>Feature sequence0001 1871 303 gene locus_tag LOCUS_00010 1871 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2917 1868 gene locus_tag LOCUS_00020 2917 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3795 2914 gene locus_tag LOCUS_00030 3795 2914 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_00030 4766 3792 gene locus_tag LOCUS_00040 4766 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8799 4759 gene locus_tag LOCUS_00050 8799 4759 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258114.1 protein_id gnl|my_center|LOCUS_00050 8883 10040 gene locus_tag LOCUS_00060 8883 10040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 12457 10043 gene locus_tag LOCUS_00070 12457 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 13567 12458 gene locus_tag LOCUS_00080 13567 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 14394 13618 gene locus_tag LOCUS_00090 gene pstB 14394 13618 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7S9 protein_id gnl|my_center|LOCUS_00090 15151 14387 gene locus_tag LOCUS_00100 gene pstB 15151 14387 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180A5 protein_id gnl|my_center|LOCUS_00100 16014 15145 gene locus_tag LOCUS_00110 16014 15145 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A852 protein_id gnl|my_center|LOCUS_00110 16929 16018 gene locus_tag LOCUS_00120 16929 16018 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7T1 protein_id gnl|my_center|LOCUS_00120 17990 16929 gene locus_tag LOCUS_00130 17990 16929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 18865 17987 gene locus_tag LOCUS_00140 18865 17987 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_00140 19521 18934 gene locus_tag LOCUS_00150 gene cynT 19521 18934 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I262 protein_id gnl|my_center|LOCUS_00150 20504 19572 gene locus_tag LOCUS_00160 20504 19572 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_00160 20609 21613 gene locus_tag LOCUS_00170 20609 21613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21610 22365 gene locus_tag LOCUS_00180 21610 22365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 22448 22648 gene locus_tag LOCUS_00190 22448 22648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22814 22972 gene locus_tag LOCUS_00200 22814 22972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23869 22973 gene locus_tag LOCUS_00210 23869 22973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23954 24328 gene locus_tag LOCUS_00220 23954 24328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24330 24833 gene locus_tag LOCUS_00230 24330 24833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24833 25312 gene locus_tag LOCUS_00240 24833 25312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25316 26713 gene locus_tag LOCUS_00250 25316 26713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27359 26724 gene locus_tag LOCUS_00260 27359 26724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 >Feature sequence0002 347 1726 gene locus_tag LOCUS_00270 347 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 1727 2479 gene locus_tag LOCUS_00280 1727 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 2519 3202 gene locus_tag LOCUS_00290 2519 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 3934 3203 gene locus_tag LOCUS_00300 3934 3203 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_00300 3967 4614 gene locus_tag LOCUS_00310 3967 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 4619 6241 gene locus_tag LOCUS_00320 4619 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 6263 7291 gene locus_tag LOCUS_00330 6263 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 7314 8408 gene locus_tag LOCUS_00340 7314 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 9833 8415 gene locus_tag LOCUS_00350 9833 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 9904 11025 gene locus_tag LOCUS_00360 9904 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 11032 11913 gene locus_tag LOCUS_00370 11032 11913 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367933.1 protein_id gnl|my_center|LOCUS_00370 11973 12770 gene locus_tag LOCUS_00380 11973 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 12805 12963 gene locus_tag LOCUS_00390 12805 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 13019 14122 gene locus_tag LOCUS_00400 13019 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 14191 15588 gene locus_tag LOCUS_00410 14191 15588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 15692 16054 gene locus_tag LOCUS_00420 15692 16054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 16124 16672 gene locus_tag LOCUS_00430 16124 16672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 17865 16741 gene locus_tag LOCUS_00440 17865 16741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 18331 17930 gene locus_tag LOCUS_00450 18331 17930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 19292 18384 gene locus_tag LOCUS_00460 19292 18384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 19420 20721 gene locus_tag LOCUS_00470 19420 20721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 20733 21053 gene locus_tag LOCUS_00480 20733 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 21050 22102 gene locus_tag LOCUS_00490 21050 22102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 >Feature sequence0003 999 91 gene locus_tag LOCUS_00500 999 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 1050 3797 gene locus_tag LOCUS_00510 1050 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 4528 3803 gene locus_tag LOCUS_00520 4528 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 6798 4573 gene locus_tag LOCUS_00530 6798 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 7421 6795 gene locus_tag LOCUS_00540 7421 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 7530 8375 gene locus_tag LOCUS_00550 gene carH 7530 8375 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53W62 protein_id gnl|my_center|LOCUS_00550 9741 8389 gene locus_tag LOCUS_00560 9741 8389 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_00560 9809 10966 gene locus_tag LOCUS_00570 9809 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 10966 12036 gene locus_tag LOCUS_00580 10966 12036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 12033 12494 gene locus_tag LOCUS_00590 12033 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 12556 14502 gene locus_tag LOCUS_00600 gene htpG 12556 14502 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61185 protein_id gnl|my_center|LOCUS_00600 14707 15072 gene locus_tag LOCUS_00610 14707 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 14964 15566 gene locus_tag LOCUS_00620 14964 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00620 15686 16408 gene locus_tag LOCUS_00630 15686 16408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 16586 16461 gene locus_tag LOCUS_00640 16586 16461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 16725 17159 gene locus_tag LOCUS_00650 16725 17159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 >Feature sequence0004 25 645 gene locus_tag LOCUS_00660 25 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 696 2168 gene locus_tag LOCUS_00670 696 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 2186 3436 gene locus_tag LOCUS_00680 2186 3436 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_00680 3433 4788 gene locus_tag LOCUS_00690 3433 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 4848 5879 gene locus_tag LOCUS_00700 4848 5879 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE7 protein_id gnl|my_center|LOCUS_00700 5876 6859 gene locus_tag LOCUS_00710 5876 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 6856 7761 gene locus_tag LOCUS_00720 gene pdxA 6856 7761 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7N4 protein_id gnl|my_center|LOCUS_00720 8233 7751 gene locus_tag LOCUS_00730 8233 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 8782 8243 gene locus_tag LOCUS_00740 8782 8243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 9645 8779 gene locus_tag LOCUS_00750 9645 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 10205 9642 gene locus_tag LOCUS_00760 10205 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 10809 10273 gene locus_tag LOCUS_00770 10809 10273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 11370 10906 gene locus_tag LOCUS_00780 11370 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 11804 11367 gene locus_tag LOCUS_00790 11804 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 13459 11801 gene locus_tag LOCUS_00800 gene hflX 13459 11801 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EF3 protein_id gnl|my_center|LOCUS_00800 14626 13511 gene locus_tag LOCUS_00810 14626 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 14656 15666 gene locus_tag LOCUS_00820 14656 15666 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388795.1 protein_id gnl|my_center|LOCUS_00820 >Feature sequence0005 1555 746 gene locus_tag LOCUS_00830 1555 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 2962 1595 gene locus_tag LOCUS_00840 2962 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 3066 3395 gene locus_tag LOCUS_00850 gene trxA 3066 3395 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747I5 protein_id gnl|my_center|LOCUS_00850 4465 3416 gene locus_tag LOCUS_00860 gene mreB-1 4465 3416 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_00860 4634 5545 gene locus_tag LOCUS_00870 4634 5545 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_00870 5625 7085 gene locus_tag LOCUS_00880 5625 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 7196 11290 gene locus_tag LOCUS_00890 7196 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 11290 12552 gene locus_tag LOCUS_00900 11290 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 12565 13239 gene locus_tag LOCUS_00910 12565 13239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 13424 13248 gene locus_tag LOCUS_00920 13424 13248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 14782 13493 gene locus_tag LOCUS_00930 14782 13493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 14986 14861 gene locus_tag LOCUS_00940 14986 14861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 >Feature sequence0006 7 405 gene locus_tag LOCUS_00950 7 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 539 3325 gene locus_tag LOCUS_00960 539 3325 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_00960 3325 4293 gene locus_tag LOCUS_00970 3325 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706538.1 protein_id gnl|my_center|LOCUS_00970 4409 5959 gene locus_tag LOCUS_00980 4409 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 6922 5966 gene locus_tag LOCUS_00990 6922 5966 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388127.1 protein_id gnl|my_center|LOCUS_00990 7033 8937 gene locus_tag LOCUS_01000 7033 8937 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61404 protein_id gnl|my_center|LOCUS_01000 9027 10253 gene locus_tag LOCUS_01010 9027 10253 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_01010 10253 11164 gene locus_tag LOCUS_01020 10253 11164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 11184 11645 gene locus_tag LOCUS_01030 11184 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890414.1 protein_id gnl|my_center|LOCUS_01030 12267 11671 gene locus_tag LOCUS_01040 gene mcbG 12267 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 protein_id gnl|my_center|LOCUS_01040 12391 13512 gene locus_tag LOCUS_01050 12391 13512 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_01050 13576 14085 gene locus_tag LOCUS_01060 13576 14085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404561.1 protein_id gnl|my_center|LOCUS_01060 14156 15037 gene locus_tag LOCUS_01070 gene desC 14156 15037 CDS product delta-9 desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142860.1 protein_id gnl|my_center|LOCUS_01070 >Feature sequence0007 154 708 gene locus_tag LOCUS_01080 154 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 3160 1031 gene locus_tag LOCUS_01090 3160 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 4850 3453 gene locus_tag LOCUS_01100 4850 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 5217 5672 gene locus_tag LOCUS_01110 5217 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 6089 5676 gene locus_tag LOCUS_01120 6089 5676 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070493.1 protein_id gnl|my_center|LOCUS_01120 7090 6086 gene locus_tag LOCUS_01130 7090 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 7160 8779 gene locus_tag LOCUS_01140 7160 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 8892 9770 gene locus_tag LOCUS_01150 8892 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 10874 9783 gene locus_tag LOCUS_01160 10874 9783 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640058.1 protein_id gnl|my_center|LOCUS_01160 11008 13281 gene locus_tag LOCUS_01170 11008 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 13263 14150 gene locus_tag LOCUS_01180 13263 14150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 >Feature sequence0008 1606 596 gene locus_tag LOCUS_01190 1606 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069660.1 protein_id gnl|my_center|LOCUS_01190 3069 1603 gene locus_tag LOCUS_01200 3069 1603 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKK9 protein_id gnl|my_center|LOCUS_01200 3755 3066 gene locus_tag LOCUS_01210 3755 3066 CDS product putative HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMG7 protein_id gnl|my_center|LOCUS_01210 4826 3840 gene locus_tag LOCUS_01220 4826 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 5217 4816 gene locus_tag LOCUS_01230 5217 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921331.1 protein_id gnl|my_center|LOCUS_01230 5684 5217 gene locus_tag LOCUS_01240 5684 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 7259 5685 gene locus_tag LOCUS_01250 7259 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877655.1 protein_id gnl|my_center|LOCUS_01250 7826 7263 gene locus_tag LOCUS_01260 7826 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 8755 7814 gene locus_tag LOCUS_01270 gene napH 8755 7814 CDS product ferredoxin-type protein NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44653 protein_id gnl|my_center|LOCUS_01270 9306 8752 gene locus_tag LOCUS_01280 9306 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 9809 9336 gene locus_tag LOCUS_01290 9809 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 10699 9806 gene locus_tag LOCUS_01300 10699 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 11280 10696 gene locus_tag LOCUS_01310 11280 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 <13864 11288 gene locus_tag LOCUS_01320 <13864 11288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141570.1:nitrate reductase catalytic subunit >Feature sequence0009 26 1249 gene locus_tag LOCUS_01330 26 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 1246 2154 gene locus_tag LOCUS_01340 gene hemF 1246 2154 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_01340 3005 2178 gene locus_tag LOCUS_01350 3005 2178 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122511.1 protein_id gnl|my_center|LOCUS_01350 3077 4759 gene locus_tag LOCUS_01360 3077 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 4892 5950 gene locus_tag LOCUS_01370 4892 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 5969 6730 gene locus_tag LOCUS_01380 gene truC 5969 6730 CDS product tRNA pseudouridine synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943781.1 protein_id gnl|my_center|LOCUS_01380 6815 8374 gene locus_tag LOCUS_01390 6815 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 8371 9912 gene locus_tag LOCUS_01400 8371 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 9914 11416 gene locus_tag LOCUS_01410 9914 11416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 11416 12024 gene locus_tag LOCUS_01420 11416 12024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 12168 12950 gene locus_tag LOCUS_01430 12168 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 >Feature sequence0010 679 191 gene locus_tag LOCUS_01440 679 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 1837 686 gene locus_tag LOCUS_01450 1837 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 2829 1846 gene locus_tag LOCUS_01460 2829 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 2822 3856 gene locus_tag LOCUS_01470 2822 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204911.1 protein_id gnl|my_center|LOCUS_01470 4520 4735 gene locus_tag LOCUS_01480 4520 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 4732 5454 gene locus_tag LOCUS_01490 4732 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 5458 6594 gene locus_tag LOCUS_01500 5458 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 7709 6567 gene locus_tag LOCUS_01510 7709 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 8536 7736 gene locus_tag LOCUS_01520 8536 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 9867 8932 gene locus_tag LOCUS_01530 9867 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 10907 9870 gene locus_tag LOCUS_01540 10907 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 10998 11948 gene locus_tag LOCUS_01550 10998 11948 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727077.1 protein_id gnl|my_center|LOCUS_01550 12165 11992 gene locus_tag LOCUS_01560 12165 11992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 12509 12204 gene locus_tag LOCUS_01570 12509 12204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 >Feature sequence0011 <1 1420 gene locus_tag LOCUS_01580 <1 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028428.1:AMP-dependent synthetase 1420 2382 gene locus_tag LOCUS_01590 1420 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 2413 3705 gene locus_tag LOCUS_01600 2413 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 4854 3718 gene locus_tag LOCUS_01610 4854 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_01610 4959 6095 gene locus_tag LOCUS_01620 4959 6095 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121141.1 protein_id gnl|my_center|LOCUS_01620 6127 6378 gene locus_tag LOCUS_01630 6127 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 6466 7044 gene locus_tag LOCUS_01640 6466 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 7318 7049 gene locus_tag LOCUS_01650 7318 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 8802 7315 gene locus_tag LOCUS_01660 8802 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 8941 9016 gene locus_tag LOCUS_t00010 8941 9016 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9341 9583 gene locus_tag LOCUS_01670 9341 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 9686 9907 gene locus_tag LOCUS_01680 9686 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 10880 9942 gene locus_tag LOCUS_01690 10880 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 >Feature sequence0012 2380 2012 gene locus_tag LOCUS_01700 2380 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626856.1 protein_id gnl|my_center|LOCUS_01700 2455 3366 gene locus_tag LOCUS_01710 2455 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 4424 3453 gene locus_tag LOCUS_01720 4424 3453 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108586.1 