 6245 gene locus_tag LOCUS_33280 5343 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 6283 6501 gene locus_tag LOCUS_33290 6283 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 6501 7283 gene locus_tag LOCUS_33300 6501 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 7280 8209 gene locus_tag LOCUS_33310 gene coxB1 7280 8209 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0S5 protein_id gnl|my_center|LOCUS_33310 8212 9846 gene locus_tag LOCUS_33320 gene ctaD 8212 9846 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328372.1 protein_id gnl|my_center|LOCUS_33320 9854 10561 gene locus_tag LOCUS_33330 9854 10561 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_33330 10564 11406 gene locus_tag LOCUS_33340 10564 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 11413 11616 gene locus_tag LOCUS_33350 11413 11616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 11613 12134 gene locus_tag LOCUS_33360 11613 12134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 12937 12101 gene locus_tag LOCUS_33370 12937 12101 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_33370 13689 12934 gene locus_tag LOCUS_33380 13689 12934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 13882 16119 gene locus_tag LOCUS_33390 13882 16119 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LW1 protein_id gnl|my_center|LOCUS_33390 17144 16125 gene locus_tag LOCUS_33400 17144 16125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 18773 17193 gene locus_tag LOCUS_33410 18773 17193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 20251 18770 gene locus_tag LOCUS_33420 20251 18770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 >Feature sequence107 2298 508 gene locus_tag LOCUS_33430 2298 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 3252 2365 gene locus_tag LOCUS_33440 3252 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 3719 3249 gene locus_tag LOCUS_33450 3719 3249 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921412.1 protein_id gnl|my_center|LOCUS_33450 4014 3658 gene locus_tag LOCUS_33460 4014 3658 CDS product heat-shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804865.1 protein_id gnl|my_center|LOCUS_33460 4030 5160 gene locus_tag LOCUS_33470 4030 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 5157 5657 gene locus_tag LOCUS_33480 5157 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 5701 9084 gene locus_tag LOCUS_33490 gene ileS 5701 9084 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ2 protein_id gnl|my_center|LOCUS_33490 9077 9943 gene locus_tag LOCUS_33500 9077 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 9944 11017 gene locus_tag LOCUS_33510 9944 11017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 11636 11019 gene locus_tag LOCUS_33520 11636 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 11635 12531 gene locus_tag LOCUS_33530 11635 12531 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_33530 12587 13765 gene locus_tag LOCUS_33540 12587 13765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 14498 13770 gene locus_tag LOCUS_33550 14498 13770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 16773 14536 gene locus_tag LOCUS_33560 16773 14536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 17974 16796 gene locus_tag LOCUS_33570 17974 16796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 17997 18989 gene locus_tag LOCUS_33580 17997 18989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 <20721 18996 gene locus_tag LOCUS_33590 <20721 18996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258732.1:ABC transporter ATP-binding protein >Feature sequence108 2595 1183 gene locus_tag LOCUS_33600 2595 1183 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_33600 2690 3517 gene locus_tag LOCUS_33610 2690 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 3517 4818 gene locus_tag LOCUS_33620 3517 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087425.1 protein_id gnl|my_center|LOCUS_33620 6293 4869 gene locus_tag LOCUS_33630 6293 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 6362 7207 gene locus_tag LOCUS_33640 6362 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 8554 7310 gene locus_tag LOCUS_33650 8554 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 8986 9690 gene locus_tag LOCUS_33660 8986 9690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 9715 10716 gene locus_tag LOCUS_33670 9715 10716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 10719 11285 gene locus_tag LOCUS_33680 10719 11285 CDS product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940149.1 protein_id gnl|my_center|LOCUS_33680 11319 12932 gene locus_tag LOCUS_33690 11319 12932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 13130 13567 gene locus_tag LOCUS_33700 13130 13567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 13567 14220 gene locus_tag LOCUS_33710 13567 14220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 14242 14604 gene locus_tag LOCUS_33720 14242 14604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 14635 14934 gene locus_tag LOCUS_33730 14635 14934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 14975 15532 gene locus_tag LOCUS_33740 14975 15532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 15655 17091 gene locus_tag LOCUS_33750 15655 17091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 17356 20529 gene locus_tag LOCUS_33760 17356 20529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 >Feature sequence109 3073 566 gene locus_tag LOCUS_33770 3073 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 3658 3110 gene locus_tag LOCUS_33780 3658 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 4005 3595 gene locus_tag LOCUS_33790 4005 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 3896 4225 gene locus_tag LOCUS_33800 3896 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 4278 5267 gene locus_tag LOCUS_33810 4278 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 6523 5285 gene locus_tag LOCUS_33820 6523 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 6738 7691 gene locus_tag LOCUS_33830 6738 7691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 7691 8092 gene locus_tag LOCUS_33840 7691 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 8458 8096 gene locus_tag LOCUS_33850 8458 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 9504 8530 gene locus_tag LOCUS_33860 9504 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 11936 9438 gene locus_tag LOCUS_33870 11936 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 12414 11938 gene locus_tag LOCUS_33880 12414 11938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 12993 12460 gene locus_tag LOCUS_33890 12993 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 13035 13334 gene locus_tag LOCUS_33900 13035 13334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 14019 13339 gene locus_tag LOCUS_33910 14019 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957581.1 protein_id gnl|my_center|LOCUS_33910 15298 14072 gene locus_tag LOCUS_33920 15298 14072 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120592.1 protein_id gnl|my_center|LOCUS_33920 15559 15308 gene locus_tag LOCUS_33930 15559 15308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 15630 16502 gene locus_tag LOCUS_33940 15630 16502 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035301.1 protein_id gnl|my_center|LOCUS_33940 17355 16843 gene locus_tag LOCUS_33950 gene ppiB 17355 16843 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F376 protein_id gnl|my_center|LOCUS_33950 17422 18927 gene locus_tag LOCUS_33960 17422 18927 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941216.1 protein_id gnl|my_center|LOCUS_33960 >Feature sequence110 1488 658 gene locus_tag LOCUS_33970 1488 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 2684 1476 gene locus_tag LOCUS_33980 2684 1476 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259590.1 protein_id gnl|my_center|LOCUS_33980 3907 2684 gene locus_tag LOCUS_33990 3907 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 3963 5294 gene locus_tag LOCUS_34000 3963 5294 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_34000 5300 6073 gene locus_tag LOCUS_34010 5300 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 6174 6854 gene locus_tag LOCUS_34020 6174 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 6865 7359 gene locus_tag LOCUS_34030 6865 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 7359 8447 gene locus_tag LOCUS_34040 7359 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 8447 8986 gene locus_tag LOCUS_34050 8447 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 8990 12160 gene locus_tag LOCUS_34060 8990 12160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 12194 13132 gene locus_tag LOCUS_34070 12194 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 13129 14586 gene locus_tag LOCUS_34080 13129 14586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 14596 16539 gene locus_tag LOCUS_34090 14596 16539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 19521 16549 gene locus_tag LOCUS_34100 19521 16549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 >Feature sequence111 1507 140 gene locus_tag LOCUS_34110 1507 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 1839 1504 gene locus_tag LOCUS_34120 1839 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 2195 1842 gene locus_tag LOCUS_34130 2195 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 2743 2195 gene locus_tag LOCUS_34140 2743 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 3561 2740 gene locus_tag LOCUS_34150 3561 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 3691 4176 gene locus_tag LOCUS_34160 3691 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 5614 4448 gene locus_tag LOCUS_34170 5614 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 5673 6542 gene locus_tag LOCUS_34180 5673 6542 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147293.1 protein_id gnl|my_center|LOCUS_34180 6539 8923 gene locus_tag LOCUS_34190 gene priA 6539 8923 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y675 protein_id gnl|my_center|LOCUS_34190 8933 9907 gene locus_tag LOCUS_34200 8933 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 9909 10823 gene locus_tag LOCUS_34210 9909 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 10874 12997 gene locus_tag LOCUS_34220 10874 12997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 13439 12987 gene locus_tag LOCUS_34230 13439 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 13539 15239 gene locus_tag LOCUS_34240 13539 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 15323 16366 gene locus_tag LOCUS_34250 gene ald 15323 16366 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEI3 protein_id gnl|my_center|LOCUS_34250 16363 16788 gene locus_tag LOCUS_34260 gene mceE 16363 16788 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_34260 16785 17906 gene locus_tag LOCUS_34270 16785 17906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 >Feature sequence112 2152 1241 gene locus_tag LOCUS_34280 2152 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 3282 2152 gene locus_tag LOCUS_34290 3282 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 3344 3919 gene locus_tag LOCUS_34300 3344 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 3939 5822 gene locus_tag LOCUS_34310 3939 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 5819 6604 gene locus_tag LOCUS_34320 5819 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 6665 7858 gene locus_tag LOCUS_34330 6665 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 8740 7868 gene locus_tag LOCUS_34340 8740 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656251.1 protein_id gnl|my_center|LOCUS_34340 10512 8737 gene locus_tag LOCUS_34350 10512 8737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 10550 12436 gene locus_tag LOCUS_34360 10550 12436 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791176.1 protein_id gnl|my_center|LOCUS_34360 13183 12440 gene locus_tag LOCUS_34370 13183 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 13219 15450 gene locus_tag LOCUS_34380 13219 15450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 15763 15431 gene locus_tag LOCUS_34390 15763 15431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 19008 15760 gene locus_tag LOCUS_34400 19008 15760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 >Feature sequence113 1027 380 gene locus_tag LOCUS_34410 1027 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 2676 1024 gene locus_tag LOCUS_34420 2676 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 4034 2673 gene locus_tag LOCUS_34430 4034 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 6607 4082 gene locus_tag LOCUS_34440 6607 4082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258514.1 protein_id gnl|my_center|LOCUS_34440 6630 8561 gene locus_tag LOCUS_34450 6630 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 9441 8470 gene locus_tag LOCUS_34460 9441 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 10075 9446 gene locus_tag LOCUS_34470 10075 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 11121 10072 gene locus_tag LOCUS_34480 11121 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 11646 11131 gene locus_tag LOCUS_34490 11646 11131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 12569 11685 gene locus_tag LOCUS_34500 12569 11685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 12638 14833 gene locus_tag LOCUS_34510 12638 14833 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402874.1 protein_id gnl|my_center|LOCUS_34510 15059 14817 gene locus_tag LOCUS_34520 15059 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 15342 15064 gene locus_tag LOCUS_34530 15342 15064 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940377.1 protein_id gnl|my_center|LOCUS_34530 15369 16169 gene locus_tag LOCUS_34540 15369 16169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 16181 16744 gene locus_tag LOCUS_34550 gene mag 16181 16744 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NU33 protein_id gnl|my_center|LOCUS_34550 17652 16741 gene locus_tag LOCUS_34560 17652 16741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 17670 19226 gene locus_tag LOCUS_34570 17670 19226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 >Feature sequence114 370 918 gene locus_tag LOCUS_34580 370 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 1066 2430 gene locus_tag LOCUS_34590 1066 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 3415 2447 gene locus_tag LOCUS_34600 gene galE 3415 2447 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938655.1 protein_id gnl|my_center|LOCUS_34600 3758 3522 gene locus_tag LOCUS_34610 3758 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 3760 6657 gene locus_tag LOCUS_34620 3760 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 6778 7524 gene locus_tag LOCUS_34630 6778 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 7592 8857 gene locus_tag LOCUS_34640 gene rimO 7592 8857 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747R0 protein_id gnl|my_center|LOCUS_34640 8858 9604 gene locus_tag LOCUS_34650 8858 9604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 10466 9552 gene locus_tag LOCUS_34660 10466 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 11764 10463 gene locus_tag LOCUS_34670 gene ctpA-2 11764 10463 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_34670 12837 11761 gene locus_tag LOCUS_34680 12837 11761 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869241.1 protein_id gnl|my_center|LOCUS_34680 13727 12837 gene locus_tag LOCUS_34690 gene ftsX 13727 12837 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CA0 protein_id gnl|my_center|LOCUS_34690 14380 13727 gene locus_tag LOCUS_34700 gene ftsE 14380 13727 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_34700 15124 14387 gene locus_tag LOCUS_34710 gene murI 15124 14387 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748S8 protein_id gnl|my_center|LOCUS_34710 15215 15742 gene locus_tag LOCUS_34720 gene nadD 15215 15742 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY0 protein_id gnl|my_center|LOCUS_34720 15739 16410 gene locus_tag LOCUS_34730 15739 16410 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_34730 17964 16390 gene locus_tag LOCUS_34740 17964 16390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 17995 18633 gene locus_tag LOCUS_34750 17995 18633 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT03 protein_id gnl|my_center|LOCUS_34750 >Feature sequence115 856 1227 gene locus_tag LOCUS_34760 856 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 1224 1658 gene locus_tag LOCUS_34770 1224 1658 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939520.1 protein_id gnl|my_center|LOCUS_34770 2131 1628 gene locus_tag LOCUS_34780 2131 1628 CDS product methyltransferase small inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_34780 2217 3155 gene locus_tag LOCUS_34790 2217 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 4773 3148 gene locus_tag LOCUS_34800 4773 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539063.1 protein_id gnl|my_center|LOCUS_34800 4825 6246 gene locus_tag LOCUS_34810 gene pyk 4825 6246 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747D6 protein_id gnl|my_center|LOCUS_34810 8040 6256 gene locus_tag LOCUS_34820 8040 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 8615 8037 gene locus_tag LOCUS_34830 8615 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 8636 9394 gene locus_tag LOCUS_34840 8636 9394 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383190.1 protein_id gnl|my_center|LOCUS_34840 9716 9369 gene locus_tag LOCUS_34850 9716 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 9923 10591 gene locus_tag LOCUS_34860 9923 10591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 10606 13632 gene locus_tag LOCUS_34870 10606 13632 CDS product Fe-S-cluster-containing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_34870 13632 14972 gene locus_tag LOCUS_34880 13632 14972 CDS product Fe-S-cluster-containing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_34880 14976 15659 gene locus_tag LOCUS_34890 14976 15659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 15663 16310 gene locus_tag LOCUS_34900 15663 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 16315 17646 gene locus_tag LOCUS_34910 16315 17646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_34910 18351 17707 gene locus_tag LOCUS_34920 18351 17707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 >Feature sequence116 1412 912 gene locus_tag LOCUS_34930 1412 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 1894 1409 gene locus_tag LOCUS_34940 1894 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 2027 3037 gene locus_tag LOCUS_34950 2027 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 4488 3043 gene locus_tag LOCUS_34960 4488 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 5212 4535 gene locus_tag LOCUS_34970 5212 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 5320 6390 gene locus_tag LOCUS_34980 5320 6390 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941287.1 protein_id gnl|my_center|LOCUS_34980 6387 7160 gene locus_tag LOCUS_34990 6387 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 8636 7134 gene locus_tag LOCUS_35000 8636 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089817.1 protein_id gnl|my_center|LOCUS_35000 10645 8636 gene locus_tag LOCUS_35010 10645 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 10666 12147 gene locus_tag LOCUS_35020 10666 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 12756 12163 gene locus_tag LOCUS_35030 12756 12163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 12995 12720 gene locus_tag LOCUS_35040 12995 12720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 14021 13041 gene locus_tag LOCUS_35050 14021 13041 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933588.1 protein_id gnl|my_center|LOCUS_35050 18640 14018 gene locus_tag LOCUS_35060 18640 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 >Feature sequence117 689 54 gene locus_tag LOCUS_35070 gene lipB 689 54 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZI1 protein_id gnl|my_center|LOCUS_35070 1249 677 gene locus_tag LOCUS_35080 1249 677 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762936.1 protein_id gnl|my_center|LOCUS_35080 2144 1251 gene locus_tag LOCUS_35090 2144 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 2971 2141 gene locus_tag LOCUS_35100 2971 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114171.1 protein_id gnl|my_center|LOCUS_35100 3072 5261 gene locus_tag LOCUS_35110 3072 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 5306 5947 gene locus_tag LOCUS_35120 5306 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 5982 6668 gene locus_tag LOCUS_35130 5982 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 6690 7889 gene locus_tag LOCUS_35140 6690 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 7961 9418 gene locus_tag LOCUS_35150 7961 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 9415 10335 gene locus_tag LOCUS_35160 9415 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 10369 12513 gene locus_tag LOCUS_35170 10369 12513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 12513 15182 gene locus_tag LOCUS_35180 12513 15182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 15170 16489 gene locus_tag LOCUS_35190 15170 16489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 17030 16452 gene locus_tag LOCUS_35200 17030 16452 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021989.1 protein_id gnl|my_center|LOCUS_35200 18244 17027 gene locus_tag LOCUS_35210 gene dinB 18244 17027 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y709 protein_id gnl|my_center|LOCUS_35210 >Feature sequence118 214 1254 gene locus_tag LOCUS_35220 214 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 1251 2120 gene locus_tag LOCUS_35230 1251 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 2128 2772 gene locus_tag LOCUS_35240 2128 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 3207 2782 gene locus_tag LOCUS_35250 3207 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 4993 3218 gene locus_tag LOCUS_35260 4993 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 8754 4993 gene locus_tag LOCUS_35270 8754 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 9478 8783 gene locus_tag LOCUS_35280 9478 8783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 9510 9749 gene locus_tag LOCUS_35290 9510 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 10037 11482 gene locus_tag LOCUS_35300 10037 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 11502 12074 gene locus_tag LOCUS_35310 gene def 11502 12074 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP01 protein_id gnl|my_center|LOCUS_35310 12071 12979 gene locus_tag LOCUS_35320 gene fmt 12071 12979 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIL6 protein_id gnl|my_center|LOCUS_35320 13095 13850 gene locus_tag LOCUS_35330 13095 13850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 13887 15479 gene locus_tag LOCUS_35340 13887 15479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 >Feature sequence119 829 83 gene locus_tag LOCUS_35350 829 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 844 2484 gene locus_tag LOCUS_35360 844 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 2519 5260 gene locus_tag LOCUS_35370 2519 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 5958 5257 gene locus_tag LOCUS_35380 5958 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 5977 7098 gene locus_tag LOCUS_35390 5977 7098 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_35390 7174 8814 gene locus_tag LOCUS_35400 7174 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 8811 10190 gene locus_tag LOCUS_35410 8811 10190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 14575 10187 gene locus_tag LOCUS_35420 14575 10187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 16403 14604 gene locus_tag LOCUS_35430 16403 14604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 16877 18019 gene locus_tag LOCUS_35440 16877 18019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 18039 18350 gene locus_tag LOCUS_35450 18039 18350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 18835 18359 gene locus_tag LOCUS_35460 gene ptpA 18835 18359 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_35460 >Feature sequence120 410 991 gene locus_tag LOCUS_35470 410 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 1001 4861 gene locus_tag LOCUS_35480 1001 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 4872 5330 gene locus_tag LOCUS_35490 4872 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 5327 5491 gene locus_tag LOCUS_35500 5327 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 5488 6225 gene locus_tag LOCUS_35510 5488 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 6213 7091 gene locus_tag LOCUS_35520 6213 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 7088 7726 gene locus_tag LOCUS_35530 7088 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 8802 7708 gene locus_tag LOCUS_35540 8802 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 9112 8834 gene locus_tag LOCUS_35550 9112 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 10721 9180 gene locus_tag LOCUS_35560 10721 9180 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208316.1 protein_id gnl|my_center|LOCUS_35560 10875 11906 gene locus_tag LOCUS_35570 gene rsgA2 10875 11906 CDS product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FP9 protein_id gnl|my_center|LOCUS_35570 13099 12278 gene locus_tag LOCUS_35580 gene hmgR 13099 12278 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072059.1 protein_id gnl|my_center|LOCUS_35580 13162 14094 gene locus_tag LOCUS_35590 13162 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 14771 14421 gene locus_tag LOCUS_35600 14771 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 14868 15170 gene locus_tag LOCUS_35610 14868 15170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 15959 15231 gene locus_tag LOCUS_35620 gene fabG 15959 15231 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065092.1 protein_id gnl|my_center|LOCUS_35620 17173 15959 gene locus_tag LOCUS_35630 17173 15959 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707147.1 protein_id gnl|my_center|LOCUS_35630 18707 17184 gene locus_tag LOCUS_35640 18707 17184 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_35640 >Feature sequence121 1797 1624 gene locus_tag LOCUS_35650 1797 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 3467 1794 gene locus_tag LOCUS_35660 3467 1794 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_35660 3589 3467 gene locus_tag LOCUS_35670 3589 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 3733 4350 gene locus_tag LOCUS_35680 3733 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 4694 4353 gene locus_tag LOCUS_35690 4694 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 5140 4691 gene locus_tag LOCUS_35700 5140 4691 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_35700 5607 5140 gene locus_tag LOCUS_35710 gene ribH 5607 5140 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX5 protein_id gnl|my_center|LOCUS_35710 6826 5609 gene locus_tag LOCUS_35720 gene ribA 6826 5609 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI3 protein_id gnl|my_center|LOCUS_35720 7484 6828 gene locus_tag LOCUS_35730 7484 6828 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_35730 8575 7484 gene locus_tag LOCUS_35740 8575 7484 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_35740 9015 8572 gene locus_tag LOCUS_35750 gene nrdR 9015 8572 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62I17 protein_id gnl|my_center|LOCUS_35750 10274 9012 gene locus_tag LOCUS_35760 gene glyA2 10274 9012 CDS product serine hydroxymethyltransferase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVI7 protein_id gnl|my_center|LOCUS_35760 10733 10299 gene locus_tag LOCUS_35770 gene rpiB 10733 10299 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_35770 11977 10742 gene locus_tag LOCUS_35780 gene fabF-2 11977 10742 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CR7 protein_id gnl|my_center|LOCUS_35780 12222 11980 gene locus_tag LOCUS_35790 gene acpP 12222 11980 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43709 protein_id gnl|my_center|LOCUS_35790 13214 12264 gene locus_tag LOCUS_35800 13214 12264 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_35800 13432 13250 gene locus_tag LOCUS_35810 gene rpmF 13432 13250 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RDX9 protein_id gnl|my_center|LOCUS_35810 13961 13449 gene locus_tag LOCUS_35820 13961 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 14788 13958 gene locus_tag LOCUS_35830 14788 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 14927 15433 gene locus_tag LOCUS_35840 14927 15433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 15469 16305 gene locus_tag LOCUS_35850 15469 16305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 18585 16321 gene locus_tag LOCUS_35860 18585 16321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 >Feature sequence122 53 1063 gene locus_tag LOCUS_35870 53 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 1060 1839 gene locus_tag LOCUS_35880 1060 1839 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013356.1 protein_id gnl|my_center|LOCUS_35880 1836 2531 gene locus_tag LOCUS_35890 1836 2531 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897325.1 protein_id gnl|my_center|LOCUS_35890 2535 3116 gene locus_tag LOCUS_35900 2535 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 3116 4621 gene locus_tag LOCUS_35910 3116 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 5969 4626 gene locus_tag LOCUS_35920 5969 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 6000 9872 gene locus_tag LOCUS_35930 6000 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 9857 12787 gene locus_tag LOCUS_35940 9857 12787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 13651 12788 gene locus_tag LOCUS_35950 13651 12788 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_35950 14952 13645 gene locus_tag LOCUS_35960 gene tolB 14952 13645 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H67 protein_id gnl|my_center|LOCUS_35960 15671 14949 gene locus_tag LOCUS_35970 15671 14949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 16096 15668 gene locus_tag LOCUS_35980 16096 15668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35980 16752 16096 gene locus_tag LOCUS_35990 16752 16096 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_35990 17607 16756 gene locus_tag LOCUS_36000 17607 16756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 17650 18357 gene locus_tag LOCUS_36010 17650 18357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 >Feature sequence123 2215 1286 gene locus_tag LOCUS_36020 2215 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 2233 4401 gene locus_tag LOCUS_36030 2233 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 4404 5360 gene locus_tag LOCUS_36040 4404 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 6252 5329 gene locus_tag LOCUS_36050 6252 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 6981 6262 gene locus_tag LOCUS_36060 6981 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 6999 8618 gene locus_tag LOCUS_36070 6999 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 9114 8857 gene locus_tag LOCUS_36080 9114 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 10482 9163 gene locus_tag LOCUS_36090 10482 9163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 10523 11875 gene locus_tag LOCUS_36100 10523 11875 CDS product DNA repair helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890488.1 protein_id gnl|my_center|LOCUS_36100 11862 13037 gene locus_tag LOCUS_36110 11862 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979670.1 protein_id gnl|my_center|LOCUS_36110 15097 13055 gene locus_tag LOCUS_36120 15097 13055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 15765 15094 gene locus_tag LOCUS_36130 15765 15094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 16439 15765 gene locus_tag LOCUS_36140 16439 15765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 18629 16440 gene locus_tag LOCUS_36150 18629 16440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36150 >Feature sequence124 1266 64 gene locus_tag LOCUS_36160 gene tyrS 1266 64 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I748 protein_id gnl|my_center|LOCUS_36160 1379 1789 gene locus_tag LOCUS_36170 1379 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 4393 1859 gene locus_tag LOCUS_36180 4393 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 4476 4997 gene locus_tag LOCUS_36190 4476 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 4994 5944 gene locus_tag LOCUS_36200 gene yeaC 4994 5944 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_36200 6016 6855 gene locus_tag LOCUS_36210 6016 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880980.1 protein_id gnl|my_center|LOCUS_36210 6852 8882 gene locus_tag LOCUS_36220 6852 8882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 8892 10379 gene locus_tag LOCUS_36230 8892 10379 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055172.1 protein_id gnl|my_center|LOCUS_36230 10379 11296 gene locus_tag LOCUS_36240 10379 11296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 12886 11303 gene locus_tag LOCUS_36250 gene prfC 12886 11303 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I754 protein_id gnl|my_center|LOCUS_36250 12970 14676 gene locus_tag LOCUS_36260 12970 14676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 16126 14678 gene locus_tag LOCUS_36270 16126 14678 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776263.1 protein_id gnl|my_center|LOCUS_36270 16687 16208 gene locus_tag LOCUS_36280 16687 16208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 16733 17992 gene locus_tag LOCUS_36290 16733 17992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 >Feature sequence125 818 1561 gene locus_tag LOCUS_36300 818 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_36300 1773 4292 gene locus_tag LOCUS_36310 1773 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 5201 4299 gene locus_tag LOCUS_36320 5201 4299 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065910.1 protein_id gnl|my_center|LOCUS_36320 6243 5233 gene locus_tag LOCUS_36330 6243 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 6329 6898 gene locus_tag LOCUS_36340 6329 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 6898 7803 gene locus_tag LOCUS_36350 6898 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 7812 8465 gene locus_tag LOCUS_36360 7812 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 9156 8452 gene locus_tag LOCUS_36370 9156 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 10598 9165 gene locus_tag LOCUS_36380 10598 9165 CDS product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230822.1 protein_id gnl|my_center|LOCUS_36380 10619 11467 gene locus_tag LOCUS_36390 10619 11467 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222203.1 protein_id gnl|my_center|LOCUS_36390 11467 12366 gene locus_tag LOCUS_36400 11467 12366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 12425 13306 gene locus_tag LOCUS_36410 12425 13306 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939052.1 protein_id gnl|my_center|LOCUS_36410 13327 15663 gene locus_tag LOCUS_36420 13327 15663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 15663 16481 gene locus_tag LOCUS_36430 15663 16481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 16501 16818 gene locus_tag LOCUS_36440 16501 16818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 17058 16810 gene locus_tag LOCUS_36450 17058 16810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 17118 18041 gene locus_tag LOCUS_36460 17118 18041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970816.1 protein_id gnl|my_center|LOCUS_36460 >Feature sequence126 <1 553 gene locus_tag LOCUS_36470 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973277.1:damage-inducible protein DinB 3840 556 gene locus_tag LOCUS_36480 3840 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 3873 5138 gene locus_tag LOCUS_36490 3873 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 5277 7145 gene locus_tag LOCUS_36500 5277 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 7921 7337 gene locus_tag LOCUS_36510 7921 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 9148 7973 gene locus_tag LOCUS_36520 9148 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 9178 9525 gene locus_tag LOCUS_36530 9178 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 9614 10255 gene locus_tag LOCUS_36540 9614 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 10961 10233 gene locus_tag LOCUS_36550 10961 10233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 11725 10982 gene locus_tag LOCUS_36560 11725 10982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 11847 13220 gene locus_tag LOCUS_36570 11847 13220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 13220 14869 gene locus_tag LOCUS_36580 13220 14869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 14945 15478 gene locus_tag LOCUS_36590 14945 15478 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224590.1 protein_id gnl|my_center|LOCUS_36590 15483 16211 gene locus_tag LOCUS_36600 15483 16211 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073567.1 protein_id gnl|my_center|LOCUS_36600 16888 16223 gene locus_tag LOCUS_36610 gene ubiG 16888 16223 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q820B5 protein_id gnl|my_center|LOCUS_36610 17328 16885 gene locus_tag LOCUS_36620 17328 16885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 18174 17383 gene locus_tag LOCUS_36630 18174 17383 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535488.1 protein_id gnl|my_center|LOCUS_36630 >Feature sequence127 1537 554 gene locus_tag LOCUS_36640 1537 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 1749 1534 gene locus_tag LOCUS_36650 1749 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 3073 1718 gene locus_tag LOCUS_36660 3073 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 3062 3976 gene locus_tag LOCUS_36670 3062 3976 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYT3 protein_id gnl|my_center|LOCUS_36670 4562 3981 gene locus_tag LOCUS_36680 4562 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 5375 4596 gene locus_tag LOCUS_36690 5375 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 6757 5375 gene locus_tag LOCUS_36700 6757 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 7821 6739 gene locus_tag LOCUS_36710 7821 6739 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_36710 8608 7799 gene locus_tag LOCUS_36720 gene dapD 8608 7799 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_36720 9785 8619 gene locus_tag LOCUS_36730 gene dapL 9785 8619 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66630 protein_id gnl|my_center|LOCUS_36730 9805 10755 gene locus_tag LOCUS_36740 9805 10755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957616.1 protein_id gnl|my_center|LOCUS_36740 10776 11480 gene locus_tag LOCUS_36750 10776 11480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 12562 11477 gene locus_tag LOCUS_36760 12562 11477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 13561 12572 gene locus_tag LOCUS_36770 13561 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 13986 13558 gene locus_tag LOCUS_36780 13986 13558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 14228 13983 gene locus_tag LOCUS_36790 14228 13983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 15884 14238 gene locus_tag LOCUS_36800 15884 14238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 17890 15893 gene locus_tag LOCUS_36810 17890 15893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 >Feature sequence128 345 5540 gene locus_tag LOCUS_36820 345 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 5609 6067 gene locus_tag LOCUS_36830 5609 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 6943 6062 gene locus_tag LOCUS_36840 6943 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 7428 6940 gene locus_tag LOCUS_36850 7428 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 7991 7425 gene locus_tag LOCUS_36860 7991 7425 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_36860 8055 9413 gene locus_tag LOCUS_36870 8055 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 9417 10244 gene locus_tag LOCUS_36880 9417 10244 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530068.1 protein_id gnl|my_center|LOCUS_36880 10241 11041 gene locus_tag LOCUS_36890 10241 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 11038 12060 gene locus_tag LOCUS_36900 11038 12060 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_36900 12051 13172 gene locus_tag LOCUS_36910 12051 13172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 13180 14199 gene locus_tag LOCUS_36920 13180 14199 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061530.1 protein_id gnl|my_center|LOCUS_36920 14187 15530 gene locus_tag LOCUS_36930 14187 15530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 15588 16520 gene locus_tag LOCUS_36940 15588 16520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 16562 17431 gene locus_tag LOCUS_36950 16562 17431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_36950 17440 18078 gene locus_tag LOCUS_36960 gene gmk 17440 18078 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV4 protein_id gnl|my_center|LOCUS_36960 >Feature sequence129 <1 1618 gene locus_tag LOCUS_36970 <1 1618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HFF0:urocanate hydratase 1873 1631 gene locus_tag LOCUS_36980 1873 1631 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DU1 protein_id gnl|my_center|LOCUS_36980 2048 2632 gene locus_tag LOCUS_36990 gene prtI 2048 2632 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971658.1 protein_id gnl|my_center|LOCUS_36990 2703 4178 gene locus_tag LOCUS_37000 2703 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 4220 5077 gene locus_tag LOCUS_37010 4220 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 7150 5105 gene locus_tag LOCUS_37020 gene pmm 7150 5105 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_37020 8690 7143 gene locus_tag LOCUS_37030 8690 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 9082 8687 gene locus_tag LOCUS_37040 9082 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 9750 9070 gene locus_tag LOCUS_37050 9750 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 9795 10412 gene locus_tag LOCUS_37060 9795 10412 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675739.1 protein_id gnl|my_center|LOCUS_37060 10409 10906 gene locus_tag LOCUS_37070 10409 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 11093 11677 gene locus_tag LOCUS_37080 11093 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 11698 11973 gene locus_tag LOCUS_37090 11698 11973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 11970 13754 gene locus_tag LOCUS_37100 11970 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 14310 13717 gene locus_tag LOCUS_37110 14310 13717 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_37110 15806 14313 gene locus_tag LOCUS_37120 gene trpE 15806 14313 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_37120 