protein_id gnl|my_center|LOCUS_01720 5721 4447 gene locus_tag LOCUS_01730 5721 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 protein_id gnl|my_center|LOCUS_01730 6992 5709 gene locus_tag LOCUS_01740 6992 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 protein_id gnl|my_center|LOCUS_01740 7036 7632 gene locus_tag LOCUS_01750 7036 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 7642 8148 gene locus_tag LOCUS_01760 7642 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 8208 9917 gene locus_tag LOCUS_01770 8208 9917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 >Feature sequence0013 333 1007 gene locus_tag LOCUS_01780 333 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 1584 1066 gene locus_tag LOCUS_01790 1584 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 2057 1572 gene locus_tag LOCUS_01800 2057 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 2818 2216 gene locus_tag LOCUS_01810 2818 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 3590 2766 gene locus_tag LOCUS_01820 3590 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 4016 3660 gene locus_tag LOCUS_01830 4016 3660 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622997.1 protein_id gnl|my_center|LOCUS_01830 4321 4010 gene locus_tag LOCUS_01840 4321 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 6208 4487 gene locus_tag LOCUS_01850 6208 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 7238 6366 gene locus_tag LOCUS_01860 7238 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 7237 7959 gene locus_tag LOCUS_01870 7237 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 9702 7981 gene locus_tag LOCUS_01880 9702 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 11227 9839 gene locus_tag LOCUS_01890 11227 9839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 12345 11227 gene locus_tag LOCUS_01900 12345 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 >Feature sequence0014 735 3824 gene locus_tag LOCUS_01910 735 3824 CDS product bifunctional TolB-family protein/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_01910 3825 4928 gene locus_tag LOCUS_01920 3825 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 4925 6106 gene locus_tag LOCUS_01930 4925 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 6115 7008 gene locus_tag LOCUS_01940 6115 7008 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_01940 8109 7009 gene locus_tag LOCUS_01950 8109 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 9046 8138 gene locus_tag LOCUS_01960 9046 8138 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388429.1 protein_id gnl|my_center|LOCUS_01960 9377 9057 gene locus_tag LOCUS_01970 9377 9057 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDL4 protein_id gnl|my_center|LOCUS_01970 9648 9394 gene locus_tag LOCUS_01980 9648 9394 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_01980 9689 10459 gene locus_tag LOCUS_01990 9689 10459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 11315 10467 gene locus_tag LOCUS_02000 11315 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 <12183 11329 gene locus_tag LOCUS_02010 <12183 11329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UIA4:orotidine 5'-phosphate decarboxylase >Feature sequence0015 <1 717 gene locus_tag LOCUS_02020 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P34750:fimbrial assembly protein PilQ 728 2920 gene locus_tag LOCUS_02030 728 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 2920 3852 gene locus_tag LOCUS_02040 2920 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 3874 4590 gene locus_tag LOCUS_02050 3874 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 5532 4609 gene locus_tag LOCUS_02060 5532 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 6675 5572 gene locus_tag LOCUS_02070 6675 5572 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_02070 8189 6672 gene locus_tag LOCUS_02080 8189 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 9992 8229 gene locus_tag LOCUS_02090 9992 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 11875 10016 gene locus_tag LOCUS_02100 11875 10016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 >Feature sequence0016 1694 591 gene locus_tag LOCUS_02110 1694 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 2925 1996 gene locus_tag LOCUS_02120 2925 1996 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546520.1 protein_id gnl|my_center|LOCUS_02120 3629 2904 gene locus_tag LOCUS_02130 3629 2904 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037178.1 protein_id gnl|my_center|LOCUS_02130 3676 4263 gene locus_tag LOCUS_02140 3676 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 5254 4271 gene locus_tag LOCUS_02150 5254 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 6471 5266 gene locus_tag LOCUS_02160 6471 5266 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038470.1 protein_id gnl|my_center|LOCUS_02160 7886 6468 gene locus_tag LOCUS_02170 7886 6468 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038469.1 protein_id gnl|my_center|LOCUS_02170 7945 8970 gene locus_tag LOCUS_02180 7945 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 9016 9537 gene locus_tag LOCUS_02190 9016 9537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 9534 11039 gene locus_tag LOCUS_02200 9534 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141838.1 protein_id gnl|my_center|LOCUS_02200 >Feature sequence0017 557 60 gene locus_tag LOCUS_02210 557 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 1552 662 gene locus_tag LOCUS_02220 1552 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 2561 1620 gene locus_tag LOCUS_02230 2561 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 2756 3397 gene locus_tag LOCUS_02240 2756 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 4746 3571 gene locus_tag LOCUS_02250 4746 3571 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_02250 7143 4789 gene locus_tag LOCUS_02260 gene fadB 7143 4789 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486386.1 protein_id gnl|my_center|LOCUS_02260 7328 7750 gene locus_tag LOCUS_02270 7328 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 7747 8601 gene locus_tag LOCUS_02280 7747 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 10174 8618 gene locus_tag LOCUS_02290 10174 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 11043 10171 gene locus_tag LOCUS_02300 11043 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 >Feature sequence0018 391 741 gene locus_tag LOCUS_02310 391 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 711 1127 gene locus_tag LOCUS_02320 711 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 1127 2779 gene locus_tag LOCUS_02330 1127 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 2776 4287 gene locus_tag LOCUS_02340 2776 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 4300 6408 gene locus_tag LOCUS_02350 gene pmm 4300 6408 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_02350 7316 6363 gene locus_tag LOCUS_02360 7316 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 8842 7313 gene locus_tag LOCUS_02370 8842 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 9499 8906 gene locus_tag LOCUS_02380 gene prtI 9499 8906 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971658.1 protein_id gnl|my_center|LOCUS_02380 9684 9968 gene locus_tag LOCUS_02390 9684 9968 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DU1 protein_id gnl|my_center|LOCUS_02390 11357 9981 gene locus_tag LOCUS_02400 gene hutU 11357 9981 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81AC7 protein_id gnl|my_center|LOCUS_02400 >Feature sequence0019 588 7 gene locus_tag LOCUS_02410 588 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 666 1865 gene locus_tag LOCUS_02420 666 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 2848 1883 gene locus_tag LOCUS_02430 2848 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 3381 2845 gene locus_tag LOCUS_02440 3381 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 3479 4999 gene locus_tag LOCUS_02450 3479 4999 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388520.1 protein_id gnl|my_center|LOCUS_02450 6916 5012 gene locus_tag LOCUS_02460 6916 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 7551 7015 gene locus_tag LOCUS_02470 7551 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 7637 7981 gene locus_tag LOCUS_02480 7637 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 7981 8364 gene locus_tag LOCUS_02490 7981 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 8364 9743 gene locus_tag LOCUS_02500 8364 9743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 10064 9744 gene locus_tag LOCUS_02510 10064 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 >Feature sequence0020 1322 261 gene locus_tag LOCUS_02520 1322 261 CDS product coenzyme PQQ biosynthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024160.1 protein_id gnl|my_center|LOCUS_02520 2859 1330 gene locus_tag LOCUS_02530 2859 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 3083 2874 gene locus_tag LOCUS_02540 3083 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 2988 4181 gene locus_tag LOCUS_02550 2988 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 4420 4211 gene locus_tag LOCUS_02560 4420 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 5055 4891 gene locus_tag LOCUS_02570 5055 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 5084 5215 gene locus_tag LOCUS_02580 5084 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 5536 6141 gene locus_tag LOCUS_02590 5536 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 7660 6458 gene locus_tag LOCUS_02600 7660 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_02600 7947 7657 gene locus_tag LOCUS_02610 7947 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256481.1 protein_id gnl|my_center|LOCUS_02610 8051 10237 gene locus_tag LOCUS_02620 8051 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 10305 10754 gene locus_tag LOCUS_02630 10305 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 >Feature sequence0021 848 153 gene locus_tag LOCUS_02640 848 153 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090346.1 protein_id gnl|my_center|LOCUS_02640 954 1949 gene locus_tag LOCUS_02650 954 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 2027 3328 gene locus_tag LOCUS_02660 2027 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 3339 4313 gene locus_tag LOCUS_02670 3339 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 4391 4771 gene locus_tag LOCUS_02680 4391 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 4775 6382 gene locus_tag LOCUS_02690 gene glnG 4775 6382 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175753.1 protein_id gnl|my_center|LOCUS_02690 6379 9060 gene locus_tag LOCUS_02700 6379 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 9057 9515 gene locus_tag LOCUS_02710 9057 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 9546 10400 gene locus_tag LOCUS_02720 9546 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 >Feature sequence0022 1066 3123 gene locus_tag LOCUS_02730 1066 3123 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 protein_id gnl|my_center|LOCUS_02730 3187 3417 gene locus_tag LOCUS_02740 3187 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 5124 3433 gene locus_tag LOCUS_02750 gene sppA 5124 3433 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727691.1 protein_id gnl|my_center|LOCUS_02750 5194 5580 gene locus_tag LOCUS_02760 5194 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 5561 6274 gene locus_tag LOCUS_02770 5561 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 7052 6240 gene locus_tag LOCUS_02780 7052 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 7790 7059 gene locus_tag LOCUS_02790 7790 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 7870 8070 gene locus_tag LOCUS_02800 7870 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 8131 9285 gene locus_tag LOCUS_02810 8131 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 9316 9756 gene locus_tag LOCUS_02820 9316 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 10821 9760 gene locus_tag LOCUS_02830 10821 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 >Feature sequence0023 42 1013 gene locus_tag LOCUS_02840 42 1013 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701468.1 protein_id gnl|my_center|LOCUS_02840 1010 1768 gene locus_tag LOCUS_02850 1010 1768 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108120.1 protein_id gnl|my_center|LOCUS_02850 1794 2858 gene locus_tag LOCUS_02860 gene mqnC 1794 2858 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHE5 protein_id gnl|my_center|LOCUS_02860 2858 4267 gene locus_tag LOCUS_02870 2858 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 6230 4290 gene locus_tag LOCUS_02880 6230 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 7339 6227 gene locus_tag LOCUS_02890 gene aspC 7339 6227 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56232 protein_id gnl|my_center|LOCUS_02890 8464 7397 gene locus_tag LOCUS_02900 8464 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 8647 10617 gene locus_tag LOCUS_02910 8647 10617 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888825.1 protein_id gnl|my_center|LOCUS_02910 >Feature sequence0024 869 1705 gene locus_tag LOCUS_02920 869 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 2350 1712 gene locus_tag LOCUS_02930 2350 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 3860 2334 gene locus_tag LOCUS_02940 3860 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 4618 3857 gene locus_tag LOCUS_02950 4618 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 5109 4615 gene locus_tag LOCUS_02960 5109 4615 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_02960 5367 6263 gene locus_tag LOCUS_02970 5367 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 6260 9148 gene locus_tag LOCUS_02980 6260 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 <10792 9176 gene locus_tag LOCUS_02990 <10792 9176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87WW1:sulfate adenylyltransferase subunit 1 >Feature sequence0025 1386 25 gene locus_tag LOCUS_03000 1386 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 2951 1386 gene locus_tag LOCUS_03010 2951 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 3664 2948 gene locus_tag LOCUS_03020 3664 2948 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_03020 3844 4434 gene locus_tag LOCUS_03030 3844 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 6544 4448 gene locus_tag LOCUS_03040 6544 4448 CDS product fatty oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524570.1 protein_id gnl|my_center|LOCUS_03040 7767 6547 gene locus_tag LOCUS_03050 7767 6547 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_03050 7812 8270 gene locus_tag LOCUS_03060 7812 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 8298 9854 gene locus_tag LOCUS_03070 8298 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 <10638 9941 gene locus_tag LOCUS_03080 <10638 9941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVK1:RNA-splicing ligase RtcB >Feature sequence0026 1968 652 gene locus_tag LOCUS_03090 1968 652 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_03090 3508 1961 gene locus_tag LOCUS_03100 3508 1961 CDS product peptidase U62 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_03100 4648 3581 gene locus_tag LOCUS_03110 4648 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 5179 4724 gene locus_tag LOCUS_03120 5179 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 6168 5176 gene locus_tag LOCUS_03130 6168 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 6248 6757 gene locus_tag LOCUS_03140 6248 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 6754 8262 gene locus_tag LOCUS_03150 6754 8262 CDS product putative GMC-type oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMV7 protein_id gnl|my_center|LOCUS_03150 8760 8263 gene locus_tag LOCUS_03160 gene infC 8760 8263 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_03160 >Feature sequence0027 1720 332 gene locus_tag LOCUS_03170 1720 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 1791 2315 gene locus_tag LOCUS_03180 1791 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 2312 2752 gene locus_tag LOCUS_03190 2312 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 2865 3290 gene locus_tag LOCUS_03200 2865 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 3290 6091 gene locus_tag LOCUS_03210 3290 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 6091 6516 gene locus_tag LOCUS_03220 6091 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 6513 6695 gene locus_tag LOCUS_03230 6513 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 6686 7780 gene locus_tag LOCUS_03240 6686 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 7767 8267 gene locus_tag LOCUS_03250 7767 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 >Feature sequence0028 31 861 gene locus_tag LOCUS_03260 31 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 2434 1244 gene locus_tag LOCUS_03270 2434 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 3533 2478 gene locus_tag LOCUS_03280 3533 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 3583 5187 gene locus_tag LOCUS_03290 3583 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 5184 5849 gene locus_tag LOCUS_03300 5184 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 5843 7285 gene locus_tag LOCUS_03310 5843 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 7407 8765 gene locus_tag LOCUS_03320 7407 8765 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_03320 8752 9939 gene locus_tag LOCUS_03330 8752 9939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_03330 9936 10409 gene locus_tag LOCUS_03340 9936 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 >Feature sequence0029 415 771 gene locus_tag LOCUS_03350 415 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 768 1277 gene locus_tag LOCUS_03360 768 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 1288 2346 gene locus_tag LOCUS_03370 1288 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 3219 2353 gene locus_tag LOCUS_03380 3219 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 3277 5034 gene locus_tag LOCUS_03390 3277 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 5055 5777 gene locus_tag LOCUS_03400 5055 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 8406 5788 gene locus_tag LOCUS_03410 gene clpB 8406 5788 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFE9 protein_id gnl|my_center|LOCUS_03410 8508 9017 gene locus_tag LOCUS_03420 8508 9017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 9042 9449 gene locus_tag LOCUS_03430 9042 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 >Feature sequence0030 2325 427 gene locus_tag LOCUS_03440 2325 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 2447 4366 gene locus_tag LOCUS_03450 2447 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 4363 5742 gene locus_tag LOCUS_03460 4363 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 7264 5750 gene locus_tag LOCUS_03470 7264 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 7773 7264 gene locus_tag LOCUS_03480 7773 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 8468 7773 gene locus_tag LOCUS_03490 8468 7773 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897325.1 protein_id gnl|my_center|LOCUS_03490 9244 8465 gene locus_tag LOCUS_03500 9244 8465 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013356.1 protein_id gnl|my_center|LOCUS_03500 10224 9241 gene locus_tag LOCUS_03510 10224 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 >Feature sequence0031 996 2771 gene locus_tag LOCUS_03520 996 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 2792 4159 gene locus_tag LOCUS_03530 2792 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 4233 4865 gene locus_tag LOCUS_03540 4233 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 4962 5663 gene locus_tag LOCUS_03550 4962 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 7957 5678 gene locus_tag LOCUS_03560 7957 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 7938 8825 gene locus_tag LOCUS_03570 7938 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 8825 9658 gene locus_tag LOCUS_03580 8825 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 9711 10151 gene locus_tag LOCUS_03590 9711 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 >Feature sequence0032 3212 2415 gene locus_tag LOCUS_03600 3212 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 4084 3209 gene locus_tag LOCUS_03610 4084 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 4818 4096 gene locus_tag LOCUS_03620 4818 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 5520 4882 gene locus_tag LOCUS_03630 5520 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 6456 5524 gene locus_tag LOCUS_03640 6456 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 8231 6534 gene locus_tag LOCUS_03650 8231 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 9783 8239 gene locus_tag LOCUS_03660 9783 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence0033 <1 836 gene locus_tag LOCUS_03670 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72AZ9:fructose-1,6-bisphosphatase class 1 836 1864 gene locus_tag LOCUS_03680 836 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 2187 1828 gene locus_tag LOCUS_03690 2187 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 4331 2247 gene locus_tag LOCUS_03700 4331 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 5187 4351 gene locus_tag LOCUS_03710 5187 4351 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946217.1 protein_id gnl|my_center|LOCUS_03710 5888 5184 gene locus_tag LOCUS_03720 gene regX 5888 5184 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222396.1 protein_id gnl|my_center|LOCUS_03720 7941 5926 gene locus_tag LOCUS_03730 7941 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 7977 9056 gene locus_tag LOCUS_03740 7977 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 9110 10057 gene locus_tag LOCUS_03750 9110 10057 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123806.