16189 15824 gene locus_tag LOCUS_37130 16189 15824 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255939.1 protein_id gnl|my_center|LOCUS_37130 17934 16378 gene locus_tag LOCUS_37140 17934 16378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 >Feature sequence130 1233 397 gene locus_tag LOCUS_37150 1233 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 2304 1354 gene locus_tag LOCUS_37160 2304 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 2403 2852 gene locus_tag LOCUS_37170 2403 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 2858 4213 gene locus_tag LOCUS_37180 2858 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 4283 7390 gene locus_tag LOCUS_37190 4283 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 7537 8868 gene locus_tag LOCUS_37200 7537 8868 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122542.1 protein_id gnl|my_center|LOCUS_37200 8931 9803 gene locus_tag LOCUS_37210 8931 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 9887 10636 gene locus_tag LOCUS_37220 9887 10636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 11331 10633 gene locus_tag LOCUS_37230 11331 10633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 11351 11569 gene locus_tag LOCUS_37240 11351 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 11569 12285 gene locus_tag LOCUS_37250 11569 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 12348 12890 gene locus_tag LOCUS_37260 12348 12890 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_37260 12914 14434 gene locus_tag LOCUS_37270 gene cysS 12914 14434 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747A2 protein_id gnl|my_center|LOCUS_37270 14468 17023 gene locus_tag LOCUS_37280 14468 17023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 >Feature sequence131 2043 1072 gene locus_tag LOCUS_37290 2043 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 4379 2040 gene locus_tag LOCUS_37300 4379 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 5302 4388 gene locus_tag LOCUS_37310 gene lpxD 5302 4388 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT5 protein_id gnl|my_center|LOCUS_37310 6636 5299 gene locus_tag LOCUS_37320 6636 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 7537 6647 gene locus_tag LOCUS_37330 7537 6647 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584122.1 protein_id gnl|my_center|LOCUS_37330 8049 7534 gene locus_tag LOCUS_37340 8049 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 8048 8830 gene locus_tag LOCUS_37350 8048 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 8830 9297 gene locus_tag LOCUS_37360 gene msrB 8830 9297 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGX7 protein_id gnl|my_center|LOCUS_37360 9920 9276 gene locus_tag LOCUS_37370 9920 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 10393 10088 gene locus_tag LOCUS_37380 10393 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 10274 11584 gene locus_tag LOCUS_37390 10274 11584 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706368.1 protein_id gnl|my_center|LOCUS_37390 12755 11856 gene locus_tag LOCUS_37400 12755 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 12755 13111 gene locus_tag LOCUS_37410 gene dksA 12755 13111 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG2 protein_id gnl|my_center|LOCUS_37410 14795 13344 gene locus_tag LOCUS_37420 14795 13344 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_37420 15413 14817 gene locus_tag LOCUS_37430 15413 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 15408 15908 gene locus_tag LOCUS_37440 15408 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 15905 16600 gene locus_tag LOCUS_37450 15905 16600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 17513 16608 gene locus_tag LOCUS_37460 17513 16608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 >Feature sequence132 1118 2122 gene locus_tag LOCUS_37470 1118 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 2191 3126 gene locus_tag LOCUS_37480 2191 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 5888 3123 gene locus_tag LOCUS_37490 5888 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 7170 5950 gene locus_tag LOCUS_37500 7170 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 7219 7731 gene locus_tag LOCUS_37510 7219 7731 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 protein_id gnl|my_center|LOCUS_37510 7728 9863 gene locus_tag LOCUS_37520 7728 9863 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_37520 10024 12426 gene locus_tag LOCUS_37530 10024 12426 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_37530 12474 13103 gene locus_tag LOCUS_37540 12474 13103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 14373 13252 gene locus_tag LOCUS_37550 14373 13252 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085418.1 protein_id gnl|my_center|LOCUS_37550 14442 15716 gene locus_tag LOCUS_37560 14442 15716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 16581 15700 gene locus_tag LOCUS_37570 16581 15700 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566082.1 protein_id gnl|my_center|LOCUS_37570 16667 17479 gene locus_tag LOCUS_37580 16667 17479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 >Feature sequence133 828 2216 gene locus_tag LOCUS_37590 828 2216 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039072.1 protein_id gnl|my_center|LOCUS_37590 2693 2223 gene locus_tag LOCUS_37600 2693 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 4057 2690 gene locus_tag LOCUS_37610 4057 2690 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225928.1 protein_id gnl|my_center|LOCUS_37610 5286 4054 gene locus_tag LOCUS_37620 5286 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 7086 5290 gene locus_tag LOCUS_37630 7086 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 8695 7094 gene locus_tag LOCUS_37640 8695 7094 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945835.1 protein_id gnl|my_center|LOCUS_37640 10325 8721 gene locus_tag LOCUS_37650 10325 8721 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142868.1 protein_id gnl|my_center|LOCUS_37650 11371 10322 gene locus_tag LOCUS_37660 11371 10322 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261512.1 protein_id gnl|my_center|LOCUS_37660 11580 11413 gene locus_tag LOCUS_37670 11580 11413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 13342 11753 gene locus_tag LOCUS_37680 13342 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 15079 13343 gene locus_tag LOCUS_37690 15079 13343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 15112 16767 gene locus_tag LOCUS_37700 15112 16767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 17503 16925 gene locus_tag LOCUS_37710 17503 16925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 >Feature sequence134 2593 758 gene locus_tag LOCUS_37720 2593 758 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028428.1 protein_id gnl|my_center|LOCUS_37720 2700 3431 gene locus_tag LOCUS_37730 2700 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 3480 4859 gene locus_tag LOCUS_37740 3480 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 4860 5444 gene locus_tag LOCUS_37750 gene rluA 4860 5444 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770474.1 protein_id gnl|my_center|LOCUS_37750 5949 5407 gene locus_tag LOCUS_37760 5949 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37760 6370 5942 gene locus_tag LOCUS_37770 6370 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37770 6987 6367 gene locus_tag LOCUS_37780 6987 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 7138 8415 gene locus_tag LOCUS_37790 7138 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 9404 8439 gene locus_tag LOCUS_37800 9404 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 10776 9409 gene locus_tag LOCUS_37810 10776 9409 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226762.1 protein_id gnl|my_center|LOCUS_37810 10801 11397 gene locus_tag LOCUS_37820 gene pssA 10801 11397 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037307.1 protein_id gnl|my_center|LOCUS_37820 11534 12664 gene locus_tag LOCUS_37830 11534 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 17146 12707 gene locus_tag LOCUS_37840 17146 12707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 >Feature sequence135 411 2324 gene locus_tag LOCUS_37850 411 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 2507 3823 gene locus_tag LOCUS_37860 2507 3823 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YB5 protein_id gnl|my_center|LOCUS_37860 3878 5323 gene locus_tag LOCUS_37870 3878 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 5366 6130 gene locus_tag LOCUS_37880 gene motA-1 5366 6130 CDS product chemotaxis protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_37880 6134 6862 gene locus_tag LOCUS_37890 6134 6862 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_37890 6869 7369 gene locus_tag LOCUS_37900 6869 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 7369 8241 gene locus_tag LOCUS_37910 7369 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 8302 8583 gene locus_tag LOCUS_37920 8302 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 8583 9485 gene locus_tag LOCUS_37930 8583 9485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 9485 10246 gene locus_tag LOCUS_37940 gene fliP 9485 10246 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI13 protein_id gnl|my_center|LOCUS_37940 10249 10512 gene locus_tag LOCUS_37950 gene fliQ 10249 10512 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67774 protein_id gnl|my_center|LOCUS_37950 10512 11273 gene locus_tag LOCUS_37960 gene fliR 10512 11273 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V866 protein_id gnl|my_center|LOCUS_37960 11275 12339 gene locus_tag LOCUS_37970 gene flhB 11275 12339 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390448.1 protein_id gnl|my_center|LOCUS_37970 12787 12332 gene locus_tag LOCUS_37980 12787 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 14172 12856 gene locus_tag LOCUS_37990 14172 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 15608 14169 gene locus_tag LOCUS_38000 15608 14169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387739.1 protein_id gnl|my_center|LOCUS_38000 15615 16652 gene locus_tag LOCUS_38010 15615 16652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 16649 17143 gene locus_tag LOCUS_38020 16649 17143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 >Feature sequence136 407 2089 gene locus_tag LOCUS_38030 407 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 2071 3183 gene locus_tag LOCUS_38040 gene dnaJ 2071 3183 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCD8 protein_id gnl|my_center|LOCUS_38040 3235 4167 gene locus_tag LOCUS_38050 3235 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 4171 5730 gene locus_tag LOCUS_38060 4171 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 5731 5988 gene locus_tag LOCUS_38070 5731 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 5985 6689 gene locus_tag LOCUS_38080 5985 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 7436 6702 gene locus_tag LOCUS_38090 7436 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 8361 7441 gene locus_tag LOCUS_38100 gene hmgL 8361 7441 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222886.1 protein_id gnl|my_center|LOCUS_38100 9293 8382 gene locus_tag LOCUS_38110 9293 8382 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_38110 10739 9303 gene locus_tag LOCUS_38120 10739 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_38120 12280 10736 gene locus_tag LOCUS_38130 12280 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 12314 13897 gene locus_tag LOCUS_38140 12314 13897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 13902 15227 gene locus_tag LOCUS_38150 13902 15227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120254.1 protein_id gnl|my_center|LOCUS_38150 15224 16015 gene locus_tag LOCUS_38160 15224 16015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 >Feature sequence137 588 232 gene locus_tag LOCUS_38170 588 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 965 609 gene locus_tag LOCUS_38180 965 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 1890 1165 gene locus_tag LOCUS_38190 1890 1165 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_38190 2117 1911 gene locus_tag LOCUS_38200 2117 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 2007 5399 gene locus_tag LOCUS_38210 2007 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 5449 6327 gene locus_tag LOCUS_38220 5449 6327 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224028.1 protein_id gnl|my_center|LOCUS_38220 6817 6356 gene locus_tag LOCUS_38230 6817 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 6899 7519 gene locus_tag LOCUS_38240 6899 7519 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266341.1 protein_id gnl|my_center|LOCUS_38240 7597 8622 gene locus_tag LOCUS_38250 7597 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 9999 8626 gene locus_tag LOCUS_38260 gene aspC 9999 8626 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56232 protein_id gnl|my_center|LOCUS_38260 10515 10006 gene locus_tag LOCUS_38270 10515 10006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 10656 12470 gene locus_tag LOCUS_38280 gene asnB 10656 12470 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 protein_id gnl|my_center|LOCUS_38280 13505 12495 gene locus_tag LOCUS_38290 13505 12495 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920800.1 protein_id gnl|my_center|LOCUS_38290 14841 13540 gene locus_tag LOCUS_38300 14841 13540 CDS product putative L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67554 protein_id gnl|my_center|LOCUS_38300 >Feature sequence138 1568 777 gene locus_tag LOCUS_38310 1568 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 3970 1565 gene locus_tag LOCUS_38320 3970 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 6732 3970 gene locus_tag LOCUS_38330 6732 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 8468 6732 gene locus_tag LOCUS_38340 8468 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 8600 9376 gene locus_tag LOCUS_38350 8600 9376 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ8 protein_id gnl|my_center|LOCUS_38350 9373 10761 gene locus_tag LOCUS_38360 9373 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 11379 10771 gene locus_tag LOCUS_38370 11379 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 11415 12860 gene locus_tag LOCUS_38380 11415 12860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 14873 12867 gene locus_tag LOCUS_38390 14873 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 15515 14931 gene locus_tag LOCUS_38400 15515 14931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 15576 15740 gene locus_tag LOCUS_38410 15576 15740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 >Feature sequence139 2025 73 gene locus_tag LOCUS_38420 2025 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 2049 3188 gene locus_tag LOCUS_38430 2049 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 3176 3868 gene locus_tag LOCUS_38440 3176 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 4573 3887 gene locus_tag LOCUS_38450 4573 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 4606 5472 gene locus_tag LOCUS_38460 4606 5472 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_38460 6530 5457 gene locus_tag LOCUS_38470 6530 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 6887 6567 gene locus_tag LOCUS_38480 6887 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 7661 6903 gene locus_tag LOCUS_38490 gene cobW 7661 6903 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969596.1 protein_id gnl|my_center|LOCUS_38490 8088 7762 gene locus_tag LOCUS_38500 8088 7762 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCR2 protein_id gnl|my_center|LOCUS_38500 8330 8085 gene locus_tag LOCUS_38510 gene bolA 8330 8085 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771070.1 protein_id gnl|my_center|LOCUS_38510 8395 9126 gene locus_tag LOCUS_38520 gene plsC 8395 9126 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Q9 protein_id gnl|my_center|LOCUS_38520 9913 9119 gene locus_tag LOCUS_38530 9913 9119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 10789 9914 gene locus_tag LOCUS_38540 gene pyrF 10789 9914 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 protein_id gnl|my_center|LOCUS_38540 11656 10817 gene locus_tag LOCUS_38550 11656 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 11792 12256 gene locus_tag LOCUS_38560 11792 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 12625 12197 gene locus_tag LOCUS_38570 12625 12197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 12850 12635 gene locus_tag LOCUS_38580 12850 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 12882 13382 gene locus_tag LOCUS_38590 12882 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 13589 13389 gene locus_tag LOCUS_38600 13589 13389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 13494 14720 gene locus_tag LOCUS_38610 13494 14720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 14811 15125 gene locus_tag LOCUS_38620 14811 15125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 15239 16201 gene locus_tag LOCUS_38630 15239 16201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 16194 16874 gene locus_tag LOCUS_38640 16194 16874 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 protein_id gnl|my_center|LOCUS_38640 >Feature sequence140 168 419 gene locus_tag LOCUS_38650 168 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 452 856 gene locus_tag LOCUS_38660 gene dtd 452 856 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE39 protein_id gnl|my_center|LOCUS_38660 853 1620 gene locus_tag LOCUS_38670 gene hisN 853 1620 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_38670 1642 3210 gene locus_tag LOCUS_38680 gene dnaK 1642 3210 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_38680 3237 3803 gene locus_tag LOCUS_38690 3237 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 6734 3819 gene locus_tag LOCUS_38700 6734 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 9347 6789 gene locus_tag LOCUS_38710 gene leuS 9347 6789 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S415 protein_id gnl|my_center|LOCUS_38710 9319 9735 gene locus_tag LOCUS_38720 9319 9735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 10024 11001 gene locus_tag LOCUS_38730 10024 11001 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_38730 10988 11842 gene locus_tag LOCUS_38740 10988 11842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 11839 12279 gene locus_tag LOCUS_38750 11839 12279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 12322 12846 gene locus_tag LOCUS_38760 12322 12846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 12851 13972 gene locus_tag LOCUS_38770 12851 13972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 13982 16384 gene locus_tag LOCUS_38780 13982 16384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 16442 16735 gene locus_tag LOCUS_38790 16442 16735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 >Feature sequence141 1366 2115 gene locus_tag LOCUS_38800 1366 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 2880 2119 gene locus_tag LOCUS_38810 2880 2119 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667090.1 protein_id gnl|my_center|LOCUS_38810 3839 2877 gene locus_tag LOCUS_38820 3839 2877 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701468.1 protein_id gnl|my_center|LOCUS_38820 4223 3876 gene locus_tag LOCUS_38830 4223 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 6101 4314 gene locus_tag LOCUS_38840 6101 4314 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_38840 6339 6163 gene locus_tag LOCUS_38850 6339 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 6648 7211 gene locus_tag LOCUS_38860 6648 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 8371 7184 gene locus_tag LOCUS_38870 8371 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 9400 8372 gene locus_tag LOCUS_38880 9400 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 10497 9400 gene locus_tag LOCUS_38890 10497 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 12463 10592 gene locus_tag LOCUS_38900 12463 10592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 14395 12464 gene locus_tag LOCUS_38910 14395 12464 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_38910 15513 14425 gene locus_tag LOCUS_38920 15513 14425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 16172 15513 gene locus_tag LOCUS_38930 16172 15513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 >Feature sequence142 1387 1085 gene locus_tag LOCUS_38940 1387 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 1701 1423 gene locus_tag LOCUS_38950 1701 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 2385 1753 gene locus_tag LOCUS_38960 2385 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 3449 2382 gene locus_tag LOCUS_38970 gene flgI 3449 2382 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIX1 protein_id gnl|my_center|LOCUS_38970 3558 4460 gene locus_tag LOCUS_38980 3558 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 4473 5522 gene locus_tag LOCUS_38990 4473 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_38990 5519 6418 gene locus_tag LOCUS_39000 gene manA 5519 6418 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174418.1 protein_id gnl|my_center|LOCUS_39000 7072 6422 gene locus_tag LOCUS_39010 7072 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 7683 7081 gene locus_tag LOCUS_39020 7683 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 8438 7680 gene locus_tag LOCUS_39030 8438 7680 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081929.1 protein_id gnl|my_center|LOCUS_39030 9132 8455 gene locus_tag LOCUS_39040 9132 8455 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFX1 protein_id gnl|my_center|LOCUS_39040 9917 9132 gene locus_tag LOCUS_39050 gene fliA 9917 9132 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3R7 protein_id gnl|my_center|LOCUS_39050 10033 11760 gene locus_tag LOCUS_39060 10033 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 11757 12752 gene locus_tag LOCUS_39070 11757 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 15144 13087 gene locus_tag LOCUS_39080 gene flhA 15144 13087 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_39080 >Feature sequence143 680 2557 gene locus_tag LOCUS_39090 680 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 2577 3410 gene locus_tag LOCUS_39100 2577 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 4527 3448 gene locus_tag LOCUS_39110 4527 3448 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459301.1 protein_id gnl|my_center|LOCUS_39110 5225 4524 gene locus_tag LOCUS_39120 gene argB 5225 4524 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59303 protein_id gnl|my_center|LOCUS_39120 6333 5206 gene locus_tag LOCUS_39130 gene argJ 6333 5206 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59610 protein_id gnl|my_center|LOCUS_39130 6742 6323 gene locus_tag LOCUS_39140 6742 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 7696 6758 gene locus_tag LOCUS_39150 gene argC 7696 6758 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748X6 protein_id gnl|my_center|LOCUS_39150 7777 8292 gene locus_tag LOCUS_39160 7777 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 8289 8792 gene locus_tag LOCUS_39170 8289 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 8789 9214 gene locus_tag LOCUS_39180 8789 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 10138 9218 gene locus_tag LOCUS_39190 10138 9218 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_39190 10168 11883 gene locus_tag LOCUS_39200 10168 11883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 11880 13604 gene locus_tag LOCUS_39210 11880 13604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 13601 14605 gene locus_tag LOCUS_39220 gene rlmL 13601 14605 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_39220 14602 15489 gene locus_tag LOCUS_39230 gene hemF 14602 15489 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEK3 protein_id gnl|my_center|LOCUS_39230 15749 15486 gene locus_tag LOCUS_39240 15749 15486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 >Feature sequence144 1331 360 gene locus_tag LOCUS_39250 1331 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 3042 1372 gene locus_tag LOCUS_39260 gene uup 3042 1372 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626143.1 protein_id gnl|my_center|LOCUS_39260 4051 3053 gene locus_tag LOCUS_39270 4051 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 4126 4722 gene locus_tag LOCUS_39280 4126 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 4719 5153 gene locus_tag LOCUS_39290 4719 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 5150 6295 gene locus_tag LOCUS_39300 5150 6295 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940226.1 protein_id gnl|my_center|LOCUS_39300 6292 6639 gene locus_tag LOCUS_39310 6292 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 6673 8139 gene locus_tag LOCUS_39320 6673 8139 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065546.1 protein_id gnl|my_center|LOCUS_39320 8482 9159 gene locus_tag LOCUS_39330 8482 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 9191 9874 gene locus_tag LOCUS_39340 9191 9874 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_39340 10971 9850 gene locus_tag LOCUS_39350 10971 9850 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338164.1 protein_id gnl|my_center|LOCUS_39350 11019 12116 gene locus_tag LOCUS_39360 11019 12116 CDS product dihydropyrimidine dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_39360 13001 12129 gene locus_tag LOCUS_39370 13001 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 15145 12998 gene locus_tag LOCUS_39380 15145 12998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 15072 15239 gene locus_tag LOCUS_39390 15072 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 15245 16279 gene locus_tag LOCUS_39400 15245 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 >Feature sequence145 418 921 gene locus_tag LOCUS_39410 418 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 3797 933 gene locus_tag LOCUS_39420 3797 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 4727 3807 gene locus_tag LOCUS_39430 4727 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 5818 4727 gene locus_tag LOCUS_39440 5818 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 5850 7277 gene locus_tag LOCUS_39450 5850 7277 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_39450 7333 8400 gene locus_tag LOCUS_39460 gene ldh 7333 8400 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A392 protein_id gnl|my_center|LOCUS_39460 8442 9269 gene locus_tag LOCUS_39470 gene scpA 8442 9269 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C43 protein_id gnl|my_center|LOCUS_39470 9262 9939 gene locus_tag LOCUS_39480 gene scpB 9262 9939 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C44 protein_id gnl|my_center|LOCUS_39480 10098 10024 gene locus_tag LOCUS_t00160 10098 10024 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10921 10109 gene locus_tag LOCUS_39490 gene rluB 10921 10109 CDS product ribosomal large subunit pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35159 protein_id gnl|my_center|LOCUS_39490 11015 11854 gene locus_tag LOCUS_39500 11015 11854 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545567.1 protein_id gnl|my_center|LOCUS_39500 12478 11834 gene locus_tag LOCUS_39510 12478 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 13001 12492 gene locus_tag LOCUS_39520 13001 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 13477 13028 gene locus_tag LOCUS_39530 13477 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 14915 13488 gene locus_tag LOCUS_39540 14915 13488 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090347.1 protein_id gnl|my_center|LOCUS_39540 15625 14912 gene locus_tag LOCUS_39550 15625 14912 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886901.1 protein_id gnl|my_center|LOCUS_39550 16164 15622 gene locus_tag LOCUS_39560 16164 15622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 >Feature sequence146 3102 3602 gene locus_tag LOCUS_39570 3102 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 3612 5852 gene locus_tag LOCUS_39580 3612 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 7190 5856 gene locus_tag LOCUS_39590 7190 5856 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q9 protein_id gnl|my_center|LOCUS_39590 7243 9348 gene locus_tag LOCUS_39600 7243 9348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 9687 9361 gene locus_tag LOCUS_39610 9687 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 10685 9954 gene locus_tag LOCUS_39620 10685 9954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 11778 10705 gene locus_tag LOCUS_39630 11778 10705 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203205.1 protein_id gnl|my_center|LOCUS_39630 12508 11780 gene locus_tag LOCUS_39640 12508 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 14306 12585 gene locus_tag LOCUS_39650 14306 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 14324 15745 gene locus_tag LOCUS_39660 14324 15745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 15754 16200 gene locus_tag LOCUS_39670 15754 16200 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_39670 16401 16201 gene locus_tag LOCUS_39680 16401 16201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 >Feature sequence147 2862 1054 gene locus_tag LOCUS_39690 2862 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 4000 2972 gene locus_tag LOCUS_39700 4000 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 4056 5324 gene locus_tag LOCUS_39710 4056 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 5324 7555 gene locus_tag LOCUS_39720 5324 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 7565 9547 gene locus_tag LOCUS_39730 7565 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 9594 10718 gene locus_tag LOCUS_39740 9594 10718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 11334 10702 gene locus_tag LOCUS_39750 11334 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 12896 11304 gene locus_tag LOCUS_39760 12896 11304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 13079 12897 gene locus_tag LOCUS_39770 13079 12897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 13069 14013 gene locus_tag LOCUS_39780 13069 14013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 14814 14038 gene locus_tag LOCUS_39790 14814 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 >Feature sequence148 1026 832 gene locus_tag LOCUS_39800 1026 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 1991 1080 gene locus_tag LOCUS_39810 1991 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 3268 2126 gene locus_tag LOCUS_39820 3268 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227554.1 protein_id gnl|my_center|LOCUS_39820 4104 3265 gene locus_tag LOCUS_39830 4104 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 5239 4112 gene locus_tag LOCUS_39840 gene acd 5239 4112 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227551.1 protein_id gnl|my_center|LOCUS_39840 7683 5398 gene locus_tag LOCUS_39850 7683 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 7907 9367 gene locus_tag LOCUS_39860 7907 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 9364 10074 gene locus_tag LOCUS_39870 9364 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 10074 11168 gene locus_tag LOCUS_39880 10074 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 11168 11689 gene locus_tag LOCUS_39890 11168 11689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 11686 11961 gene locus_tag LOCUS_39900 11686 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 11958 12410 gene locus_tag LOCUS_39910 11958 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 12407 12937 gene locus_tag LOCUS_39920 12407 12937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 12930 13832 gene locus_tag LOCUS_39930 12930 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 13825 15030 gene locus_tag LOCUS_39940 13825 15030 CDS product Hdr menaquinol oxidoreductase integral membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_39940 15027 16211 gene locus_tag LOCUS_39950 15027 16211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 16264 16338 gene locus_tag LOCUS_t00170 16264 16338 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence149 <1 2124 gene locus_tag LOCUS_39960 <1 2124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000844448.1:peptidase M14 2175 3284 gene locus_tag LOCUS_39970 2175 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 5640 3316 gene locus_tag LOCUS_39980 5640 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 5731 6684 gene locus_tag LOCUS_39990 5731 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 7716 6691 gene locus_tag LOCUS_40000 7716 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_40000 8376 7717 gene locus_tag LOCUS_40010 gene mtnC 8376 7717 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB8 protein_id gnl|my_center|LOCUS_40010 8919 8380 gene locus_tag LOCUS_40020 gene mtnD 8919 8380 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67785 protein_id gnl|my_center|LOCUS_40020 9503 8916 gene locus_tag LOCUS_40030 gene mtnB 9503 8916 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884P3 protein_id gnl|my_center|LOCUS_40030 9980 9519 gene locus_tag LOCUS_40040 9980 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 10543 9977 gene locus_tag LOCUS_40050 10543 9977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 10582 11757 gene locus_tag LOCUS_40060 gene aspC1 10582 11757 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGG1 protein_id gnl|my_center|LOCUS_40060 11781 12902 gene locus_tag LOCUS_40070 11781 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 15705 12922 gene locus_tag LOCUS_40080 15705 12922 CDS product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DV4 protein_id gnl|my_center|LOCUS_40080 >Feature sequence150 2050 869 gene locus_tag LOCUS_40090 2050 869 CDS product serpin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250733.1 protein_id gnl|my_center|LOCUS_40090 2387 2061 gene locus_tag LOCUS_40100 2387 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 2429 3724 gene locus_tag LOCUS_40110 2429 3724 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404380.1 protein_id gnl|my_center|LOCUS_40110 3727 5214 gene locus_tag LOCUS_40120 3727 5214 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 protein_id gnl|my_center|LOCUS_40120 5264 6814 gene locus_tag LOCUS_40130 5264 6814 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_40130 6852 8426 gene locus_tag LOCUS_40140 6852 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 8455 9111 gene locus_tag LOCUS_40150 8455 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 9124 10872 gene locus_tag LOCUS_40160 9124 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 10878 11345 gene locus_tag LOCUS_40170 10878 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 11377 12198 gene locus_tag LOCUS_40180 11377 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_40180 13177 12185 gene locus_tag LOCUS_40190 13177 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 14223 13186 gene locus_tag LOCUS_40200 14223 13186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 15520 14333 gene locus_tag LOCUS_40210 gene caiA 15520 14333 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 protein_id gnl|my_center|LOCUS_40210 15920 15513 gene locus_tag LOCUS_40220 15920 15513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 >Feature sequence151 178 1518 gene locus_tag LOCUS_40230 178 1518 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_40230 1857 2093 gene locus_tag LOCUS_40240 1857 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 2090 2281 gene locus_tag LOCUS_40250 2090 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 2300 2995 gene locus_tag LOCUS_40260 2300 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 3022 3276 gene locus_tag LOCUS_40270 3022 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40270 3331 5148 gene locus_tag LOCUS_40280 3331 5148 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404983.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40280 5437 5114 gene locus_tag LOCUS_40290 5437 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 6925 5483 gene locus_tag LOCUS_40300 6925 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 7500 6922 gene locus_tag LOCUS_40310 7500 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 8158 7472 gene locus_tag LOCUS_40320 8158 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 9621 8155 gene locus_tag LOCUS_40330 9621 8155 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869171.1 protein_id gnl|my_center|LOCUS_40330 11066 9624 gene locus_tag LOCUS_40340 gene dht 11066 9624 CDS product D-hydantoinase/dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I676 protein_id gnl|my_center|LOCUS_40340 11949 11071 gene locus_tag LOCUS_40350 11949 11071 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228419.1 protein_id gnl|my_center|LOCUS_40350 11997 12491 gene locus_tag LOCUS_40360 11997 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 12514 12936 gene locus_tag LOCUS_40370 12514 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 13456 12938 gene locus_tag LOCUS_40380 13456 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 14565 13453 gene locus_tag LOCUS_40390 14565 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 14907 14584 gene locus_tag LOCUS_40400 14907 14584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 >Feature sequence152 610 3117 gene locus_tag LOCUS_40410 610 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 3212 4051 gene locus_tag LOCUS_40420 3212 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 4650 4048 gene locus_tag LOCUS_40430 4650 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 4734 5495 gene locus_tag LOCUS_40440 4734 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 6653 5502 gene locus_tag LOCUS_40450 6653 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 6801 8243 gene locus_tag LOCUS_40460 6801 8243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141838.1 protein_id gnl|my_center|LOCUS_40460 10029 8266 gene locus_tag LOCUS_40470 10029 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 10106 11392 gene locus_tag LOCUS_40480 10106 11392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 11472 12236 gene locus_tag LOCUS_40490 11472 12236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 13018 12233 gene locus_tag LOCUS_40500 13018 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 13112 13609 gene locus_tag LOCUS_40510 13112 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 14709 13621 gene locus_tag LOCUS_40520 14709 13621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 14708 15628 gene locus_tag LOCUS_40530 14708 15628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 <16211 15641 gene locus_tag LOCUS_40540 <16211 15641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083827.1:hydrolase glyoxylase >Feature sequence153 1122 559 gene locus_tag LOCUS_40550 1122 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 2453 1122 gene locus_tag LOCUS_40560 2453 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 3165 2464 gene locus_tag LOCUS_40570 3165 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 3878 3165 gene locus_tag LOCUS_40580 3878 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 4024 5628 gene locus_tag LOCUS_40590 4024 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 6057 5635 gene locus_tag LOCUS_40600 6057 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 6173 6862 gene locus_tag LOCUS_40610 6173 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 8280 6865 gene locus_tag LOCUS_40620 8280 6865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 8279 9895 gene locus_tag LOCUS_40630 8279 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 11393 9897 gene locus_tag LOCUS_40640 11393 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 11487 12062 gene locus_tag LOCUS_40650 11487 12062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 12746 12066 gene locus_tag LOCUS_40660 12746 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 14178 12748 gene locus_tag LOCUS_40670 14178 12748 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244563.1 protein_id gnl|my_center|LOCUS_40670 16205 14178 gene locus_tag LOCUS_40680 16205 14178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 >Feature sequence154 2996 1692 gene locus_tag LOCUS_40690 2996 1692 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566866.1 protein_id gnl|my_center|LOCUS_40690 3769 3008 gene locus_tag LOCUS_40700 3769 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 4125 3769 gene locus_tag LOCUS_40710 4125 3769 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_40710 4724 4131 gene locus_tag LOCUS_40720 4724 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 4723 7086 gene locus_tag LOCUS_40730 4723 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 9826 7046 gene locus_tag LOCUS_40740 9826 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 9957 10394 gene locus_tag LOCUS_40750 9957 10394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 10665 10396 gene locus_tag LOCUS_40760 10665 10396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 12236 10749 gene locus_tag LOCUS_40770 12236 10749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 13600 12233 gene locus_tag LOCUS_40780 13600 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 14622 13597 gene locus_tag LOCUS_40790 14622 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 >Feature sequence155 456 2240 gene locus_tag LOCUS_40800 456 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 2262 3230 gene locus_tag LOCUS_40810 2262 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 3241 5637 gene locus_tag LOCUS_40820 3241 5637 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769700.1 protein_id gnl|my_center|LOCUS_40820 3356 3267 gene locus_tag LOCUS_t00180 3356 3267 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6451 5615 gene locus_tag LOCUS_40830 6451 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 6670 6485 gene locus_tag LOCUS_40840 6670 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 7842 6667 gene locus_tag LOCUS_40850 7842 6667 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461057.1 protein_id gnl|my_center|LOCUS_40850 10175 7851 gene locus_tag LOCUS_40860 10175 7851 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272544.1 protein_id gnl|my_center|LOCUS_40860 10975 10349 gene locus_tag LOCUS_40870 10975 10349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 11441 11019 gene locus_tag LOCUS_40880 11441 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 12400 11438 gene locus_tag LOCUS_40890 12400 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 12897 12397 gene locus_tag LOCUS_40900 12897 12397 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_40900 13847 12996 gene locus_tag LOCUS_40910 13847 12996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 14307 13867 gene locus_tag LOCUS_40920 14307 13867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 14381 15607 gene locus_tag LOCUS_40930 14381 15607 CDS product nucleoside:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_40930 >Feature sequence156 <1 623 gene locus_tag LOCUS_40940 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528841.1:kumamolisin 539 1444 gene locus_tag LOCUS_40950 539 1444 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_40950 1438 2517 gene locus_tag LOCUS_40960 1438 2517 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 protein_id gnl|my_center|LOCUS_40960 2514 7667 gene locus_tag LOCUS_40970 2514 7667 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_40970 7654 8592 gene locus_tag LOCUS_40980 7654 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 9808 8552 gene locus_tag LOCUS_40990 9808 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 10116 9898 gene locus_tag LOCUS_41000 10116 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 10186 10563 gene locus_tag LOCUS_41010 10186 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 10560 11633 gene locus_tag LOCUS_41020 10560 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 11661 12782 gene locus_tag LOCUS_41030 11661 12782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 12779 13750 gene locus_tag LOCUS_41040 gene moaA 12779 13750 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGL2 protein_id gnl|my_center|LOCUS_41040 >Feature sequence157 <1 526 gene locus_tag LOCUS_41050 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P44632:Holliday junction ATP-dependent DNA helicase RuvA 523 1548 gene locus_tag LOCUS_41060 gene ruvB 523 1548 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HA9 protein_id gnl|my_center|LOCUS_41060 1545 1964 gene locus_tag LOCUS_41070 1545 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 1964 2725 gene locus_tag LOCUS_41080 gene lpxC 1964 2725 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI02 protein_id gnl|my_center|LOCUS_41080 2960 3916 gene locus_tag LOCUS_41090 2960 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 3925 5457 gene locus_tag LOCUS_41100 3925 5457 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_41100 6225 5590 gene locus_tag LOCUS_41110 6225 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 7577 6513 gene locus_tag LOCUS_41120 7577 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 7781 7605 gene locus_tag LOCUS_41130 7781 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 9108 7807 gene locus_tag LOCUS_41140 9108 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 9752 9111 gene locus_tag LOCUS_41150 9752 9111 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A973 protein_id gnl|my_center|LOCUS_41150 9775 10431 gene locus_tag LOCUS_41160 9775 10431 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_41160 10444 12243 gene locus_tag LOCUS_41170 10444 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 13657 12245 gene locus_tag LOCUS_41180 13657 12245 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_41180 16012 13667 gene locus_tag LOCUS_41190 16012 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 >Feature sequence158 229 603 gene locus_tag LOCUS_41200 229 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 690 1757 gene locus_tag LOCUS_41210 gene atoB 690 1757 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_41210 1754 3310 gene locus_tag LOCUS_41220 1754 3310 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224430.1 protein_id gnl|my_center|LOCUS_41220 3307 4038 gene locus_tag LOCUS_41230 gene fabG 3307 4038 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722299.1 protein_id gnl|my_center|LOCUS_41230 4049 4687 gene locus_tag LOCUS_41240 4049 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 4695 5852 gene locus_tag LOCUS_41250 4695 5852 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_41250 5861 6769 gene locus_tag LOCUS_41260 5861 6769 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704886.1 protein_id gnl|my_center|LOCUS_41260 6769 7560 gene locus_tag LOCUS_41270 gene lpqC 6769 7560 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_41270 11817 7570 gene locus_tag LOCUS_41280 11817 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 12773 11736 gene locus_tag LOCUS_41290 12773 11736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 13744 12764 gene locus_tag LOCUS_41300 13744 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 14910 13753 gene locus_tag LOCUS_41310 14910 13753 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730892.1 protein_id gnl|my_center|LOCUS_41310 15118 15429 gene locus_tag LOCUS_41320 15118 15429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 >Feature sequence159 778 678 gene locus_tag LOCUS_t00190 778 678 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 811 1938 gene locus_tag LOCUS_41330 811 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 2551 1940 gene locus_tag LOCUS_41340 2551 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 2591 2854 gene locus_tag LOCUS_41350 2591 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 2851 3342 gene locus_tag LOCUS_41360 2851 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 4458 3349 gene locus_tag LOCUS_41370 gene tyrA 4458 3349 CDS product T-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH68 protein_id gnl|my_center|LOCUS_41370 4487 5239 gene locus_tag LOCUS_41380 4487 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 5236 6831 gene locus_tag LOCUS_41390 5236 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 9064 6797 gene locus_tag LOCUS_41400 9064 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 9110 9556 gene locus_tag LOCUS_41410 9110 9556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 10034 9561 gene locus_tag LOCUS_41420 10034 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 10070 11557 gene locus_tag LOCUS_41430 10070 11557 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058287.1 protein_id gnl|my_center|LOCUS_41430 12125 11547 gene locus_tag LOCUS_41440 12125 11547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 12598 12128 gene locus_tag LOCUS_41450 12598 12128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 12708 15041 gene locus_tag LOCUS_41460 12708 15041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 >Feature sequence160 1496 279 gene locus_tag LOCUS_41470 1496 279 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393033.1 protein_id gnl|my_center|LOCUS_41470 2297 1515 gene locus_tag LOCUS_41480 2297 1515 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973077.1 protein_id gnl|my_center|LOCUS_41480 2296 3048 gene locus_tag LOCUS_41490 2296 3048 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391687.1 protein_id gnl|my_center|LOCUS_41490 3109 3339 gene locus_tag LOCUS_41500 3109 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 4052 3336 gene locus_tag LOCUS_41510 4052 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 4130 4366 gene locus_tag LOCUS_41520 gene rpmB 4130 4366 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEP1 protein_id gnl|my_center|LOCUS_41520 5354 4320 gene locus_tag LOCUS_41530 5354 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 6091 5384 gene locus_tag LOCUS_41540 6091 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 7711 6095 gene locus_tag LOCUS_41550 7711 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 8434 7721 gene locus_tag LOCUS_41560 8434 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 9552 8434 gene locus_tag LOCUS_41570 9552 8434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 9601 10104 gene locus_tag LOCUS_41580 9601 10104 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211558.1 protein_id gnl|my_center|LOCUS_41580 10097 10786 gene locus_tag LOCUS_41590 10097 10786 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 protein_id gnl|my_center|LOCUS_41590 10783 11520 gene locus_tag LOCUS_41600 10783 11520 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258397.1 protein_id gnl|my_center|LOCUS_41600 11522 12436 gene locus_tag LOCUS_41610 11522 12436 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121327.1 protein_id gnl|my_center|LOCUS_41610 14988 12439 gene locus_tag LOCUS_41620 14988 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 >Feature sequence161 170 1360 gene locus_tag LOCUS_41630 170 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 1347 2183 gene locus_tag LOCUS_41640 1347 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 2183 3547 gene locus_tag LOCUS_41650 2183 3547 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903982.1 protein_id gnl|my_center|LOCUS_41650 4383 3544 gene locus_tag LOCUS_41660 4383 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 6377 4383 gene locus_tag LOCUS_41670 6377 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 6376 7440 gene locus_tag LOCUS_41680 gene solA 6376 7440 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58524 protein_id gnl|my_center|LOCUS_41680 7433 8812 gene locus_tag LOCUS_41690 7433 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 8809 9360 gene locus_tag LOCUS_41700 8809 9360 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_41700 9364 9999 gene locus_tag LOCUS_41710 9364 9999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 9996 11753 gene locus_tag LOCUS_41720 9996 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 11753 12547 gene locus_tag LOCUS_41730 11753 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 13628 12444 gene locus_tag LOCUS_41740 13628 12444 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338987.1 protein_id gnl|my_center|LOCUS_41740 13722 15782 gene locus_tag LOCUS_41750 13722 15782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 >Feature sequence162 142 534 gene locus_tag LOCUS_41760 142 534 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_41760 1158 550 gene locus_tag LOCUS_41770 1158 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 1224 8117 gene locus_tag LOCUS_41780 1224 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 8114 9475 gene locus_tag LOCUS_41790 8114 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 9809 9483 gene locus_tag LOCUS_41800 9809 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 10413 9895 gene locus_tag LOCUS_41810 10413 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 10875 10435 gene locus_tag LOCUS_41820 10875 10435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 10901 11947 gene locus_tag LOCUS_41830 10901 11947 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887674.1 protein_id gnl|my_center|LOCUS_41830 12383 11949 gene locus_tag LOCUS_41840 12383 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 13805 12393 gene locus_tag LOCUS_41850 13805 12393 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_41850 14760 13819 gene locus_tag LOCUS_41860 14760 13819 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388127.1 protein_id gnl|my_center|LOCUS_41860 15717 14770 gene locus_tag LOCUS_41870 15717 14770 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546520.1 protein_id gnl|my_center|LOCUS_41870 >Feature sequence163 1967 2383 gene locus_tag LOCUS_41880 1967 2383 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_41880 2509 3972 gene locus_tag LOCUS_41890 2509 3972 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_41890 3969 4397 gene locus_tag LOCUS_41900 3969 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_41900 4384 5073 gene locus_tag LOCUS_41910 4384 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 5515 5057 gene locus_tag LOCUS_41920 5515 5057 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_41920 5591 7366 gene locus_tag LOCUS_41930 5591 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 7363 8757 gene locus_tag LOCUS_41940 7363 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 8759 10504 gene locus_tag LOCUS_41950 8759 10504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 11306 10512 gene locus_tag LOCUS_41960 11306 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 11992 11309 gene locus_tag LOCUS_41970 11992 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 12356 12090 gene locus_tag LOCUS_41980 12356 12090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 14089 12362 gene locus_tag LOCUS_41990 14089 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 14127 15461 gene locus_tag LOCUS_42000 14127 15461 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_42000 >Feature sequence164 549 1460 gene locus_tag LOCUS_42010 549 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 3119 1464 gene locus_tag LOCUS_42020 3119 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 3656 3123 gene locus_tag LOCUS_42030 3656 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 3758 5119 gene locus_tag LOCUS_42040 3758 5119 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_42040 5140 6189 gene locus_tag LOCUS_42050 5140 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 7010 6207 gene locus_tag LOCUS_42060 gene rsmI 7010 6207 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DID6 protein_id gnl|my_center|LOCUS_42060 7294 7007 gene locus_tag LOCUS_42070 7294 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 7800 7369 gene locus_tag LOCUS_42080 gene rplS 7800 7369 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CSU9 protein_id gnl|my_center|LOCUS_42080 8563 7880 gene locus_tag LOCUS_42090 gene trmD 8563 7880 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDJ3 protein_id gnl|my_center|LOCUS_42090 8958 8560 gene locus_tag LOCUS_42100 8958 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 9300 9043 gene locus_tag LOCUS_42110 9300 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 9562 9302 gene locus_tag LOCUS_42120 gene rpsP 9562 9302 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4M6 protein_id gnl|my_center|LOCUS_42120 9658 10710 gene locus_tag LOCUS_42130 9658 10710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 12285 10735 gene locus_tag LOCUS_42140 12285 10735 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_42140 12405 15515 gene locus_tag LOCUS_42150 12405 15515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 >Feature sequence165 2268 991 gene locus_tag LOCUS_42160 2268 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 2306 4024 gene locus_tag LOCUS_42170 2306 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 4021 5871 gene locus_tag LOCUS_42180 gene metF-2 4021 5871 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_42180 5928 6584 gene locus_tag LOCUS_42190 5928 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 6665 9979 gene locus_tag LOCUS_42200 6665 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 10551 9943 gene locus_tag LOCUS_42210 10551 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 12184 10526 gene locus_tag LOCUS_42220 12184 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_42220 13256 12240 gene locus_tag LOCUS_42230 13256 12240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 13277 13546 gene locus_tag LOCUS_42240 13277 13546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 13495 14823 gene locus_tag LOCUS_42250 13495 14823 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_42250 15528 14827 gene locus_tag LOCUS_42260 15528 14827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 >Feature sequence166 1075 146 gene locus_tag LOCUS_42270 1075 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 2380 1088 gene locus_tag LOCUS_42280 2380 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 3660 2380 gene locus_tag LOCUS_42290 3660 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 4139 3669 gene locus_tag LOCUS_42300 4139 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 5182 4145 gene locus_tag LOCUS_42310 5182 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 5252 7249 gene locus_tag LOCUS_42320 5252 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 7263 10007 gene locus_tag LOCUS_42330 7263 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 10919 10011 gene locus_tag LOCUS_42340 10919 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 11482 10916 gene locus_tag LOCUS_42350 11482 10916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 12403 11492 gene locus_tag LOCUS_42360 12403 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 12413 13687 gene locus_tag LOCUS_42370 12413 13687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 13680 14630 gene locus_tag LOCUS_42380 13680 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 15168 14617 gene locus_tag LOCUS_42390 15168 14617 CDS product ribosomal protein N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889068.1 protein_id gnl|my_center|LOCUS_42390 >Feature sequence167 466 1092 gene locus_tag LOCUS_42400 466 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 1104 1493 gene locus_tag LOCUS_42410 1104 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 1483 2490 gene locus_tag LOCUS_42420 1483 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 4729 2483 gene locus_tag LOCUS_42430 4729 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 4831 6987 gene locus_tag LOCUS_42440 4831 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 protein_id gnl|my_center|LOCUS_42440 7017 7508 gene locus_tag LOCUS_42450 7017 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 7509 9584 gene locus_tag LOCUS_42460 7509 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 10633 9806 gene locus_tag LOCUS_42470 10633 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 10664 11287 gene locus_tag LOCUS_42480 10664 11287 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088397.1 protein_id gnl|my_center|LOCUS_42480 13629 11284 gene locus_tag LOCUS_42490 gene pheT 13629 11284 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHN8 protein_id gnl|my_center|LOCUS_42490 13679 14197 gene locus_tag LOCUS_42500 13679 14197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 14851 14279 gene locus_tag LOCUS_42510 14851 14279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 >Feature sequence168 1146 526 gene locus_tag LOCUS_42520 gene engB 1146 526 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TG0 protein_id gnl|my_center|LOCUS_42520 1177 2196 gene locus_tag LOCUS_42530 1177 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 2193 2993 gene locus_tag LOCUS_42540 2193 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 3002 4069 gene locus_tag LOCUS_42550 gene mtnA 3002 4069 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI0 protein_id gnl|my_center|LOCUS_42550 4066 5007 gene locus_tag LOCUS_42560 4066 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 5983 4997 gene locus_tag LOCUS_42570 5983 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 7344 6037 gene locus_tag LOCUS_42580 7344 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 8559 7345 gene locus_tag LOCUS_42590 8559 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 12485 8556 gene locus_tag LOCUS_42600 12485 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 12513 14759 gene locus_tag LOCUS_42610 gene lon 12513 14759 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2J0 protein_id gnl|my_center|LOCUS_42610 14776 15048 gene locus_tag LOCUS_42620 14776 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 >Feature sequence169 762 484 gene locus_tag LOCUS_42630 762 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 807 3032 gene locus_tag LOCUS_42640 807 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 3918 3229 gene locus_tag LOCUS_42650 3918 3229 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_42650 4569 3946 gene locus_tag LOCUS_42660 4569 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 5531 4608 gene locus_tag LOCUS_42670 5531 4608 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529052.1 protein_id gnl|my_center|LOCUS_42670 5591 8701 gene locus_tag LOCUS_42680 5591 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 8726 10747 gene locus_tag LOCUS_42690 8726 10747 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42690 12414 10744 gene locus_tag LOCUS_42700 12414 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 12478 12870 gene locus_tag LOCUS_42710 12478 12870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 13000 13530 gene locus_tag LOCUS_42720 13000 13530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 13559 14590 gene locus_tag LOCUS_42730 gene mreB-1 13559 14590 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_42730 15209 14577 gene locus_tag LOCUS_42740 15209 14577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 >Feature sequence170 845 300 gene locus_tag LOCUS_42750 gene pyrE 845 300 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN6 protein_id gnl|my_center|LOCUS_42750 1644 838 gene locus_tag LOCUS_42760 1644 838 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404568.1 protein_id gnl|my_center|LOCUS_42760 5133 1651 gene locus_tag LOCUS_42770 5133 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 6194 5160 gene locus_tag LOCUS_42780 6194 5160 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888316.1 protein_id gnl|my_center|LOCUS_42780 7067 6198 gene locus_tag LOCUS_42790 7067 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 7204 8670 gene locus_tag LOCUS_42800 gene guaB 7204 8670 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B47 protein_id gnl|my_center|LOCUS_42800 8697 9443 gene locus_tag LOCUS_42810 8697 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 9443 10162 gene locus_tag LOCUS_42820 9443 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 10167 10931 gene locus_tag LOCUS_42830 10167 10931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 10954 12849 gene locus_tag LOCUS_42840 10954 12849 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391442.1 protein_id gnl|my_center|LOCUS_42840 13499 12846 gene locus_tag LOCUS_42850 gene rplC 13499 12846 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0E0 protein_id gnl|my_center|LOCUS_42850 14704 13592 gene locus_tag LOCUS_42860 14704 13592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 >Feature sequence171 561 85 gene locus_tag LOCUS_42870 gene msrB 561 85 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q1 protein_id gnl|my_center|LOCUS_42870 1227 661 gene locus_tag LOCUS_42880 1227 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 3322 1241 gene locus_tag LOCUS_42890 3322 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 3359 4033 gene locus_tag LOCUS_42900 3359 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 4848 3988 gene locus_tag LOCUS_42910 4848 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 5108 5611 gene locus_tag LOCUS_42920 5108 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 5676 6113 gene locus_tag LOCUS_42930 5676 6113 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080815.1 protein_id gnl|my_center|LOCUS_42930 7081 6386 gene locus_tag LOCUS_42940 7081 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 8151 7078 gene locus_tag LOCUS_42950 8151 7078 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_42950 9748 8162 gene locus_tag LOCUS_42960 9748 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 11379 9886 gene locus_tag LOCUS_42970 11379 9886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 12814 11471 gene locus_tag LOCUS_42980 12814 11471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 13772 12822 gene locus_tag LOCUS_42990 13772 12822 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_42990 14416 13769 gene locus_tag LOCUS_43000 14416 13769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 <15220 14440 gene locus_tag LOCUS_43010 <15220 14440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000200580.1:hemolysin >Feature sequence172 902 4303 gene locus_tag LOCUS_43020 902 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 4304 5455 gene locus_tag LOCUS_43030 4304 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 5455 6927 gene locus_tag LOCUS_43040 5455 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 6924 8000 gene locus_tag LOCUS_43050 6924 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 8603 8010 gene locus_tag LOCUS_43060 8603 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 8873 8613 gene locus_tag LOCUS_43070 8873 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 9750 8950 gene locus_tag LOCUS_43080 9750 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 9908 10201 gene locus_tag LOCUS_43090 gene hup2 9908 10201 CDS product SPBc2 prophage-derived DNA-binding protein HU 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P68573 protein_id gnl|my_center|LOCUS_43090 12720 10357 gene locus_tag LOCUS_43100 12720 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 13951 12734 gene locus_tag LOCUS_43110 13951 12734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 >Feature sequence173 267 1106 gene locus_tag LOCUS_43120 267 1106 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403967.1 protein_id gnl|my_center|LOCUS_43120 1103 1237 gene locus_tag LOCUS_43130 1103 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 3071 1251 gene locus_tag LOCUS_43140 3071 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 4033 3071 gene locus_tag LOCUS_43150 4033 3071 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WK6 protein_id gnl|my_center|LOCUS_43150 5703 4054 gene locus_tag LOCUS_43160 5703 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 5771 5989 gene locus_tag LOCUS_43170 gene infA2 5771 5989 CDS product translation initiation factor IF-1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61687 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43170 6364 6963 gene locus_tag LOCUS_43180 6364 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 6989 7687 gene locus_tag LOCUS_43190 6989 7687 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_43190 8357 7707 gene locus_tag LOCUS_43200 8357 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 9145 8354 gene locus_tag LOCUS_43210 9145 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 9196 10965 gene locus_tag LOCUS_43220 9196 10965 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389063.1 protein_id gnl|my_center|LOCUS_43220 11469 13091 gene locus_tag LOCUS_43230 11469 13091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 13129 13527 gene locus_tag LOCUS_43240 13129 13527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 14606 13545 gene locus_tag LOCUS_43250 14606 13545 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240521.1 protein_id gnl|my_center|LOCUS_43250 >Feature sequence174 398 1306 gene locus_tag LOCUS_43260 398 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 1306 2292 gene locus_tag LOCUS_43270 1306 2292 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_43270 2289 2951 gene locus_tag LOCUS_43280 2289 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 2948 4528 gene locus_tag LOCUS_43290 2948 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 4525 5838 gene locus_tag LOCUS_43300 4525 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 8183 5967 gene locus_tag LOCUS_43310 8183 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 8935 8315 gene locus_tag LOCUS_43320 8935 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 8996 9763 gene locus_tag LOCUS_43330 8996 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 10319 9792 gene locus_tag LOCUS_43340 10319 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 11456 10344 gene locus_tag LOCUS_43350 11456 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 12301 11456 gene locus_tag LOCUS_43360 12301 11456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 12864 12298 gene locus_tag LOCUS_43370 12864 12298 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199294.1 protein_id gnl|my_center|LOCUS_43370 13714 12881 gene locus_tag LOCUS_43380 13714 12881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 13807 14319 gene locus_tag LOCUS_43390 13807 14319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 >Feature sequence175 1730 1230 gene locus_tag LOCUS_43400 gene prtI 1730 1230 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RY4 protein_id gnl|my_center|LOCUS_43400 1875 2660 gene locus_tag LOCUS_43410 1875 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 2738 3313 gene locus_tag LOCUS_43420 2738 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036513.1 protein_id gnl|my_center|LOCUS_43420 4120 3287 gene locus_tag LOCUS_43430 4120 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889566.1 protein_id gnl|my_center|LOCUS_43430 4281 4535 gene locus_tag LOCUS_43440 4281 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 4556 5287 gene locus_tag LOCUS_43450 4556 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 5284 6495 gene locus_tag LOCUS_43460 5284 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 7140 6496 gene locus_tag LOCUS_43470 7140 6496 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930359.1 protein_id gnl|my_center|LOCUS_43470 8255 7125 gene locus_tag LOCUS_43480 8255 7125 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976258.1 protein_id gnl|my_center|LOCUS_43480 9636 8266 gene locus_tag LOCUS_43490 9636 8266 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_43490 9658 10893 gene locus_tag LOCUS_43500 9658 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 11577 10897 gene locus_tag LOCUS_43510 gene ycbL 11577 10897 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065967.1 protein_id gnl|my_center|LOCUS_43510 11607 12725 gene locus_tag LOCUS_43520 11607 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 13450 12722 gene locus_tag LOCUS_43530 13450 12722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 13449 14783 gene locus_tag LOCUS_43540 13449 14783 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104117.1 protein_id gnl|my_center|LOCUS_43540 >Feature sequence176 1417 2052 gene locus_tag LOCUS_43550 gene msrA 1417 2052 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_43550 2100 5495 gene locus_tag LOCUS_43560 2100 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 5896 5492 gene locus_tag LOCUS_43570 5896 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819665.1 protein_id gnl|my_center|LOCUS_43570 5941 6924 gene locus_tag LOCUS_43580 gene mdh 5941 6924 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3J3 protein_id gnl|my_center|LOCUS_43580 7085 8647 gene locus_tag LOCUS_43590 7085 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 9122 8715 gene locus_tag LOCUS_43600 9122 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 9508 9119 gene locus_tag LOCUS_43610 9508 9119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 10548 9505 gene locus_tag LOCUS_43620 10548 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 11662 10628 gene locus_tag LOCUS_43630 11662 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 12140 11670 gene locus_tag LOCUS_43640 12140 11670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 12780 12130 gene locus_tag LOCUS_43650 12780 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 13367 12777 gene locus_tag LOCUS_43660 13367 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 >Feature sequence177 557 1036 gene locus_tag LOCUS_43670 557 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022607.1 protein_id gnl|my_center|LOCUS_43670 1650 1042 gene locus_tag LOCUS_43680 1650 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 1819 1652 gene locus_tag LOCUS_43690 1819 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 2424 1816 gene locus_tag LOCUS_43700 2424 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 2909 3391 gene locus_tag LOCUS_43710 2909 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 5054 3363 gene locus_tag LOCUS_43720 5054 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 5078 5611 gene locus_tag LOCUS_43730 5078 5611 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_43730 5628 6980 gene locus_tag LOCUS_43740 5628 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 6993 8045 gene locus_tag LOCUS_43750 6993 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 8087 9124 gene locus_tag LOCUS_43760 8087 9124 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228210.1 protein_id gnl|my_center|LOCUS_43760 9146 10399 gene locus_tag LOCUS_43770 9146 10399 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_43770 10396 11721 gene locus_tag LOCUS_43780 10396 11721 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532354.1 protein_id gnl|my_center|LOCUS_43780 12610 11726 gene locus_tag LOCUS_43790 12610 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140485.1 protein_id gnl|my_center|LOCUS_43790 13053 12595 gene locus_tag LOCUS_43800 13053 12595 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_43800 14555 13056 gene locus_tag LOCUS_43810 14555 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 >Feature sequence178 <1 654 gene locus_tag LOCUS_43820 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001252959.1:metallo beta-lactamase superfamily lipoprotein 1982 645 gene locus_tag LOCUS_43830 1982 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_43830 3531 1993 gene locus_tag LOCUS_43840 3531 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 3570 4721 gene locus_tag LOCUS_43850 3570 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700860.1 protein_id gnl|my_center|LOCUS_43850 4737 5318 gene locus_tag LOCUS_43860 4737 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 5329 7491 gene locus_tag LOCUS_43870 5329 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 5683 5761 gene locus_tag LOCUS_t00200 5683 5761 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7491 8384 gene locus_tag LOCUS_43880 7491 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 8381 8971 gene locus_tag LOCUS_43890 8381 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 11132 8988 gene locus_tag LOCUS_43900 11132 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 12922 11129 gene locus_tag LOCUS_43910 12922 11129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 >Feature sequence179 1009 146 gene locus_tag LOCUS_43920 1009 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 1371 1006 gene locus_tag LOCUS_43930 1371 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121288.1 protein_id gnl|my_center|LOCUS_43930 2452 1412 gene locus_tag LOCUS_43940 gene pyrH 2452 1412 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFI0 protein_id gnl|my_center|LOCUS_43940 2644 3858 gene locus_tag LOCUS_43950 2644 3858 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_43950 3855 5099 gene locus_tag LOCUS_43960 3855 5099 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_43960 5102 5797 gene locus_tag LOCUS_43970 5102 5797 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_43970 5809 6687 gene locus_tag LOCUS_43980 5809 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 7344 6694 gene locus_tag LOCUS_43990 7344 6694 CDS product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 protein_id gnl|my_center|LOCUS_43990 8648 7341 gene locus_tag LOCUS_44000 8648 7341 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865056.1 protein_id gnl|my_center|LOCUS_44000 8833 9306 gene locus_tag LOCUS_44010 8833 9306 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707436.1 protein_id gnl|my_center|LOCUS_44010 10515 9496 gene locus_tag LOCUS_44020 10515 9496 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104216.1 protein_id gnl|my_center|LOCUS_44020 10599 11432 gene locus_tag LOCUS_44030 10599 11432 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530630.1 protein_id gnl|my_center|LOCUS_44030 12627 11437 gene locus_tag LOCUS_44040 12627 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 13106 12624 gene locus_tag LOCUS_44050 13106 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 13593 13189 gene locus_tag LOCUS_44060 13593 13189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 14385 13750 gene locus_tag LOCUS_44070 14385 13750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 >Feature sequence180 <1 2904 gene locus_tag LOCUS_44080 <1 2904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967237.1:guanylate cyclase 3602 3069 gene locus_tag LOCUS_44090 3602 3069 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973277.1 protein_id gnl|my_center|LOCUS_44090 3601 4500 gene locus_tag LOCUS_44100 gene soj 3601 4500 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37522 protein_id gnl|my_center|LOCUS_44100 4538 6436 gene locus_tag LOCUS_44110 4538 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 6671 6453 gene locus_tag LOCUS_44120 6671 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 7103 6681 gene locus_tag LOCUS_44130 7103 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 7678 7103 gene locus_tag LOCUS_44140 7678 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 7723 8484 gene locus_tag LOCUS_44150 7723 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 9751 8471 gene locus_tag LOCUS_44160 9751 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 10501 9764 gene locus_tag LOCUS_44170 10501 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 10616 11923 gene locus_tag LOCUS_44180 10616 11923 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886672.1 protein_id gnl|my_center|LOCUS_44180 11935 12009 gene locus_tag LOCUS_t00210 11935 12009 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12237 14270 gene locus_tag LOCUS_44190 12237 14270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 >Feature sequence181 4467 886 gene locus_tag LOCUS_44200 4467 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 5602 4457 gene locus_tag LOCUS_44210 5602 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 7903 5630 gene locus_tag LOCUS_44220 7903 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 8153 7908 gene locus_tag LOCUS_44230 8153 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 9205 8153 gene locus_tag LOCUS_44240 9205 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 9235 10104 gene locus_tag LOCUS_44250 9235 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 11384 10149 gene locus_tag LOCUS_44260 11384 10149 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878813.1 protein_id gnl|my_center|LOCUS_44260 12280 11384 gene locus_tag LOCUS_44270 gene thrB 12280 11384 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Q0 protein_id gnl|my_center|LOCUS_44270 12315 13628 gene locus_tag LOCUS_44280 12315 13628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 >Feature sequence182 1474 770 gene locus_tag LOCUS_44290 1474 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 2117 1506 gene locus_tag LOCUS_44300 2117 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 2360 2208 gene locus_tag LOCUS_44310 2360 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 2997 2377 gene locus_tag LOCUS_44320 2997 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 4022 2997 gene locus_tag LOCUS_44330 4022 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 5575 4019 gene locus_tag LOCUS_44340 5575 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 7182 5575 gene locus_tag LOCUS_44350 7182 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 7269 8867 gene locus_tag LOCUS_44360 7269 8867 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_44360 10337 8880 gene locus_tag LOCUS_44370 10337 8880 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_44370 11712 10339 gene locus_tag LOCUS_44380 11712 10339 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_44380 11996 11730 gene locus_tag LOCUS_44390 11996 11730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 12325 11993 gene locus_tag LOCUS_44400 12325 11993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 12364 13614 gene locus_tag LOCUS_44410 12364 13614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 >Feature sequence183 2335 1049 gene locus_tag LOCUS_44420 gene murD 2335 1049 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK81 protein_id gnl|my_center|LOCUS_44420 3432 2332 gene locus_tag LOCUS_44430 gene mraY 3432 2332 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D3 protein_id gnl|my_center|LOCUS_44430 4766 3432 gene locus_tag LOCUS_44440 gene murF 4766 3432 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9Q4 protein_id gnl|my_center|LOCUS_44440 5836 4763 gene locus_tag LOCUS_44450 gene murE 5836 4763 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_44450 5864 6097 gene locus_tag LOCUS_44460 5864 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 6416 6270 gene locus_tag LOCUS_44470 6416 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 8573 6588 gene locus_tag LOCUS_44480 gene ftsI 8573 6588 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_44480 8887 8570 gene locus_tag LOCUS_44490 8887 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 9726 8884 gene locus_tag LOCUS_44500 gene rsmH 9726 8884 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEN7 protein_id gnl|my_center|LOCUS_44500 10249 9770 gene locus_tag LOCUS_44510 10249 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 10297 10839 gene locus_tag LOCUS_44520 10297 10839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 10870 12132 gene locus_tag LOCUS_44530 10870 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 12132 12977 gene locus_tag LOCUS_44540 12132 12977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 12974 13633 gene locus_tag LOCUS_44550 12974 13633 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0T7 protein_id gnl|my_center|LOCUS_44550 >Feature sequence184 105 1142 gene locus_tag LOCUS_44560 105 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 1142 1618 gene locus_tag LOCUS_44570 1142 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 1618 2241 gene locus_tag LOCUS_44580 1618 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 2344 4278 gene locus_tag LOCUS_44590 2344 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460248.1 protein_id gnl|my_center|LOCUS_44590 4821 4294 gene locus_tag LOCUS_44600 4821 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 5417 4821 gene locus_tag LOCUS_44610 5417 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 5567 6205 gene locus_tag LOCUS_44620 5567 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 6242 6823 gene locus_tag LOCUS_44630 6242 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 6847 7500 gene locus_tag LOCUS_44640 6847 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 7501 8613 gene locus_tag LOCUS_44650 7501 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 8610 9155 gene locus_tag LOCUS_44660 8610 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 9192 10628 gene locus_tag LOCUS_44670 9192 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 11612 10653 gene locus_tag LOCUS_44680 11612 10653 CDS product protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804994.1 protein_id gnl|my_center|LOCUS_44680 11661 12128 gene locus_tag LOCUS_44690 11661 12128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 13529 12141 gene locus_tag LOCUS_44700 13529 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 >Feature sequence185 1147 86 gene locus_tag LOCUS_44710 gene hemB 1147 86 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45622 protein_id gnl|my_center|LOCUS_44710 1206 2426 gene locus_tag LOCUS_44720 1206 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 4324 2429 gene locus_tag LOCUS_44730 4324 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 4361 5008 gene locus_tag LOCUS_44740 gene msrA 4361 5008 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y6C3 protein_id gnl|my_center|LOCUS_44740 5478 6146 gene locus_tag LOCUS_44750 5478 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 6896 6315 gene locus_tag LOCUS_44760 6896 