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence0034 1267 350 gene locus_tag LOCUS_03760 1267 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 1300 3270 gene locus_tag LOCUS_03770 1300 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 4632 3280 gene locus_tag LOCUS_03780 4632 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 5459 4653 gene locus_tag LOCUS_03790 5459 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 6361 5459 gene locus_tag LOCUS_03800 6361 5459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_03800 6490 7743 gene locus_tag LOCUS_03810 6490 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 7824 9188 gene locus_tag LOCUS_03820 gene plcC 7824 9188 CDS product phospholipase C 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIB1 protein_id gnl|my_center|LOCUS_03820 9501 9211 gene locus_tag LOCUS_03830 9501 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 >Feature sequence0035 <1 946 gene locus_tag LOCUS_03840 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944009.1:RND transporter 943 2118 gene locus_tag LOCUS_03850 943 2118 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_03850 2108 5254 gene locus_tag LOCUS_03860 gene czcA 2108 5254 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123153.1 protein_id gnl|my_center|LOCUS_03860 5335 5706 gene locus_tag LOCUS_03870 5335 5706 CDS product penicillinase repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225370.1 protein_id gnl|my_center|LOCUS_03870 5706 6680 gene locus_tag LOCUS_03880 5706 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 7192 6731 gene locus_tag LOCUS_03890 7192 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 7821 7219 gene locus_tag LOCUS_03900 7821 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_03900 8543 7836 gene locus_tag LOCUS_03910 8543 7836 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970465.1 protein_id gnl|my_center|LOCUS_03910 8725 9810 gene locus_tag LOCUS_03920 8725 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 9840 10151 gene locus_tag LOCUS_03930 9840 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence0036 <1 8619 gene locus_tag LOCUS_03940 <1 8619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226443.1:polyketide synthase 8657 9238 gene locus_tag LOCUS_03950 8657 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence0037 2735 1062 gene locus_tag LOCUS_03960 2735 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 3458 2796 gene locus_tag LOCUS_03970 3458 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 3836 3462 gene locus_tag LOCUS_03980 3836 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 3964 5169 gene locus_tag LOCUS_03990 gene add 3964 5169 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403444.1 protein_id gnl|my_center|LOCUS_03990 5376 5182 gene locus_tag LOCUS_04000 5376 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 7574 5376 gene locus_tag LOCUS_04010 7574 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 9305 7623 gene locus_tag LOCUS_04020 9305 7623 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence0038 1156 2502 gene locus_tag LOCUS_04030 1156 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 3357 2506 gene locus_tag LOCUS_04040 3357 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 3440 5410 gene locus_tag LOCUS_04050 gene metG 3440 5410 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AE2 protein_id gnl|my_center|LOCUS_04050 5535 7163 gene locus_tag LOCUS_04060 5535 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 7246 8238 gene locus_tag LOCUS_04070 7246 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 8286 9863 gene locus_tag LOCUS_04080 8286 9863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 >Feature sequence0039 908 2452 gene locus_tag LOCUS_04090 908 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 3647 2679 gene locus_tag LOCUS_04100 3647 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3690 4508 gene locus_tag LOCUS_04110 gene htpX 3690 4508 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKM8 protein_id gnl|my_center|LOCUS_04110 4749 6329 gene locus_tag LOCUS_04120 4749 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 6404 8779 gene locus_tag LOCUS_04130 gene pheT 6404 8779 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ9 protein_id gnl|my_center|LOCUS_04130 9685 8825 gene locus_tag LOCUS_04140 9685 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 >Feature sequence0040 2432 324 gene locus_tag LOCUS_04150 2432 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 3529 2432 gene locus_tag LOCUS_04160 3529 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 3578 5128 gene locus_tag LOCUS_04170 3578 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 5427 6908 gene locus_tag LOCUS_04180 5427 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 7962 6874 gene locus_tag LOCUS_04190 gene yhaZ 7962 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07541 protein_id gnl|my_center|LOCUS_04190 8738 7950 gene locus_tag LOCUS_04200 8738 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 >Feature sequence0041 365 1192 gene locus_tag LOCUS_04210 gene selD 365 1192 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI12 protein_id gnl|my_center|LOCUS_04210 1193 2530 gene locus_tag LOCUS_04220 1193 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 2539 2955 gene locus_tag LOCUS_04230 2539 2955 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977376.1 protein_id gnl|my_center|LOCUS_04230 3325 3056 gene locus_tag LOCUS_04240 3325 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 3270 3860 gene locus_tag LOCUS_04250 gene kptA 3270 3860 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0B5 protein_id gnl|my_center|LOCUS_04250 4721 4104 gene locus_tag LOCUS_04260 4721 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 5241 4711 gene locus_tag LOCUS_04270 5241 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 5310 6041 gene locus_tag LOCUS_04280 5310 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 6090 6764 gene locus_tag LOCUS_04290 6090 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 6761 7630 gene locus_tag LOCUS_04300 6761 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 8029 7634 gene locus_tag LOCUS_04310 8029 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 >Feature sequence0042 2349 1288 gene locus_tag LOCUS_04320 2349 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 3273 2368 gene locus_tag LOCUS_04330 gene xerC 3273 2368 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFZ8 protein_id gnl|my_center|LOCUS_04330 3319 6078 gene locus_tag LOCUS_04340 gene topA 3319 6078 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV5 protein_id gnl|my_center|LOCUS_04340 6369 6082 gene locus_tag LOCUS_04350 6369 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 7339 6356 gene locus_tag LOCUS_04360 7339 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 8455 7397 gene locus_tag LOCUS_04370 8455 7397 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943187.1 protein_id gnl|my_center|LOCUS_04370 8918 8574 gene locus_tag LOCUS_04380 8918 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence0043 <1 1022 gene locus_tag LOCUS_04390 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209885.1:anaerobic sulfatase maturase 1032 2480 gene locus_tag LOCUS_04400 1032 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 2477 3277 gene locus_tag LOCUS_04410 2477 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 4318 3281 gene locus_tag LOCUS_04420 4318 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 4374 5900 gene locus_tag LOCUS_04430 gene crtU 4374 5900 CDS product isorenieratene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225919.1 protein_id gnl|my_center|LOCUS_04430 6009 6821 gene locus_tag LOCUS_04440 6009 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 7041 6802 gene locus_tag LOCUS_04450 7041 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 6965 7792 gene locus_tag LOCUS_04460 6965 7792 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence0044 2219 1293 gene locus_tag LOCUS_04470 2219 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 3015 2242 gene locus_tag LOCUS_04480 3015 2242 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969842.1 protein_id gnl|my_center|LOCUS_04480 3076 3711 gene locus_tag LOCUS_04490 3076 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 4457 3774 gene locus_tag LOCUS_04500 4457 3774 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_04500 4600 5421 gene locus_tag LOCUS_04510 4600 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 5757 6683 gene locus_tag LOCUS_04520 5757 6683 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083062.1 protein_id gnl|my_center|LOCUS_04520 7588 6710 gene locus_tag LOCUS_04530 7588 6710 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530131.1 protein_id gnl|my_center|LOCUS_04530 7587 7805 gene locus_tag LOCUS_04540 7587 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 8515 7727 gene locus_tag LOCUS_04550 8515 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 8636 9136 gene locus_tag LOCUS_04560 8636 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence0045 459 1166 gene locus_tag LOCUS_04570 459 1166 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_04570 1281 1940 gene locus_tag LOCUS_04580 1281 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 2930 1941 gene locus_tag LOCUS_04590 2930 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 3522 3028 gene locus_tag LOCUS_04600 3522 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 3553 5151 gene locus_tag LOCUS_04610 3553 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5066 6844 gene locus_tag LOCUS_04620 5066 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 7635 6859 gene locus_tag LOCUS_04630 7635 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 7682 8932 gene locus_tag LOCUS_04640 7682 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 9338 8979 gene locus_tag LOCUS_04650 9338 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence0046 2572 1439 gene locus_tag LOCUS_04660 gene wecB 2572 1439 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q329W5 protein_id gnl|my_center|LOCUS_04660 4128 2569 gene locus_tag LOCUS_04670 4128 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 5042 4125 gene locus_tag LOCUS_04680 5042 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 5888 5061 gene locus_tag LOCUS_04690 5888 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 7424 5985 gene locus_tag LOCUS_04700 7424 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 <9308 7421 gene locus_tag LOCUS_04710 <9308 7421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000147064.1:chain-length determining protein >Feature sequence0047 2 1249 gene locus_tag LOCUS_04720 2 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 1246 2481 gene locus_tag LOCUS_04730 gene sbcD 1246 2481 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMP7 protein_id gnl|my_center|LOCUS_04730 2478 5663 gene locus_tag LOCUS_04740 gene sbcC 2478 5663 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSI6 protein_id gnl|my_center|LOCUS_04740 5665 6405 gene locus_tag LOCUS_04750 5665 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 6402 8162 gene locus_tag LOCUS_04760 6402 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 <9298 8164 gene locus_tag LOCUS_04770 <9298 8164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405234.1:alkaline phosphatase family protein >Feature sequence0048 48 629 gene locus_tag LOCUS_04780 48 629 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087753.1 protein_id gnl|my_center|LOCUS_04780 666 1697 gene locus_tag LOCUS_04790 gene rsgA 666 1697 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFS8 protein_id gnl|my_center|LOCUS_04790 1773 5132 gene locus_tag LOCUS_04800 gene recC 1773 5132 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CY8 protein_id gnl|my_center|LOCUS_04800 5132 8779 gene locus_tag LOCUS_04810 gene recB 5132 8779 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDI1 protein_id gnl|my_center|LOCUS_04810 >Feature sequence0049 835 263 gene locus_tag LOCUS_04820 835 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 1853 885 gene locus_tag LOCUS_04830 1853 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 1898 2161 gene locus_tag LOCUS_04840 1898 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 2158 2979 gene locus_tag LOCUS_04850 2158 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 3711 2980 gene locus_tag LOCUS_04860 3711 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 4236 3721 gene locus_tag LOCUS_04870 4236 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 5034 4552 gene locus_tag LOCUS_04880 5034 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 5522 5094 gene locus_tag LOCUS_04890 5522 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 5572 6348 gene locus_tag LOCUS_04900 5572 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04900 6376 6765 gene locus_tag LOCUS_04910 6376 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04910 7355 6795 gene locus_tag LOCUS_04920 7355 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 7731 7375 gene locus_tag LOCUS_04930 7731 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence0050 <1 2920 gene locus_tag LOCUS_04940 <1 2920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262113.1:ATPase AAA 2923 3756 gene locus_tag LOCUS_04950 2923 3756 CDS product potassium transporter KefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262214.1 protein_id gnl|my_center|LOCUS_04950 4635 3769 gene locus_tag LOCUS_04960 4635 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 4798 5508 gene locus_tag LOCUS_04970 4798 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 6056 5580 gene locus_tag LOCUS_04980 6056 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 7018 6056 gene locus_tag LOCUS_04990 7018 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 8066 7095 gene locus_tag LOCUS_05000 8066 7095 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392508.1 protein_id gnl|my_center|LOCUS_05000 9085 8063 gene locus_tag LOCUS_05010 9085 8063 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392508.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence0051 <1 1535 gene locus_tag LOCUS_05020 <1 1535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein 2130 1540 gene locus_tag LOCUS_05030 2130 1540 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6D8 protein_id gnl|my_center|LOCUS_05030 3203 2130 gene locus_tag LOCUS_05040 3203 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 4148 3246 gene locus_tag LOCUS_05050 4148 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 4288 5757 gene locus_tag LOCUS_05060 4288 5757 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_05060 5873 6271 gene locus_tag LOCUS_05070 5873 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 6329 7690 gene locus_tag LOCUS_05080 6329 7690 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_05080 7707 8468 gene locus_tag LOCUS_05090 gene mtap 7707 8468 CDS product 5'-methylthioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404886.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence0052 50 1303 gene locus_tag LOCUS_05100 50 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 1407 3044 gene locus_tag LOCUS_05110 1407 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 3049 3777 gene locus_tag LOCUS_05120 3049 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3792 4805 gene locus_tag LOCUS_05130 3792 4805 CDS product peptidyl-arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121927.1 protein_id gnl|my_center|LOCUS_05130 5038 4802 gene locus_tag LOCUS_05140 gene rpmB 5038 4802 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG62 protein_id gnl|my_center|LOCUS_05140 5397 5107 gene locus_tag LOCUS_05150 5397 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 5314 5889 gene locus_tag LOCUS_05160 5314 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 6105 5899 gene locus_tag LOCUS_05170 6105 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 6953 6219 gene locus_tag LOCUS_05180 6953 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 6990 7772 gene locus_tag LOCUS_05190 gene fadB 6990 7772 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087728.1 protein_id gnl|my_center|LOCUS_05190 7769 8995 gene locus_tag LOCUS_05200 7769 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence0053 3 1124 gene locus_tag LOCUS_05210 3 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 2889 1126 gene locus_tag LOCUS_05220 2889 1126 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_05220 4625 2886 gene locus_tag LOCUS_05230 4625 2886 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_05230 4957 4622 gene locus_tag LOCUS_05240 4957 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 5333 4950 gene locus_tag LOCUS_05250 5333 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 5945 5334 gene locus_tag LOCUS_05260 5945 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 6115 6933 gene locus_tag LOCUS_05270 6115 6933 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_05270 6930 8435 gene locus_tag LOCUS_05280 6930 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 8467 8628 gene locus_tag LOCUS_05290 8467 8628 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970082.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence0054 2169 715 gene locus_tag LOCUS_05300 2169 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3509 2172 gene locus_tag LOCUS_05310 3509 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 4038 3559 gene locus_tag LOCUS_05320 4038 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 5949 4075 gene locus_tag LOCUS_05330 5949 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 6340 6014 gene locus_tag LOCUS_05340 6340 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 6370 6918 gene locus_tag LOCUS_05350 6370 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 6915 8411 gene locus_tag LOCUS_05360 6915 8411 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence0055 <1 3138 gene locus_tag LOCUS_05370 <1 3138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001015947.1:peptidase inhibitor 3546 3148 gene locus_tag LOCUS_05380 3546 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 3591 4418 gene locus_tag LOCUS_05390 gene map 3591 4418 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX4 protein_id gnl|my_center|LOCUS_05390 5077 4445 gene locus_tag LOCUS_05400 5077 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 5531 5091 gene locus_tag LOCUS_05410 gene dksA 5531 5091 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG2 protein_id gnl|my_center|LOCUS_05410 5702 6667 gene locus_tag LOCUS_05420 5702 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 6712 7521 gene locus_tag LOCUS_05430 6712 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 8632 7526 gene locus_tag LOCUS_05440 8632 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence0056 1177 431 gene locus_tag LOCUS_05450 1177 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 1322 2194 gene locus_tag LOCUS_05460 1322 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2293 3585 gene locus_tag LOCUS_05470 gene glmU 2293 3585 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMC5 protein_id gnl|my_center|LOCUS_05470 3582 5864 gene locus_tag LOCUS_05480 3582 5864 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817187.1 protein_id gnl|my_center|LOCUS_05480 5950 7428 gene locus_tag LOCUS_05490 5950 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 >Feature sequence0057 92 1468 gene locus_tag LOCUS_05500 92 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 1530 1973 gene locus_tag LOCUS_05510 gene elaA 1530 1973 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070867.1 protein_id gnl|my_center|LOCUS_05510 2033 3196 gene locus_tag LOCUS_05520 2033 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 3320 3520 gene locus_tag LOCUS_05530 3320 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 3542 4582 gene locus_tag LOCUS_05540 3542 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 5542 4586 gene locus_tag LOCUS_05550 5542 4586 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_05550 5690 6016 gene locus_tag LOCUS_05560 5690 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 6085 6567 gene locus_tag LOCUS_05570 6085 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 6858 6601 gene locus_tag LOCUS_05580 6858 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 8418 6925 gene locus_tag LOCUS_05590 8418 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 8678 8415 gene locus_tag LOCUS_05600 8678 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence0058 929 93 gene locus_tag LOCUS_05610 929 93 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932324.1 protein_id gnl|my_center|LOCUS_05610 1666 932 gene locus_tag LOCUS_05620 1666 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 1650 2969 gene locus_tag LOCUS_05630 1650 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 2975 3988 gene locus_tag LOCUS_05640 2975 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 5384 3936 gene locus_tag LOCUS_05650 5384 3936 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_05650 6495 5467 gene locus_tag LOCUS_05660 6495 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 7759 6779 gene locus_tag LOCUS_05670 7759 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence0059 <1 982 gene locus_tag LOCUS_05680 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454913.1:sodium:glutamate symporter 979 1713 gene locus_tag LOCUS_05690 979 1713 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402807.1 protein_id gnl|my_center|LOCUS_05690 1715 2635 gene locus_tag LOCUS_05700 1715 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 3406 2642 gene locus_tag LOCUS_05710 3406 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 4058 3465 gene locus_tag LOCUS_05720 4058 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 4156 5196 gene locus_tag LOCUS_05730 4156 5196 CDS product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338461.1 protein_id gnl|my_center|LOCUS_05730 5196 5924 gene locus_tag LOCUS_05740 gene menG 5196 5924 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4C2 protein_id gnl|my_center|LOCUS_05740 5921 6487 gene locus_tag LOCUS_05750 5921 6487 CDS product phenolic acid decarboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_05750 6484 7302 gene locus_tag LOCUS_05760 6484 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05760 7389 7634 gene locus_tag LOCUS_05770 7389 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05770 >Feature sequence0060 739 407 gene locus_tag LOCUS_05780 739 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 738 3308 gene locus_tag LOCUS_05790 738 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 3354 4724 gene locus_tag LOCUS_05800 3354 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 4780 6360 gene locus_tag LOCUS_05810 4780 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 6423 6499 gene locus_tag LOCUS_t00020 6423 6499 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8056 6434 gene locus_tag LOCUS_05820 8056 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence0061 2872 1196 gene locus_tag LOCUS_05830 2872 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2871 4583 gene locus_tag LOCUS_05840 2871 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 6948 4591 gene locus_tag LOCUS_05850 6948 4591 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458990.1 protein_id gnl|my_center|LOCUS_05850 7082 7555 gene locus_tag LOCUS_05860 7082 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence0062 1539 3623 gene locus_tag LOCUS_05870 1539 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 3633 4370 gene locus_tag LOCUS_05880 3633 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 4560 4817 gene locus_tag LOCUS_05890 4560 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 4837 6270 gene locus_tag LOCUS_05900 4837 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 6267 7253 gene locus_tag LOCUS_05910 6267 7253 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120210.1 protein_id gnl|my_center|LOCUS_05910 >Feature sequence0063 308 1666 gene locus_tag LOCUS_05920 gene purF 308 1666 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU6 protein_id gnl|my_center|LOCUS_05920 4618 1682 gene locus_tag LOCUS_05930 4618 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 4689 6659 gene locus_tag LOCUS_05940 4689 6659 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791176.1 protein_id gnl|my_center|LOCUS_05940 7972 6638 gene locus_tag LOCUS_05950 7972 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05950 7952 8125 gene locus_tag LOCUS_05960 7952 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 <8597 8065 gene locus_tag LOCUS_05970 <8597 8065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q036L0:3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ >Feature sequence0064 <1 636 gene locus_tag LOCUS_05980 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015886858.1:multicopper oxidase 641 1078 gene locus_tag LOCUS_05990 641 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 3049 1097 gene locus_tag LOCUS_06000 3049 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 3156 3668 gene locus_tag LOCUS_06010 3156 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895908.1 protein_id gnl|my_center|LOCUS_06010 4718 3687 gene locus_tag LOCUS_06020 4718 3687 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_06020 6040 4715 gene locus_tag LOCUS_06030 6040 4715 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_06030 6112 6495 gene locus_tag LOCUS_06040 6112 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 7782 6505 gene locus_tag LOCUS_06050 7782 6505 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704045.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence0065 1065 1751 gene locus_tag LOCUS_06060 1065 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 1748 3178 gene locus_tag LOCUS_06070 1748 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 3175 3462 gene locus_tag LOCUS_06080 3175 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 3532 4005 gene locus_tag LOCUS_06090 gene rpoE 3532 4005 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229943.1 protein_id gnl|my_center|LOCUS_06090 4002 4709 gene locus_tag LOCUS_06100 4002 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4711 6849 gene locus_tag LOCUS_06110 4711 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 7267 6851 gene locus_tag LOCUS_06120 7267 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 7710 7267 gene locus_tag LOCUS_06130 7710 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 >Feature sequence0066 377 2284 gene locus_tag LOCUS_06140 377 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 4600 2285 gene locus_tag LOCUS_06150 4600 2285 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972413.1 protein_id gnl|my_center|LOCUS_06150 5575 4601 gene locus_tag LOCUS_06160 5575 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196302.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06160 6483 5575 gene locus_tag LOCUS_06170 6483 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189723.1 protein_id gnl|my_center|LOCUS_06170 7644 6487 gene locus_tag LOCUS_06180 gene acd 7644 6487 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972410.1 protein_id gnl|my_center|LOCUS_06180 7903 7658 gene locus_tag LOCUS_06190 7903 7658 CDS product aminoacyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHM9 protein_id gnl|my_center|LOCUS_06190 >Feature sequence0067 1768 392 gene locus_tag LOCUS_06200 1768 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 3624 1765 gene locus_tag LOCUS_06210 3624 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4766 3621 gene locus_tag LOCUS_06220 4766 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 5210 4782 gene locus_tag LOCUS_06230 5210 4782 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868197.1 protein_id gnl|my_center|LOCUS_06230 5833 5237 gene locus_tag LOCUS_06240 5833 5237 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971839.1 protein_id gnl|my_center|LOCUS_06240 6700 5972 gene locus_tag LOCUS_06250 6700 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 7953 6697 gene locus_tag LOCUS_06260 7953 6697 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731374.1 protein_id gnl|my_center|LOCUS_06260 >Feature sequence0068 891 100 gene locus_tag LOCUS_06270 gene fdhD 891 100 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R194 protein_id gnl|my_center|LOCUS_06270 1022 3349 gene locus_tag LOCUS_06280 gene recQ 1022 3349 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122787.1 protein_id gnl|my_center|LOCUS_06280 3381 5804 gene locus_tag LOCUS_06290 3381 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 6552 5791 gene locus_tag LOCUS_06300 6552 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 6816 7049 gene locus_tag LOCUS_06310 6816 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 7789 7052 gene locus_tag LOCUS_06320 7789 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415118.1 protein_id gnl|my_center|LOCUS_06320 8392 7793 gene locus_tag LOCUS_06330 8392 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776424.1 protein_id gnl|my_center|LOCUS_06330 >Feature sequence0069 1370 2245 gene locus_tag LOCUS_06340 1370 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887428.1 protein_id gnl|my_center|LOCUS_06340 3078 2257 gene locus_tag LOCUS_06350 3078 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3174 3881 gene locus_tag LOCUS_06360 3174 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 3878 5581 gene locus_tag LOCUS_06370 3878 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 5591 6562 gene locus_tag LOCUS_06380 5591 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 6573 7334 gene locus_tag LOCUS_06390 6573 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 7429 8121 gene locus_tag LOCUS_06400 7429 8121 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226433.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence0070 <1 1023 gene locus_tag LOCUS_06410 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P54980:phytoene desaturase (neurosporene-forming) 1047 2240 gene locus_tag LOCUS_06420 1047 2240 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707147.1 protein_id gnl|my_center|LOCUS_06420 2244 2969 gene locus_tag LOCUS_06430 gene fabG 2244 2969 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132504.1 protein_id gnl|my_center|LOCUS_06430 3062 3355 gene locus_tag LOCUS_06440 3062 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4989 3382 gene locus_tag LOCUS_06450 4989 3382 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173104.1 protein_id gnl|my_center|LOCUS_06450 5204 4986 gene locus_tag LOCUS_06460 5204 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5670 5197 gene locus_tag LOCUS_06470 5670 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 <8288 5661 gene locus_tag LOCUS_06480 <8288 5661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964344.1:acyl-CoA--6-aminopenicillanic acid acyl-transferase >Feature sequence0071 637 47 gene locus_tag LOCUS_06490 637 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 697 2088 gene locus_tag LOCUS_06500 697 2088 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403878.1 protein_id gnl|my_center|LOCUS_06500 2085 3251 gene locus_tag LOCUS_06510 2085 3251 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902843.1 protein_id gnl|my_center|LOCUS_06510 3244 4266 gene locus_tag LOCUS_06520 3244 4266 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803855.1 protein_id gnl|my_center|LOCUS_06520 4515 4826 gene locus_tag LOCUS_06530 4515 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 4823 7444 gene locus_tag LOCUS_06540 4823 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 7441 7791 gene locus_tag LOCUS_06550 7441 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence0072 1101 151 gene locus_tag LOCUS_06560 1101 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 1100 1423 gene locus_tag LOCUS_06570 1100 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 1484 1732 gene locus_tag LOCUS_06580 1484 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 1749 2129 gene locus_tag LOCUS_06590 1749 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 protein_id gnl|my_center|LOCUS_06590 2596 2126 gene locus_tag LOCUS_06600 2596 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 2848 3156 gene locus_tag LOCUS_06610 2848 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 3236 5002 gene locus_tag LOCUS_06620 3236 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 5074 5379 gene locus_tag LOCUS_06630 5074 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 5890 5384 gene locus_tag LOCUS_06640 5890 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 5922 7112 gene locus_tag LOCUS_06650 5922 7112 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329168.1 protein_id gnl|my_center|LOCUS_06650 7099 7617 gene locus_tag LOCUS_06660 7099 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 7661 8017 gene locus_tag LOCUS_06670 7661 8017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence0073 800 1486 gene locus_tag LOCUS_06680 800 1486 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230619.1 protein_id gnl|my_center|LOCUS_06680 1483 3516 gene locus_tag LOCUS_06690 1483 3516 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_06690 3568 4437 gene locus_tag LOCUS_06700 3568 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 6318 4462 gene locus_tag LOCUS_06710 6318 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 6971 6321 gene locus_tag LOCUS_06720 6971 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 7516 7154 gene locus_tag LOCUS_06730 7516 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 7631 7912 gene locus_tag LOCUS_06740 7631 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence0074 311 1036 gene locus_tag LOCUS_06750 311 1036 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074690.1 protein_id gnl|my_center|LOCUS_06750 1036 2460 gene locus_tag LOCUS_06760 1036 2460 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018377.1 protein_id gnl|my_center|LOCUS_06760 2457 3431 gene locus_tag LOCUS_06770 2457 3431 CDS product radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103978.1 protein_id gnl|my_center|LOCUS_06770 4348 3563 gene locus_tag LOCUS_06780 4348 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 5148 4417 gene locus_tag LOCUS_06790 5148 4417 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_06790 6374 5145 gene locus_tag LOCUS_06800 6374 5145 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016502.1 protein_id gnl|my_center|LOCUS_06800 7573 6374 gene locus_tag LOCUS_06810 7573 6374 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228946.1 protein_id gnl|my_center|LOCUS_06810 <8165 7570 gene locus_tag LOCUS_06820 <8165 7570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482754.1:ABC transporter ATP-binding protein >Feature sequence0075 202 1470 gene locus_tag LOCUS_06830 202 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 2293 1493 gene locus_tag LOCUS_06840 gene lgt 2293 1493 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1A4 protein_id gnl|my_center|LOCUS_06840 2854 2297 gene locus_tag LOCUS_06850 gene lspA 2854 2297 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Y0 protein_id gnl|my_center|LOCUS_06850 3426 2851 gene locus_tag LOCUS_06860 gene lspA 3426 2851 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Y0 protein_id gnl|my_center|LOCUS_06860 3559 5280 gene locus_tag LOCUS_06870 3559 5280 CDS product electron-transferring-flavoprotein dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_06870 5298 5738 gene locus_tag LOCUS_06880 5298 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 5678 6913 gene locus_tag LOCUS_06890 5678 6913 CDS product CDP-4-keto-6-deoxy-D-glucose-3-dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_06890 6906 7835 gene locus_tag LOCUS_06900 6906 7835 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence0076 507 917 gene locus_tag LOCUS_06910 507 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3817 1274 gene locus_tag LOCUS_06920 3817 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 3967 4506 gene locus_tag LOCUS_06930 3967 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 4571 5440 gene locus_tag LOCUS_06940 gene yeaC 4571 5440 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_06940 5437 6390 gene locus_tag LOCUS_06950 5437 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880980.