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700774.1 protein_id gnl|my_center|LOCUS_44760 7010 8335 gene locus_tag LOCUS_44770 7010 8335 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073021.1 protein_id gnl|my_center|LOCUS_44770 8960 9109 gene locus_tag LOCUS_44780 8960 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 10230 9112 gene locus_tag LOCUS_44790 10230 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 10341 11282 gene locus_tag LOCUS_44800 10341 11282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 11327 12166 gene locus_tag LOCUS_44810 11327 12166 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143535.1 protein_id gnl|my_center|LOCUS_44810 13614 12163 gene locus_tag LOCUS_44820 13614 12163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 >Feature sequence186 930 2402 gene locus_tag LOCUS_44830 930 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 2399 3367 gene locus_tag LOCUS_44840 2399 3367 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 protein_id gnl|my_center|LOCUS_44840 3731 3342 gene locus_tag LOCUS_44850 3731 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 4234 3731 gene locus_tag LOCUS_44860 4234 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 4290 5570 gene locus_tag LOCUS_44870 4290 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 5610 5894 gene locus_tag LOCUS_44880 5610 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 5919 6209 gene locus_tag LOCUS_44890 5919 6209 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098922.1 protein_id gnl|my_center|LOCUS_44890 6209 6928 gene locus_tag LOCUS_44900 6209 6928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090657.1 protein_id gnl|my_center|LOCUS_44900 6925 7674 gene locus_tag LOCUS_44910 6925 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 9371 7671 gene locus_tag LOCUS_44920 9371 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 11086 9413 gene locus_tag LOCUS_44930 11086 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 12335 11175 gene locus_tag LOCUS_44940 12335 11175 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485071.1 protein_id gnl|my_center|LOCUS_44940 12353 13012 gene locus_tag LOCUS_44950 12353 13012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 >Feature sequence187 429 1625 gene locus_tag LOCUS_44960 429 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 1653 2375 gene locus_tag LOCUS_44970 gene terY 1653 2375 CDS product tellurium resistance protein TerY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210395.1 protein_id gnl|my_center|LOCUS_44970 2379 3200 gene locus_tag LOCUS_44980 2379 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143034.1 protein_id gnl|my_center|LOCUS_44980 3201 4526 gene locus_tag LOCUS_44990 3201 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 5557 4523 gene locus_tag LOCUS_45000 5557 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 8805 5557 gene locus_tag LOCUS_45010 8805 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 9205 8813 gene locus_tag LOCUS_45020 9205 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 10440 9202 gene locus_tag LOCUS_45030 10440 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 12260 10464 gene locus_tag LOCUS_45040 12260 10464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 13325 12282 gene locus_tag LOCUS_45050 13325 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 >Feature sequence188 3 488 gene locus_tag LOCUS_45060 3 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 509 1516 gene locus_tag LOCUS_45070 509 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 2481 1492 gene locus_tag LOCUS_45080 2481 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 3128 2502 gene locus_tag LOCUS_45090 3128 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 3508 3125 gene locus_tag LOCUS_45100 3508 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 4846 3518 gene locus_tag LOCUS_45110 4846 3518 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI85 protein_id gnl|my_center|LOCUS_45110 5126 4878 gene locus_tag LOCUS_45120 5126 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 5011 5364 gene locus_tag LOCUS_45130 5011 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 5437 5895 gene locus_tag LOCUS_45140 5437 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 5910 6272 gene locus_tag LOCUS_45150 5910 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 6284 8128 gene locus_tag LOCUS_45160 6284 8128 CDS product peptidase S9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140278.1 protein_id gnl|my_center|LOCUS_45160 8176 9846 gene locus_tag LOCUS_45170 8176 9846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 10190 10312 gene locus_tag LOCUS_45180 10190 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 10346 11167 gene locus_tag LOCUS_45190 10346 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 >Feature sequence189 995 1240 gene locus_tag LOCUS_45200 995 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 1642 1268 gene locus_tag LOCUS_45210 1642 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083895.1 protein_id gnl|my_center|LOCUS_45210 2616 1639 gene locus_tag LOCUS_45220 2616 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 2777 3187 gene locus_tag LOCUS_45230 2777 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 3184 4140 gene locus_tag LOCUS_45240 3184 4140 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304427.1 protein_id gnl|my_center|LOCUS_45240 4134 5243 gene locus_tag LOCUS_45250 4134 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 5240 6568 gene locus_tag LOCUS_45260 5240 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 6982 6608 gene locus_tag LOCUS_45270 6982 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 7479 7078 gene locus_tag LOCUS_45280 7479 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 8235 7495 gene locus_tag LOCUS_45290 8235 7495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 9162 8287 gene locus_tag LOCUS_45300 9162 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 9683 9162 gene locus_tag LOCUS_45310 9683 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 10312 9680 gene locus_tag LOCUS_45320 10312 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 10193 11188 gene locus_tag LOCUS_45330 10193 11188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 >Feature sequence190 3475 1931 gene locus_tag LOCUS_45340 3475 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 4689 3472 gene locus_tag LOCUS_45350 4689 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 4947 4714 gene locus_tag LOCUS_45360 4947 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 5302 5078 gene locus_tag LOCUS_45370 5302 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 5490 5272 gene locus_tag LOCUS_45380 5490 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 6586 5537 gene locus_tag LOCUS_45390 6586 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 8167 6644 gene locus_tag LOCUS_45400 8167 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 8324 9643 gene locus_tag LOCUS_45410 8324 9643 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_45410 9640 10647 gene locus_tag LOCUS_45420 9640 10647 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_45420 10699 11124 gene locus_tag LOCUS_45430 10699 11124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 11807 11295 gene locus_tag LOCUS_45440 11807 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946769.1 protein_id gnl|my_center|LOCUS_45440 12038 13393 gene locus_tag LOCUS_45450 12038 13393 CDS product metallo-oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119305.1 protein_id gnl|my_center|LOCUS_45450 >Feature sequence191 1462 3780 gene locus_tag LOCUS_45460 1462 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 3793 5325 gene locus_tag LOCUS_45470 3793 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 5437 7773 gene locus_tag LOCUS_45480 5437 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 7827 10121 gene locus_tag LOCUS_45490 7827 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 11050 10190 gene locus_tag LOCUS_45500 11050 10190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 11073 11492 gene locus_tag LOCUS_45510 11073 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 11492 11890 gene locus_tag LOCUS_45520 11492 11890 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_45520 >Feature sequence192 <1 1434 gene locus_tag LOCUS_45530 <1 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263309.1:cation transporter 2385 1441 gene locus_tag LOCUS_45540 2385 1441 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405050.1 protein_id gnl|my_center|LOCUS_45540 3933 2566 gene locus_tag LOCUS_45550 3933 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 4054 5571 gene locus_tag LOCUS_45560 4054 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141838.1 protein_id gnl|my_center|LOCUS_45560 6836 5646 gene locus_tag LOCUS_45570 6836 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 9051 6838 gene locus_tag LOCUS_45580 9051 6838 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702235.1 protein_id gnl|my_center|LOCUS_45580 9521 9051 gene locus_tag LOCUS_45590 9521 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 10201 9518 gene locus_tag LOCUS_45600 10201 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 10200 11060 gene locus_tag LOCUS_45610 10200 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 11405 11103 gene locus_tag LOCUS_45620 11405 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 >Feature sequence193 2124 1009 gene locus_tag LOCUS_45630 2124 1009 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MJU6 protein_id gnl|my_center|LOCUS_45630 2837 2133 gene locus_tag LOCUS_45640 2837 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 2988 3413 gene locus_tag LOCUS_45650 2988 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 3410 4273 gene locus_tag LOCUS_45660 3410 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 4280 6073 gene locus_tag LOCUS_45670 4280 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 6147 6590 gene locus_tag LOCUS_45680 6147 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 6647 7012 gene locus_tag LOCUS_45690 6647 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 7269 8453 gene locus_tag LOCUS_45700 7269 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 8463 8921 gene locus_tag LOCUS_45710 8463 8921 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_45710 8927 12199 gene locus_tag LOCUS_45720 8927 12199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 >Feature sequence194 226 2040 gene locus_tag LOCUS_45730 226 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 2050 3657 gene locus_tag LOCUS_45740 2050 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 4509 3631 gene locus_tag LOCUS_45750 4509 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 4545 5429 gene locus_tag LOCUS_45760 4545 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 5429 7066 gene locus_tag LOCUS_45770 5429 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 8500 7076 gene locus_tag LOCUS_45780 gene purB 8500 7076 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFU0 protein_id gnl|my_center|LOCUS_45780 8499 9662 gene locus_tag LOCUS_45790 8499 9662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 9672 10325 gene locus_tag LOCUS_45800 9672 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 10325 11305 gene locus_tag LOCUS_45810 10325 11305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 11268 12608 gene locus_tag LOCUS_45820 11268 12608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 >Feature sequence195 4746 6416 gene locus_tag LOCUS_45830 4746 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 8045 6423 gene locus_tag LOCUS_45840 8045 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 9037 8045 gene locus_tag LOCUS_45850 9037 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 12437 9042 gene locus_tag LOCUS_45860 12437 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 >Feature sequence196 429 782 gene locus_tag LOCUS_45870 429 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 3160 806 gene locus_tag LOCUS_45880 gene dinG 3160 806 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941031.1 protein_id gnl|my_center|LOCUS_45880 3239 4321 gene locus_tag LOCUS_45890 gene murG 3239 4321 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S528 protein_id gnl|my_center|LOCUS_45890 6002 4290 gene locus_tag LOCUS_45900 6002 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 6940 5999 gene locus_tag LOCUS_45910 6940 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 7509 6988 gene locus_tag LOCUS_45920 7509 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 8394 7672 gene locus_tag LOCUS_45930 gene trmB 8394 7672 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CQ23 protein_id gnl|my_center|LOCUS_45930 8773 8363 gene locus_tag LOCUS_45940 gene moaE 8773 8363 CDS product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31705 protein_id gnl|my_center|LOCUS_45940 9009 8770 gene locus_tag LOCUS_45950 9009 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45950 9030 9536 gene locus_tag LOCUS_45960 9030 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 10539 9538 gene locus_tag LOCUS_45970 10539 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 12281 10584 gene locus_tag LOCUS_45980 12281 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 >Feature sequence197 103 870 gene locus_tag LOCUS_45990 103 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 870 1499 gene locus_tag LOCUS_46000 870 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 1509 2759 gene locus_tag LOCUS_46010 1509 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 2772 3242 gene locus_tag LOCUS_46020 2772 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 3243 3578 gene locus_tag LOCUS_46030 3243 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 3575 4501 gene locus_tag LOCUS_46040 3575 4501 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_46040 4512 5279 gene locus_tag LOCUS_46050 4512 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_46050 5276 6304 gene locus_tag LOCUS_46060 gene wbpE 5276 6304 CDS product UDP-2-acetamido-2-deoxy-3-oxo-D-glucuronate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ76 protein_id gnl|my_center|LOCUS_46060 6301 7152 gene locus_tag LOCUS_46070 gene pilD 6301 7152 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ8 protein_id gnl|my_center|LOCUS_46070 7190 7852 gene locus_tag LOCUS_46080 7190 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 7849 8169 gene locus_tag LOCUS_46090 gene trx 7849 8169 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ76 protein_id gnl|my_center|LOCUS_46090 10105 8171 gene locus_tag LOCUS_46100 10105 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 12070 10181 gene locus_tag LOCUS_46110 12070 10181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 12095 12571 gene locus_tag LOCUS_46120 12095 12571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 >Feature sequence198 <1 594 gene locus_tag LOCUS_46130 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228953.1:CoA transferase 591 1085 gene locus_tag LOCUS_46140 591 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 1105 2124 gene locus_tag LOCUS_46150 1105 2124 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_46150 2121 2732 gene locus_tag LOCUS_46160 2121 2732 CDS product F420-dependent NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871024.1 protein_id gnl|my_center|LOCUS_46160 2732 3448 gene locus_tag LOCUS_46170 2732 3448 CDS product F420-0--gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870273.1 protein_id gnl|my_center|LOCUS_46170 3445 4311 gene locus_tag LOCUS_46180 gene cofD 3445 4311 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222933.1 protein_id gnl|my_center|LOCUS_46180 4333 4977 gene locus_tag LOCUS_46190 4333 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 4869 5237 gene locus_tag LOCUS_46200 4869 5237 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528594.1 protein_id gnl|my_center|LOCUS_46200 5234 6253 gene locus_tag LOCUS_46210 5234 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 6250 6771 gene locus_tag LOCUS_46220 6250 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 8274 6775 gene locus_tag LOCUS_46230 8274 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 8857 8384 gene locus_tag LOCUS_46240 8857 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 9112 9285 gene locus_tag LOCUS_46250 9112 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 9509 9264 gene locus_tag LOCUS_46260 9509 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 9986 10651 gene locus_tag LOCUS_46270 9986 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 <12711 10670 gene locus_tag LOCUS_46280 <12711 10670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259544.1:alpha/beta hydrolase >Feature sequence199 1611 3065 gene locus_tag LOCUS_46290 1611 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 3062 4042 gene locus_tag LOCUS_46300 3062 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 4043 5650 gene locus_tag LOCUS_46310 4043 5650 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404427.1 protein_id gnl|my_center|LOCUS_46310 5674 7056 gene locus_tag LOCUS_46320 5674 7056 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_46320 7924 7064 gene locus_tag LOCUS_46330 7924 7064 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229794.1 protein_id gnl|my_center|LOCUS_46330 8425 7928 gene locus_tag LOCUS_46340 8425 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 9479 8709 gene locus_tag LOCUS_46350 9479 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 10319 9555 gene locus_tag LOCUS_46360 10319 9555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 10386 11954 gene locus_tag LOCUS_46370 10386 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 <12700 12030 gene locus_tag LOCUS_46380 <12700 12030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326708.1:ferrous iron transporter B >Feature sequence200 1071 406 gene locus_tag LOCUS_46390 gene ytfE 1071 406 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FN36 protein_id gnl|my_center|LOCUS_46390 1988 1071 gene locus_tag LOCUS_46400 1988 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 1878 2957 gene locus_tag LOCUS_46410 1878 2957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223144.1 protein_id gnl|my_center|LOCUS_46410 2971 3408 gene locus_tag LOCUS_46420 2971 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 3791 3405 gene locus_tag LOCUS_46430 3791 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 5133 3832 gene locus_tag LOCUS_46440 5133 3832 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF6 protein_id gnl|my_center|LOCUS_46440 5352 5143 gene locus_tag LOCUS_46450 5352 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 5882 5349 gene locus_tag LOCUS_46460 5882 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 7182 5971 gene locus_tag LOCUS_46470 7182 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 7810 7265 gene locus_tag LOCUS_46480 7810 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 10877 8028 gene locus_tag LOCUS_46490 10877 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 11839 10856 gene locus_tag LOCUS_46500 11839 10856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 11885 12328 gene locus_tag LOCUS_46510 11885 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 >Feature sequence201 877 656 gene locus_tag LOCUS_46520 877 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 2016 928 gene locus_tag LOCUS_46530 2016 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 2039 2596 gene locus_tag LOCUS_46540 2039 2596 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543360.1 protein_id gnl|my_center|LOCUS_46540 2661 3008 gene locus_tag LOCUS_46550 2661 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 3015 3398 gene locus_tag LOCUS_46560 3015 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 4500 3415 gene locus_tag LOCUS_46570 4500 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 5829 4522 gene locus_tag LOCUS_46580 5829 4522 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974998.1 protein_id gnl|my_center|LOCUS_46580 7628 5823 gene locus_tag LOCUS_46590 7628 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 7652 8029 gene locus_tag LOCUS_46600 7652 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 8029 8388 gene locus_tag LOCUS_46610 8029 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 8385 8990 gene locus_tag LOCUS_46620 8385 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 8990 9535 gene locus_tag LOCUS_46630 8990 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 9532 10653 gene locus_tag LOCUS_46640 gene mauG 9532 10653 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_46640 11705 10662 gene locus_tag LOCUS_46650 11705 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888985.1 protein_id gnl|my_center|LOCUS_46650 11789 12040 gene locus_tag LOCUS_46660 11789 12040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 >Feature sequence202 4000 1520 gene locus_tag LOCUS_46670 4000 1520 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_46670 4760 4017 gene locus_tag LOCUS_46680 4760 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 7868 4824 gene locus_tag LOCUS_46690 7868 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 8476 7868 gene locus_tag LOCUS_46700 8476 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 8533 10344 gene locus_tag LOCUS_46710 8533 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 10344 10979 gene locus_tag LOCUS_46720 10344 10979 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537552.1 protein_id gnl|my_center|LOCUS_46720 11002 12009 gene locus_tag LOCUS_46730 gene acoA 11002 12009 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4N0 protein_id gnl|my_center|LOCUS_46730 >Feature sequence203 1127 4165 gene locus_tag LOCUS_46740 1127 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 4253 5167 gene locus_tag LOCUS_46750 4253 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 5749 5177 gene locus_tag LOCUS_46760 gene acrR3 5749 5177 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880133.1 protein_id gnl|my_center|LOCUS_46760 5833 6309 gene locus_tag LOCUS_46770 5833 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 6314 7021 gene locus_tag LOCUS_46780 6314 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 7126 10605 gene locus_tag LOCUS_46790 7126 10605 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_46790 10613 12172 gene locus_tag LOCUS_46800 10613 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880130.1 protein_id gnl|my_center|LOCUS_46800 >Feature sequence204 867 382 gene locus_tag LOCUS_46810 867 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 1386 1018 gene locus_tag LOCUS_46820 1386 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 1387 1740 gene locus_tag LOCUS_46830 1387 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 1963 2982 gene locus_tag LOCUS_46840 gene recA 1963 2982 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q66X92 protein_id gnl|my_center|LOCUS_46840 4335 3055 gene locus_tag LOCUS_46850 gene pyrC 4335 3055 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NF57 protein_id gnl|my_center|LOCUS_46850 4715 4569 gene locus_tag LOCUS_46860 4715 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 4716 5174 gene locus_tag LOCUS_46870 4716 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 5394 6449 gene locus_tag LOCUS_46880 5394 6449 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_46880 6694 6975 gene locus_tag LOCUS_46890 6694 6975 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940232.1 protein_id gnl|my_center|LOCUS_46890 7120 7725 gene locus_tag LOCUS_46900 7120 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 7792 10269 gene locus_tag LOCUS_46910 7792 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 10396 10782 gene locus_tag LOCUS_46920 10396 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 10824 11900 gene locus_tag LOCUS_46930 10824 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 >Feature sequence205 941 126 gene locus_tag LOCUS_46940 941 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_46940 965 2641 gene locus_tag LOCUS_46950 965 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 3188 2655 gene locus_tag LOCUS_46960 3188 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 4462 3185 gene locus_tag LOCUS_46970 4462 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 4453 6444 gene locus_tag LOCUS_46980 4453 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 6455 7669 gene locus_tag LOCUS_46990 6455 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 7729 8109 gene locus_tag LOCUS_47000 7729 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 9328 8111 gene locus_tag LOCUS_47010 9328 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 10212 9391 gene locus_tag LOCUS_47020 gene carH 10212 9391 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53W62 protein_id gnl|my_center|LOCUS_47020 10304 10918 gene locus_tag LOCUS_47030 10304 10918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 11003 10931 gene locus_tag LOCUS_t00220 11003 10931 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence206 638 234 gene locus_tag LOCUS_47040 638 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 637 1404 gene locus_tag LOCUS_47050 gene surE 637 1404 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ6 protein_id gnl|my_center|LOCUS_47050 2020 1379 gene locus_tag LOCUS_47060 2020 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 2105 2632 gene locus_tag LOCUS_47070 gene apt 2105 2632 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCV7 protein_id gnl|my_center|LOCUS_47070 2655 4112 gene locus_tag LOCUS_47080 2655 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 4664 4068 gene locus_tag LOCUS_47090 gene coaE 4664 4068 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCU7 protein_id gnl|my_center|LOCUS_47090 5095 4661 gene locus_tag LOCUS_47100 5095 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 6867 5095 gene locus_tag LOCUS_47110 6867 5095 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_47110 7664 6882 gene locus_tag LOCUS_47120 7664 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 7765 8601 gene locus_tag LOCUS_47130 7765 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 10107 8623 gene locus_tag LOCUS_47140 10107 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 10502 10104 gene locus_tag LOCUS_47150 10502 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 <11896 10611 gene locus_tag LOCUS_47160 <11896 10611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121918.1:protein kinase >Feature sequence207 1231 512 gene locus_tag LOCUS_47170 gene ate1 1231 512 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UET6 protein_id gnl|my_center|LOCUS_47170 1886 1245 gene locus_tag LOCUS_47180 1886 1245 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_47180 1906 2577 gene locus_tag LOCUS_47190 1906 2577 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977985.1 protein_id gnl|my_center|LOCUS_47190 2587 3321 gene locus_tag LOCUS_47200 2587 3321 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056496.1 protein_id gnl|my_center|LOCUS_47200 3318 4769 gene locus_tag LOCUS_47210 gene ggt 3318 4769 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_47210 6779 4932 gene locus_tag LOCUS_47220 6779 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 9247 6776 gene locus_tag LOCUS_47230 9247 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 9246 10568 gene locus_tag LOCUS_47240 9246 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 >Feature sequence208 2379 3353 gene locus_tag LOCUS_47250 2379 3353 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903481.1 protein_id gnl|my_center|LOCUS_47250 3332 4060 gene locus_tag LOCUS_47260 3332 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 4057 5169 gene locus_tag LOCUS_47270 4057 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 5199 5273 gene locus_tag LOCUS_t00230 5199 5273 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5318 5402 gene locus_tag LOCUS_t00240 5318 5402 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5431 5506 gene locus_tag LOCUS_t00250 5431 5506 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5550 5624 gene locus_tag LOCUS_t00260 5550 5624 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5662 6852 gene locus_tag LOCUS_47280 gene tuf-2 5662 6852 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_953913.1 protein_id gnl|my_center|LOCUS_47280 7047 7421 gene locus_tag LOCUS_47290 7047 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 7437 7976 gene locus_tag LOCUS_47300 gene nusG 7437 7976 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y1 protein_id gnl|my_center|LOCUS_47300 7994 8425 gene locus_tag LOCUS_47310 gene rplK 7994 8425 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66054 protein_id gnl|my_center|LOCUS_47310 8541 9254 gene locus_tag LOCUS_47320 gene rplA 8541 9254 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y3 protein_id gnl|my_center|LOCUS_47320 9263 9796 gene locus_tag LOCUS_47330 gene rplJ 9263 9796 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727C9 protein_id gnl|my_center|LOCUS_47330 9876 10250 gene locus_tag LOCUS_47340 gene rplL 9876 10250 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7K2 protein_id gnl|my_center|LOCUS_47340 >Feature sequence209 2 1510 gene locus_tag LOCUS_47350 2 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 1520 3202 gene locus_tag LOCUS_47360 1520 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 3199 4104 gene locus_tag LOCUS_47370 3199 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 4138 5091 gene locus_tag LOCUS_47380 4138 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 6369 5101 gene locus_tag LOCUS_47390 6369 5101 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_47390 6737 6366 gene locus_tag LOCUS_47400 6737 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 8788 6734 gene locus_tag LOCUS_47410 8788 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 8828 10555 gene locus_tag LOCUS_47420 8828 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 >Feature sequence210 <1 1357 gene locus_tag LOCUS_47430 <1 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460919.1:trigger factor 1445 2095 gene locus_tag LOCUS_47440 gene clpP1 1445 2095 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180F0 protein_id gnl|my_center|LOCUS_47440 2148 3035 gene locus_tag LOCUS_47450 2148 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47450 2999 3397 gene locus_tag LOCUS_47460 2999 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47460 3409 5802 gene locus_tag LOCUS_47470 gene lon-2 3409 5802 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C84 protein_id gnl|my_center|LOCUS_47470 6002 6280 gene locus_tag LOCUS_47480 6002 6280 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481749.1 protein_id gnl|my_center|LOCUS_47480 6327 6611 gene locus_tag LOCUS_47490 gene hupB 6327 6611 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_47490 6744 6817 gene locus_tag LOCUS_t00270 6744 6817 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6856 6932 gene locus_tag LOCUS_t00280 6856 6932 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7475 7026 gene locus_tag LOCUS_47500 7475 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 7804 7475 gene locus_tag LOCUS_47510 7804 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 7864 8652 gene locus_tag LOCUS_47520 gene uppP4 7864 8652 CDS product undecaprenyl-diphosphatase 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI21 protein_id gnl|my_center|LOCUS_47520 8954 8634 gene locus_tag LOCUS_47530 8954 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 9077 9150 gene locus_tag LOCUS_t00290 9077 9150 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 10098 9223 gene locus_tag LOCUS_47540 10098 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 10377 10162 gene locus_tag LOCUS_47550 10377 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 10264 10644 gene locus_tag LOCUS_47560 10264 10644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 10958 10602 gene locus_tag LOCUS_47570 10958 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 >Feature sequence211 466 1023 gene locus_tag LOCUS_47580 466 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 1045 1944 gene locus_tag LOCUS_47590 1045 1944 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_47590 1941 2351 gene locus_tag LOCUS_47600 1941 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 protein_id gnl|my_center|LOCUS_47600 2408 2629 gene locus_tag LOCUS_47610 2408 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 2626 3777 gene locus_tag LOCUS_47620 gene moeB 2626 3777 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_47620 4212 3880 gene locus_tag LOCUS_47630 4212 3880 CDS product divalent ion tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 protein_id gnl|my_center|LOCUS_47630 5372 4209 gene locus_tag LOCUS_47640 5372 4209 CDS product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814041.1 protein_id gnl|my_center|LOCUS_47640 5662 5375 gene locus_tag LOCUS_47650 5662 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814039.1 protein_id gnl|my_center|LOCUS_47650 6615 5659 gene locus_tag LOCUS_47660 gene adh 6615 5659 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_47660 7294 6623 gene locus_tag LOCUS_47670 gene gno 7294 6623 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_47670 8544 7291 gene locus_tag LOCUS_47680 gene hisD 8544 7291 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R401 protein_id gnl|my_center|LOCUS_47680 9122 8541 gene locus_tag LOCUS_47690 9122 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 9342 10232 gene locus_tag LOCUS_47700 9342 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 >Feature sequence212 891 322 gene locus_tag LOCUS_47710 891 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 1841 978 gene locus_tag LOCUS_47720 1841 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 3630 1870 gene locus_tag LOCUS_47730 3630 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 3611 4924 gene locus_tag LOCUS_47740 3611 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 4934 5908 gene locus_tag LOCUS_47750 4934 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 5985 6350 gene locus_tag LOCUS_47760 5985 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 6352 7956 gene locus_tag LOCUS_47770 6352 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 7953 10580 gene locus_tag LOCUS_47780 7953 10580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 10577 11032 gene locus_tag LOCUS_47790 10577 11032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 >Feature sequence213 1608 484 gene locus_tag LOCUS_47800 1608 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 2633 1608 gene locus_tag LOCUS_47810 2633 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 3906 2620 gene locus_tag LOCUS_47820 gene hemY 3906 2620 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_47820 3957 4760 gene locus_tag LOCUS_47830 3957 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 6184 5276 gene locus_tag LOCUS_47840 6184 5276 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_47840 7578 6184 gene locus_tag LOCUS_47850 gene fumC 7578 6184 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S250 protein_id gnl|my_center|LOCUS_47850 7600 8259 gene locus_tag LOCUS_47860 gene queE 7600 8259 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTW7 protein_id gnl|my_center|LOCUS_47860 8259 8807 gene locus_tag LOCUS_47870 8259 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 >Feature sequence214 1883 789 gene locus_tag LOCUS_47880 1883 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 3475 1877 gene locus_tag LOCUS_47890 3475 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 3735 4184 gene locus_tag LOCUS_47900 3735 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 5781 4177 gene locus_tag LOCUS_47910 5781 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941782.1 protein_id gnl|my_center|LOCUS_47910 5845 6852 gene locus_tag LOCUS_47920 gene gapA 5845 6852 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CP4 protein_id gnl|my_center|LOCUS_47920 6885 8048 gene locus_tag LOCUS_47930 gene pgk 6885 8048 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYC0 protein_id gnl|my_center|LOCUS_47930 8051 8809 gene locus_tag LOCUS_47940 gene tpiA 8051 8809 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP89 protein_id gnl|my_center|LOCUS_47940 8868 9233 gene locus_tag LOCUS_47950 8868 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 9277 9361 gene locus_tag LOCUS_t00300 9277 9361 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9840 9391 gene locus_tag LOCUS_47960 gene fur 9840 9391 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_47960 10402 9923 gene locus_tag LOCUS_47970 10402 9923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 11408 10407 gene locus_tag LOCUS_47980 gene rpoA 11408 10407 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B3 protein_id gnl|my_center|LOCUS_47980 >Feature sequence215 127 1854 gene locus_tag LOCUS_47990 127 1854 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028428.1 protein_id gnl|my_center|LOCUS_47990 1851 3665 gene locus_tag LOCUS_48000 1851 3665 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028428.1 protein_id gnl|my_center|LOCUS_48000 4842 3652 gene locus_tag LOCUS_48010 4842 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 4875 6152 gene locus_tag LOCUS_48020 4875 6152 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC96 protein_id gnl|my_center|LOCUS_48020 6190 7047 gene locus_tag LOCUS_48030 6190 7047 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_48030 7044 7994 gene locus_tag LOCUS_48040 gene mvaD 7044 7994 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_48040 7991 8818 gene locus_tag LOCUS_48050 7991 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 8829 9851 gene locus_tag LOCUS_48060 8829 9851 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_48060 9845 10363 gene locus_tag LOCUS_48070 9845 10363 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_48070 >Feature sequence216 692 1894 gene locus_tag LOCUS_48080 692 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 3193 1907 gene locus_tag LOCUS_48090 3193 1907 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028586.1 protein_id gnl|my_center|LOCUS_48090 4407 3190 gene locus_tag LOCUS_48100 4407 3190 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727055.1 protein_id gnl|my_center|LOCUS_48100 4471 5328 gene locus_tag LOCUS_48110 4471 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 6182 5325 gene locus_tag LOCUS_48120 6182 5325 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784893.1 protein_id gnl|my_center|LOCUS_48120 9955 6188 gene locus_tag LOCUS_48130 gene purL 9955 6188 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RW0 protein_id gnl|my_center|LOCUS_48130 10451 10008 gene locus_tag LOCUS_48140 10451 10008 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8F4 protein_id gnl|my_center|LOCUS_48140 10798 10448 gene locus_tag LOCUS_48150 10798 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 >Feature sequence217 3147 76 gene locus_tag LOCUS_48160 3147 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 5536 3158 gene locus_tag LOCUS_48170 5536 3158 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272585.1 protein_id gnl|my_center|LOCUS_48170 5582 6610 gene locus_tag LOCUS_48180 5582 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 >Feature sequence218 1552 434 gene locus_tag LOCUS_48190 1552 434 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339415.1 protein_id gnl|my_center|LOCUS_48190 1585 2556 gene locus_tag LOCUS_48200 gene dusA 1585 2556 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD0 protein_id gnl|my_center|LOCUS_48200 2553 3806 gene locus_tag LOCUS_48210 2553 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 3816 3950 gene locus_tag LOCUS_48220 3816 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48220 4083 4271 gene locus_tag LOCUS_48230 4083 4271 CDS product bacterioferritin comigratory inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056324.1 protein_id gnl|my_center|LOCUS_48230 4281 5243 gene locus_tag LOCUS_48240 gene gmd 4281 5243 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 protein_id gnl|my_center|LOCUS_48240 5264 5617 gene locus_tag LOCUS_48250 5264 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 5636 5953 gene locus_tag LOCUS_48260 5636 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 8181 6097 gene locus_tag LOCUS_48270 8181 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 8250 9830 gene locus_tag LOCUS_48280 8250 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 9827 10390 gene locus_tag LOCUS_48290 9827 10390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 10420 10629 gene locus_tag LOCUS_48300 10420 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 10622 10936 gene locus_tag LOCUS_48310 10622 10936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 10933 11298 gene locus_tag LOCUS_48320 10933 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 >Feature sequence219 2390 1410 gene locus_tag LOCUS_48330 gene lpxB 2390 1410 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5Y6 protein_id gnl|my_center|LOCUS_48330 3187 2387 gene locus_tag LOCUS_48340 3187 2387 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120182.1 protein_id gnl|my_center|LOCUS_48340 4023 3226 gene locus_tag LOCUS_48350 gene lpxA 4023 3226 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHC0 protein_id gnl|my_center|LOCUS_48350 4884 4033 gene locus_tag LOCUS_48360 4884 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 5315 4881 gene locus_tag LOCUS_48370 gene fabZ 5315 4881 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61453 protein_id gnl|my_center|LOCUS_48370 5832 5323 gene locus_tag LOCUS_48380 5832 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 6063 7031 gene locus_tag LOCUS_48390 6063 7031 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_48390 9497 7050 gene locus_tag LOCUS_48400 gene yaeT 9497 7050 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT3 protein_id gnl|my_center|LOCUS_48400 10189 9494 gene locus_tag LOCUS_48410 gene lolD 10189 9494 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT2 protein_id gnl|my_center|LOCUS_48410 <11381 10202 gene locus_tag LOCUS_48420 <11381 10202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942910.1:ABC transporter permease >Feature sequence220 685 131 gene locus_tag LOCUS_48430 685 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 783 1325 gene locus_tag LOCUS_48440 783 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 1690 1322 gene locus_tag LOCUS_48450 1690 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 2548 1715 gene locus_tag LOCUS_48460 2548 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 3690 2545 gene locus_tag LOCUS_48470 3690 2545 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 protein_id gnl|my_center|LOCUS_48470 4913 3687 gene locus_tag LOCUS_48480 4913 3687 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731374.1 protein_id gnl|my_center|LOCUS_48480 6410 4917 gene