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence0077 354 76 gene locus_tag LOCUS_06960 354 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 475 1005 gene locus_tag LOCUS_06970 475 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 1758 1006 gene locus_tag LOCUS_06980 1758 1006 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975613.1 protein_id gnl|my_center|LOCUS_06980 2408 1761 gene locus_tag LOCUS_06990 2408 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2447 3322 gene locus_tag LOCUS_07000 2447 3322 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113474.1 protein_id gnl|my_center|LOCUS_07000 3427 4647 gene locus_tag LOCUS_07010 3427 4647 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_07010 4644 5891 gene locus_tag LOCUS_07020 4644 5891 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_07020 5900 6616 gene locus_tag LOCUS_07030 5900 6616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence0078 2810 819 gene locus_tag LOCUS_07040 2810 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3505 2807 gene locus_tag LOCUS_07050 3505 2807 CDS product low-co2 inducible protein lcib inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544972.1 protein_id gnl|my_center|LOCUS_07050 3523 5352 gene locus_tag LOCUS_07060 3523 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 6744 5341 gene locus_tag LOCUS_07070 6744 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 6854 7603 gene locus_tag LOCUS_07080 6854 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence0079 1230 22 gene locus_tag LOCUS_07090 1230 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_07090 1334 4555 gene locus_tag LOCUS_07100 1334 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 5618 4578 gene locus_tag LOCUS_07110 5618 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 6617 5682 gene locus_tag LOCUS_07120 6617 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 6642 7355 gene locus_tag LOCUS_07130 6642 7355 CDS product peptidase C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461522.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence0080 207 995 gene locus_tag LOCUS_07140 207 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 1000 1716 gene locus_tag LOCUS_07150 1000 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 1716 2747 gene locus_tag LOCUS_07160 1716 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3572 2754 gene locus_tag LOCUS_07170 3572 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 5596 3569 gene locus_tag LOCUS_07180 5596 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 5616 6332 gene locus_tag LOCUS_07190 5616 6332 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence0081 865 1941 gene locus_tag LOCUS_07200 865 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 2071 3357 gene locus_tag LOCUS_07210 2071 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 3354 4460 gene locus_tag LOCUS_07220 3354 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 5850 4393 gene locus_tag LOCUS_07230 5850 4393 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_07230 6324 5851 gene locus_tag LOCUS_07240 gene msrB 6324 5851 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGX7 protein_id gnl|my_center|LOCUS_07240 6953 6321 gene locus_tag LOCUS_07250 gene eda 6953 6321 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339194.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence0082 156 347 gene locus_tag LOCUS_07260 156 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 352 2160 gene locus_tag LOCUS_07270 352 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 2275 2610 gene locus_tag LOCUS_07280 2275 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 2808 3509 gene locus_tag LOCUS_07290 2808 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 4711 3533 gene locus_tag LOCUS_07300 4711 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083321.1 protein_id gnl|my_center|LOCUS_07300 5581 5186 gene locus_tag LOCUS_07310 5581 5186 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120292.1 protein_id gnl|my_center|LOCUS_07310 7551 5617 gene locus_tag LOCUS_07320 7551 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence0083 1015 2382 gene locus_tag LOCUS_07330 1015 2382 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974998.1 protein_id gnl|my_center|LOCUS_07330 2777 2388 gene locus_tag LOCUS_07340 2777 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 3724 2795 gene locus_tag LOCUS_07350 3724 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 4605 3772 gene locus_tag LOCUS_07360 gene hmgR 4605 3772 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072059.1 protein_id gnl|my_center|LOCUS_07360 5092 4613 gene locus_tag LOCUS_07370 5092 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 5091 7112 gene locus_tag LOCUS_07380 5091 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence0084 1020 1853 gene locus_tag LOCUS_07390 1020 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 1870 2760 gene locus_tag LOCUS_07400 1870 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 2764 4641 gene locus_tag LOCUS_07410 2764 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 4731 7889 gene locus_tag LOCUS_07420 4731 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence0085 1702 800 gene locus_tag LOCUS_07430 1702 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2033 1800 gene locus_tag LOCUS_07440 2033 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2129 3322 gene locus_tag LOCUS_07450 2129 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 3369 3554 gene locus_tag LOCUS_07460 3369 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 3697 3906 gene locus_tag LOCUS_07470 3697 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3925 5721 gene locus_tag LOCUS_07480 3925 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 5718 6866 gene locus_tag LOCUS_07490 5718 6866 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938566.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence0086 318 1385 gene locus_tag LOCUS_07500 318 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 1382 2830 gene locus_tag LOCUS_07510 1382 2830 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_07510 2880 4217 gene locus_tag LOCUS_07520 2880 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4661 4221 gene locus_tag LOCUS_07530 4661 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 4728 5231 gene locus_tag LOCUS_07540 4728 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 5235 6998 gene locus_tag LOCUS_07550 5235 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 7162 7347 gene locus_tag LOCUS_07560 7162 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence0087 811 92 gene locus_tag LOCUS_07570 811 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 913 2412 gene locus_tag LOCUS_07580 913 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 2406 3347 gene locus_tag LOCUS_07590 2406 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4644 3364 gene locus_tag LOCUS_07600 4644 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 4701 5246 gene locus_tag LOCUS_07610 4701 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 5243 6985 gene locus_tag LOCUS_07620 5243 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence0088 1493 885 gene locus_tag LOCUS_07630 1493 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 2059 1490 gene locus_tag LOCUS_07640 2059 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3613 2069 gene locus_tag LOCUS_07650 3613 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 3735 5645 gene locus_tag LOCUS_07660 3735 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 5774 6343 gene locus_tag LOCUS_07670 5774 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 7513 6359 gene locus_tag LOCUS_07680 7513 6359 CDS product calcineurin-like phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551577.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence0089 190 1122 gene locus_tag LOCUS_07690 190 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 1158 1811 gene locus_tag LOCUS_07700 1158 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 1808 2350 gene locus_tag LOCUS_07710 1808 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 2347 4029 gene locus_tag LOCUS_07720 2347 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 4716 4030 gene locus_tag LOCUS_07730 4716 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 4816 7014 gene locus_tag LOCUS_07740 4816 7014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 7249 7016 gene locus_tag LOCUS_07750 7249 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence0090 429 2534 gene locus_tag LOCUS_07760 429 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2531 3325 gene locus_tag LOCUS_07770 2531 3325 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887993.1 protein_id gnl|my_center|LOCUS_07770 3322 3867 gene locus_tag LOCUS_07780 3322 3867 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 protein_id gnl|my_center|LOCUS_07780 3864 6002 gene locus_tag LOCUS_07790 3864 6002 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_07790 6081 7541 gene locus_tag LOCUS_07800 6081 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence0091 <1 1838 gene locus_tag LOCUS_07810 <1 1838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028372.1:peptidase 1926 3122 gene locus_tag LOCUS_07820 1926 3122 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_07820 4551 3064 gene locus_tag LOCUS_07830 4551 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4628 5863 gene locus_tag LOCUS_07840 4628 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 6873 5860 gene locus_tag LOCUS_07850 6873 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence0092 1786 812 gene locus_tag LOCUS_07860 gene scbA 1786 812 CDS product adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_07860 2850 1783 gene locus_tag LOCUS_07870 2850 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 3235 2906 gene locus_tag LOCUS_07880 3235 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 3832 3305 gene locus_tag LOCUS_07890 3832 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 4791 3823 gene locus_tag LOCUS_07900 4791 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 5403 4885 gene locus_tag LOCUS_07910 5403 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 5625 5413 gene locus_tag LOCUS_07920 5625 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 5673 6491 gene locus_tag LOCUS_07930 5673 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence0093 <1 1086 gene locus_tag LOCUS_07940 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932252.1:FAD-linked oxidase 1143 1742 gene locus_tag LOCUS_07950 1143 1742 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766239.1 protein_id gnl|my_center|LOCUS_07950 1739 3085 gene locus_tag LOCUS_07960 1739 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 3982 3164 gene locus_tag LOCUS_07970 3982 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 5256 3979 gene locus_tag LOCUS_07980 5256 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_07980 6857 5286 gene locus_tag LOCUS_07990 6857 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 7415 7026 gene locus_tag LOCUS_08000 7415 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence0094 712 1419 gene locus_tag LOCUS_08010 712 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_08010 1416 2471 gene locus_tag LOCUS_08020 1416 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040337.1 protein_id gnl|my_center|LOCUS_08020 2481 2837 gene locus_tag LOCUS_08030 2481 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 2834 3250 gene locus_tag LOCUS_08040 2834 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08040 4662 3451 gene locus_tag LOCUS_08050 4662 3451 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120592.1 protein_id gnl|my_center|LOCUS_08050 4722 4979 gene locus_tag LOCUS_08060 4722 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 4972 5418 gene locus_tag LOCUS_08070 4972 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5439 6002 gene locus_tag LOCUS_08080 5439 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 7332 6007 gene locus_tag LOCUS_08090 7332 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence0095 2842 1292 gene locus_tag LOCUS_08100 2842 1292 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_08100 2962 6075 gene locus_tag LOCUS_08110 2962 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 7105 6080 gene locus_tag LOCUS_08120 7105 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence0096 <1 567 gene locus_tag LOCUS_08130 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392775.1:AMP-dependent ligase 564 1631 gene locus_tag LOCUS_08140 564 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 2175 1579 gene locus_tag LOCUS_08150 2175 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 2271 4046 gene locus_tag LOCUS_08160 2271 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 5637 4051 gene locus_tag LOCUS_08170 gene prfC 5637 4051 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LD2 protein_id gnl|my_center|LOCUS_08170 >Feature sequence0097 1753 533 gene locus_tag LOCUS_08180 1753 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 3258 1960 gene locus_tag LOCUS_08190 3258 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 3701 3255 gene locus_tag LOCUS_08200 3701 3255 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_08200 4501 3698 gene locus_tag LOCUS_08210 4501 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 5237 4482 gene locus_tag LOCUS_08220 5237 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 6341 5247 gene locus_tag LOCUS_08230 6341 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 7288 6338 gene locus_tag LOCUS_08240 7288 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence0098 26 1318 gene locus_tag LOCUS_08250 26 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1329 2345 gene locus_tag LOCUS_08260 1329 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2335 3243 gene locus_tag LOCUS_08270 2335 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 4899 3259 gene locus_tag LOCUS_08280 4899 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 4958 5410 gene locus_tag LOCUS_08290 4958 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 5441 6556 gene locus_tag LOCUS_08300 5441 6556 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E252 protein_id gnl|my_center|LOCUS_08300 6553 6948 gene locus_tag LOCUS_08310 6553 6948 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920003.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence0099 1 1494 gene locus_tag LOCUS_08320 1 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 1506 2351 gene locus_tag LOCUS_08330 1506 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 2758 2354 gene locus_tag LOCUS_08340 2758 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 3989 2760 gene locus_tag LOCUS_08350 3989 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 5042 3990 gene locus_tag LOCUS_08360 5042 3990 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173990.1 protein_id gnl|my_center|LOCUS_08360 5125 7206 gene locus_tag LOCUS_08370 5125 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 7413 7210 gene locus_tag LOCUS_08380 7413 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence0100 2671 1760 gene locus_tag LOCUS_08390 2671 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 2767 4548 gene locus_tag LOCUS_08400 2767 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 4575 6632 gene locus_tag LOCUS_08410 4575 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence0101 106 1488 gene locus_tag LOCUS_08420 106 1488 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_08420 2010 1471 gene locus_tag LOCUS_08430 2010 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2171 2052 gene locus_tag LOCUS_08440 2171 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2942 2181 gene locus_tag LOCUS_08450 2942 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3178 3810 gene locus_tag LOCUS_08460 3178 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 3912 4547 gene locus_tag LOCUS_08470 gene paaG 3912 4547 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_08470 4547 5095 gene locus_tag LOCUS_08480 4547 5095 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620469.1 protein_id gnl|my_center|LOCUS_08480 6614 5106 gene locus_tag LOCUS_08490 6614 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 7335 6643 gene locus_tag LOCUS_08500 7335 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence0102 1468 1007 gene locus_tag LOCUS_08510 1468 1007 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947031.1 protein_id gnl|my_center|LOCUS_08510 2184 1450 gene locus_tag LOCUS_08520 2184 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 2281 3282 gene locus_tag LOCUS_08530 2281 3282 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528474.1 protein_id gnl|my_center|LOCUS_08530 3279 3821 gene locus_tag LOCUS_08540 3279 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 4320 3829 gene locus_tag LOCUS_08550 4320 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4942 4478 gene locus_tag LOCUS_08560 4942 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 5550 4942 gene locus_tag LOCUS_08570 5550 4942 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence0103 1036 239 gene locus_tag LOCUS_08580 1036 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 4095 1033 gene locus_tag LOCUS_08590 4095 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 4276 5586 gene locus_tag LOCUS_08600 4276 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087425.1 protein_id gnl|my_center|LOCUS_08600 5583 5969 gene locus_tag LOCUS_08610 5583 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence0104 209 1252 gene locus_tag LOCUS_08620 209 1252 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403202.1 protein_id gnl|my_center|LOCUS_08620 1544 1263 gene locus_tag LOCUS_08630 1544 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 3056 1584 gene locus_tag LOCUS_08640 3056 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 3055 3669 gene locus_tag LOCUS_08650 3055 3669 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385291.1 protein_id gnl|my_center|LOCUS_08650 3666 5351 gene locus_tag LOCUS_08660 3666 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 6466 5681 gene locus_tag LOCUS_08670 6466 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 6353 7015 gene locus_tag LOCUS_08680 6353 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence0105 222 470 gene locus_tag LOCUS_08690 222 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 548 1159 gene locus_tag LOCUS_08700 548 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1184 2884 gene locus_tag LOCUS_08710 gene argS 1184 2884 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RG14 protein_id gnl|my_center|LOCUS_08710 3471 2890 gene locus_tag LOCUS_08720 3471 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 3684 5405 gene locus_tag LOCUS_08730 3684 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 5402 6865 gene locus_tag LOCUS_08740 5402 6865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence0106 276 145 gene locus_tag LOCUS_08750 276 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1861 326 gene locus_tag LOCUS_08760 1861 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141838.1 protein_id gnl|my_center|LOCUS_08760 3366 1924 gene locus_tag LOCUS_08770 3366 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 3404 4906 gene locus_tag LOCUS_08780 3404 4906 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123571.1 protein_id gnl|my_center|LOCUS_08780 6457 4940 gene locus_tag LOCUS_08790 6457 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 7055 6558 gene locus_tag LOCUS_08800 7055 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence0107 1332 700 gene locus_tag LOCUS_08810 1332 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 4457 1317 gene locus_tag LOCUS_08820 4457 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 4636 4956 gene locus_tag LOCUS_08830 4636 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence0108 805 242 gene locus_tag LOCUS_08840 805 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3330 802 gene locus_tag LOCUS_08850 3330 802 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_08850 3371 4483 gene locus_tag LOCUS_08860 gene hemN 3371 4483 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NC94 protein_id gnl|my_center|LOCUS_08860 4537 5550 gene locus_tag LOCUS_08870 4537 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence0109 160 1770 gene locus_tag LOCUS_08880 160 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1767 3020 gene locus_tag LOCUS_08890 1767 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3050 4552 gene locus_tag LOCUS_08900 3050 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 4549 5094 gene locus_tag LOCUS_08910 4549 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5679 5101 gene locus_tag LOCUS_08920 5679 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence0110 3771 787 gene locus_tag LOCUS_08930 3771 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4600 3806 gene locus_tag LOCUS_08940 4600 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 4711 5130 gene locus_tag LOCUS_08950 gene ndk 4711 5130 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QX9 protein_id gnl|my_center|LOCUS_08950 5243 5728 gene locus_tag LOCUS_08960 5243 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence0111 1671 826 gene locus_tag LOCUS_08970 1671 826 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_08970 2073 4130 gene locus_tag LOCUS_08980 2073 4130 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517762.1 protein_id gnl|my_center|LOCUS_08980 4127 5275 gene locus_tag LOCUS_08990 4127 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 5275 5610 gene locus_tag LOCUS_09000 5275 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 5601 7127 gene locus_tag LOCUS_09010 5601 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence0112 157 486 gene locus_tag LOCUS_09020 gene atpE 157 486 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC8 protein_id gnl|my_center|LOCUS_09020 618 1442 gene locus_tag LOCUS_09030 618 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1468 2499 gene locus_tag LOCUS_09040 1468 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 2496 3224 gene locus_tag LOCUS_09050 2496 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 3716 3234 gene locus_tag LOCUS_09060 3716 3234 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977536.1 protein_id gnl|my_center|LOCUS_09060 3803 4975 gene locus_tag LOCUS_09070 gene metB 3803 4975 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229485.1 protein_id gnl|my_center|LOCUS_09070 4992 5903 gene locus_tag LOCUS_09080 4992 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028100.1 protein_id gnl|my_center|LOCUS_09080 6903 6010 gene locus_tag LOCUS_09090 6903 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence0113 3318 370 gene locus_tag LOCUS_09100 3318 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 5008 3446 gene locus_tag LOCUS_09110 5008 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 6162 5179 gene locus_tag LOCUS_09120 gene mdh 6162 5179 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3J3 protein_id gnl|my_center|LOCUS_09120 6231 6656 gene locus_tag LOCUS_09130 6231 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819665.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence0114 1814 318 gene locus_tag LOCUS_09140 1814 318 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943972.1 protein_id gnl|my_center|LOCUS_09140 1860 3086 gene locus_tag LOCUS_09150 1860 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 3083 4348 gene locus_tag LOCUS_09160 3083 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 4416 5177 gene locus_tag LOCUS_09170 4416 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 5324 5773 gene locus_tag LOCUS_09180 5324 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 5773 6987 gene locus_tag LOCUS_09190 5773 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence0115 133 984 gene locus_tag LOCUS_09200 gene genX 133 984 CDS product EF-P lysine aminoacylase GenX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_09200 981 1673 gene locus_tag LOCUS_09210 981 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 4184 1680 gene locus_tag LOCUS_09220 4184 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 5614 4217 gene locus_tag LOCUS_09230 gene purF 5614 4217 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN7 protein_id gnl|my_center|LOCUS_09230 6434 5700 gene locus_tag LOCUS_09240 gene purC 6434 5700 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9P4 protein_id gnl|my_center|LOCUS_09240 >Feature sequence0116 869 126 gene locus_tag LOCUS_09250 869 126 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_09250 2814 880 gene locus_tag LOCUS_09260 gene sdhA 2814 880 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_09260 3491 2811 gene locus_tag LOCUS_09270 3491 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_09270 5768 3639 gene locus_tag LOCUS_09280 5768 3639 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_09280 5848 6264 gene locus_tag LOCUS_09290 5848 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence0117 199 747 gene locus_tag LOCUS_09300 199 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2130 763 gene locus_tag LOCUS_09310 2130 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4101 2131 gene locus_tag LOCUS_09320 4101 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 4117 4758 gene locus_tag LOCUS_09330 4117 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 5521 4664 gene locus_tag LOCUS_09340 5521 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 5520 6317 gene locus_tag LOCUS_09350 5520 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence0118 <1 694 gene locus_tag LOCUS_09360 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001883987.1:glutathione amide-dependent peroxidase 860 1045 gene locus_tag LOCUS_09370 860 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1688 1026 gene locus_tag LOCUS_09380 1688 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1777 2403 gene locus_tag LOCUS_09390 1777 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2408 2821 gene locus_tag LOCUS_09400 2408 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09400 2818 3759 gene locus_tag LOCUS_09410 2818 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 3756 4706 gene locus_tag LOCUS_09420 3756 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4716 5372 gene locus_tag LOCUS_09430 4716 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_09430 6035 5379 gene locus_tag LOCUS_09440 gene rpe 6035 5379 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE8 protein_id gnl|my_center|LOCUS_09440 7017 6070 gene locus_tag LOCUS_09450 7017 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence0119 <1 977 gene locus_tag LOCUS_09460 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001095359.1:alpha/beta hydrolase 974 1417 gene locus_tag LOCUS_09470 974 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1414 2688 gene locus_tag LOCUS_09480 1414 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 2711 3667 gene locus_tag LOCUS_09490 gene lgt 2711 3667 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1A4 protein_id gnl|my_center|LOCUS_09490 3755 4714 gene locus_tag LOCUS_09500 3755 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 4817 5320 gene locus_tag LOCUS_09510 4817 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 6122 5328 gene locus_tag LOCUS_09520 6122 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 6173 6469 gene locus_tag LOCUS_09530 6173 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence0120 1095 1568 gene locus_tag LOCUS_09540 1095 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 2181 1546 gene locus_tag LOCUS_09550 2181 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 2365 2192 gene locus_tag LOCUS_09560 2365 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 2339 2602 gene locus_tag LOCUS_09570 2339 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3279 2560 gene locus_tag LOCUS_09580 3279 2560 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_09580 4462 3305 gene locus_tag LOCUS_09590 4462 3305 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818337.1 protein_id gnl|my_center|LOCUS_09590 4530 6353 gene locus_tag LOCUS_09600 4530 6353 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_09600 6686 6357 gene locus_tag LOCUS_09610 6686 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence0121 1903 68 gene locus_tag LOCUS_09620 gene selB 1903 68 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_09620 2855 1905 gene locus_tag LOCUS_09630 2855 1905 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_09630 2925 4514 gene locus_tag LOCUS_09640 2925 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 4594 5358 gene locus_tag LOCUS_09650 4594 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 5747 5364 gene locus_tag LOCUS_09660 5747 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence0122 548 1129 gene locus_tag LOCUS_09670 548 1129 CDS product cytochrome C oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118864.1 protein_id gnl|my_center|LOCUS_09670 1126 1365 gene locus_tag LOCUS_09680 1126 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1551 1366 gene locus_tag LOCUS_09690 1551 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2122 1640 gene locus_tag LOCUS_09700 2122 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2191 4092 gene locus_tag LOCUS_09710 2191 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 4113 6365 gene locus_tag LOCUS_09720 4113 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence0123 <1 1791 gene locus_tag LOCUS_09730 <1 1791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941639.1:ATPase AAA 2787 1804 gene locus_tag LOCUS_09740 2787 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 4306 2798 gene locus_tag LOCUS_09750 4306 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 6248 4314 gene locus_tag LOCUS_09760 6248 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence0124 146 745 gene locus_tag LOCUS_09770 146 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 694 1872 gene locus_tag LOCUS_09780 gene rnd 694 1872 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 protein_id gnl|my_center|LOCUS_09780 2027 2194 gene locus_tag LOCUS_09790 2027 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2214 2708 gene locus_tag LOCUS_09800 2214 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2786 3781 gene locus_tag LOCUS_09810 2786 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 3787 5211 gene locus_tag LOCUS_09820 3787 5211 CDS product pilus assembly protein CpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 protein_id gnl|my_center|LOCUS_09820 5215 6402 gene locus_tag LOCUS_09830 5215 6402 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939398.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence0125 1565 861 gene locus_tag LOCUS_09840 1565 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1630 2691 gene locus_tag LOCUS_09850 1630 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 3911 2733 gene locus_tag LOCUS_09860 3911 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 3967 4986 gene locus_tag LOCUS_09870 3967 4986 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_09870 5180 6700 gene locus_tag LOCUS_09880 gene cafA 5180 6700 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence0126 <1 1413 gene locus_tag LOCUS_09890 <1 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141921.1:phytoene dehydrogenase 1424 2440 gene locus_tag LOCUS_09900 gene hemE 1424 2440 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFA8 protein_id gnl|my_center|LOCUS_09900 2437 3423 gene locus_tag LOCUS_09910 gene hemH 2437 3423 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747F5 protein_id gnl|my_center|LOCUS_09910 3473 4489 gene locus_tag LOCUS_09920 3473 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 4514 6505 gene locus_tag LOCUS_09930 4514 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence0127 883 539 gene locus_tag LOCUS_09940 883 539 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_09940 960 3230 gene locus_tag LOCUS_09950 960 3230 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 protein_id gnl|my_center|LOCUS_09950 3264 4004 gene locus_tag LOCUS_09960 3264 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 4063 5811 gene locus_tag LOCUS_09970 4063 5811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_09970 <6759 5808 gene locus_tag LOCUS_09980 <6759 5808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WIX2:UvrABC system protein A >Feature sequence0128 1614 418 gene locus_tag LOCUS_09990 gene ribA 1614 418 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI3 protein_id gnl|my_center|LOCUS_09990 2261 1611 gene locus_tag LOCUS_10000 2261 1611 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_10000 3325 2261 gene locus_tag LOCUS_10010 3325 2261 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_10010 3777 3322 gene locus_tag LOCUS_10020 gene nrdR 3777 3322 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCN3 protein_id gnl|my_center|LOCUS_10020 5033 3774 gene locus_tag LOCUS_10030 gene glyA 5033 3774 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH33 protein_id gnl|my_center|LOCUS_10030 5500 5063 gene locus_tag LOCUS_10040 5500 5063 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722019.1 protein_id gnl|my_center|LOCUS_10040 6660 5503 gene locus_tag LOCUS_10050 gene fabF-2 6660 5503 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CR7 protein_id gnl|my_center|LOCUS_10050 >Feature sequence0129 1431 328 gene locus_tag LOCUS_10060 1431 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2057 1431 gene locus_tag LOCUS_10070 2057 1431 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963558.1 protein_id gnl|my_center|LOCUS_10070 4582 2054 gene locus_tag LOCUS_10080 4582 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 5409 4606 gene locus_tag LOCUS_10090 5409 4606 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877777.1 protein_id gnl|my_center|LOCUS_10090 6593 5730 gene locus_tag LOCUS_10100 6593 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence0130 1683 3272 gene locus_tag LOCUS_10110 1683 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 3339 4568 gene locus_tag LOCUS_10120 3339 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 4565 4987 gene locus_tag LOCUS_10130 4565 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 4987 5424 gene locus_tag LOCUS_10140 4987 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5444 6223 gene locus_tag LOCUS_10150 5444 6223 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708125.