locus_tag LOCUS_48490 6410 4917 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MII8 protein_id gnl|my_center|LOCUS_48490 7378 6410 gene locus_tag LOCUS_48500 7378 6410 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_48500 7943 7359 gene locus_tag LOCUS_48510 7943 7359 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224372.1 protein_id gnl|my_center|LOCUS_48510 8109 8897 gene locus_tag LOCUS_48520 8109 8897 CDS product putative enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704891.1 protein_id gnl|my_center|LOCUS_48520 8959 10401 gene locus_tag LOCUS_48530 8959 10401 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726785.1 protein_id gnl|my_center|LOCUS_48530 10398 10817 gene locus_tag LOCUS_48540 10398 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 10911 11063 gene locus_tag LOCUS_48550 10911 11063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 >Feature sequence221 240 1679 gene locus_tag LOCUS_48560 240 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 1688 2005 gene locus_tag LOCUS_48570 1688 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 3773 2022 gene locus_tag LOCUS_48580 3773 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 3860 4501 gene locus_tag LOCUS_48590 3860 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 5453 4485 gene locus_tag LOCUS_48600 5453 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 5653 7830 gene locus_tag LOCUS_48610 5653 7830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 7851 8663 gene locus_tag LOCUS_48620 7851 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 9154 8660 gene locus_tag LOCUS_48630 9154 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 9263 10198 gene locus_tag LOCUS_48640 9263 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 10204 11007 gene locus_tag LOCUS_48650 10204 11007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 >Feature sequence222 315 1550 gene locus_tag LOCUS_48660 315 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 1547 2512 gene locus_tag LOCUS_48670 1547 2512 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980100.1 protein_id gnl|my_center|LOCUS_48670 2509 3159 gene locus_tag LOCUS_48680 2509 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 3582 3166 gene locus_tag LOCUS_48690 3582 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 3922 3662 gene locus_tag LOCUS_48700 gene minE 3922 3662 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJ38 protein_id gnl|my_center|LOCUS_48700 4737 3922 gene locus_tag LOCUS_48710 4737 3922 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_48710 5511 4765 gene locus_tag LOCUS_48720 5511 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 5695 5946 gene locus_tag LOCUS_48730 gene grxC 5695 5946 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721669.1 protein_id gnl|my_center|LOCUS_48730 7064 5943 gene locus_tag LOCUS_48740 7064 5943 CDS product rRNA (guanine-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886697.1 protein_id gnl|my_center|LOCUS_48740 7738 7061 gene locus_tag LOCUS_48750 7738 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 8313 10376 gene locus_tag LOCUS_48760 8313 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 >Feature sequence223 <1 963 gene locus_tag LOCUS_48770 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8GXK7:phosphoglucosamine mutase 983 1699 gene locus_tag LOCUS_48780 gene pdxJ 983 1699 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V8C9 protein_id gnl|my_center|LOCUS_48780 1721 3142 gene locus_tag LOCUS_48790 gene nnr 1721 3142 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X024 protein_id gnl|my_center|LOCUS_48790 3135 3563 gene locus_tag LOCUS_48800 3135 3563 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_48800 3576 4643 gene locus_tag LOCUS_48810 gene nifS-2 3576 4643 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_48810 4640 5680 gene locus_tag LOCUS_48820 gene mnmA 4640 5680 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A22 protein_id gnl|my_center|LOCUS_48820 5673 6350 gene locus_tag LOCUS_48830 gene rnc 5673 6350 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX1 protein_id gnl|my_center|LOCUS_48830 6340 7287 gene locus_tag LOCUS_48840 gene era 6340 7287 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CP21 protein_id gnl|my_center|LOCUS_48840 7287 8642 gene locus_tag LOCUS_48850 gene der 7287 8642 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIV4 protein_id gnl|my_center|LOCUS_48850 8643 10490 gene locus_tag LOCUS_48860 gene mutL 8643 10490 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP0 protein_id gnl|my_center|LOCUS_48860 >Feature sequence224 860 786 gene locus_tag LOCUS_t00310 860 786 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 968 877 gene locus_tag LOCUS_t00320 968 877 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1078 993 gene locus_tag LOCUS_t00330 1078 993 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2450 1098 gene locus_tag LOCUS_48870 gene serS 2450 1098 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H55 protein_id gnl|my_center|LOCUS_48870 2825 2604 gene locus_tag LOCUS_48880 2825 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 2733 2993 gene locus_tag LOCUS_48890 2733 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 3022 4113 gene locus_tag LOCUS_48900 3022 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 4123 5649 gene locus_tag LOCUS_48910 4123 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 5665 6900 gene locus_tag LOCUS_48920 5665 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 6928 9369 gene locus_tag LOCUS_48930 6928 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 10597 9374 gene locus_tag LOCUS_48940 gene bioF 10597 9374 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749W3 protein_id gnl|my_center|LOCUS_48940 10653 11174 gene locus_tag LOCUS_48950 10653 11174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 >Feature sequence225 936 2417 gene locus_tag LOCUS_48960 gene zwf 936 2417 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM53 protein_id gnl|my_center|LOCUS_48960 2414 3091 gene locus_tag LOCUS_48970 gene pgl 2414 3091 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQP5 protein_id gnl|my_center|LOCUS_48970 3088 4482 gene locus_tag LOCUS_48980 3088 4482 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLC0 protein_id gnl|my_center|LOCUS_48980 4479 5102 gene locus_tag LOCUS_48990 gene pmtA 4479 5102 CDS product phospholipid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_48990 5127 8234 gene locus_tag LOCUS_49000 5127 8234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 9357 8116 gene locus_tag LOCUS_49010 9357 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 10925 9423 gene locus_tag LOCUS_49020 10925 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 >Feature sequence226 70 1005 gene locus_tag LOCUS_49030 70 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 2213 1032 gene locus_tag LOCUS_49040 2213 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 3111 2308 gene locus_tag LOCUS_49050 3111 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 4902 3121 gene locus_tag LOCUS_49060 4902 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 5390 4911 gene locus_tag LOCUS_49070 5390 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 6418 5390 gene locus_tag LOCUS_49080 6418 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 6688 8517 gene locus_tag LOCUS_49090 6688 8517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 8569 9159 gene locus_tag LOCUS_49100 8569 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 9183 9707 gene locus_tag LOCUS_49110 9183 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 9707 10543 gene locus_tag LOCUS_49120 9707 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 >Feature sequence227 467 2017 gene locus_tag LOCUS_49130 467 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 3331 2027 gene locus_tag LOCUS_49140 3331 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 3358 4698 gene locus_tag LOCUS_49150 3358 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 4837 5007 gene locus_tag LOCUS_49160 4837 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 6944 5004 gene locus_tag LOCUS_49170 6944 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 7661 7053 gene locus_tag LOCUS_49180 7661 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 8388 7678 gene locus_tag LOCUS_49190 8388 7678 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084226.1 protein_id gnl|my_center|LOCUS_49190 10125 8413 gene locus_tag LOCUS_49200 10125 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 10571 10125 gene locus_tag LOCUS_49210 10571 10125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 >Feature sequence228 1691 495 gene locus_tag LOCUS_49220 1691 495 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889090.1 protein_id gnl|my_center|LOCUS_49220 3031 1688 gene locus_tag LOCUS_49230 3031 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 3259 3032 gene locus_tag LOCUS_49240 3259 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 4011 3262 gene locus_tag LOCUS_49250 4011 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 4945 4013 gene locus_tag LOCUS_49260 4945 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523363.1 protein_id gnl|my_center|LOCUS_49260 5907 4945 gene locus_tag LOCUS_49270 5907 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537325.1 protein_id gnl|my_center|LOCUS_49270 7268 5904 gene locus_tag LOCUS_49280 gene tadA 7268 5904 CDS product secretion system protein TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120689.1 protein_id gnl|my_center|LOCUS_49280 8466 7279 gene locus_tag LOCUS_49290 8466 7279 CDS product pilus assembly-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523366.1 protein_id gnl|my_center|LOCUS_49290 9895 8474 gene locus_tag LOCUS_49300 9895 8474 CDS product pilus assembly protein CpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 protein_id gnl|my_center|LOCUS_49300 10884 9895 gene locus_tag LOCUS_49310 10884 9895 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932120.1 protein_id gnl|my_center|LOCUS_49310 >Feature sequence229 1099 143 gene locus_tag LOCUS_49320 gene prsA 1099 143 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE8 protein_id gnl|my_center|LOCUS_49320 1193 1121 gene locus_tag LOCUS_t00340 1193 1121 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2470 1238 gene locus_tag LOCUS_49330 2470 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 3641 2442 gene locus_tag LOCUS_49340 3641 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470532.1 protein_id gnl|my_center|LOCUS_49340 4469 3645 gene locus_tag LOCUS_49350 4469 3645 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_49350 6202 4466 gene locus_tag LOCUS_49360 6202 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 7495 6212 gene locus_tag LOCUS_49370 7495 6212 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403440.1 protein_id gnl|my_center|LOCUS_49370 7376 7684 gene locus_tag LOCUS_49380 7376 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 7660 9831 gene locus_tag LOCUS_49390 7660 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 9828 10520 gene locus_tag LOCUS_49400 9828 10520 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249206.1 protein_id gnl|my_center|LOCUS_49400 >Feature sequence230 998 267 gene locus_tag LOCUS_49410 gene speA 998 267 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_49410 2724 1009 gene locus_tag LOCUS_49420 2724 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 3647 2724 gene locus_tag LOCUS_49430 3647 2724 CDS product 3-oxoadipate enol-lactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405393.1 protein_id gnl|my_center|LOCUS_49430 5038 3647 gene locus_tag LOCUS_49440 5038 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 5580 5038 gene locus_tag LOCUS_49450 5580 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 7001 5577 gene locus_tag LOCUS_49460 7001 5577 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_49460 8005 6998 gene locus_tag LOCUS_49470 8005 6998 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206330.1 protein_id gnl|my_center|LOCUS_49470 8937 8002 gene locus_tag LOCUS_49480 8937 8002 CDS product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085669.1 protein_id gnl|my_center|LOCUS_49480 9386 8985 gene locus_tag LOCUS_49490 9386 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 9667 9467 gene locus_tag LOCUS_49500 9667 9467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 9783 10265 gene locus_tag LOCUS_49510 9783 10265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 10276 10860 gene locus_tag LOCUS_49520 10276 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 >Feature sequence231 2 760 gene locus_tag LOCUS_49530 2 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 760 2049 gene locus_tag LOCUS_49540 760 2049 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S152 protein_id gnl|my_center|LOCUS_49540 2061 3428 gene locus_tag LOCUS_49550 gene lpdA2 2061 3428 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_49550 3425 4150 gene locus_tag LOCUS_49560 3425 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 5401 4157 gene locus_tag LOCUS_49570 5401 4157 CDS product hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391508.1 protein_id gnl|my_center|LOCUS_49570 6554 5433 gene locus_tag LOCUS_49580 6554 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 6642 7106 gene locus_tag LOCUS_49590 6642 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 7106 8326 gene locus_tag LOCUS_49600 7106 8326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 8370 9932 gene locus_tag LOCUS_49610 gene pntA 8370 9932 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CII9 protein_id gnl|my_center|LOCUS_49610 >Feature sequence232 2750 1131 gene locus_tag LOCUS_49620 2750 1131 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104536.1 protein_id gnl|my_center|LOCUS_49620 2999 2751 gene locus_tag LOCUS_49630 2999 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 4966 3011 gene locus_tag LOCUS_49640 4966 3011 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_49640 5616 4963 gene locus_tag LOCUS_49650 5616 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 5855 5613 gene locus_tag LOCUS_49660 5855 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 6730 6446 gene locus_tag LOCUS_49670 6730 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 7374 6751 gene locus_tag LOCUS_49680 7374 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 7622 7371 gene locus_tag LOCUS_49690 7622 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 8314 7733 gene locus_tag LOCUS_49700 8314 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 8734 8324 gene locus_tag LOCUS_49710 8734 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 9614 8727 gene locus_tag LOCUS_49720 9614 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 10470 9598 gene locus_tag LOCUS_49730 10470 9598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 >Feature sequence233 <1 1042 gene locus_tag LOCUS_49740 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461043.1:UDP-N-acetyl-D-glucosamine dehydrogenase 3109 1037 gene locus_tag LOCUS_49750 3109 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 3441 4358 gene locus_tag LOCUS_49760 3441 4358 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939395.1 protein_id gnl|my_center|LOCUS_49760 4355 5155 gene locus_tag LOCUS_49770 4355 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 5170 6492 gene locus_tag LOCUS_49780 5170 6492 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932125.1 protein_id gnl|my_center|LOCUS_49780 6493 7431 gene locus_tag LOCUS_49790 6493 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 7433 8329 gene locus_tag LOCUS_49800 7433 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523363.1 protein_id gnl|my_center|LOCUS_49800 8350 9450 gene locus_tag LOCUS_49810 8350 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 9447 9821 gene locus_tag LOCUS_49820 9447 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 9818 10222 gene locus_tag LOCUS_49830 9818 10222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 10248 10370 gene locus_tag LOCUS_49840 10248 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 >Feature sequence234 949 380 gene locus_tag LOCUS_49850 949 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 1055 2209 gene locus_tag LOCUS_49860 1055 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 2356 4005 gene locus_tag LOCUS_49870 2356 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 4033 4893 gene locus_tag LOCUS_49880 4033 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 4890 7298 gene locus_tag LOCUS_49890 4890 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 >Feature sequence235 <1 829 gene locus_tag LOCUS_49900 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIT6:anthranilate phosphoribosyltransferase 826 1575 gene locus_tag LOCUS_49910 gene trpC 826 1575 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D185 protein_id gnl|my_center|LOCUS_49910 1566 2144 gene locus_tag LOCUS_49920 gene trpF 1566 2144 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59649 protein_id gnl|my_center|LOCUS_49920 2157 3338 gene locus_tag LOCUS_49930 gene trpB 2157 3338 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS4 protein_id gnl|my_center|LOCUS_49930 3335 4099 gene locus_tag LOCUS_49940 gene trpA 3335 4099 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI3 protein_id gnl|my_center|LOCUS_49940 4219 4779 gene locus_tag LOCUS_49950 4219 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 4792 5145 gene locus_tag LOCUS_49960 4792 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 6335 5154 gene locus_tag LOCUS_49970 6335 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 6359 7867 gene locus_tag LOCUS_49980 6359 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 7864 8757 gene locus_tag LOCUS_49990 7864 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 10642 8735 gene locus_tag LOCUS_50000 10642 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 >Feature sequence236 1564 344 gene locus_tag LOCUS_50010 gene fabB 1564 344 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_50010 2438 1572 gene locus_tag LOCUS_50020 2438 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 3559 2435 gene locus_tag LOCUS_50030 3559 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 4027 3569 gene locus_tag LOCUS_50040 4027 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 4045 4746 gene locus_tag LOCUS_50050 gene nodB 4045 4746 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038465.1 protein_id gnl|my_center|LOCUS_50050 4746 5723 gene locus_tag LOCUS_50060 4746 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 5720 6841 gene locus_tag LOCUS_50070 gene cyp135B1 5720 6841 CDS product putative cytochrome P450 135B1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPM9 protein_id gnl|my_center|LOCUS_50070 7737 6856 gene locus_tag LOCUS_50080 7737 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 7994 7734 gene locus_tag LOCUS_50090 7994 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 8992 8000 gene locus_tag LOCUS_50100 8992 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 10020 8989 gene locus_tag LOCUS_50110 10020 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 10089 10346 gene locus_tag LOCUS_50120 10089 10346 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551687.1 protein_id gnl|my_center|LOCUS_50120 >Feature sequence237 1025 2020 gene locus_tag LOCUS_50130 1025 2020 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803855.1 protein_id gnl|my_center|LOCUS_50130 2010 2273 gene locus_tag LOCUS_50140 2010 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 2266 4890 gene locus_tag LOCUS_50150 gene plsB 2266 4890 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEQ0 protein_id gnl|my_center|LOCUS_50150 4887 5234 gene locus_tag LOCUS_50160 4887 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 7242 5218 gene locus_tag LOCUS_50170 7242 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 7394 8662 gene locus_tag LOCUS_50180 gene eno 7394 8662 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HBF3 protein_id gnl|my_center|LOCUS_50180 8758 9480 gene locus_tag LOCUS_50190 8758 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 9504 10055 gene locus_tag LOCUS_50200 9504 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 10025 10549 gene locus_tag LOCUS_50210 10025 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932906.1 protein_id gnl|my_center|LOCUS_50210 >Feature sequence238 1419 2054 gene locus_tag LOCUS_50220 1419 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 2500 2051 gene locus_tag LOCUS_50230 2500 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 3111 2497 gene locus_tag LOCUS_50240 3111 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 10436 3108 gene locus_tag LOCUS_50250 10436 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 >Feature sequence239 2014 98 gene locus_tag LOCUS_50260 gene gyrB 2014 98 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU72 protein_id gnl|my_center|LOCUS_50260 4302 2011 gene locus_tag LOCUS_50270 4302 2011 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H4 protein_id gnl|my_center|LOCUS_50270 6247 4415 gene locus_tag LOCUS_50280 6247 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 6337 8502 gene locus_tag LOCUS_50290 6337 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 8506 10152 gene locus_tag LOCUS_50300 8506 10152 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SH28 protein_id gnl|my_center|LOCUS_50300 10549 10112 gene locus_tag LOCUS_50310 10549 10112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 >Feature sequence240 2251 1370 gene locus_tag LOCUS_50320 2251 1370 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174156.1 protein_id gnl|my_center|LOCUS_50320 2335 2865 gene locus_tag LOCUS_50330 2335 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 2978 3703 gene locus_tag LOCUS_50340 2978 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 4563 3685 gene locus_tag LOCUS_50350 4563 3685 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704837.1 protein_id gnl|my_center|LOCUS_50350 4700 5494 gene locus_tag LOCUS_50360 4700 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 6707 5484 gene locus_tag LOCUS_50370 6707 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 8464 6704 gene locus_tag LOCUS_50380 gene glgB 8464 6704 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0G8 protein_id gnl|my_center|LOCUS_50380 8517 8831 gene locus_tag LOCUS_50390 8517 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 9374 8838 gene locus_tag LOCUS_50400 9374 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 >Feature sequence241 323 1087 gene locus_tag LOCUS_50410 323 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 1091 2533 gene locus_tag LOCUS_50420 1091 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 2544 3689 gene locus_tag LOCUS_50430 2544 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 6140 3681 gene locus_tag LOCUS_50440 6140 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 6409 6137 gene locus_tag LOCUS_50450 6409 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 7158 6619 gene locus_tag LOCUS_50460 7158 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 9679 7181 gene locus_tag LOCUS_50470 9679 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 >Feature sequence242 1224 193 gene locus_tag LOCUS_50480 1224 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 2248 1316 gene locus_tag LOCUS_50490 2248 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 2317 3642 gene locus_tag LOCUS_50500 2317 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 3703 5487 gene locus_tag LOCUS_50510 3703 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 5481 6794 gene locus_tag LOCUS_50520 5481 6794 CDS product pyridoxal-5'-phosphate-dependent protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_50520 6779 8005 gene locus_tag LOCUS_50530 6779 8005 CDS product chlorohydrolase/aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705208.1 protein_id gnl|my_center|LOCUS_50530 8002 8670 gene locus_tag LOCUS_50540 8002 8670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50540 8667 9338 gene locus_tag LOCUS_50550 8667 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 9516 10349 gene locus_tag LOCUS_50560 9516 10349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 >Feature sequence243 974 114 gene locus_tag LOCUS_50570 974 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 1878 991 gene locus_tag LOCUS_50580 1878 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 3466 1934 gene locus_tag LOCUS_50590 3466 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_50590 4946 3489 gene locus_tag LOCUS_50600 4946 3489 CDS product UDP-phosphate galactose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_50600 4999 5814 gene locus_tag LOCUS_50610 gene kdsA 4999 5814 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61655 protein_id gnl|my_center|LOCUS_50610 5823 7142 gene locus_tag LOCUS_50620 5823 7142 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938556.1 protein_id gnl|my_center|LOCUS_50620 7262 8041 gene locus_tag LOCUS_50630 7262 8041 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXZ7 protein_id gnl|my_center|LOCUS_50630 9479 8124 gene locus_tag LOCUS_50640 9479 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 9537 10133 gene locus_tag LOCUS_50650 9537 10133 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 protein_id gnl|my_center|LOCUS_50650 >Feature sequence244 1412 495 gene locus_tag LOCUS_50660 gene ilvA 1412 495 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227667.1 protein_id gnl|my_center|LOCUS_50660 1864 1412 gene locus_tag LOCUS_50670 1864 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 2523 1867 gene locus_tag LOCUS_50680 gene gstA 2523 1867 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 protein_id gnl|my_center|LOCUS_50680 3079 2543 gene locus_tag LOCUS_50690 3079 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 4565 3057 gene locus_tag LOCUS_50700 4565 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 5323 4565 gene locus_tag LOCUS_50710 5323 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 5829 5320 gene locus_tag LOCUS_50720 5829 5320 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EMC9 protein_id gnl|my_center|LOCUS_50720 6776 5898 gene locus_tag LOCUS_50730 6776 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 8566 6776 gene locus_tag LOCUS_50740 8566 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 8652 9149 gene locus_tag LOCUS_50750 8652 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_50750 9913 9152 gene locus_tag LOCUS_50760 9913 9152 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103613.1 protein_id gnl|my_center|LOCUS_50760 9993 10382 gene locus_tag LOCUS_50770 9993 10382 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530730.1 protein_id gnl|my_center|LOCUS_50770 >Feature sequence245 2186 339 gene locus_tag LOCUS_50780 2186 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 3322 2180 gene locus_tag LOCUS_50790 3322 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 4473 3331 gene locus_tag LOCUS_50800 4473 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 5395 4496 gene locus_tag LOCUS_50810 5395 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 5458 7917 gene locus_tag LOCUS_50820 5458 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 7917 8654 gene locus_tag LOCUS_50830 7917 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 >Feature sequence246 1301 471 gene locus_tag LOCUS_50840 1301 471 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970011.1 protein_id gnl|my_center|LOCUS_50840 2182 1298 gene locus_tag LOCUS_50850 2182 1298 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808548.1 protein_id gnl|my_center|LOCUS_50850 3753 2239 gene locus_tag LOCUS_50860 3753 2239 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_50860 4996 3755 gene locus_tag LOCUS_50870 4996 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 5401 4997 gene locus_tag LOCUS_50880 5401 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 8232 5398 gene locus_tag LOCUS_50890 8232 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 8369 9262 gene locus_tag LOCUS_50900 8369 9262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 9253 9684 gene locus_tag LOCUS_50910 9253 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 10034 9699 gene locus_tag LOCUS_50920 10034 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 >Feature sequence247 1568 5077 gene locus_tag LOCUS_50930 1568 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 5074 6588 gene locus_tag LOCUS_50940 5074 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 6614 6805 gene locus_tag LOCUS_50950 6614 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 7030 7689 gene locus_tag LOCUS_50960 7030 7689 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_50960 7773 8342 gene locus_tag LOCUS_50970 7773 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 8354 8881 gene locus_tag LOCUS_50980 8354 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 >Feature sequence248 <1 1273 gene locus_tag LOCUS_50990 <1 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097341.1:glycoside hydrolase 2054 1284 gene locus_tag LOCUS_51000 2054 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 2100 2684 gene locus_tag LOCUS_51010 2100 2684 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 protein_id gnl|my_center|LOCUS_51010 2946 2725 gene locus_tag LOCUS_51020 2946 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 2827 6081 gene locus_tag LOCUS_51030 2827 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 6160 6882 gene locus_tag LOCUS_51040 gene purC 6160 6882 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9P4 protein_id gnl|my_center|LOCUS_51040 6886 8301 gene locus_tag LOCUS_51050 gene purF 6886 8301 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN7 protein_id gnl|my_center|LOCUS_51050 >Feature sequence249 1412 2737 gene locus_tag LOCUS_51060 1412 2737 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_51060 4024 2744 gene locus_tag LOCUS_51070 4024 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 4293 4066 gene locus_tag LOCUS_51080 4293 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 5147 4290 gene locus_tag LOCUS_51090 5147 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 5201 7189 gene locus_tag LOCUS_51100 gene metG 5201 7189 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AE2 protein_id gnl|my_center|LOCUS_51100 7271 8878 gene locus_tag LOCUS_51110 7271 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 9027 10010 gene locus_tag LOCUS_51120 9027 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 >Feature sequence250 <1 1175 gene locus_tag LOCUS_51130 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036001.1:nucleoside transporter 1172 2266 gene locus_tag LOCUS_51140 1172 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 2263 3411 gene locus_tag LOCUS_51150 2263 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 3447 3674 gene locus_tag LOCUS_51160 3447 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 3689 4204 gene locus_tag LOCUS_51170 3689 4204 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_51170 4275 7904 gene locus_tag LOCUS_51180 gene smc 4275 7904 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G5EBD4 protein_id gnl|my_center|LOCUS_51180 7918 8988 gene locus_tag LOCUS_51190 gene ftsY 7918 8988 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1Z8 protein_id gnl|my_center|LOCUS_51190 9009 9293 gene locus_tag LOCUS_51200 9009 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 9290 9718 gene locus_tag LOCUS_51210 9290 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 >Feature sequence251 596 2188 gene locus_tag LOCUS_51220 596 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 3140 2202 gene locus_tag LOCUS_51230 3140 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 6756 3160 gene locus_tag LOCUS_51240 6756 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 6865 8196 gene locus_tag LOCUS_51250 6865 8196 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405421.1 protein_id gnl|my_center|LOCUS_51250 8189 8800 gene locus_tag LOCUS_51260 8189 8800 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944032.1 protein_id gnl|my_center|LOCUS_51260 >Feature sequence252 999 1736 gene locus_tag LOCUS_51270 999 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255354.1 protein_id gnl|my_center|LOCUS_51270 3898 1793 gene locus_tag LOCUS_51280 3898 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 4096 4794 gene locus_tag LOCUS_51290 4096 4794 CDS product morphological differentiation-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975378.1 protein_id gnl|my_center|LOCUS_51290 4803 6410 gene locus_tag LOCUS_51300 4803 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 >Feature sequence253 796 1782 gene locus_tag LOCUS_51310 796 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 1902 2756 gene locus_tag LOCUS_51320 1902 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 2753 3985 gene locus_tag LOCUS_51330 2753 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 4975 3974 gene locus_tag LOCUS_51340 4975 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 5109 7607 gene locus_tag LOCUS_51350 5109 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 7663 9456 gene locus_tag LOCUS_51360 gene thrZ 7663 9456 CDS product threonine--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18256 protein_id gnl|my_center|LOCUS_51360 >Feature sequence254 1264 314 gene locus_tag LOCUS_51370 1264 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 1339 1716 gene locus_tag LOCUS_51380 1339 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 2060 1743 gene locus_tag LOCUS_51390 2060 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 3502 2060 gene locus_tag LOCUS_51400 3502 2060 CDS product His-Xaa-Ser system radical SAM maturase HxsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479204.1 protein_id gnl|my_center|LOCUS_51400 3702 3499 gene locus_tag LOCUS_51410 3702 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 4109 3702 gene locus_tag LOCUS_51420 4109 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 4573 4106 gene locus_tag LOCUS_51430 4573 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 6567 4570 gene locus_tag LOCUS_51440 6567 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 9251 6624 gene locus_tag LOCUS_51450 9251 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 <9976 9272 gene locus_tag LOCUS_51460 <9976 9272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103930.1:acyl-CoA dehydrogenase >Feature sequence255 1896 535 gene locus_tag LOCUS_51470 gene nqrA 1896 535 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_51470 2686 1925 gene locus_tag LOCUS_51480 2686 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 2788 4473 gene locus_tag LOCUS_51490 2788 4473 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_51490 4470 5081 gene locus_tag LOCUS_51500 4470 5081 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867642.1 protein_id gnl|my_center|LOCUS_51500 5138 5767 gene locus_tag LOCUS_51510 5138 5767 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027228.1 protein_id gnl|my_center|LOCUS_51510 5767 5904 gene locus_tag LOCUS_51520 5767 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 6049 6279 gene locus_tag LOCUS_51530 6049 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 6302 7633 gene locus_tag LOCUS_51540 6302 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 >Feature sequence256 979 545 gene locus_tag LOCUS_51550 979 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 1359 973 gene locus_tag LOCUS_51560 1359 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 1416 2126 gene locus_tag LOCUS_51570 1416 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 2536 2132 gene locus_tag LOCUS_51580 2536 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 5919 2536 gene locus_tag LOCUS_51590 5919 2536 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_51590 7018 5957 gene locus_tag LOCUS_51600 7018 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 8949 7069 gene locus_tag LOCUS_51610 8949 7069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 <9956 9026 gene locus_tag LOCUS_51620 <9956 9026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9X0K7:flagellar hook-associated protein 2 >Feature sequence257 2480 318 gene locus_tag LOCUS_51630 2480 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 2658 3047 gene locus_tag LOCUS_51640 2658 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 3063 3773 gene locus_tag LOCUS_51650 gene gloB 3063 3773 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP80 protein_id gnl|my_center|LOCUS_51650 3742 4803 gene locus_tag LOCUS_51660 3742 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 4807 5637 gene locus_tag LOCUS_51670 4807 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 6030 5764 gene locus_tag LOCUS_51680 6030 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 7301 6027 gene locus_tag LOCUS_51690 7301 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 8913 7459 gene locus_tag LOCUS_51700 8913 7459 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_51700 9569 8910 gene locus_tag LOCUS_51710 9569 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 >Feature sequence258 <1 1740 gene locus_tag LOCUS_51720 <1 1740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942344.1:bifunctional malic enzyme oxidoreductase/phosphotransacetylase 1737 2771 gene locus_tag LOCUS_51730 1737 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 4600 2774 gene locus_tag LOCUS_51740 4600 2774 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266869.1 protein_id gnl|my_center|LOCUS_51740 4731 5840 gene locus_tag LOCUS_51750 4731 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 6303 5848 gene locus_tag LOCUS_51760 6303 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 7539 6310 gene locus_tag LOCUS_51770 7539 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 9341 7539 gene locus_tag LOCUS_51780 9341 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 >Feature sequence259 1357 323 gene locus_tag LOCUS_51790 1357 323 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BQ0 protein_id gnl|my_center|LOCUS_51790 1431 3365 gene locus_tag LOCUS_51800 1431 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 3400 6465 gene locus_tag LOCUS_51810 3400 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 6504 9725 gene locus_tag LOCUS_51820 6504 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 >Feature sequence260 356 1285 gene locus_tag LOCUS_51830 356 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 2808 1282 gene locus_tag LOCUS_51840 gene ahcY 2808 1282 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZM1 protein_id gnl|my_center|LOCUS_51840 2866 3735 gene locus_tag LOCUS_51850 2866 3735 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_51850 4443 3760 gene locus_tag LOCUS_51860 4443 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 5118 4447 gene locus_tag LOCUS_51870 5118 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 6004 5144 gene locus_tag LOCUS_51880 6004 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 6828 6010 gene locus_tag LOCUS_51890 6828 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 8323 6875 gene locus_tag LOCUS_51900 8323 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 >Feature sequence261 1477 185 gene locus_tag LOCUS_51910 1477 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 1824 1474 gene locus_tag LOCUS_51920 1824 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 1838 5164 gene locus_tag LOCUS_51930 1838 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 5221 6414 gene locus_tag LOCUS_51940 5221 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 6414 8717 gene locus_tag LOCUS_51950 6414 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 >Feature sequence262 1251 496 gene locus_tag LOCUS_51960 1251 496 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942204.1 protein_id gnl|my_center|LOCUS_51960 2250 1261 gene locus_tag LOCUS_51970 2250 1261 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_51970 3248 2250 gene locus_tag LOCUS_51980 3248 2250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 protein_id gnl|my_center|LOCUS_51980 4336 3245 gene locus_tag LOCUS_51990 4336 3245 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_51990 5391 4333 gene locus_tag LOCUS_52000 5391 4333 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_52000 7087 5399 gene locus_tag LOCUS_52010 7087 5399 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933296.1 protein_id gnl|my_center|LOCUS_52010 7184 8650 gene locus_tag LOCUS_52020 7184 8650 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_52020 8650 9636 gene locus_tag LOCUS_52030 8650 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920762.1 protein_id gnl|my_center|LOCUS_52030 >Feature sequence263 299 1183 gene locus_tag LOCUS_52040 gene flgL 299 1183 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96501 protein_id gnl|my_center|LOCUS_52040 1246 3063 gene locus_tag LOCUS_52050 1246 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 3063 3494 gene locus_tag LOCUS_52060 3063 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 3491 4129 gene locus_tag LOCUS_52070 3491 4129 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419313.1 protein_id gnl|my_center|LOCUS_52070 4820 4116 gene locus_tag LOCUS_52080 4820 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 5452 4814 gene locus_tag LOCUS_52090 gene ptr1 5452 4814 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_52090 6276 5449 gene locus_tag LOCUS_52100 6276 5449 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7F8 protein_id gnl|my_center|LOCUS_52100 6300 6767 gene locus_tag LOCUS_52110 gene greB 6300 6767 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ24 protein_id gnl|my_center|LOCUS_52110 8026 6752 gene locus_tag LOCUS_52120 8026 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 8059 9030 gene locus_tag LOCUS_52130 gene holB 8059 9030 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_52130 >Feature sequence264 2811 514 gene locus_tag LOCUS_52140 2811 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 2803 4041 gene locus_tag LOCUS_52150 2803 4041 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_52150 4579 4022 gene locus_tag LOCUS_52160 4579 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 5763 4576 gene locus_tag LOCUS_52170 5763 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 5809 7524 gene locus_tag LOCUS_52180 5809 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 7524 8750 gene locus_tag LOCUS_52190 gene moeA 7524 8750 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_52190 8725 9240 gene locus_tag LOCUS_52200 8725 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 >Feature sequence265 <1 752 gene locus_tag LOCUS_52210 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FK19:signal recognition particle protein 810 1667 gene locus_tag LOCUS_52220 810 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 1924 1670 gene locus_tag LOCUS_52230 1924 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 