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence0131 1708 2382 gene locus_tag LOCUS_10160 1708 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2406 3125 gene locus_tag LOCUS_10170 gene fabL 2406 3125 CDS product enoyl-[acyl-carrier-protein] reductase [NADPH] FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71079 protein_id gnl|my_center|LOCUS_10170 3163 4035 gene locus_tag LOCUS_10180 3163 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4132 5484 gene locus_tag LOCUS_10190 gene tnaA 4132 5484 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1V4 protein_id gnl|my_center|LOCUS_10190 >Feature sequence0132 1379 540 gene locus_tag LOCUS_10200 1379 540 CDS product DNA-binding transcriptional activator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189368.1 protein_id gnl|my_center|LOCUS_10200 3429 1369 gene locus_tag LOCUS_10210 gene nadE 3429 1369 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_10210 5897 3558 gene locus_tag LOCUS_10220 5897 3558 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence0133 1261 401 gene locus_tag LOCUS_10230 gene rrmA 1261 401 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262328.1 protein_id gnl|my_center|LOCUS_10230 1385 4138 gene locus_tag LOCUS_10240 gene ppc 1385 4138 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWX4 protein_id gnl|my_center|LOCUS_10240 4135 5178 gene locus_tag LOCUS_10250 4135 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 5215 5820 gene locus_tag LOCUS_10260 5215 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 6054 5830 gene locus_tag LOCUS_10270 6054 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence0134 1371 178 gene locus_tag LOCUS_10280 gene tgt-1 1371 178 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DZ0 protein_id gnl|my_center|LOCUS_10280 1506 3014 gene locus_tag LOCUS_10290 1506 3014 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258512.1 protein_id gnl|my_center|LOCUS_10290 3788 3024 gene locus_tag LOCUS_10300 3788 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 3811 5007 gene locus_tag LOCUS_10310 3811 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 5057 6541 gene locus_tag LOCUS_10320 5057 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence0135 25 939 gene locus_tag LOCUS_10330 25 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 936 1595 gene locus_tag LOCUS_10340 936 1595 CDS product microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462275.1 protein_id gnl|my_center|LOCUS_10340 1639 2076 gene locus_tag LOCUS_10350 1639 2076 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225379.1 protein_id gnl|my_center|LOCUS_10350 2343 2561 gene locus_tag LOCUS_10360 2343 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 2564 2845 gene locus_tag LOCUS_10370 2564 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 2882 4720 gene locus_tag LOCUS_10380 2882 4720 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 protein_id gnl|my_center|LOCUS_10380 4775 5287 gene locus_tag LOCUS_10390 4775 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 5378 5974 gene locus_tag LOCUS_10400 5378 5974 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence0136 1020 346 gene locus_tag LOCUS_10410 1020 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1700 1017 gene locus_tag LOCUS_10420 1700 1017 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_10420 2937 1798 gene locus_tag LOCUS_10430 2937 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10430 3554 2937 gene locus_tag LOCUS_10440 3554 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10440 3879 3610 gene locus_tag LOCUS_10450 3879 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888378.1 protein_id gnl|my_center|LOCUS_10450 4060 5130 gene locus_tag LOCUS_10460 gene aroC 4060 5130 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_10460 5475 5134 gene locus_tag LOCUS_10470 5475 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 6326 5367 gene locus_tag LOCUS_10480 6326 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence0137 735 19 gene locus_tag LOCUS_10490 735 19 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900432.1 protein_id gnl|my_center|LOCUS_10490 1759 785 gene locus_tag LOCUS_10500 gene fabH 1759 785 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV1 protein_id gnl|my_center|LOCUS_10500 1890 2309 gene locus_tag LOCUS_10510 1890 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 2306 2830 gene locus_tag LOCUS_10520 2306 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2827 4080 gene locus_tag LOCUS_10530 2827 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 4129 4884 gene locus_tag LOCUS_10540 4129 4884 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZC4 protein_id gnl|my_center|LOCUS_10540 4881 5285 gene locus_tag LOCUS_10550 4881 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5390 6133 gene locus_tag LOCUS_10560 5390 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence0138 2073 1171 gene locus_tag LOCUS_10570 2073 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 2633 2073 gene locus_tag LOCUS_10580 2633 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 3109 2633 gene locus_tag LOCUS_10590 3109 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 3375 3106 gene locus_tag LOCUS_10600 3375 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 3920 3372 gene locus_tag LOCUS_10610 3920 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 5044 3917 gene locus_tag LOCUS_10620 5044 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 5799 5044 gene locus_tag LOCUS_10630 5799 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 >Feature sequence0139 <1 1321 gene locus_tag LOCUS_10640 <1 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121176.1:arylsulfatase 2974 1697 gene locus_tag LOCUS_10650 2974 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 3117 3407 gene locus_tag LOCUS_10660 3117 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 6106 3455 gene locus_tag LOCUS_10670 6106 3455 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403520.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence0140 767 144 gene locus_tag LOCUS_10680 767 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1989 880 gene locus_tag LOCUS_10690 1989 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1931 2257 gene locus_tag LOCUS_10700 1931 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 2275 3390 gene locus_tag LOCUS_10710 2275 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 3801 3400 gene locus_tag LOCUS_10720 3801 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 5046 3811 gene locus_tag LOCUS_10730 5046 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 6242 5037 gene locus_tag LOCUS_10740 6242 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence0141 1235 426 gene locus_tag LOCUS_10750 1235 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1274 1771 gene locus_tag LOCUS_10760 1274 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1768 2622 gene locus_tag LOCUS_10770 1768 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947383.1 protein_id gnl|my_center|LOCUS_10770 2649 3338 gene locus_tag LOCUS_10780 2649 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 3380 5467 gene locus_tag LOCUS_10790 3380 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 5464 6432 gene locus_tag LOCUS_10800 5464 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence0142 3399 370 gene locus_tag LOCUS_10810 3399 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 3759 4349 gene locus_tag LOCUS_10820 3759 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 6106 4346 gene locus_tag LOCUS_10830 6106 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence0143 944 1025 gene locus_tag LOCUS_t00030 944 1025 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2515 1262 gene locus_tag LOCUS_10840 2515 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090158.1 protein_id gnl|my_center|LOCUS_10840 4107 2515 gene locus_tag LOCUS_10850 4107 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4985 4101 gene locus_tag LOCUS_10860 4985 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 5081 5959 gene locus_tag LOCUS_10870 5081 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence0144 2149 3471 gene locus_tag LOCUS_10880 gene selA 2149 3471 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFK3 protein_id gnl|my_center|LOCUS_10880 3471 4349 gene locus_tag LOCUS_10890 3471 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 4351 5286 gene locus_tag LOCUS_10900 gene rluD 4351 5286 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HES2 protein_id gnl|my_center|LOCUS_10900 6311 5283 gene locus_tag LOCUS_10910 6311 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence0145 3105 268 gene locus_tag LOCUS_10920 gene sucA 3105 268 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_426301.2 protein_id gnl|my_center|LOCUS_10920 >Feature sequence0146 <1 1314 gene locus_tag LOCUS_10930 <1 1314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001181592.1:FMN-binding glutamate synthase family protein 1440 4985 gene locus_tag LOCUS_10940 gene nifJ 1440 4985 CDS product pyruvate-flavodoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53046 protein_id gnl|my_center|LOCUS_10940 4989 5984 gene locus_tag LOCUS_10950 4989 5984 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_10950 5994 6380 gene locus_tag LOCUS_10960 5994 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence0147 2200 275 gene locus_tag LOCUS_10970 2200 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2283 3512 gene locus_tag LOCUS_10980 2283 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 3521 4063 gene locus_tag LOCUS_10990 3521 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 5761 4067 gene locus_tag LOCUS_11000 5761 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence0148 2004 445 gene locus_tag LOCUS_11010 2004 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2738 2001 gene locus_tag LOCUS_11020 2738 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 2770 4029 gene locus_tag LOCUS_11030 2770 4029 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_11030 5196 4039 gene locus_tag LOCUS_11040 5196 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 5483 5112 gene locus_tag LOCUS_11050 5483 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 6082 5561 gene locus_tag LOCUS_11060 6082 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence0149 93 368 gene locus_tag LOCUS_11070 gene rpmA 93 368 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8REI3 protein_id gnl|my_center|LOCUS_11070 413 1459 gene locus_tag LOCUS_11080 gene obg 413 1459 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83Q14 protein_id gnl|my_center|LOCUS_11080 1428 2108 gene locus_tag LOCUS_11090 1428 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2292 2657 gene locus_tag LOCUS_11100 2292 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2713 3354 gene locus_tag LOCUS_11110 gene comF 2713 3354 CDS product competence protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403831.1 protein_id gnl|my_center|LOCUS_11110 3560 3733 gene locus_tag LOCUS_11120 3560 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 5562 3802 gene locus_tag LOCUS_11130 5562 3802 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490750.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence0150 1659 199 gene locus_tag LOCUS_11140 1659 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 2624 1656 gene locus_tag LOCUS_11150 2624 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 2838 5189 gene locus_tag LOCUS_11160 gene bsgA 2838 5189 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3W9 protein_id gnl|my_center|LOCUS_11160 5263 5916 gene locus_tag LOCUS_11170 5263 5916 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140484.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence0151 280 1200 gene locus_tag LOCUS_11180 280 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1869 1177 gene locus_tag LOCUS_11190 1869 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1943 2191 gene locus_tag LOCUS_11200 1943 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 2193 2393 gene locus_tag LOCUS_11210 2193 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2371 3432 gene locus_tag LOCUS_11220 2371 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 3978 3613 gene locus_tag LOCUS_11230 3978 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 4092 4796 gene locus_tag LOCUS_11240 4092 4796 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531680.1 protein_id gnl|my_center|LOCUS_11240 4793 5047 gene locus_tag LOCUS_11250 4793 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 5044 5238 gene locus_tag LOCUS_11260 5044 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence0152 536 1330 gene locus_tag LOCUS_11270 536 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 2334 1345 gene locus_tag LOCUS_11280 2334 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2388 2960 gene locus_tag LOCUS_11290 2388 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3584 2973 gene locus_tag LOCUS_11300 gene grpE 3584 2973 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66745 protein_id gnl|my_center|LOCUS_11300 3786 5402 gene locus_tag LOCUS_11310 3786 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 5993 5559 gene locus_tag LOCUS_11320 5993 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence0153 <1 709 gene locus_tag LOCUS_11330 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028749.1:formimidoylglutamate deiminase 846 679 gene locus_tag LOCUS_11340 846 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1407 1102 gene locus_tag LOCUS_11350 1407 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 2537 1407 gene locus_tag LOCUS_11360 2537 1407 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MJU6 protein_id gnl|my_center|LOCUS_11360 3159 2542 gene locus_tag LOCUS_11370 3159 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3277 3777 gene locus_tag LOCUS_11380 3277 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 3777 4637 gene locus_tag LOCUS_11390 3777 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence0154 637 458 gene locus_tag LOCUS_11400 637 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1494 634 gene locus_tag LOCUS_11410 1494 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4180 1628 gene locus_tag LOCUS_11420 4180 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 4232 4966 gene locus_tag LOCUS_11430 4232 4966 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_11430 4963 6228 gene locus_tag LOCUS_11440 4963 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence0155 86 856 gene locus_tag LOCUS_11450 86 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 853 2433 gene locus_tag LOCUS_11460 853 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2430 3647 gene locus_tag LOCUS_11470 2430 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 3670 5403 gene locus_tag LOCUS_11480 3670 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence0156 124 540 gene locus_tag LOCUS_11490 124 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 701 516 gene locus_tag LOCUS_11500 701 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 696 1295 gene locus_tag LOCUS_11510 696 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1292 2767 gene locus_tag LOCUS_11520 1292 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 2788 3975 gene locus_tag LOCUS_11530 2788 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4043 4444 gene locus_tag LOCUS_11540 4043 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 4444 5814 gene locus_tag LOCUS_11550 4444 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence0157 217 1008 gene locus_tag LOCUS_11560 217 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1005 2006 gene locus_tag LOCUS_11570 1005 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 2856 2044 gene locus_tag LOCUS_11580 2856 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 3293 2877 gene locus_tag LOCUS_11590 3293 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 3444 3863 gene locus_tag LOCUS_11600 3444 3863 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_11600 3931 5274 gene locus_tag LOCUS_11610 3931 5274 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_11610 5274 5828 gene locus_tag LOCUS_11620 5274 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence0158 876 1460 gene locus_tag LOCUS_11630 876 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1525 2016 gene locus_tag LOCUS_11640 1525 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 2019 2825 gene locus_tag LOCUS_11650 2019 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3255 2833 gene locus_tag LOCUS_11660 3255 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 3248 5230 gene locus_tag LOCUS_11670 3248 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 <6178 5185 gene locus_tag LOCUS_11680 <6178 5185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105444.1:SAM-dependent methyltransferase >Feature sequence0159 1433 852 gene locus_tag LOCUS_11690 gene plsY 1433 852 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60926 protein_id gnl|my_center|LOCUS_11690 1490 3535 gene locus_tag LOCUS_11700 1490 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3542 4246 gene locus_tag LOCUS_11710 gene sfsA 3542 4246 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61664 protein_id gnl|my_center|LOCUS_11710 4962 4258 gene locus_tag LOCUS_11720 4962 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 5576 4980 gene locus_tag LOCUS_11730 5576 4980 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038832.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence0160 808 2901 gene locus_tag LOCUS_11740 808 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 2898 5084 gene locus_tag LOCUS_11750 2898 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence0161 1949 1644 gene locus_tag LOCUS_11760 gene nuoK2 1949 1644 CDS product NADH-quinone oxidoreductase subunit K 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UFL3 protein_id gnl|my_center|LOCUS_11760 2353 1946 gene locus_tag LOCUS_11770 2353 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 2940 2422 gene locus_tag LOCUS_11780 2940 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 3938 2937 gene locus_tag LOCUS_11790 gene nuoH 3938 2937 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEB9 protein_id gnl|my_center|LOCUS_11790 5164 3935 gene locus_tag LOCUS_11800 gene nuoD 5164 3935 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC0 protein_id gnl|my_center|LOCUS_11800 5616 5155 gene locus_tag LOCUS_11810 5616 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 6110 5613 gene locus_tag LOCUS_11820 6110 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence0162 589 2406 gene locus_tag LOCUS_11830 589 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2425 3330 gene locus_tag LOCUS_11840 gene htrB 2425 3330 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227145.1 protein_id gnl|my_center|LOCUS_11840 3327 5000 gene locus_tag LOCUS_11850 3327 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 <6137 5015 gene locus_tag LOCUS_11860 <6137 5015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SMC1:glucose-1-phosphate adenylyltransferase >Feature sequence0163 659 21 gene locus_tag LOCUS_11870 659 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1111 656 gene locus_tag LOCUS_11880 1111 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1189 1767 gene locus_tag LOCUS_11890 1189 1767 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289404.1 protein_id gnl|my_center|LOCUS_11890 2924 2052 gene locus_tag LOCUS_11900 2924 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 3050 4702 gene locus_tag LOCUS_11910 3050 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 6017 4722 gene locus_tag LOCUS_11920 6017 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence0164 625 86 gene locus_tag LOCUS_11930 625 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1696 872 gene locus_tag LOCUS_11940 1696 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2325 1750 gene locus_tag LOCUS_11950 2325 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2633 2316 gene locus_tag LOCUS_11960 2633 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3037 2630 gene locus_tag LOCUS_11970 3037 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 3071 3520 gene locus_tag LOCUS_11980 3071 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence0165 1697 240 gene locus_tag LOCUS_11990 1697 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1839 3908 gene locus_tag LOCUS_12000 gene flhA 1839 3908 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_12000 3980 4777 gene locus_tag LOCUS_12010 gene whiG 3980 4777 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17211 protein_id gnl|my_center|LOCUS_12010 4774 5469 gene locus_tag LOCUS_12020 4774 5469 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545861.