2421 1921 gene locus_tag LOCUS_52240 2421 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 2458 3426 gene locus_tag LOCUS_52250 2458 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 3423 4109 gene locus_tag LOCUS_52260 3423 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 4562 4125 gene locus_tag LOCUS_52270 gene dut 4562 4125 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UII1 protein_id gnl|my_center|LOCUS_52270 6736 4559 gene locus_tag LOCUS_52280 gene pnp 6736 4559 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS9 protein_id gnl|my_center|LOCUS_52280 7123 6854 gene locus_tag LOCUS_52290 gene rpsO 7123 6854 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYT8 protein_id gnl|my_center|LOCUS_52290 8177 7236 gene locus_tag LOCUS_52300 8177 7236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 8551 8177 gene locus_tag LOCUS_52310 8551 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 >Feature sequence266 3 224 gene locus_tag LOCUS_52320 3 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 221 952 gene locus_tag LOCUS_52330 221 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 949 2541 gene locus_tag LOCUS_52340 949 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 4036 2543 gene locus_tag LOCUS_52350 4036 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 4979 4050 gene locus_tag LOCUS_52360 4979 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 6214 4976 gene locus_tag LOCUS_52370 6214 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 7569 6211 gene locus_tag LOCUS_52380 7569 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 <9411 7578 gene locus_tag LOCUS_52390 <9411 7578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121420.1:chloride channel protein >Feature sequence267 736 2757 gene locus_tag LOCUS_52400 736 2757 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_52400 2842 3333 gene locus_tag LOCUS_52410 2842 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 3912 3397 gene locus_tag LOCUS_52420 3912 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 4821 3931 gene locus_tag LOCUS_52430 4821 3931 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289348.1 protein_id gnl|my_center|LOCUS_52430 5633 4818 gene locus_tag LOCUS_52440 5633 4818 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_52440 8507 5892 gene locus_tag LOCUS_52450 gene valS 8507 5892 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ6 protein_id gnl|my_center|LOCUS_52450 9314 8592 gene locus_tag LOCUS_52460 9314 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 >Feature sequence268 1507 992 gene locus_tag LOCUS_52470 1507 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459839.1 protein_id gnl|my_center|LOCUS_52470 2295 1504 gene locus_tag LOCUS_52480 2295 1504 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_52480 3321 2314 gene locus_tag LOCUS_52490 3321 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 4631 3321 gene locus_tag LOCUS_52500 4631 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 5632 4661 gene locus_tag LOCUS_52510 5632 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 5738 6064 gene locus_tag LOCUS_52520 5738 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 6154 7479 gene locus_tag LOCUS_52530 6154 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 7482 9137 gene locus_tag LOCUS_52540 7482 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 >Feature sequence269 <1 2456 gene locus_tag LOCUS_52550 <1 2456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026867.1:polyketide synthase >Feature sequence270 2296 1676 gene locus_tag LOCUS_52560 2296 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 2356 3591 gene locus_tag LOCUS_52570 gene hutF 2356 3591 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727478.1 protein_id gnl|my_center|LOCUS_52570 3629 3958 gene locus_tag LOCUS_52580 3629 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 3955 4641 gene locus_tag LOCUS_52590 3955 4641 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531896.1 protein_id gnl|my_center|LOCUS_52590 4669 5538 gene locus_tag LOCUS_52600 4669 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 7082 5577 gene locus_tag LOCUS_52610 7082 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 7108 7785 gene locus_tag LOCUS_52620 7108 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 7782 8222 gene locus_tag LOCUS_52630 7782 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 8291 8770 gene locus_tag LOCUS_52640 8291 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 >Feature sequence271 <1 508 gene locus_tag LOCUS_52650 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39694:ComE operon protein 1 617 1915 gene locus_tag LOCUS_52660 617 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 1912 3189 gene locus_tag LOCUS_52670 1912 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 3189 4250 gene locus_tag LOCUS_52680 3189 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 4269 4436 gene locus_tag LOCUS_52690 4269 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 4494 4841 gene locus_tag LOCUS_52700 4494 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 4845 5609 gene locus_tag LOCUS_52710 4845 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 6833 5580 gene locus_tag LOCUS_52720 6833 5580 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5M7 protein_id gnl|my_center|LOCUS_52720 7444 6833 gene locus_tag LOCUS_52730 7444 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762447.1 protein_id gnl|my_center|LOCUS_52730 7443 9011 gene locus_tag LOCUS_52740 7443 9011 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537423.1 protein_id gnl|my_center|LOCUS_52740 >Feature sequence272 382 1755 gene locus_tag LOCUS_52750 382 1755 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_52750 2603 1752 gene locus_tag LOCUS_52760 2603 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089214.1 protein_id gnl|my_center|LOCUS_52760 2626 4092 gene locus_tag LOCUS_52770 gene ppx 2626 4092 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZN70 protein_id gnl|my_center|LOCUS_52770 6133 4073 gene locus_tag LOCUS_52780 gene ppk 6133 4073 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S646 protein_id gnl|my_center|LOCUS_52780 6155 8254 gene locus_tag LOCUS_52790 6155 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 8245 8367 gene locus_tag LOCUS_52800 8245 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 >Feature sequence273 1160 585 gene locus_tag LOCUS_52810 1160 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 1176 2312 gene locus_tag LOCUS_52820 1176 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 2372 2920 gene locus_tag LOCUS_52830 gene yceI 2372 2920 CDS product protein YceI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NAT2 protein_id gnl|my_center|LOCUS_52830 2921 3532 gene locus_tag LOCUS_52840 2921 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 3539 5581 gene locus_tag LOCUS_52850 3539 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 5650 6552 gene locus_tag LOCUS_52860 5650 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 8257 6536 gene locus_tag LOCUS_52870 8257 6536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 >Feature sequence274 890 1234 gene locus_tag LOCUS_52880 890 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 2232 1240 gene locus_tag LOCUS_52890 2232 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 2291 4171 gene locus_tag LOCUS_52900 2291 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 4168 5328 gene locus_tag LOCUS_52910 4168 5328 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259675.1 protein_id gnl|my_center|LOCUS_52910 5325 5936 gene locus_tag LOCUS_52920 5325 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 6004 6531 gene locus_tag LOCUS_52930 6004 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459288.1 protein_id gnl|my_center|LOCUS_52930 6528 7415 gene locus_tag LOCUS_52940 6528 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 7461 8513 gene locus_tag LOCUS_52950 7461 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 >Feature sequence275 1109 489 gene locus_tag LOCUS_52960 1109 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 1436 1113 gene locus_tag LOCUS_52970 1436 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 2188 1433 gene locus_tag LOCUS_52980 2188 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 3107 2220 gene locus_tag LOCUS_52990 3107 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 3878 3123 gene locus_tag LOCUS_53000 3878 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 5041 3878 gene locus_tag LOCUS_53010 5041 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 7087 5048 gene locus_tag LOCUS_53020 7087 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 7650 7132 gene locus_tag LOCUS_53030 gene pcp 7650 7132 CDS product pyrrolidone-carboxylate peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A5R5 protein_id gnl|my_center|LOCUS_53030 8549 7647 gene locus_tag LOCUS_53040 8549 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143967.1 protein_id gnl|my_center|LOCUS_53040 >Feature sequence276 1430 81 gene locus_tag LOCUS_53050 1430 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 1462 1917 gene locus_tag LOCUS_53060 1462 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 1914 2561 gene locus_tag LOCUS_53070 1914 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 2558 3526 gene locus_tag LOCUS_53080 2558 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 5106 3523 gene locus_tag LOCUS_53090 gene astD 5106 3523 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XYL2 protein_id gnl|my_center|LOCUS_53090 5161 6543 gene locus_tag LOCUS_53100 5161 6543 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403878.1 protein_id gnl|my_center|LOCUS_53100 6551 7705 gene locus_tag LOCUS_53110 gene metB 6551 7705 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_53110 7720 8349 gene locus_tag LOCUS_53120 7720 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 <8946 8359 gene locus_tag LOCUS_53130 <8946 8359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889584.1:N-glycosidase F >Feature sequence277 1616 4738 gene locus_tag LOCUS_53140 1616 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 4845 5225 gene locus_tag LOCUS_53150 4845 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 5298 5675 gene locus_tag LOCUS_53160 5298 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 5708 6856 gene locus_tag LOCUS_53170 5708 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 6853 7671 gene locus_tag LOCUS_53180 6853 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 8169 7675 gene locus_tag LOCUS_53190 8169 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 8522 8130 gene locus_tag LOCUS_53200 8522 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 >Feature sequence278 469 2031 gene locus_tag LOCUS_53210 469 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 2033 3859 gene locus_tag LOCUS_53220 gene uvrC 2033 3859 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747I7 protein_id gnl|my_center|LOCUS_53220 3856 5502 gene locus_tag LOCUS_53230 3856 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 6147 5503 gene locus_tag LOCUS_53240 6147 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 6213 6932 gene locus_tag LOCUS_53250 6213 6932 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_53250 7584 6937 gene locus_tag LOCUS_53260 7584 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 <8879 7591 gene locus_tag LOCUS_53270 <8879 7591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074085.1:electron transfer flavoprotein-ubiquinone oxidoreductase >Feature sequence279 1040 828 gene locus_tag LOCUS_53280 1040 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 4194 1507 gene locus_tag LOCUS_53290 4194 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 4355 4191 gene locus_tag LOCUS_53300 4355 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 6062 4365 gene locus_tag LOCUS_53310 6062 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 protein_id gnl|my_center|LOCUS_53310 6814 6059 gene locus_tag LOCUS_53320 6814 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 <8701 6829 gene locus_tag LOCUS_53330 <8701 6829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888244.1:two-component sensor histidine kinase >Feature sequence280 <1 534 gene locus_tag LOCUS_53340 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877386.1:B12-binding domain-containing radical SAM protein 534 1508 gene locus_tag LOCUS_53350 534 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 2356 1517 gene locus_tag LOCUS_53360 gene prmC 2356 1517 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B2 protein_id gnl|my_center|LOCUS_53360 3441 2353 gene locus_tag LOCUS_53370 gene prfA 3441 2353 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B1 protein_id gnl|my_center|LOCUS_53370 3858 3520 gene locus_tag LOCUS_53380 3858 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 4888 3893 gene locus_tag LOCUS_53390 4888 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 5545 4925 gene locus_tag LOCUS_53400 5545 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 7046 5562 gene locus_tag LOCUS_53410 7046 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 8182 7490 gene locus_tag LOCUS_53420 8182 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 8465 8214 gene locus_tag LOCUS_53430 8465 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 >Feature sequence281 4199 2934 gene locus_tag LOCUS_53440 4199 2934 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_53440 4238 4999 gene locus_tag LOCUS_53450 4238 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 5057 5245 gene locus_tag LOCUS_53460 5057 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 6345 5242 gene locus_tag LOCUS_53470 6345 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 7009 6347 gene locus_tag LOCUS_53480 7009 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 7434 7006 gene locus_tag LOCUS_53490 7434 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 7955 7431 gene locus_tag LOCUS_53500 7955 7431 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 protein_id gnl|my_center|LOCUS_53500 >Feature sequence282 <1 823 gene locus_tag LOCUS_53510 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031541.1:amidase 879 1793 gene locus_tag LOCUS_53520 879 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 1854 2654 gene locus_tag LOCUS_53530 1854 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 2726 3271 gene locus_tag LOCUS_53540 2726 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 3268 3822 gene locus_tag LOCUS_53550 3268 3822 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_53550 4699 3812 gene locus_tag LOCUS_53560 4699 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 5124 4696 gene locus_tag LOCUS_53570 5124 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 6490 5111 gene locus_tag LOCUS_53580 6490 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 6559 7902 gene locus_tag LOCUS_53590 6559 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 <8503 7906 gene locus_tag LOCUS_53600 <8503 7906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226565.1:dolichol-phosphate mannosyltransferase >Feature sequence283 541 1443 gene locus_tag LOCUS_53610 541 1443 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946638.1 protein_id gnl|my_center|LOCUS_53610 1464 2651 gene locus_tag LOCUS_53620 1464 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 3073 2693 gene locus_tag LOCUS_53630 3073 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 4538 3078 gene locus_tag LOCUS_53640 4538 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 4679 5257 gene locus_tag LOCUS_53650 4679 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 5301 5843 gene locus_tag LOCUS_53660 5301 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 5825 6370 gene locus_tag LOCUS_53670 5825 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 6349 8070 gene locus_tag LOCUS_53680 6349 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53680 >Feature sequence284 <1 502 gene locus_tag LOCUS_53690 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RFW2:threonylcarbamoyl-AMP synthase 514 1053 gene locus_tag LOCUS_53700 514 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 1075 1767 gene locus_tag LOCUS_53710 1075 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53710 3147 2341 gene locus_tag LOCUS_53720 3147 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 4005 3157 gene locus_tag LOCUS_53730 4005 3157 CDS product peptidase S58 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384240.1 protein_id gnl|my_center|LOCUS_53730 6191 4032 gene locus_tag LOCUS_53740 6191 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 6301 7818 gene locus_tag LOCUS_53750 gene cafA 6301 7818 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_53750 >Feature sequence285 1898 747 gene locus_tag LOCUS_53760 1898 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53760 3754 1895 gene locus_tag LOCUS_53770 3754 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 4843 3770 gene locus_tag LOCUS_53780 4843 3770 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706904.1 protein_id gnl|my_center|LOCUS_53780 4745 4993 gene locus_tag LOCUS_53790 4745 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 6231 5041 gene locus_tag LOCUS_53800 6231 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 6777 6232 gene locus_tag LOCUS_53810 6777 6232 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LK0 protein_id gnl|my_center|LOCUS_53810 8069 6804 gene locus_tag LOCUS_53820 gene clpX 8069 6804 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C83 protein_id gnl|my_center|LOCUS_53820 >Feature sequence286 6147 1756 gene locus_tag LOCUS_53830 6147 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 6812 6144 gene locus_tag LOCUS_53840 6812 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 7807 6809 gene locus_tag LOCUS_53850 7807 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 >Feature sequence287 <1 687 gene locus_tag LOCUS_53860 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582600.1:peptidase C69 684 2036 gene locus_tag LOCUS_53870 684 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 2798 2043 gene locus_tag LOCUS_53880 2798 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 2890 3960 gene locus_tag LOCUS_53890 2890 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 >Feature sequence288 1838 2770 gene locus_tag LOCUS_53900 1838 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 2793 3455 gene locus_tag LOCUS_53910 2793 3455 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889429.1 protein_id gnl|my_center|LOCUS_53910 3452 4204 gene locus_tag LOCUS_53920 3452 4204 CDS product molybdenum ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_53920 4201 4872 gene locus_tag LOCUS_53930 4201 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 5865 4879 gene locus_tag LOCUS_53940 5865 4879 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227818.1 protein_id gnl|my_center|LOCUS_53940 6920 5862 gene locus_tag LOCUS_53950 6920 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 >Feature sequence289 586 1974 gene locus_tag LOCUS_53960 586 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 2800 1985 gene locus_tag LOCUS_53970 2800 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 3252 2797 gene locus_tag LOCUS_53980 3252 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 3325 4215 gene locus_tag LOCUS_53990 3325 4215 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268101.1 protein_id gnl|my_center|LOCUS_53990 5733 4219 gene locus_tag LOCUS_54000 5733 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 5856 5780 gene locus_tag LOCUS_t00350 5856 5780 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6285 5899 gene locus_tag LOCUS_54010 6285 5899 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958148.1 protein_id gnl|my_center|LOCUS_54010 6604 6290 gene locus_tag LOCUS_54020 gene ihfA-1 6604 6290 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ8 protein_id gnl|my_center|LOCUS_54020 7071 6607 gene locus_tag LOCUS_54030 7071 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54030 7435 7082 gene locus_tag LOCUS_54040 gene rplT 7435 7082 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMK7 protein_id gnl|my_center|LOCUS_54040 7705 7502 gene locus_tag LOCUS_54050 gene rpmI 7705 7502 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67917 protein_id gnl|my_center|LOCUS_54050 8201 7728 gene locus_tag LOCUS_54060 8201 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 >Feature sequence290 745 272 gene locus_tag LOCUS_54070 745 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54070 1118 738 gene locus_tag LOCUS_54080 1118 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54080 1449 1123 gene locus_tag LOCUS_54090 1449 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 1539 1820 gene locus_tag LOCUS_54100 1539 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_54100 1824 3332 gene locus_tag LOCUS_54110 1824 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 3342 5378 gene locus_tag LOCUS_54120 3342 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 6398 5385 gene locus_tag LOCUS_54130 6398 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 7549 6353 gene locus_tag LOCUS_54140 7549 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 7952 8206 gene locus_tag LOCUS_54150 7952 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 >Feature sequence291 1238 2962 gene locus_tag LOCUS_54160 1238 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 2994 4856 gene locus_tag LOCUS_54170 2994 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 4900 5748 gene locus_tag LOCUS_54180 gene deoC 4900 5748 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CMP6 protein_id gnl|my_center|LOCUS_54180 5749 6897 gene locus_tag LOCUS_54190 gene deoB 5749 6897 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RID0 protein_id gnl|my_center|LOCUS_54190 6897 8102 gene locus_tag LOCUS_54200 6897 8102 CDS product putative thymidine phosphorylase DeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704399.1 protein_id gnl|my_center|LOCUS_54200 >Feature sequence292 54 809 gene locus_tag LOCUS_54210 54 809 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091874.1 protein_id gnl|my_center|LOCUS_54210 796 1506 gene locus_tag LOCUS_54220 796 1506 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972089.1 protein_id gnl|my_center|LOCUS_54220 1503 2087 gene locus_tag LOCUS_54230 1503 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 3319 2093 gene locus_tag LOCUS_54240 3319 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 4574 3336 gene locus_tag LOCUS_54250 4574 3336 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124897.1 protein_id gnl|my_center|LOCUS_54250 4703 5272 gene locus_tag LOCUS_54260 4703 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 5269 6624 gene locus_tag LOCUS_54270 gene ibeB 5269 6624 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123112.1 protein_id gnl|my_center|LOCUS_54270 6621 7751 gene locus_tag LOCUS_54280 6621 7751 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969409.1 protein_id gnl|my_center|LOCUS_54280 >Feature sequence293 2473 137 gene locus_tag LOCUS_54290 2473 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 3260 2523 gene locus_tag LOCUS_54300 3260 2523 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_54300 3290 5191 gene locus_tag LOCUS_54310 3290 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 6014 5169 gene locus_tag LOCUS_54320 6014 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 7198 6050 gene locus_tag LOCUS_54330 7198 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 7211 7789 gene locus_tag LOCUS_54340 7211 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 >Feature sequence294 566 1378 gene locus_tag LOCUS_54350 566 1378 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941846.1 protein_id gnl|my_center|LOCUS_54350 1388 1735 gene locus_tag LOCUS_54360 1388 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 2961 1729 gene locus_tag LOCUS_54370 gene rpoE 2961 1729 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226537.1 protein_id gnl|my_center|LOCUS_54370 3350 2958 gene locus_tag LOCUS_54380 3350 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_54380 3992 3384 gene locus_tag LOCUS_54390 gene cysC 3992 3384 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88X60 protein_id gnl|my_center|LOCUS_54390 5517 4024 gene locus_tag LOCUS_54400 5517 4024 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016790.1 protein_id gnl|my_center|LOCUS_54400 5996 5505 gene locus_tag LOCUS_54410 5996 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 8018 6006 gene locus_tag LOCUS_54420 8018 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 >Feature sequence295 649 80 gene locus_tag LOCUS_54430 649 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 1880 543 gene locus_tag LOCUS_54440 1880 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 1967 2563 gene locus_tag LOCUS_54450 1967 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056977.1 protein_id gnl|my_center|LOCUS_54450 2560 4083 gene locus_tag LOCUS_54460 2560 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 5378 4080 gene locus_tag LOCUS_54470 5378 4080 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGF9 protein_id gnl|my_center|LOCUS_54470 6059 5451 gene locus_tag LOCUS_54480 6059 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 6807 6118 gene locus_tag LOCUS_54490 6807 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 >Feature sequence296 378 938 gene locus_tag LOCUS_54500 378 938 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_54500 1596 1381 gene locus_tag LOCUS_54510 1596 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 3383 1785 gene locus_tag LOCUS_54520 3383 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 4615 3383 gene locus_tag LOCUS_54530 4615 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54530 7383 4651 gene locus_tag LOCUS_54540 7383 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 >Feature sequence297 <1 647 gene locus_tag LOCUS_54550 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941811.1:hopanoid biosynthesis associated radical SAM protein HpnJ 2120 651 gene locus_tag LOCUS_54560 2120 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54560 3191 2130 gene locus_tag LOCUS_54570 gene pfk-1 3191 2130 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CH0 protein_id gnl|my_center|LOCUS_54570 3920 3201 gene locus_tag LOCUS_54580 3920 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 4804 3974 gene locus_tag LOCUS_54590 4804 3974 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942276.1 protein_id gnl|my_center|LOCUS_54590 5154 4807 gene locus_tag LOCUS_54600 5154 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 5185 5934 gene locus_tag LOCUS_54610 gene ycf63 5185 5934 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057285.1 protein_id gnl|my_center|LOCUS_54610 5931 6668 gene locus_tag LOCUS_54620 5931 6668 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121261.1 protein_id gnl|my_center|LOCUS_54620 6665 7411 gene locus_tag LOCUS_54630 6665 7411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_54630 >Feature sequence298 1836 4697 gene locus_tag LOCUS_54640 1836 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 4694 4990 gene locus_tag LOCUS_54650 4694 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 5001 5588 gene locus_tag LOCUS_54660 5001 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 >Feature sequence299 <1 2905 gene locus_tag LOCUS_54670 <1 2905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q748Y6:DNA-directed RNA polymerase subunit beta 2962 7683 gene locus_tag LOCUS_54680 2962 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 >Feature sequence300 377 2026 gene locus_tag LOCUS_54690 377 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 2921 2049 gene locus_tag LOCUS_54700 2921 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 2970 4298 gene locus_tag LOCUS_54710 2970 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 4289 4573 gene locus_tag LOCUS_54720 4289 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 6366 4561 gene locus_tag LOCUS_54730 6366 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54730 6475 7512 gene locus_tag LOCUS_54740 6475 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 7793 7506 gene locus_tag LOCUS_54750 7793 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 >Feature sequence301 189 911 gene locus_tag LOCUS_54760 189 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404256.1 protein_id gnl|my_center|LOCUS_54760 921 2147 gene locus_tag LOCUS_54770 921 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 2135 3397 gene locus_tag LOCUS_54780 2135 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54780 4927 3419 gene locus_tag LOCUS_54790 4927 3419 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_54790 6370 4934 gene locus_tag LOCUS_54800 6370 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 >Feature sequence302 <1 1026 gene locus_tag LOCUS_54810 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392429.1:serine/threonine protein kinase 1669 1118 gene locus_tag LOCUS_54820 1669 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 2211 1666 gene locus_tag LOCUS_54830 2211 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 2257 3354 gene locus_tag LOCUS_54840 2257 3354 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC70 protein_id gnl|my_center|LOCUS_54840 3416 3922 gene locus_tag LOCUS_54850 3416 3922 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_54850 3919 4644 gene locus_tag LOCUS_54860 3919 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 4644 6218 gene locus_tag LOCUS_54870 4644 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 6218 7090 gene locus_tag LOCUS_54880 6218 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 7119 7352 gene locus_tag LOCUS_54890 7119 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 >Feature sequence303 2243 390 gene locus_tag LOCUS_54900 2243 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 2292 3383 gene locus_tag LOCUS_54910 2292 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 3969 3364 gene locus_tag LOCUS_54920 3969 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 4413 3991 gene locus_tag LOCUS_54930 4413 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 4843 4421 gene locus_tag LOCUS_54940 4843 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 4869 5597 gene locus_tag LOCUS_54950 4869 5597 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_54950 5600 6814 gene locus_tag LOCUS_54960 5600 6814 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533497.1 protein_id gnl|my_center|LOCUS_54960 >Feature sequence304 <1 1813 gene locus_tag LOCUS_54970 <1 1813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886991.1:cytochrome c biogenesis protein CcmF 1810 2346 gene locus_tag LOCUS_54980 gene ccmG 1810 2346 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_54980 2343 2780 gene locus_tag LOCUS_54990 2343 2780 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228652.1 protein_id gnl|my_center|LOCUS_54990 3483 2788 gene locus_tag LOCUS_55000 3483 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 3802 3494 gene locus_tag LOCUS_55010 3802 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 4611 3823 gene locus_tag LOCUS_55020 4611 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 4683 5174 gene locus_tag LOCUS_55030 4683 5174 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_55030 <7823 5164 gene locus_tag LOCUS_55040 <7823 5164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123807.1:serine/threonine protein kinase >Feature sequence305 743 351 gene locus_tag LOCUS_55050 743 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 832 2115 gene locus_tag LOCUS_55060 832 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 2128 2775 gene locus_tag LOCUS_55070 2128 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 2772 4247 gene locus_tag LOCUS_55080 2772 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 4248 5000 gene locus_tag LOCUS_55090 4248 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 4997 5713 gene locus_tag LOCUS_55100 gene mtap 4997 5713 CDS product 5'-methylthioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404886.1 protein_id gnl|my_center|LOCUS_55100 5724 7484 gene locus_tag LOCUS_55110 5724 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 >Feature sequence306 1684 1106 gene locus_tag LOCUS_55120 1684 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 2041 1700 gene locus_tag LOCUS_55130 2041 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 4591 2285 gene locus_tag LOCUS_55140 4591 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 5416 4658 gene locus_tag LOCUS_55150 5416 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 5437 7542 gene locus_tag LOCUS_55160 5437 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 7759 7526 gene locus_tag LOCUS_55170 7759 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 >Feature sequence307 422 2671 gene locus_tag LOCUS_55180 422 2671 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_55180 3715 2672 gene locus_tag LOCUS_55190 3715 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 4164 3742 gene locus_tag LOCUS_55200 4164 3742 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329166.1 protein_id gnl|my_center|LOCUS_55200 4191 5045 gene locus_tag LOCUS_55210 4191 5045 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336950.1 protein_id gnl|my_center|LOCUS_55210 5824 5021 gene locus_tag LOCUS_55220 5824 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 7327 5852 gene locus_tag LOCUS_55230 7327 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 >Feature sequence308 1429 2517 gene locus_tag LOCUS_55240 1429 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 2554 2985 gene locus_tag LOCUS_55250 2554 2985 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089880.1 protein_id gnl|my_center|LOCUS_55250 2994 3701 gene locus_tag LOCUS_55260 2994 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55260 3698 5887 gene locus_tag LOCUS_55270 3698 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 5888 6913 gene locus_tag LOCUS_55280 5888 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 6910 7626 gene locus_tag LOCUS_55290 6910 7626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 >Feature sequence309 1841 336 gene locus_tag LOCUS_55300 1841 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 4131 1873 gene locus_tag LOCUS_55310 4131 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 5032 4310 gene locus_tag LOCUS_55320 5032 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 <7758 5076 gene locus_tag LOCUS_55330 <7758 5076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:membrane protein >Feature sequence310 1852 305 gene locus_tag LOCUS_55340 1852 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523287.1 protein_id gnl|my_center|LOCUS_55340 1963 2997 gene locus_tag LOCUS_55350 1963 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 2994 4478 gene locus_tag LOCUS_55360 2994 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 4533 4970 gene locus_tag LOCUS_55370 4533 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 6123 4957 gene locus_tag LOCUS_55380 6123 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 6918 6166 gene locus_tag LOCUS_55390 6918 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 7664 6939 gene locus_tag LOCUS_55400 gene mutM 7664 6939 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XL4 protein_id gnl|my_center|LOCUS_55400 >Feature sequence311 2048 768 gene locus_tag LOCUS_55410 2048 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 3891 2065 gene locus_tag LOCUS_55420 3891 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 4403 3903 gene locus_tag LOCUS_55430 4403 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 5129 4419 gene locus_tag LOCUS_55440 5129 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 5584 5141 gene locus_tag LOCUS_55450 5584 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55450 6739 5600 gene locus_tag LOCUS_55460 6739 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55460 6977 6768 gene locus_tag LOCUS_55470 6977 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55470 >Feature sequence312 384 1067 gene locus_tag LOCUS_55480 384 1067 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_55480 1080 2345 gene locus_tag LOCUS_55490 1080 2345 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY3 protein_id gnl|my_center|LOCUS_55490 2342 2839 gene locus_tag LOCUS_55500 2342 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 2869 4356 gene locus_tag LOCUS_55510 2869 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55510 4360 4704 gene locus_tag LOCUS_55520 4360 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55520 4769 5566 gene locus_tag LOCUS_55530 4769 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 5582 7066 gene locus_tag LOCUS_55540 5582 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 >Feature sequence313 1451 756 gene locus_tag LOCUS_55550 1451 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887695.1 protein_id gnl|my_center|LOCUS_55550 1478 1840 gene locus_tag LOCUS_55560 1478 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 1837 2760 gene locus_tag LOCUS_55570 1837 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 2815 4026 gene locus_tag LOCUS_55580 2815 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 4023 5543 gene locus_tag LOCUS_55590 4023 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 >Feature sequence314 106 3576 gene locus_tag LOCUS_55600 106 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 3584 5965 gene locus_tag LOCUS_55610 3584 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55610 >Feature sequence315 1117 2259 gene locus_tag LOCUS_55620 1117 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 2650 2267 gene locus_tag LOCUS_55630 2650 2267 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4N0 protein_id gnl|my_center|LOCUS_55630 3534 2650 gene locus_tag LOCUS_55640 3534 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 3712 3999 gene locus_tag LOCUS_55650 3712 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 4020 5024 gene locus_tag LOCUS_55660 4020 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55660 5069 5836 gene locus_tag LOCUS_55670 5069 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 5836 6807 gene locus_tag LOCUS_55680 5836 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 6822 7463 gene locus_tag LOCUS_55690 6822 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 >Feature sequence316 <1 891 gene locus_tag LOCUS_55700 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZX85:UDP-N-acetylglucosamine 1-carboxyvinyltransferase 900 2675 gene locus_tag LOCUS_55710 gene dnaG 900 2675 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B7 protein_id gnl|my_center|LOCUS_55710 2719 4431 gene locus_tag LOCUS_55720 gene rpoD 2719 4431 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B8 protein_id gnl|my_center|LOCUS_55720 4453 4528 gene locus_tag LOCUS_t00360 4453 4528 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4553 5251 gene locus_tag LOCUS_55730 4553 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 5244 5627 gene locus_tag LOCUS_55740 5244 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 >Feature sequence317 566 69 gene locus_tag LOCUS_55750 gene ruvC 566 69 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44633 protein_id gnl|my_center|LOCUS_55750 893 573 gene locus_tag LOCUS_55760 893 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 1412 912 gene locus_tag LOCUS_55770 1412 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 2959 1535 gene locus_tag LOCUS_55780 2959 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 3000 4268 gene locus_tag LOCUS_55790 3000 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 4310 5842 gene locus_tag LOCUS_55800 4310 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 <7454 5847 gene locus_tag LOCUS_55810 <7454 5847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9CEF5:putative serine/threonine-protein kinase PknB >Feature sequence318 434 2020 gene locus_tag LOCUS_55820 434 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 2017 2280 gene locus_tag LOCUS_55830 2017 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 2294 3694 gene locus_tag LOCUS_55840 2294 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 4672 3707 gene locus_tag LOCUS_55850 4672 3707 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_55850 5622 4669 gene locus_tag LOCUS_55860 5622 4669 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_55860 6527 5622 gene locus_tag LOCUS_55870 6527 5622 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_55870 <7415 6524 gene locus_tag LOCUS_55880 <7415 6524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144111.1:peptide ABC transporter permease >Feature sequence319 1394 870 gene locus_tag LOCUS_55890 1394 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 1389 3068 gene locus_tag LOCUS_55900 1389 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 3074 4069 gene locus_tag LOCUS_55910 3074 4069 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_55910 4070 4975 gene locus_tag LOCUS_55920 4070 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259249.1 protein_id gnl|my_center|LOCUS_55920 4972 6681 gene locus_tag LOCUS_55930 4972 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55930 >Feature sequence320 631 939 gene locus_tag LOCUS_55940 631 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 1017 2675 gene locus_tag LOCUS_55950 1017 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 3579 2659 gene locus_tag LOCUS_55960 3579 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 3614 4627 gene locus_tag LOCUS_55970 3614 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 4637 5707 gene locus_tag LOCUS_55980 gene proB 4637 5707 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDJ9 protein_id gnl|my_center|LOCUS_55980 5704 6906 gene locus_tag LOCUS_55990 gene proA 5704 6906 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU1 protein_id gnl|my_center|LOCUS_55990 >Feature sequence321 499 1110 gene locus_tag LOCUS_56000 499 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 1212 1140 gene locus_tag LOCUS_t00370 1212 1140 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1277 2335 gene locus_tag LOCUS_56010 1277 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 2323 3033 gene locus_tag LOCUS_56020 2323 3033 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_56020 3041 4030 gene locus_tag LOCUS_56030 3041 4030 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 protein_id gnl|my_center|LOCUS_56030 >Feature sequence322 692 450 gene locus_tag LOCUS_56040 692 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 811 689 gene locus_tag LOCUS_56050 811 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 1016 2803 gene locus_tag LOCUS_56060 gene aspS 1016 2803 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D56 protein_id gnl|my_center|LOCUS_56060 4542 2836 gene locus_tag LOCUS_56070 4542 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 4681 6321 gene locus_tag LOCUS_56080 4681 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 >Feature sequence323 347 3724 gene locus_tag LOCUS_56090 347 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56090 3836 4972 gene locus_tag LOCUS_56100 3836 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 6275 4977 gene locus_tag LOCUS_56110 6275 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 >Feature sequence324 1940 204 gene locus_tag LOCUS_56120 1940 204 CDS product nodulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_56120 2559 1951 gene locus_tag LOCUS_56130 2559 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56130 3293 2556 gene locus_tag LOCUS_56140 3293 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 3327 3863 gene locus_tag LOCUS_56150 3327 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933339.1 protein_id gnl|my_center|LOCUS_56150 3860 4645 gene locus_tag LOCUS_56160 3860 4645 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258519.1 protein_id gnl|my_center|LOCUS_56160 4642 5043 gene locus_tag LOCUS_56170 4642 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56170 5043 6248 gene locus_tag LOCUS_56180 5043 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 6253 6435 gene locus_tag LOCUS_56190 6253 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 6483 7019 gene locus_tag LOCUS_56200 6483 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 >Feature sequence325 1076 468 gene locus_tag LOCUS_56210 1076 468 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969342.1 protein_id gnl|my_center|LOCUS_56210 1828 1073 gene locus_tag LOCUS_56220 1828 1073 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_56220 3204 1825 gene locus_tag LOCUS_56230 3204 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 3301 4287 gene locus_tag LOCUS_56240 3301 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56240 <7240 4263 gene locus_tag LOCUS_56250 <7240 4263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967237.1:guanylate cyclase >Feature sequence326 <1 532 gene locus_tag LOCUS_56260 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3ECZ7:UPF0246 protein YaaA 569 1033 gene locus_tag LOCUS_56270 569 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 1157 1279 gene locus_tag LOCUS_56280 1157 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 1331 1759 gene locus_tag LOCUS_56290 1331 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 3868 1934 gene locus_tag LOCUS_56300 3868 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 4518 3865 gene locus_tag LOCUS_56310 4518 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56310 4994 4515 gene locus_tag LOCUS_56320 4994 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 <7218 5089 gene locus_tag LOCUS_56330 <7218 5089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026868.1:type I polyketide synthase >Feature sequence327 941 159 gene locus_tag LOCUS_56340 gene coaX 941 159 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8YAC5 protein_id gnl|my_center|LOCUS_56340 1049 3124 gene locus_tag LOCUS_56350 gene fusA-1 1049 3124 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_56350 3150 4442 gene locus_tag LOCUS_56360 3150 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 5398 4448 gene locus_tag LOCUS_56370 gene ald 5398 4448 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63LB8 protein_id gnl|my_center|LOCUS_56370 5676 5386 gene locus_tag LOCUS_56380 5676 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 5647 6414 gene locus_tag LOCUS_56390 5647 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56390 >Feature sequence328 1570 1313 gene locus_tag LOCUS_56400 1570 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 1954 1634 gene locus_tag LOCUS_56410 1954 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56410 2033 3544 gene locus_tag LOCUS_56420 2033 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 3595 4440 gene locus_tag LOCUS_56430 gene soj 3595 4440 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37522 protein_id gnl|my_center|LOCUS_56430 5005 4442 gene locus_tag LOCUS_56440 5005 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 5182 7131 gene locus_tag LOCUS_56450 5182 7131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 >Feature sequence329 550 1602 gene locus_tag LOCUS_56460 550 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 1645 2799 gene locus_tag LOCUS_56470 gene caiA 1645 2799 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215329.1 protein_id gnl|my_center|LOCUS_56470 2800 3801 gene locus_tag LOCUS_56480 2800 3801 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_56480 3812 5044 gene locus_tag LOCUS_56490 3812 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56490 5071 5490 gene locus_tag LOCUS_56500 5071 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 5863 5492 gene locus_tag LOCUS_56510 5863 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 6690 5863 gene locus_tag LOCUS_56520 6690 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 >Feature sequence330 179 2482 gene locus_tag LOCUS_56530 179 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 2427 3671 gene locus_tag LOCUS_56540 2427 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 6309 3739 gene locus_tag LOCUS_56550 6309 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 >Feature sequence331 2713 1157 gene locus_tag LOCUS_56560 2713 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 3158 3418 gene locus_tag LOCUS_56570 3158 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 4050 3757 gene locus_tag LOCUS_56580 4050 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 4265 4068 gene locus_tag LOCUS_56590 4265 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 4206 4508 gene locus_tag LOCUS_56600 4206 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 4514 6580 gene locus_tag LOCUS_56610 4514 6580 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_56610 >Feature sequence332 2231 783 gene locus_tag LOCUS_56620 gene mdsA 2231 783 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121930.1 protein_id gnl|my_center|LOCUS_56620 3310 2228 gene locus_tag LOCUS_56630 gene carA 3310 2228 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH03 protein_id gnl|my_center|LOCUS_56630 4526 3375 gene locus_tag LOCUS_56640 4526 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 6070 4526 gene locus_tag LOCUS_56650 6070 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 6813 6067 gene locus_tag LOCUS_56660 6813 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 >Feature sequence333 1540 992 gene locus_tag LOCUS_56670 1540 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 4899 3079 gene locus_tag LOCUS_56680 4899 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 4956 5759 gene locus_tag LOCUS_56690 4956 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 >Feature sequence334 3770 1125 gene locus_tag LOCUS_56700 3770 1125 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_56700 5770 3770 gene locus_tag LOCUS_56710 gene glyS 5770 3770 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FM7 protein_id gnl|my_center|LOCUS_56710 6620 5763 gene locus_tag LOCUS_56720 gene glyQ 6620 5763 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FM8 protein_id gnl|my_center|LOCUS_56720 >Feature sequence335 <1 1289 gene locus_tag LOCUS_56730 <1 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942671.1:pilus modification protein PilQ 1337 1780 gene locus_tag LOCUS_56740 1337 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 1770 2849 gene locus_tag LOCUS_56750 gene aroB 1770 2849 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BL6 protein_id gnl|my_center|LOCUS_56750 2846 3466 gene locus_tag LOCUS_56760 2846 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 3702 3409 gene locus_tag LOCUS_56770 3702 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56770 3679 3900 gene locus_tag LOCUS_56780 3679 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 3933 4385 gene locus_tag LOCUS_56790 3933 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 4385 5734 gene locus_tag LOCUS_56800 4385 5734 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704972.1 protein_id gnl|my_center|LOCUS_56800 >Feature sequence336 87 884 gene locus_tag LOCUS_56810 87 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_56810 1046 1246 gene locus_tag LOCUS_56820 1046 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56820 1243 1767 gene locus_tag LOCUS_56830 1243 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 1802 2713 gene locus_tag LOCUS_56840 1802 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 4452 3001 gene locus_tag LOCUS_56850 4452 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 4796 4449 gene locus_tag LOCUS_56860 4796 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 5571 6572 gene locus_tag LOCUS_56870 5571 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 >Feature sequence337 812 177 gene locus_tag LOCUS_56880 812 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 839 2584 gene locus_tag LOCUS_56890 839 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 5361 2581 gene locus_tag LOCUS_56900 5361 2581 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003914906.1 protein_id gnl|my_center|LOCUS_56900 6281 5382 gene locus_tag LOCUS_56910 6281 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 >Feature sequence338 1473 457 gene locus_tag LOCUS_56920 1473 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56920 2454 1483 gene locus_tag LOCUS_56930 2454 1483 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392508.1 protein_id gnl|my_center|LOCUS_56930 3461 2463 gene locus_tag LOCUS_56940 3461 2463 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392508.1 protein_id gnl|my_center|LOCUS_56940 3539 4237 gene locus_tag LOCUS_56950 3539 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 4270 5427 gene locus_tag LOCUS_56960 4270 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 6400 5438 gene locus_tag LOCUS_56970 6400 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 >Feature sequence339 <1 538 gene locus_tag LOCUS_56980 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TIV6:succinate--CoA ligase [ADP-forming] subunit beta 539 1411 gene locus_tag LOCUS_56990 gene sucD 539 1411 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKI2 protein_id gnl|my_center|LOCUS_56990 1418 2590 gene locus_tag LOCUS_57000 1418 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57000 2632 3045 gene locus_tag LOCUS_57010 gene ndk 2632 3045 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B874 protein_id gnl|my_center|LOCUS_57010 3105 3878 gene locus_tag LOCUS_57020 3105 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 5630 3894 gene locus_tag LOCUS_57030 5630 3894 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_57030 >Feature sequence340 3133 662 gene locus_tag LOCUS_57040 3133 662 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964119.1 protein_id gnl|my_center|LOCUS_57040 3989 3150 gene locus_tag LOCUS_57050 3989 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 4986 4036 gene locus_tag LOCUS_57060 4986 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 5010 6095 gene locus_tag LOCUS_57070 gene rnd 5010 6095 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7L8 protein_id gnl|my_center|LOCUS_57070 6228 6395 gene locus_tag LOCUS_57080 6228 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 >Feature sequence341 551 1363 gene locus_tag LOCUS_57090 551 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 1351 2142 gene locus_tag LOCUS_57100 1351 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 3021 2188 gene locus_tag LOCUS_57110 3021 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57110 3519 3085 gene locus_tag LOCUS_57120 3519 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 4130 3516 gene locus_tag LOCUS_57130 4130 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57130 4154 6310 gene locus_tag LOCUS_57140 4154 6310 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530880.1 protein_id gnl|my_center|LOCUS_57140 5707 5621 gene locus_tag LOCUS_t00380 5707 5621 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence342 568 11 gene locus_tag LOCUS_57150 568 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57150 623 2272 gene locus_tag LOCUS_57160 623 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 2282 3877 gene locus_tag LOCUS_57170 2282 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57170 4634 3855 gene locus_tag LOCUS_57180 4634 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 4658 5164 gene locus_tag LOCUS_57190 4658 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57190 5203 5793 gene locus_tag LOCUS_57200 5203 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57200 6515 5739 gene locus_tag LOCUS_57210 gene proC 6515 5739 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFV0 protein_id gnl|my_center|LOCUS_57210 >Feature sequence343 <1 996 gene locus_tag LOCUS_57220 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083901.1:benzoyl-CoA oxygenase subunit B 1026 3497 gene locus_tag LOCUS_57230 1026 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 3572 4093 gene locus_tag LOCUS_57240 3572 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 4872 4090 gene locus_tag LOCUS_57250 4872 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57250 >Feature sequence344 1248 877 gene locus_tag LOCUS_57260 1248 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 1247 1981 gene locus_tag LOCUS_57270 1247 1981 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_57270 3007 1955 gene locus_tag LOCUS_57280 gene mutY 3007 1955 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968924.1 protein_id gnl|my_center|LOCUS_57280 3029 4327 gene locus_tag LOCUS_57290 3029 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57290 >Feature sequence345 1299 262 gene locus_tag LOCUS_57300 1299 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57300 1207 1452 gene locus_tag LOCUS_57310 1207 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 1832 1401 gene locus_tag LOCUS_57320 1832 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57320 2335 1829 gene locus_tag LOCUS_57330 2335 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 2415 3329 gene locus_tag LOCUS_57340 2415 3329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_57340 3329 4039 gene locus_tag LOCUS_57350 3329 4039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404002.1 protein_id gnl|my_center|LOCUS_57350 4030 5514 gene locus_tag LOCUS_57360 4030 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 >Feature sequence346 2897 1215 gene locus_tag LOCUS_57370 2897 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57370 3093 2914 gene locus_tag LOCUS_57380 3093 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 3049 4416 gene locus_tag LOCUS_57390 3049 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57390 4668 4420 gene locus_tag LOCUS_57400 4668 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 4802 5746 gene locus_tag LOCUS_57410 4802 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 >Feature sequence347 299 2083 gene locus_tag LOCUS_57420 299 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 3689 2091 gene locus_tag LOCUS_57430 3689 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57430 3759 4550 gene locus_tag LOCUS_57440 3759 4550 CDS product putative steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703552.1 protein_id gnl|my_center|LOCUS_57440 4550 5230 gene locus_tag LOCUS_57450 4550 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702031.1 protein_id gnl|my_center|LOCUS_57450 5240 5839 gene locus_tag LOCUS_57460 5240 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57460 >Feature sequence348 101 1141 gene locus_tag LOCUS_57470 gene plsX 101 1141 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CS5 protein_id gnl|my_center|LOCUS_57470 1142 2254 gene locus_tag LOCUS_57480 1142 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640419.1 protein_id gnl|my_center|LOCUS_57480 4201 2225 gene locus_tag LOCUS_57490 4201 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57490 4219 4716 gene locus_tag LOCUS_57500 4219 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57500 4713 5861 gene locus_tag LOCUS_57510 gene tilS 4713 5861 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7L3 protein_id gnl|my_center|LOCUS_57510 >Feature sequence349 1427 336 gene locus_tag LOCUS_57520 gene alr 1427 336 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FK2 protein_id gnl|my_center|LOCUS_57520 1475 2407 gene locus_tag LOCUS_57530 1475 2407 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_57530 2428 3357 gene locus_tag LOCUS_57540 2428 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 3361 4890 gene locus_tag LOCUS_57550 3361 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 4887 6077 gene locus_tag LOCUS_57560 4887 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 >Feature sequence350 803 12 gene locus_tag LOCUS_57570 803 12 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_57570 1818 814 gene locus_tag LOCUS_57580 1818 814 CDS product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028575.1 protein_id gnl|my_center|LOCUS_57580 2414 1818 gene locus_tag LOCUS_57590 2414 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57590 3985 2435 gene locus_tag LOCUS_57600 3985 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57600 4949 3975 gene locus_tag LOCUS_57610 4949 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57610 >Feature sequence351 2075 1050 gene locus_tag LOCUS_57620 2075 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 3901 2078 gene locus_tag LOCUS_57630 3901 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57630 4485 3898 gene locus_tag LOCUS_57640 4485 3898 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868289.1 protein_id gnl|my_center|LOCUS_57640 4517 4936 gene locus_tag LOCUS_57650 4517 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57650 4941 5438 gene locus_tag LOCUS_57660 4941 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57660 5858 5403 gene locus_tag LOCUS_57670 5858 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57670 6238 5891 gene locus_tag LOCUS_57680 6238 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57680 >Feature sequence352 1139 93 gene locus_tag LOCUS_57690 1139 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57690 1185 2165 gene locus_tag LOCUS_57700 1185 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 2162 3580 gene locus_tag LOCUS_57710 2162 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 4940 3564 gene locus_tag LOCUS_57720 4940 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 <6378 4940 gene locus_tag LOCUS_57730 <6378 4940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730726.1:helicase >Feature sequence353 1049 114 gene locus_tag LOCUS_57740 1049 114 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942950.1 protein_id gnl|my_center|LOCUS_57740 1170 2204 gene locus_tag LOCUS_57750 1170 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57750 4347 2194 gene locus_tag LOCUS_57760 4347 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 4370 5023 gene locus_tag LOCUS_57770 4370 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 5582 5010 gene locus_tag LOCUS_57780 gene kynB 5582 5010 CDS product kynurenine formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MHU5 protein_id gnl|my_center|LOCUS_57780 <6306 5632 gene locus_tag LOCUS_57790 <6306 5632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403054.1:transketolase >Feature sequence354 1777 872 gene locus_tag LOCUS_57800 1777 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 3075 1825 gene locus_tag LOCUS_57810 3075 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57810 3132 3797 gene locus_tag LOCUS_57820 3132 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 3866 4246 gene locus_tag LOCUS_57830 3866 4246 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHA9 protein_id gnl|my_center|LOCUS_57830 4246 5316 gene locus_tag LOCUS_57840 gene manC 4246 5316 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_57840 5363 5728 gene locus_tag LOCUS_57850 5363 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 >Feature sequence355 214 759 gene locus_tag LOCUS_57860 214 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57860 756 1649 gene locus_tag LOCUS_57870 756 1649 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407856.1 protein_id gnl|my_center|LOCUS_57870 1681 2433 gene locus_tag LOCUS_57880 1681 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57880 3000 2440 gene locus_tag LOCUS_57890 3000 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 5492 2997 gene locus_tag LOCUS_57900 5492 2997 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_57900 >Feature sequence356 353 171 gene locus_tag LOCUS_57910 353 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57910 1213 350 gene locus_tag LOCUS_57920 1213 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57920 1476 1210 gene locus_tag LOCUS_57930 1476 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 1975 1550 gene locus_tag LOCUS_57940 1975 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57940 2346 1972 gene locus_tag LOCUS_57950 2346 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 2546 2695 gene locus_tag LOCUS_57960 2546 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 2802 3335 gene locus_tag LOCUS_57970 2802 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 3332 3769 gene locus_tag LOCUS_57980 3332 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 3813 4007 gene locus_tag LOCUS_57990 3813 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 4004 4831 gene locus_tag LOCUS_58000 4004 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 4828 6117 gene locus_tag LOCUS_58010 4828 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 >Feature sequence357 1 630 gene locus_tag LOCUS_58020 1 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 656 2101 gene locus_tag LOCUS_58030 656 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809081.1 protein_id gnl|my_center|LOCUS_58030 2350 2772 gene locus_tag LOCUS_58040 2350 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58040 3780 2776 gene locus_tag LOCUS_58050 3780 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_58050 4457 3783 gene locus_tag LOCUS_58060 4457 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 4726 4454 gene locus_tag LOCUS_58070 4726 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58070 5196 4723 gene locus_tag LOCUS_58080 5196 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 >Feature sequence358 615 358 gene locus_tag LOCUS_58090 615 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 733 1827 gene locus_tag LOCUS_58100 gene ychF 733 1827 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYK0 protein_id gnl|my_center|LOCUS_58100 2456 1839 gene locus_tag LOCUS_58110 2456 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58110 3435 2380 gene locus_tag LOCUS_58120 3435 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58120 3485 4099 gene locus_tag LOCUS_58130 3485 4099 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_58130 4093 4974 gene locus_tag LOCUS_58140 4093 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58140 5367 4981 gene locus_tag LOCUS_58150 5367 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58150 >Feature sequence359 1028 45 gene locus_tag LOCUS_58160 1028 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58160 1043 1825 gene locus_tag LOCUS_58170 1043 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58170 1826 3190 gene locus_tag LOCUS_58180 1826 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58180 3187 3906 gene locus_tag LOCUS_58190 3187 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 >Feature sequence360 424 125 gene locus_tag LOCUS_58200 424 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58200 524 357 gene locus_tag LOCUS_58210 524 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58210 1922 822 gene locus_tag LOCUS_58220 1922 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58220 2497 1991 gene locus_tag LOCUS_58230 2497 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 2774 3190 gene locus_tag LOCUS_58240 2774 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58240 5090 3528 gene locus_tag LOCUS_58250 5090 3528 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_58250 5827 5087 gene locus_tag LOCUS_58260 5827 5087 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978111.1 protein_id gnl|my_center|LOCUS_58260 >Feature sequence361 191 1852 gene locus_tag LOCUS_58270 191 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58270 1905 2888 gene locus_tag LOCUS_58280 1905 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58280 3909 3031 gene locus_tag LOCUS_58290 3909 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 4429 3920 gene locus_tag LOCUS_58300 4429 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58300 5196 4612 gene locus_tag LOCUS_58310 5196 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58310 6017 5478 gene locus_tag LOCUS_58320 6017 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 >Feature sequence362 <1 714 gene locus_tag LOCUS_58330 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250712.1:beta-galactosidase 1635 718 gene locus_tag LOCUS_58340 gene nhaR 1635 718 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704639.1 protein_id gnl|my_center|LOCUS_58340 1802 3832 gene locus_tag LOCUS_58350 1802 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58350 >Feature sequence363 928 188 gene locus_tag LOCUS_58360 928 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 1039 1203 gene locus_tag LOCUS_58370 1039 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58370 2071 1235 gene locus_tag LOCUS_58380 2071 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 3822 2068 gene locus_tag LOCUS_58390 3822 2068 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_58390 4138 5205 gene locus_tag LOCUS_58400 4138 5205 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246120.1 protein_id gnl|my_center|LOCUS_58400 >Feature sequence364 <1 623 gene locus_tag LOCUS_58410 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545811.1:peptide-binding protein 638 1561 gene locus_tag LOCUS_58420 638 1561 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_58420 1558 2373 gene locus_tag LOCUS_58430 1558 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 2370 3095 gene locus_tag LOCUS_58440 2370 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58440 3092 3865 gene locus_tag LOCUS_58450 3092 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58450 3874 5109 gene locus_tag LOCUS_58460 3874 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58460 >Feature sequence365 2051 3151 gene locus_tag LOCUS_58470 2051 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58470 3154 5184 gene locus_tag LOCUS_58480 3154 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 5873 5157 gene locus_tag LOCUS_58490 5873 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58490 >Feature sequence366 838 386 gene locus_tag LOCUS_58500 838 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 863 1228 gene locus_tag LOCUS_58510 863 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 1279 2235 gene locus_tag LOCUS_58520 1279 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 2236 3429 gene locus_tag LOCUS_58530 2236 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 4426 3371 gene locus_tag LOCUS_58540 4426 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58540 4492 5892 gene locus_tag LOCUS_58550 4492 5892 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337079.1 protein_id gnl|my_center|LOCUS_58550 >Feature sequence367 2810 1932 gene locus_tag LOCUS_58560 2810 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58560 2884 4449 gene locus_tag LOCUS_58570 2884 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58570 5172 4453 gene locus_tag LOCUS_58580 5172 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58580 >Feature sequence368 <1 2707 gene locus_tag LOCUS_58590 <1 2707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403251.1:multidrug transporter AcrB 4666 2714 gene locus_tag LOCUS_58600 4666 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58600 >Feature sequence369 <1 734 gene locus_tag LOCUS_58610 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942307.1:uridine phosphorylase 731 1072 gene locus_tag LOCUS_58620 731 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704141.1 protein_id gnl|my_center|LOCUS_58620 1370 2155 gene locus_tag LOCUS_58630 1370 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 4880 2223 gene locus_tag LOCUS_58640 4880 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 5250 4921 gene locus_tag LOCUS_58650 5250 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 >Feature sequence370 454 86 gene locus_tag LOCUS_58660 454 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 984 745 gene locus_tag LOCUS_58670 984 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 4446 1027 gene locus_tag LOCUS_58680 4446 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 4585 5595 gene locus_tag LOCUS_58690 gene trpD 4585 5595 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIT6 protein_id gnl|my_center|LOCUS_58690 >Feature sequence371 1061 2974 gene locus_tag LOCUS_58700 1061 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 2982 4508 gene locus_tag LOCUS_58710 2982 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58710 4549 5586 gene locus_tag LOCUS_58720 4549 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 >Feature sequence372 449 1915 gene locus_tag LOCUS_58730 449 1915 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_58730 3444 1921 gene locus_tag LOCUS_58740 3444 1921 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124897.1 protein_id gnl|my_center|LOCUS_58740 4401 3481 gene locus_tag LOCUS_58750 4401 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58750 4442 4762 gene locus_tag LOCUS_58760 4442 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58760 4816 4889 gene locus_tag LOCUS_t00390 4816 4889 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence373 1278 193 gene locus_tag LOCUS_58770 1278 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 2219 1278 gene locus_tag LOCUS_58780 gene ansA 2219 1278 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230730.1 protein_id gnl|my_center|LOCUS_58780 2218 2820 gene locus_tag LOCUS_58790 2218 2820 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337318.1 protein_id gnl|my_center|LOCUS_58790 2881 5538 gene locus_tag LOCUS_58800 2881 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 >Feature sequence374 <1 2838 gene locus_tag LOCUS_58810 <1 2838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803940.1:PDK repeat-containing protein >Feature sequence375 1068 4313 gene locus_tag LOCUS_58820 1068 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 >Feature sequence376 2270 456 gene locus_tag LOCUS_58830 2270 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58830 4942 2336 gene locus_tag LOCUS_58840 4942 2336 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3JRX8 protein_id gnl|my_center|LOCUS_58840 >Feature sequence377 293 1780 gene locus_tag LOCUS_58850 293 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58850 2642 1767 gene locus_tag LOCUS_58860 2642 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58860 2704 4464 gene locus_tag LOCUS_58870 2704 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58870 4504 5286 gene locus_tag LOCUS_58880 4504 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 5787 5293 gene locus_tag LOCUS_58890 5787 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 >Feature sequence378 1150 785 gene locus_tag LOCUS_58900 1150 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58900 3345 1147 gene locus_tag LOCUS_58910 3345 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 3448 4272 gene locus_tag LOCUS_58920 3448 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 4959 4261 gene locus_tag LOCUS_58930 4959 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58930 5597 5022 gene locus_tag LOCUS_58940 5597 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 >Feature sequence379 948 175 gene locus_tag LOCUS_58950 948 175 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_58950 947 2446 gene locus_tag LOCUS_58960 947 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 4232 2451 gene locus_tag LOCUS_58970 4232 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 >Feature sequence380 213 3266 gene locus_tag LOCUS_58980 213 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 >Feature sequence381 3800 1566 gene locus_tag LOCUS_58990 3800 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58990 3919 5100 gene locus_tag LOCUS_59000 3919 5100 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940649.1 protein_id gnl|my_center|LOCUS_59000 >Feature sequence382 3869 2700 gene locus_tag LOCUS_59010 3869 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 4022 4516 gene locus_tag LOCUS_59020 4022 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 4949 4506 gene locus_tag LOCUS_59030 4949 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 >Feature sequence383 2264 243 gene locus_tag LOCUS_59040 2264 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59040 3928 2261 gene locus_tag LOCUS_59050 3928 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 3955 4446 gene locus_tag LOCUS_59060 3955 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59060 4488 5501 gene locus_tag LOCUS_59070 4488 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59070 >Feature sequence384 657 502 gene locus_tag LOCUS_59080 657 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59080 1709 1095 gene locus_tag LOCUS_59090 1709 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 2666 1770 gene locus_tag LOCUS_59100 2666 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59100 2690 3460 gene locus_tag LOCUS_59110 2690 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59110 3470 4006 gene locus_tag LOCUS_59120 3470 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 4052 5071 gene locus_tag LOCUS_59130 4052 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 >Feature sequence385 945 1256 gene locus_tag LOCUS_59140 945 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089416.1 protein_id gnl|my_center|LOCUS_59140 1256 2122 gene locus_tag LOCUS_59150 1256 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59150 2153 3781 gene locus_tag LOCUS_59160 2153 3781 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_59160 3778 5025 gene locus_tag LOCUS_59170 3778 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59170 >Feature sequence386 67 1272 gene locus_tag LOCUS_59180 67 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59180 2530 1235 gene locus_tag LOCUS_59190 gene hisS 2530 1235 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHH9 protein_id gnl|my_center|LOCUS_59190 2601 4022 gene locus_tag LOCUS_59200 gene gatB 2601 4022 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL60 protein_id gnl|my_center|LOCUS_59200 >Feature sequence387 1991 876 gene locus_tag LOCUS_59210 1991 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 3055 1988 gene locus_tag LOCUS_59220 3055 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 4784 3060 gene locus_tag LOCUS_59230 4784 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 >Feature sequence388 <1 2729 gene locus_tag LOCUS_59240 <1 2729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q881T7:error-prone DNA polymerase 2833 3846 gene locus_tag LOCUS_59250 2833 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59250 3895 4959 gene locus_tag LOCUS_59260 3895 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 >Feature sequence389 832 1206 gene locus_tag LOCUS_59270 832 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 3857 1230 gene locus_tag LOCUS_59280 3857 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59280 >Feature sequence390 842 327 gene locus_tag LOCUS_59290 842 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 1988 864 gene locus_tag LOCUS_59300 1988 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59300 2059 3042 gene locus_tag LOCUS_59310 2059 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59310 3042 3590 gene locus_tag LOCUS_59320 3042 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59320 4926 3607 gene locus_tag LOCUS_59330 4926 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59330 >Feature sequence391 1000 200 gene locus_tag LOCUS_59340 1000 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 1437 1027 gene locus_tag LOCUS_59350 1437 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59350 2891 1626 gene locus_tag LOCUS_59360 2891 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59360 4024 2894 gene locus_tag LOCUS_59370 4024 2894 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404020.1 protein_id gnl|my_center|LOCUS_59370 4091 4933 gene locus_tag LOCUS_59380 4091 4933 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_59380 >Feature sequence392 3516 3806 gene locus_tag LOCUS_59390 3516 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59390 3766 4104 gene locus_tag LOCUS_59400 3766 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59400 4101 4430 gene locus_tag LOCUS_59410 4101 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 4774 4427 gene locus_tag LOCUS_59420 4774 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 >Feature sequence393 1327 455 gene locus_tag LOCUS_59430 gene xerD 1327 455 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46352 protein_id gnl|my_center|LOCUS_59430 2484 1324 gene locus_tag LOCUS_59440 2484 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59440 5034 2494 gene locus_tag LOCUS_59450 gene mutS 5034 2494 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61667 protein_id gnl|my_center|LOCUS_59450 >Feature sequence394 2426 3718 gene locus_tag LOCUS_59460 2426 3718 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730651.1 protein_id gnl|my_center|LOCUS_59460 3715 4647 gene locus_tag LOCUS_59470 3715 4647 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_59470 >Feature sequence395 <1 1658 gene locus_tag LOCUS_59480 <1 1658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731117.1:protein kinase 1660 2613 gene locus_tag LOCUS_59490 1660 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 2679 3458 gene locus_tag LOCUS_59500 2679 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59500 3455 4084 gene locus_tag LOCUS_59510 3455 4084 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701236.1 protein_id gnl|my_center|LOCUS_59510 >Feature sequence396 449 823 gene locus_tag LOCUS_59520 449 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59520 820 1977 gene locus_tag LOCUS_59530 820 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 1986 2438 gene locus_tag LOCUS_59540 1986 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59540 3425 2445 gene locus_tag LOCUS_59550 3425 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 3480 4991 gene locus_tag LOCUS_59560 3480 4991 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_59560 >Feature sequence397 1065 4448 gene locus_tag LOCUS_59570 1065 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59570 >Feature sequence398 1797 661 gene locus_tag LOCUS_59580 1797 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59580 2091 1834 gene locus_tag LOCUS_59590 2091 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59590 2694 2293 gene locus_tag LOCUS_59600 2694 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 3096 3662 gene locus_tag LOCUS_59610 3096 3662 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072497.1 protein_id gnl|my_center|LOCUS_59610 3655 4029 gene locus_tag LOCUS_59620 3655 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59620 4872 4048 gene locus_tag LOCUS_59630 4872 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59630 >Feature sequence399 1433 2374 gene locus_tag LOCUS_59640 1433 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 3087 2371 gene locus_tag LOCUS_59650 3087 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 3572 3123 gene locus_tag LOCUS_59660 3572 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59660 3606 4817 gene locus_tag LOCUS_59670 3606 4817 CDS product gliding motility protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583682.1 protein_id gnl|my_center|LOCUS_59670 >Feature sequence400 379 795 gene locus_tag LOCUS_59680 379 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59680 873 1217 gene locus_tag LOCUS_59690 873 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 2524 1637 gene locus_tag LOCUS_59700 2524 1637 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_59700 2677 3045 gene locus_tag LOCUS_59710 2677 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 3080 3676 gene locus_tag LOCUS_59720 3080 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 4272 4568 gene locus_tag LOCUS_59730 4272 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59730 >Feature sequence401 906 2690 gene locus_tag LOCUS_59740 906 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 2753 3547 gene locus_tag LOCUS_59750 2753 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 >Feature sequence402 472 53 gene locus_tag LOCUS_59760 472 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59760 820 545 gene locus_tag LOCUS_59770 820 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59770 1682 963 gene locus_tag LOCUS_59780 1682 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59780 2443 1679 gene locus_tag LOCUS_59790 2443 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59790 4563 2440 gene locus_tag LOCUS_59800 gene recD2 4563 2440 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGW5 protein_id gnl|my_center|LOCUS_59800 >Feature sequence403 1801 4461 gene locus_tag LOCUS_59810 1801 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59810 4683 4610 gene locus_tag LOCUS_t00400 4683 4610 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4764 4691 gene locus_tag LOCUS_t00410 4764 4691 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence404 1230 2723 gene locus_tag LOCUS_59820 gene proS 1230 2723 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A988 protein_id gnl|my_center|LOCUS_59820 2842 4506 gene locus_tag LOCUS_59830 2842 4506 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021862.1 protein_id gnl|my_center|LOCUS_59830 >Feature sequence405 4659 3109 gene locus_tag LOCUS_59840 4659 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 >Feature sequence406 1 819 gene locus_tag LOCUS_59850 1 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59850 819 1298 gene locus_tag LOCUS_59860 gene fabZ 819 1298 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97DA9 protein_id gnl|my_center|LOCUS_59860 1295 2479 gene locus_tag LOCUS_59870 1295 2479 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHD3 protein_id gnl|my_center|LOCUS_59870 2476 3348 gene locus_tag LOCUS_59880 2476 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59880 >Feature sequence407 1782 112 gene locus_tag LOCUS_59890 1782 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59890 2232 1867 gene locus_tag LOCUS_59900 2232 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59900 2261 3514 gene locus_tag LOCUS_59910 gene add 2261 3514 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403444.1 protein_id gnl|my_center|LOCUS_59910 3493 3969 gene locus_tag LOCUS_59920 3493 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 4108 4524 gene locus_tag LOCUS_59930 4108 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59930 >Feature sequence408 1385 3610 gene locus_tag LOCUS_59940 1385 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 4696 3614 gene locus_tag LOCUS_59950 4696 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59950 >Feature sequence409 1467 934 gene locus_tag LOCUS_59960 1467 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59960 1666 1857 gene locus_tag LOCUS_59970 1666 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59970 2742 1978 gene locus_tag LOCUS_59980 gene pppL 2742 1978 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_59980 2850 3323 gene locus_tag LOCUS_59990 2850 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59990 >Feature sequence410 1544 2263 gene locus_tag LOCUS_60000 1544 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60000 2245 2703 gene locus_tag LOCUS_60010 2245 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60010 >Feature sequence411 379 1899 gene locus_tag LOCUS_60020 379 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60020 1932 2705 gene locus_tag LOCUS_60030 1932 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60030 3512 2709 gene locus_tag LOCUS_60040 3512 2709 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968957.1 protein_id gnl|my_center|LOCUS_60040 3960 3538 gene locus_tag LOCUS_60050 3960 3538 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_60050 3959 4315 gene locus_tag LOCUS_60060 3959 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60060 >Feature sequence412 >Feature sequence413 876 2087 gene locus_tag LOCUS_60070 876 2087 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943766.1 protein_id gnl|my_center|LOCUS_60070 2087 3049 gene locus_tag LOCUS_60080 2087 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60080 3421 3053 gene locus_tag LOCUS_60090 3421 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60090 4403 3435 gene locus_tag LOCUS_60100 gene dfrA 4403 3435 CDS product dihydroflavonol 4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403593.1 protein_id gnl|my_center|LOCUS_60100 >Feature sequence414 983 177 gene locus_tag LOCUS_60110 983 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60110 1773 994 gene locus_tag LOCUS_60120 1773 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60120 2329 1826 gene locus_tag LOCUS_60130 2329 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60130 3274 2393 gene locus_tag LOCUS_60140 3274 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60140 3432 3271 gene locus_tag LOCUS_60150 3432 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60150 3522 3436 gene locus_tag LOCUS_t00420 3522 3436 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence415 555 106 gene locus_tag LOCUS_60160 555 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60160 1043 558 gene locus_tag LOCUS_60170 1043 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60170 1042 2760 gene locus_tag LOCUS_60180 1042 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 2760 3383 gene locus_tag LOCUS_60190 2760 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60190 >Feature sequence416 548 1246 gene locus_tag LOCUS_60200 548 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60200 1302 1868 gene locus_tag LOCUS_60210 1302 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 >Feature sequence417 1374 2597 gene locus_tag LOCUS_60220 1374 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60220 2590 4131 gene locus_tag LOCUS_60230 gene kmo 2590 4131 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_60230 >Feature sequence418 3222 3716 gene locus_tag LOCUS_60240 3222 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 >Feature sequence419 847 2064 gene locus_tag LOCUS_60250 847 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60250 2061 2258 gene locus_tag LOCUS_60260 2061 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60260 2255 3673 gene locus_tag LOCUS_60270 2255 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60270 >Feature sequence420 2277 274 gene locus_tag LOCUS_60280 2277 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60280 4046 2346 gene locus_tag LOCUS_60290 4046 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60290 >Feature sequence421 646 2937 gene locus_tag LOCUS_60300 646 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60300 2984 4264 gene locus_tag LOCUS_60310 2984 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60310 >Feature sequence422 1399 2409 gene locus_tag LOCUS_60320 1399 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60320 3043 2378 gene locus_tag LOCUS_60330 3043 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60330 3800 3054 gene locus_tag LOCUS_60340 3800 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60340 >Feature sequence423 <1 862 gene locus_tag LOCUS_60350 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933213.1:peptidase M16 1531 875 gene locus_tag LOCUS_60360 1531 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60360 2804 1665 gene locus_tag LOCUS_60370 2804 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60370 >Feature sequence424 1472 765 gene locus_tag LOCUS_60380 1472 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60380 1754 1515 gene locus_tag LOCUS_60390 1754 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60390 2113 1751 gene locus_tag LOCUS_60400 2113 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60400 2281 3828 gene locus_tag LOCUS_60410 2281 3828 CDS product anaerobic nitric oxide reductase transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 protein_id gnl|my_center|LOCUS_60410 >Feature sequence425 405 1802 gene locus_tag LOCUS_60420 405 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60420 3128 1809 gene locus_tag LOCUS_60430 3128 1809 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786958.1 protein_id gnl|my_center|LOCUS_60430 3152 3916 gene locus_tag LOCUS_60440 3152 3916 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203662.1 protein_id gnl|my_center|LOCUS_60440 4271 3888 gene locus_tag LOCUS_60450 4271 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60450 >Feature sequence426 1638 1189 gene locus_tag LOCUS_60460 1638 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60460 2443 1661 gene locus_tag LOCUS_60470 2443 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60470 >Feature sequence427 251 2638 gene locus_tag LOCUS_60480 251 2638 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHI0 protein_id gnl|my_center|LOCUS_60480 2655 4100 gene locus_tag LOCUS_60490 2655 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60490 >Feature sequence428 3087 1804 gene locus_tag LOCUS_60500 3087 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60500 <4310 3138 gene locus_tag LOCUS_60510 <4310 3138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070433.1:bifunctional TolB-family protein/amidohydrolase >Feature sequence429 1064 603 gene locus_tag LOCUS_60520 1064 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60520 1560 1057 gene locus_tag LOCUS_60530 1560 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60530 2244 1561 gene locus_tag LOCUS_60540 2244 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60540 3198 2320 gene locus_tag LOCUS_60550 3198 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60550 3811 3227 gene locus_tag LOCUS_60560 3811 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60560 4060 3812 gene locus_tag LOCUS_60570 4060 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 >Feature sequence430 50 586 gene locus_tag LOCUS_60580 50 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60580 1576 557 gene locus_tag LOCUS_60590 gene pyrD 1576 557 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBI7 protein_id gnl|my_center|LOCUS_60590 1599 2528 gene locus_tag LOCUS_60600 1599 2528 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_60600 2566 4086 gene locus_tag LOCUS_60610 2566 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60610 >Feature sequence431 <1 2064 gene locus_tag LOCUS_60620 <1 2064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071612.1:helicase 2298 2684 gene locus_tag LOCUS_60630 2298 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60630 2751 3917 gene locus_tag LOCUS_60640 2751 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60640 >Feature sequence432 55 1188 gene locus_tag LOCUS_60650 55 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_60650 1181 2500 gene locus_tag LOCUS_60660 1181 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 3742 2513 gene locus_tag LOCUS_60670 3742 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60670 >Feature sequence433 546 896 gene locus_tag LOCUS_60680 546 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60680 893 2221 gene locus_tag LOCUS_60690 893 2221 CDS product putative GMC-type oxidoreductase y4nJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55582 protein_id gnl|my_center|LOCUS_60690 2256 3377 gene locus_tag LOCUS_60700 2256 3377 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142387.1 protein_id gnl|my_center|LOCUS_60700 3826 3374 gene locus_tag LOCUS_60710 3826 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60710 3713 3994 gene locus_tag LOCUS_60720 3713 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60720 >Feature sequence434 282 208 gene locus_tag LOCUS_t00430 282 208 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 590 324 gene locus_tag LOCUS_60730 590 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60730 629 1159 gene locus_tag LOCUS_60740 629 1159 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_60740 1149 2465 gene locus_tag LOCUS_60750 1149 2465 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_60750 2488 3579 gene locus_tag LOCUS_60760 2488 3579 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403641.1 protein_id gnl|my_center|LOCUS_60760 >Feature sequence435 2 574 gene locus_tag LOCUS_60770 2 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60770 582 1484 gene locus_tag LOCUS_60780 582 1484 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257108.1 protein_id gnl|my_center|LOCUS_60780 1525 2646 gene locus_tag LOCUS_60790 1525 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60790 2656 3270 gene locus_tag LOCUS_60800 gene tdk 2656 3270 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZH4 protein_id gnl|my_center|LOCUS_60800 >Feature sequence436 1211 198 gene locus_tag LOCUS_60810 1211 198 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104643.1 protein_id gnl|my_center|LOCUS_60810 2926 1208 gene locus_tag LOCUS_60820 2926 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60820 3859 2936 gene locus_tag LOCUS_60830 3859 2936 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH43 protein_id gnl|my_center|LOCUS_60830 >Feature sequence437 2275 1475 gene locus_tag LOCUS_60840 2275 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60840 2959 2285 gene locus_tag LOCUS_60850 gene nth 2959 2285 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_60850 3025 3366 gene locus_tag LOCUS_60860 3025 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60860 >Feature sequence438 635 270 gene locus_tag LOCUS_60870 635 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60870 972 643 gene locus_tag LOCUS_60880 972 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60880 1255 2028 gene locus_tag LOCUS_60890 1255 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_60890 2561 2040 gene locus_tag LOCUS_60900 2561 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 2678 3562 gene locus_tag LOCUS_60910 2678 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60910 3613 3789 gene locus_tag LOCUS_60920 3613 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60920 >Feature sequence439 265 522 gene locus_tag LOCUS_60930 265 522 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_60930 3606 574 gene locus_tag LOCUS_60940 gene tri1 3606 574 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDE2 protein_id gnl|my_center|LOCUS_60940 >Feature sequence440 <1 1399 gene locus_tag LOCUS_60950 <1 1399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122787.1:helicase 1704 1417 gene locus_tag LOCUS_60960 1704 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60960 3148 1793 gene locus_tag LOCUS_60970 3148 1793 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704511.1 protein_id gnl|my_center|LOCUS_60970 >Feature sequence441 1292 816 gene locus_tag LOCUS_60980 1292 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60980 1656 1486 gene locus_tag LOCUS_60990 1656 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60990 2022 1657 gene locus_tag LOCUS_61000 2022 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61000 2259 2023 gene locus_tag LOCUS_61010 2259 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61010 3855 2284 gene locus_tag LOCUS_61020 3855 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61020 >Feature sequence442 3 1112 gene locus_tag LOCUS_61030 3 1112 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_61030 2713 1109 gene locus_tag LOCUS_61040 gene nadB 2713 1109 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C48 protein_id gnl|my_center|LOCUS_61040 2759 3331 gene locus_tag LOCUS_61050 2759 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61050 3336 3938 gene locus_tag LOCUS_61060 gene pgsA 3336 3938 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939132.1 protein_id gnl|my_center|LOCUS_61060 >Feature sequence443 732 2918 gene locus_tag LOCUS_61070 gene ligA 732 2918 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ER9 protein_id gnl|my_center|LOCUS_61070 >Feature sequence444 361 1299 gene locus_tag LOCUS_61080 361 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61080 3191 1278 gene locus_tag LOCUS_61090 3191 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61090 3437 3363 gene locus_tag LOCUS_t00440 3437 3363 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence445 2 1456 gene locus_tag LOCUS_61100 2 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61100 1549 2013 gene locus_tag LOCUS_61110 1549 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61110 2010 2912 gene locus_tag LOCUS_61120 2010 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61120 3779 2925 gene locus_tag LOCUS_61130 3779 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61130 >Feature sequence446 1101 691 gene locus_tag LOCUS_61140 1101 691 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_61140 1853 1098 gene locus_tag LOCUS_61150 1853 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61150 3751 1850 gene locus_tag LOCUS_61160 3751 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61160 >Feature sequence447 698 1672 gene locus_tag LOCUS_61170 698 1672 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_61170 2545 1673 gene locus_tag LOCUS_61180 2545 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61180 2595 3293 gene locus_tag LOCUS_61190 2595 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61190 >Feature sequence448 783 1586 gene locus_tag LOCUS_61200 783 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61200 3240 1594 gene locus_tag LOCUS_61210 3240 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 >Feature sequence449 >Feature sequence450 1007 2155 gene locus_tag LOCUS_61220 gene gltA 1007 2155 CDS product type I citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_61220 3004 2165 gene locus_tag LOCUS_61230 3004 2165 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089324.1 protein_id gnl|my_center|LOCUS_61230 >Feature sequence451 >Feature sequence452 404 1210 gene locus_tag LOCUS_61240 gene deoD 404 1210 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE80 protein_id gnl|my_center|LOCUS_61240 1201 1638 gene locus_tag LOCUS_61250 1201 1638 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_61250 1952 1614 gene locus_tag LOCUS_61260 1952 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61260 2201 2614 gene locus_tag LOCUS_61270 2201 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61270 >Feature sequence453 338 694 gene locus_tag LOCUS_61280 338 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61280 691 969 gene locus_tag LOCUS_61290 691 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61290 969 2102 gene locus_tag LOCUS_61300 969 2102 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_61300 2194 3327 gene locus_tag LOCUS_61310 2194 3327 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_61310 >Feature sequence454 146 874 gene locus_tag LOCUS_61320 146 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61320 1538 891 gene locus_tag LOCUS_61330 1538 891 CDS product deoxycytidine triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902137.1 protein_id gnl|my_center|LOCUS_61330 1560 3125 gene locus_tag LOCUS_61340 1560 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 >Feature sequence455 280 1080 gene locus_tag LOCUS_61350 gene crt 280 1080 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52046 protein_id gnl|my_center|LOCUS_61350 1083 2222 gene locus_tag LOCUS_61360 1083 2222 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_61360 2265 2879 gene locus_tag LOCUS_61370 2265 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61370 3127 2870 gene locus_tag LOCUS_61380 3127 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61380 >Feature sequence456 424 1686 gene locus_tag LOCUS_61390 gene aroA 424 1686 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749Y6 protein_id gnl|my_center|LOCUS_61390 1683 2354 gene locus_tag LOCUS_61400 gene cmk 1683 2354 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749Y7 protein_id gnl|my_center|LOCUS_61400 >Feature sequence457 367 80 gene locus_tag LOCUS_61410 367 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61410 686 504 gene locus_tag LOCUS_61420 686 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61420 793 2388 gene locus_tag LOCUS_61430 793 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61430 2385 2651 gene locus_tag LOCUS_61440 2385 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61440 >Feature sequence458 <1 2081 gene locus_tag LOCUS_61450 <1 2081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DB6:DNA-directed DNA polymerase 2089 2841 gene locus_tag LOCUS_61460 2089 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61460 >Feature sequence459 1560 1051 gene locus_tag LOCUS_61470 1560 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61470 2192 1560 gene locus_tag LOCUS_61480 gene pilO 2192 1560 CDS product pilus assembly protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_61480 2789 2193 gene locus_tag LOCUS_61490 gene pilN 2789 2193 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_61490 <3533 2786 gene locus_tag LOCUS_61500 <3533 2786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942675.1:pilus assembly protein PilM >Feature sequence460 241 420 gene locus_tag LOCUS_61510 241 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61510 492 668 gene locus_tag LOCUS_61520 492 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61520 763 1098 gene locus_tag LOCUS_61530 763 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61530 1098 2030 gene locus_tag LOCUS_61540 1098 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61540 2027 2302 gene locus_tag LOCUS_61550 2027 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61550 2302 2508 gene locus_tag LOCUS_61560 2302 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61560 >Feature sequence461 >Feature sequence462 173 985 gene locus_tag LOCUS_61570 173 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61570 982 1869 gene locus_tag LOCUS_61580 982 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61580 1866 2930 gene locus_tag LOCUS_61590 1866 2930 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_61590 >Feature sequence463 745 1392 gene locus_tag LOCUS_61600 745 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61600 2702 1410 gene locus_tag LOCUS_61610 2702 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61610 3403 2882 gene locus_tag LOCUS_61620 3403 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61620 >Feature sequence464 788 417 gene locus_tag LOCUS_61630 788 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61630 1739 807 gene locus_tag LOCUS_61640 1739 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61640 <3384 1814 gene locus_tag LOCUS_61650 <3384 1814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q727A5:glutamine--tRNA ligase >Feature sequence465 <1 1125 gene locus_tag LOCUS_61660 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942139.1:type II secretion system protein F 1148 2692 gene locus_tag LOCUS_61670 gene pilS 1148 2692 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_61670 >Feature sequence466 1241 888 gene locus_tag LOCUS_61680 1241 888 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896546.1 protein_id gnl|my_center|LOCUS_61680 2092 1244 gene locus_tag LOCUS_61690 2092 1244 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181Z6 protein_id gnl|my_center|LOCUS_61690 2120 3184 gene locus_tag LOCUS_61700 gene caiB 2120 3184 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071499.1 protein_id gnl|my_center|LOCUS_61700 >Feature sequence467 1800 172 gene locus_tag LOCUS_61710 1800 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61710 2439 2218 gene locus_tag LOCUS_61720 2439 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61720 >Feature sequence468 460 1314 gene locus_tag LOCUS_61730 gene pecR 460 1314 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_61730 2850 1327 gene locus_tag LOCUS_61740 2850 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61740 >Feature sequence469 <3323 942 gene locus_tag LOCUS_61750 <3323 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870015.1:dynamin family protein >Feature sequence470 120 1319 gene locus_tag LOCUS_61760 120 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61760 2373 1342 gene locus_tag LOCUS_61770 2373 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61770 2439 3194 gene locus_tag LOCUS_61780 2439 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140913.1 protein_id gnl|my_center|LOCUS_61780 >Feature sequence471 490 1251 gene locus_tag LOCUS_61790 gene folP 490 1251 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X9 protein_id gnl|my_center|LOCUS_61790 1239 2024 gene locus_tag LOCUS_61800 1239 2024 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_61800 2021 2998 gene locus_tag LOCUS_61810 2021 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61810 >Feature sequence472 989 459 gene locus_tag LOCUS_61820 989 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61820 1085 1774 gene locus_tag LOCUS_61830 gene dck 1085 1774 CDS product deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403716.1 protein_id gnl|my_center|LOCUS_61830 1777 2613 gene locus_tag LOCUS_61840 gene panB 1777 2613 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CG8 protein_id gnl|my_center|LOCUS_61840 >Feature sequence473 1700 2479 gene locus_tag LOCUS_61850 1700 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61850 >Feature sequence474 1839 151 gene locus_tag LOCUS_61860 1839 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61860 2641 1841 gene locus_tag LOCUS_61870 gene norQ 2641 1841 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 protein_id gnl|my_center|LOCUS_61870 <3258 2647 gene locus_tag LOCUS_61880 <3258 2647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085999.1:nitric oxide reductase subunit B >Feature sequence475 2205 1138 gene locus_tag LOCUS_61890 2205 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61890 2978 2205 gene locus_tag LOCUS_61900 2978 2205 CDS product UDP-N-acetyl-D-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_61900 >Feature sequence476 1897 590 gene locus_tag LOCUS_61910 1897 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61910 1969 2580 gene locus_tag LOCUS_61920 1969 2580 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_61920 2876 2595 gene locus_tag LOCUS_61930 2876 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61930 2763 3215 gene locus_tag LOCUS_61940 2763 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61940 >Feature sequence477 2406 1117 gene locus_tag LOCUS_61950 2406 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61950 2747 2433 gene locus_tag LOCUS_61960 2747 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61960 >Feature sequence478 1738 2628 gene locus_tag LOCUS_61970 1738 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61970 >Feature sequence479 1118 252 gene locus_tag LOCUS_61980 1118 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61980 1223 1558 gene locus_tag LOCUS_61990 1223 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61990 2010 1567 gene locus_tag LOCUS_62000 2010 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62000 >Feature sequence480 1 849 gene locus_tag LOCUS_62010 1 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62010 852 2960 gene locus_tag LOCUS_62020 852 2960 CDS product fatty oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524570.1 protein_id gnl|my_center|LOCUS_62020 >Feature sequence481 1028 573 gene locus_tag LOCUS_62030 1028 573 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530705.1 protein_id gnl|my_center|LOCUS_62030 2129 1038 gene locus_tag LOCUS_62040 2129 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62040 2883 2203 gene locus_tag LOCUS_62050 2883 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62050 >Feature sequence482 984 370 gene locus_tag LOCUS_62060 gene rlmE 984 370 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THI2 protein_id gnl|my_center|LOCUS_62060 2405 981 gene locus_tag LOCUS_62070 gene pepA 2405 981 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67868 protein_id gnl|my_center|LOCUS_62070 >Feature sequence483 388 1317 gene locus_tag LOCUS_62080 388 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62080 2593 1385 gene locus_tag LOCUS_62090 2593 1385 CDS product ISSfl3 ORF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_858161.2 protein_id gnl|my_center|LOCUS_62090 >Feature sequence484 1663 248 gene locus_tag LOCUS_62100 1663 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62100 1969 2463 gene locus_tag LOCUS_62110 1969 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62110 >Feature sequence485 <1 641 gene locus_tag LOCUS_62120 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943240.1:30S ribosomal protein S1 676 978 gene locus_tag LOCUS_62130 676 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62130 975 1817 gene locus_tag LOCUS_62140 975 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 1827 2960 gene locus_tag LOCUS_62150 1827 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62150 >Feature sequence486 416 1432 gene locus_tag LOCUS_62160 416 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62160 1435 2418 gene locus_tag LOCUS_62170 1435 2418 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_62170 >Feature sequence487 1028 567 gene locus_tag LOCUS_62180 1028 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 1702 1022 gene locus_tag LOCUS_62190 1702 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62190 2679 1699 gene locus_tag LOCUS_62200 2679 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62200 >Feature sequence488 60 506 gene locus_tag LOCUS_62210 60 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62210 538 1860 gene locus_tag LOCUS_62220 gene accC 538 1860 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124229.1 protein_id gnl|my_center|LOCUS_62220 >Feature sequence489 436 1113 gene locus_tag LOCUS_62230 436 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 1891 1085 gene locus_tag LOCUS_62240 1891 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 2234 1908 gene locus_tag LOCUS_62250 2234 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62250 2806 2291 gene locus_tag LOCUS_62260 2806 2291 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400057.1 protein_id gnl|my_center|LOCUS_62260 >Feature sequence490 464 745 gene locus_tag LOCUS_62270 464 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62270 1535 1161 gene locus_tag LOCUS_62280 1535 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62280 1661 2668 gene locus_tag LOCUS_62290 1661 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62290 >Feature sequence491 184 627 gene locus_tag LOCUS_62300 gene ybeY 184 627 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67367 protein_id gnl|my_center|LOCUS_62300 977 1783 gene locus_tag LOCUS_62310 977 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62310 1780 2436 gene locus_tag LOCUS_62320 1780 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62320 >Feature sequence492 143 655 gene locus_tag LOCUS_62330 143 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62330 659 1468 gene locus_tag LOCUS_62340 659 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62340 1465 2442 gene locus_tag LOCUS_62350 1465 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62350 >Feature sequence493 2224 260 gene locus_tag LOCUS_62360 2224 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62360 >Feature sequence494 2247 166 gene locus_tag LOCUS_62370 2247 166 CDS product DNA recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084515.1 protein_id gnl|my_center|LOCUS_62370 2419 2240 gene locus_tag LOCUS_62380 2419 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62380 2397 2717 gene locus_tag LOCUS_62390 2397 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62390 >Feature sequence495 >Feature sequence496 667 584 gene locus_tag LOCUS_t00450 667 584 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1645 680 gene locus_tag LOCUS_62400 1645 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 2177 1659 gene locus_tag LOCUS_62410 2177 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62410 >Feature sequence497 >Feature sequence498 1180 392 gene locus_tag LOCUS_62420 1180 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62420 1773 1168 gene locus_tag LOCUS_62430 1773 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62430 <2702 1944 gene locus_tag LOCUS_62440 <2702 1944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941639.1:ATPase AAA >Feature sequence499 381 1463 gene locus_tag LOCUS_62450 381 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62450 >Feature sequence500 >Feature sequence501 2148 1195 gene locus_tag LOCUS_62460 2148 1195 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257437.1 protein_id gnl|my_center|LOCUS_62460 >Feature sequence502 152 841 gene locus_tag LOCUS_62470 152 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357807.1 protein_id gnl|my_center|LOCUS_62470 838 1647 gene locus_tag LOCUS_62480 838 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62480 2585 1650 gene locus_tag LOCUS_62490 2585 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_62490 >Feature sequence503 <1 1161 gene locus_tag LOCUS_62500 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942750.1:PglZ domain-containing protein 1158 2429 gene locus_tag LOCUS_62510 1158 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62510 >Feature sequence504 2191 1877 gene locus_tag LOCUS_62520 2191 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62520 2370 2188 gene locus_tag LOCUS_62530 2370 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62530 >Feature sequence505 >Feature sequence506 816 1001 gene locus_tag LOCUS_62540 816 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62540 1672 1010 gene locus_tag LOCUS_62550 1672 1010 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727382.1 protein_id gnl|my_center|LOCUS_62550 1781 2560 gene locus_tag LOCUS_62560 1781 2560 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_62560 >Feature sequence507 >Feature sequence508 >Feature sequence509 1737 574 gene locus_tag LOCUS_62570 1737 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62570 >Feature sequence510 922 761 gene locus_tag LOCUS_62580 922 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62580 1572 1420 gene locus_tag LOCUS_62590 1572 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62590 >Feature sequence511 <1 834 gene locus_tag LOCUS_62600 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091272.1:D-alanyl-D-alanine carboxypeptidase 956 1651 gene locus_tag LOCUS_62610 956 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62610 >Feature sequence512 924 376 gene locus_tag LOCUS_62620 924 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62620 1069 2304 gene locus_tag LOCUS_62630 1069 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62630 >Feature sequence513 126 515 gene locus_tag LOCUS_62640 126 515 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040482.1 protein_id gnl|my_center|LOCUS_62640 515 1123 gene locus_tag LOCUS_62650 515 1123 CDS product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057873.1 protein_id gnl|my_center|LOCUS_62650 1133 1735 gene locus_tag LOCUS_62660 1133 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62660 >Feature sequence514 1978 980 gene locus_tag LOCUS_62670 gene yjeK 1978 980 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_62670 >Feature sequence515 <2390 153 gene locus_tag LOCUS_62680 <2390 153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000844448.1:peptidase M14 >Feature sequence516 884 672 gene locus_tag LOCUS_62690 884 672 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_62690 2032 1022 gene locus_tag LOCUS_62700 2032 1022 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069707.1 protein_id gnl|my_center|LOCUS_62700 >Feature sequence517 343 885 gene locus_tag LOCUS_62710 343 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62710 882 1388 gene locus_tag LOCUS_62720 882 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 >Feature sequence518 1360 689 gene locus_tag LOCUS_62730 1360 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62730 1661 1335 gene locus_tag LOCUS_62740 1661 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 >Feature sequence519 161 1663 gene locus_tag LOCUS_62750 161 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62750 >Feature sequence520 >Feature sequence521 649 1365 gene locus_tag LOCUS_62760 649 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62760 1362 1580 gene locus_tag LOCUS_62770 1362 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62770 1586 1825 gene locus_tag LOCUS_62780 1586 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62780 >Feature sequence522 <2299 1189 gene locus_tag LOCUS_62790 <2299 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NCB3:histidine ammonia-lyase >Feature sequence523 >Feature sequence524 <1 776 gene locus_tag LOCUS_62800 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941973.1:sensor histidine kinase 1265 681 gene locus_tag LOCUS_62810 1265 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62810 <2268 1262 gene locus_tag LOCUS_62820 <2268 1262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83C85:exodeoxyribonuclease 7 large subunit >Feature sequence525 34 121 gene locus_tag LOCUS_t00460 34 121 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 847 284 gene locus_tag LOCUS_62830 847 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62830 >Feature sequence526 2071 1142 gene locus_tag LOCUS_62840 2071 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62840 >Feature sequence527 >Feature sequence528 2037 424 gene locus_tag LOCUS_62850 2037 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62850 >Feature sequence529 1714 284 gene locus_tag LOCUS_62860 1714 284 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_62860 1942 1772 gene locus_tag LOCUS_62870 1942 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62870 >Feature sequence530 97 573 gene locus_tag LOCUS_62880 97 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62880 1048 839 gene locus_tag LOCUS_62890 1048 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62890 1362 1937 gene locus_tag LOCUS_62900 1362 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62900 >Feature sequence531 87 950 gene locus_tag LOCUS_62910 87 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62910 >Feature sequence532 1445 1627 gene locus_tag LOCUS_62920 1445 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62920 >Feature sequence533 303 752 gene locus_tag LOCUS_62930 303 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62930 >Feature sequence534 1546 1034 gene locus_tag LOCUS_62940 1546 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62940 1992 1546 gene locus_tag LOCUS_62950 1992 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62950 >Feature sequence535 402 812 gene locus_tag LOCUS_62960 402 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 protein_id gnl|my_center|LOCUS_62960 1004 1894 gene locus_tag LOCUS_62970 1004 1894 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144318.1 protein_id gnl|my_center|LOCUS_62970 >Feature sequence536 1196 777 gene locus_tag LOCUS_62980 1196 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62980 1368 1201 gene locus_tag LOCUS_62990 1368 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62990 1655 1365 gene locus_tag LOCUS_63000 1655 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63000 >Feature sequence537 548 147 gene locus_tag LOCUS_63010 548 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63010 1588 707 gene locus_tag LOCUS_63020 1588 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63020 >Feature sequence538 547 422 gene locus_tag LOCUS_63030 547 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63030 1818 853 gene locus_tag LOCUS_63040 1818 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63040 >Feature sequence539 <1 1270 gene locus_tag LOCUS_63050 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255965.1:protein kinase 1267 1695 gene locus_tag LOCUS_63060 1267 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63060 >Feature sequence540 256 1428 gene locus_tag LOCUS_63070 256 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63070 1428 1964 gene locus_tag LOCUS_63080 1428 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63080 >Feature sequence541 <1 816 gene locus_tag LOCUS_63090 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957826.1:cell division protein Fic 857 1417 gene locus_tag LOCUS_63100 857 1417 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_63100 1664 1816 gene locus_tag LOCUS_63110 1664 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63110 >Feature sequence542 <1963 738 gene locus_tag LOCUS_63120 <1963 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257240.1:aldehyde dehydrogenase >Feature sequence543 321 635 gene locus_tag LOCUS_63130 321 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63130 >Feature sequence544 >Feature sequence545 1576 920 gene locus_tag LOCUS_63140 1576 920 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537687.1 protein_id gnl|my_center|LOCUS_63140 >Feature sequence546 >Feature sequence547 713 1696 gene locus_tag LOCUS_63150 713 1696 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391782.1 protein_id gnl|my_center|LOCUS_63150 >Feature sequence548 >Feature sequence549 1624 872 gene locus_tag LOCUS_63160 1624 872 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776752.1 protein_id gnl|my_center|LOCUS_63160 1854 1624 gene locus_tag LOCUS_63170 1854 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63170 >Feature sequence550 1766 1242 gene locus_tag LOCUS_63180 1766 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63180 >Feature sequence551 381 653 gene locus_tag LOCUS_63190 381 653 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WZ6 protein_id gnl|my_center|LOCUS_63190 650 1618 gene locus_tag LOCUS_63200 gene rlmN 650 1618 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E53 protein_id gnl|my_center|LOCUS_63200 >Feature sequence552 >Feature sequence553 127 576 gene locus_tag LOCUS_63210 127 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63210 996 682 gene locus_tag LOCUS_63220 996 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63220 1428 1570 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gatgcaacctttgcaacctt >Feature sequence554 1524 1129 gene locus_tag LOCUS_63230 1524 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 >Feature sequence555 >Feature sequence556 1508 189 gene locus_tag LOCUS_63240 1508 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 >Feature sequence557 <1755 887 gene locus_tag LOCUS_63250 <1755 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66627:prolipoprotein diacylglyceryl transferase >Feature sequence558 >Feature sequence559 606 112 gene locus_tag LOCUS_63260 gene usp-2 606 112 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E46 protein_id gnl|my_center|LOCUS_63260 >Feature sequence560 >Feature sequence561 >Feature sequence562 217 50 gene locus_tag LOCUS_63270 217 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63270 532 221 gene locus_tag LOCUS_63280 532 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63280 1143 565 gene locus_tag LOCUS_63290 1143 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63290 1280 1570 gene locus_tag LOCUS_63300 gene groS 1280 1570 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C8 protein_id gnl|my_center|LOCUS_63300 >Feature sequence563 >Feature sequence564 >Feature sequence565 490 125 gene locus_tag LOCUS_63310 490 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63310 1020 487 gene locus_tag LOCUS_63320 1020 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63320 >Feature sequence566 13 1191 gene locus_tag LOCUS_63330 13 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63330 >Feature sequence567 >Feature sequence568 >Feature sequence569 905 468 gene locus_tag LOCUS_63340 905 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63340 1516 902 gene locus_tag LOCUS_63350 1516 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325274.1 protein_id gnl|my_center|LOCUS_63350 >Feature sequence570 1078 251 gene locus_tag LOCUS_63360 1078 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63360 >Feature sequence571 <1 1463 gene locus_tag LOCUS_63370 <1 1463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000677374.1:NTPase >Feature sequence572 237 1001 gene locus_tag LOCUS_63380 237 1001 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_63380 994 1392 gene locus_tag LOCUS_63390 994 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 >Feature sequence573 1400 930 gene locus_tag LOCUS_63400 gene rpsG 1400 930 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG51 protein_id gnl|my_center|LOCUS_63400 >Feature sequence574 >Feature sequence575 1085 282 gene locus_tag LOCUS_63410 1085 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 1320 1057 gene locus_tag LOCUS_63420 1320 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63420 >Feature sequence576 >Feature sequence577 454 1476 gene locus_tag LOCUS_63430 454 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63430 >Feature sequence578 787 524 gene locus_tag LOCUS_63440 787 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63440 1267 923 gene locus_tag LOCUS_63450 1267 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63450 >Feature sequence579 390 971 gene locus_tag LOCUS_63460 390 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63460