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence0166 <1 1012 gene locus_tag LOCUS_12030 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940771.1:DNA polymerase III subunit gamma/tau 1023 1334 gene locus_tag LOCUS_12040 1023 1334 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPZ1 protein_id gnl|my_center|LOCUS_12040 1335 1931 gene locus_tag LOCUS_12050 gene recR 1335 1931 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI4 protein_id gnl|my_center|LOCUS_12050 1933 2319 gene locus_tag LOCUS_12060 1933 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2316 3026 gene locus_tag LOCUS_12070 2316 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence0167 375 1070 gene locus_tag LOCUS_12080 375 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1121 1858 gene locus_tag LOCUS_12090 1121 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3319 1862 gene locus_tag LOCUS_12100 gene lap 3319 1862 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZQ8 protein_id gnl|my_center|LOCUS_12100 4231 3416 gene locus_tag LOCUS_12110 4231 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 4895 4260 gene locus_tag LOCUS_12120 4895 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence0168 168 887 gene locus_tag LOCUS_12130 168 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 881 1342 gene locus_tag LOCUS_12140 881 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1339 2112 gene locus_tag LOCUS_12150 1339 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499399.1 protein_id gnl|my_center|LOCUS_12150 2992 2063 gene locus_tag LOCUS_12160 2992 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 3072 4310 gene locus_tag LOCUS_12170 3072 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 5719 4307 gene locus_tag LOCUS_12180 5719 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence0169 1233 310 gene locus_tag LOCUS_12190 1233 310 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_12190 2045 1299 gene locus_tag LOCUS_12200 2045 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3253 2045 gene locus_tag LOCUS_12210 3253 2045 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105114.1 protein_id gnl|my_center|LOCUS_12210 3153 4976 gene locus_tag LOCUS_12220 3153 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence0170 760 221 gene locus_tag LOCUS_12230 760 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2054 768 gene locus_tag LOCUS_12240 2054 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2111 2599 gene locus_tag LOCUS_12250 2111 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4526 2664 gene locus_tag LOCUS_12260 4526 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 <6043 4642 gene locus_tag LOCUS_12270 <6043 4642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460619.1:succinate dehydrogenase/fumarate reductase flavoprotein subunit >Feature sequence0171 756 1370 gene locus_tag LOCUS_12280 756 1370 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_12280 1403 1693 gene locus_tag LOCUS_12290 gene cchA 1403 1693 CDS product ethanolamine utilization protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_12290 1705 2019 gene locus_tag LOCUS_12300 gene ccmL 1705 2019 CDS product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_12300 2019 3422 gene locus_tag LOCUS_12310 gene eutE 2019 3422 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075682.1 protein_id gnl|my_center|LOCUS_12310 3425 3997 gene locus_tag LOCUS_12320 3425 3997 CDS product propanediol utilization: polyhedral bodies pduT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815271.1 protein_id gnl|my_center|LOCUS_12320 3997 4299 gene locus_tag LOCUS_12330 gene ccmL 3997 4299 CDS product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_12330 4296 4592 gene locus_tag LOCUS_12340 4296 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 4847 4596 gene locus_tag LOCUS_12350 4847 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 4994 5848 gene locus_tag LOCUS_12360 4994 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence0172 503 967 gene locus_tag LOCUS_12370 gene fsxA 503 967 CDS product exclusion protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938508.1 protein_id gnl|my_center|LOCUS_12370 1452 970 gene locus_tag LOCUS_12380 1452 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2188 1478 gene locus_tag LOCUS_12390 2188 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 5786 2193 gene locus_tag LOCUS_12400 5786 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence0173 2226 616 gene locus_tag LOCUS_12410 2226 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3909 2230 gene locus_tag LOCUS_12420 3909 2230 CDS product 1,4-alpha-glucan-branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867884.1 protein_id gnl|my_center|LOCUS_12420 <5998 3896 gene locus_tag LOCUS_12430 <5998 3896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583261.1:4-alpha-glucanotransferase >Feature sequence0174 <1 914 gene locus_tag LOCUS_12440 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DBI7:dihydroorotate dehydrogenase (quinone) 911 1588 gene locus_tag LOCUS_12450 911 1588 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_12450 3280 1565 gene locus_tag LOCUS_12460 3280 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 4180 3284 gene locus_tag LOCUS_12470 4180 3284 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259151.1 protein_id gnl|my_center|LOCUS_12470 4219 5133 gene locus_tag LOCUS_12480 4219 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence0175 184 1104 gene locus_tag LOCUS_12490 184 1104 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898866.1 protein_id gnl|my_center|LOCUS_12490 2027 1110 gene locus_tag LOCUS_12500 2027 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2557 2015 gene locus_tag LOCUS_12510 2557 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 2777 2541 gene locus_tag LOCUS_12520 2777 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3247 2774 gene locus_tag LOCUS_12530 3247 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3343 4179 gene locus_tag LOCUS_12540 3343 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4176 4484 gene locus_tag LOCUS_12550 4176 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 4563 5912 gene locus_tag LOCUS_12560 4563 5912 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence0176 >Feature sequence0177 <1 670 gene locus_tag LOCUS_12570 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326708.1:ferrous iron transporter B 1685 678 gene locus_tag LOCUS_12580 1685 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2378 1740 gene locus_tag LOCUS_12590 2378 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2495 3322 gene locus_tag LOCUS_12600 2495 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 4568 3330 gene locus_tag LOCUS_12610 4568 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 5166 4594 gene locus_tag LOCUS_12620 5166 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence0178 745 1227 gene locus_tag LOCUS_12630 745 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2728 1919 gene locus_tag LOCUS_12640 2728 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 2823 3221 gene locus_tag LOCUS_12650 2823 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 4385 3231 gene locus_tag LOCUS_12660 4385 3231 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_12660 4408 5307 gene locus_tag LOCUS_12670 4408 5307 CDS product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140115.1 protein_id gnl|my_center|LOCUS_12670 5898 5308 gene locus_tag LOCUS_12680 5898 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence0179 832 485 gene locus_tag LOCUS_12690 832 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1585 1040 gene locus_tag LOCUS_12700 1585 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1646 2986 gene locus_tag LOCUS_12710 1646 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3693 2977 gene locus_tag LOCUS_12720 3693 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 4556 3690 gene locus_tag LOCUS_12730 4556 3690 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259544.1 protein_id gnl|my_center|LOCUS_12730 5493 4648 gene locus_tag LOCUS_12740 5493 4648 CDS product 2-hydroxy-6-oxohepta-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143319.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence0180 1083 2345 gene locus_tag LOCUS_12750 1083 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 2342 3196 gene locus_tag LOCUS_12760 2342 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3193 4806 gene locus_tag LOCUS_12770 3193 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence0181 3013 1727 gene locus_tag LOCUS_12780 3013 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 5317 3104 gene locus_tag LOCUS_12790 5317 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 5495 5656 gene locus_tag LOCUS_12800 5495 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence0182 3561 5702 gene locus_tag LOCUS_12810 3561 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 5824 5687 gene locus_tag LOCUS_12820 5824 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence0183 361 1731 gene locus_tag LOCUS_12830 361 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1733 3511 gene locus_tag LOCUS_12840 1733 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 3556 3954 gene locus_tag LOCUS_12850 3556 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence0184 103 1131 gene locus_tag LOCUS_12860 103 1131 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228210.1 protein_id gnl|my_center|LOCUS_12860 1241 2575 gene locus_tag LOCUS_12870 1241 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3661 2594 gene locus_tag LOCUS_12880 3661 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 5041 3680 gene locus_tag LOCUS_12890 5041 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence0185 820 1545 gene locus_tag LOCUS_12900 gene rph 820 1545 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T93 protein_id gnl|my_center|LOCUS_12900 1542 2132 gene locus_tag LOCUS_12910 1542 2132 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DFC5 protein_id gnl|my_center|LOCUS_12910 2129 2797 gene locus_tag LOCUS_12920 2129 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2830 4452 gene locus_tag LOCUS_12930 2830 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence0186 646 846 gene locus_tag LOCUS_12940 646 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 846 1286 gene locus_tag LOCUS_12950 gene dtd 846 1286 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B603 protein_id gnl|my_center|LOCUS_12950 1286 2041 gene locus_tag LOCUS_12960 gene hisN 1286 2041 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_12960 2085 3647 gene locus_tag LOCUS_12970 gene dnaK 2085 3647 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_12970 3666 4241 gene locus_tag LOCUS_12980 3666 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 4486 4280 gene locus_tag LOCUS_12990 4486 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 4942 4580 gene locus_tag LOCUS_13000 4942 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence0187 69 1805 gene locus_tag LOCUS_13010 69 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1810 3072 gene locus_tag LOCUS_13020 gene moeA 1810 3072 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_13020 3066 3578 gene locus_tag LOCUS_13030 3066 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 3588 4598 gene locus_tag LOCUS_13040 3588 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4643 5815 gene locus_tag LOCUS_13050 4643 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence0188 124 879 gene locus_tag LOCUS_13060 124 879 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546769.1 protein_id gnl|my_center|LOCUS_13060 2010 880 gene locus_tag LOCUS_13070 2010 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2966 2010 gene locus_tag LOCUS_13080 2966 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 3711 2959 gene locus_tag LOCUS_13090 3711 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3761 5350 gene locus_tag LOCUS_13100 3761 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122313.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence0189 2201 1347 gene locus_tag LOCUS_13110 2201 1347 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524880.1 protein_id gnl|my_center|LOCUS_13110 2237 2785 gene locus_tag LOCUS_13120 2237 2785 CDS product putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700839.1 protein_id gnl|my_center|LOCUS_13120 3067 2789 gene locus_tag LOCUS_13130 3067 2789 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTF7 protein_id gnl|my_center|LOCUS_13130 3111 3971 gene locus_tag LOCUS_13140 3111 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 5691 4009 gene locus_tag LOCUS_13150 5691 4009 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence0190 1911 46 gene locus_tag LOCUS_13160 gene glgB 1911 46 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0G8 protein_id gnl|my_center|LOCUS_13160 3234 1999 gene locus_tag LOCUS_13170 3234 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 3269 3595 gene locus_tag LOCUS_13180 3269 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 3662 5032 gene locus_tag LOCUS_13190 3662 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence0191 1913 240 gene locus_tag LOCUS_13200 1913 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 3805 1910 gene locus_tag LOCUS_13210 3805 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence0192 244 1332 gene locus_tag LOCUS_13220 244 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 3494 1413 gene locus_tag LOCUS_13230 3494 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 4110 3568 gene locus_tag LOCUS_13240 4110 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 4289 5407 gene locus_tag LOCUS_13250 4289 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244116.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence0193 658 1881 gene locus_tag LOCUS_13260 gene pilC 658 1881 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_13260 1896 3446 gene locus_tag LOCUS_13270 gene pilS 1896 3446 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_13270 3439 4848 gene locus_tag LOCUS_13280 gene pilR 3439 4848 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_13280 5059 5505 gene locus_tag LOCUS_13290 gene pilA 5059 5505 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04739 protein_id gnl|my_center|LOCUS_13290 >Feature sequence0194 2208 280 gene locus_tag LOCUS_13300 2208 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 2250 3200 gene locus_tag LOCUS_13310 2250 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 3997 3146 gene locus_tag LOCUS_13320 3997 3146 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_13320 5634 3994 gene locus_tag LOCUS_13330 5634 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence0195 407 2125 gene locus_tag LOCUS_13340 407 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 3408 2137 gene locus_tag LOCUS_13350 3408 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 3533 4606 gene locus_tag LOCUS_13360 3533 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence0196 1760 1161 gene locus_tag LOCUS_13370 1760 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2677 1757 gene locus_tag LOCUS_13380 2677 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 4509 2674 gene locus_tag LOCUS_13390 4509 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence0197 1806 430 gene locus_tag LOCUS_13400 1806 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 2636 1911 gene locus_tag LOCUS_13410 2636 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2673 3533 gene locus_tag LOCUS_13420 2673 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 3530 4351 gene locus_tag LOCUS_13430 3530 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 5031 4330 gene locus_tag LOCUS_13440 5031 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence0198 1019 186 gene locus_tag LOCUS_13450 1019 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1957 1016 gene locus_tag LOCUS_13460 1957 1016 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973851.1 protein_id gnl|my_center|LOCUS_13460 3575 1998 gene locus_tag LOCUS_13470 3575 1998 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_13470 4917 3583 gene locus_tag LOCUS_13480 4917 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence0199 292 1227 gene locus_tag LOCUS_13490 gene pyrB 292 1227 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP5 protein_id gnl|my_center|LOCUS_13490 1208 2473 gene locus_tag LOCUS_13500 gene pyrC 1208 2473 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP4 protein_id gnl|my_center|LOCUS_13500 2486 2962 gene locus_tag LOCUS_13510 gene greA 2486 2962 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV46 protein_id gnl|my_center|LOCUS_13510 2965 5436 gene locus_tag LOCUS_13520 2965 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence0200 <1 1430 gene locus_tag LOCUS_13530 <1 1430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Y6D6:putative RNA methyltransferase 1441 2961 gene locus_tag LOCUS_13540 1441 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3003 3965 gene locus_tag LOCUS_13550 3003 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 3953 4690 gene locus_tag LOCUS_13560 3953 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 4912 4691 gene locus_tag LOCUS_13570 4912 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 5691 4954 gene locus_tag LOCUS_13580 gene fliA 5691 4954 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MG14 protein_id gnl|my_center|LOCUS_13580 >Feature sequence0201 586 347 gene locus_tag LOCUS_13590 586 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 631 1131 gene locus_tag LOCUS_13600 631 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1131 2489 gene locus_tag LOCUS_13610 1131 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2530 2850 gene locus_tag LOCUS_13620 2530 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2898 3587 gene locus_tag LOCUS_13630 2898 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 3750 4430 gene locus_tag LOCUS_13640 3750 4430 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence0202 <1 1522 gene locus_tag LOCUS_13650 <1 1522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787020.1:TonB-dependent receptor 2229 1738 gene locus_tag LOCUS_13660 2229 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_13660 2308 2865 gene locus_tag LOCUS_13670 2308 2865 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640214.1 protein_id gnl|my_center|LOCUS_13670 2995 4218 gene locus_tag LOCUS_13680 gene bioF 2995 4218 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749W3 protein_id gnl|my_center|LOCUS_13680 4288 4950 gene locus_tag LOCUS_13690 4288 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 5098 4952 gene locus_tag LOCUS_13700 5098 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 <5704 5108 gene locus_tag LOCUS_13710 <5704 5108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528300.1:FAD-binding dehydrogenase >Feature sequence0203 <1 1402 gene locus_tag LOCUS_13720 <1 1402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080510933.1:formate dehydrogenase subunit alpha 1399 1815 gene locus_tag LOCUS_13730 1399 1815 CDS product glyoxalase/bleomycin resistance protein/dioxygenase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204789.1 protein_id gnl|my_center|LOCUS_13730 1818 2249 gene locus_tag LOCUS_13740 1818 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3061 2246 gene locus_tag LOCUS_13750 3061 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 3212 4504 gene locus_tag LOCUS_13760 3212 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence0204 >Feature sequence0205 <1 896 gene locus_tag LOCUS_13770 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87RE9:dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex 896 1216 gene locus_tag LOCUS_13780 896 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1905 1120 gene locus_tag LOCUS_13790 1905 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3338 1977 gene locus_tag LOCUS_13800 3338 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3415 3897 gene locus_tag LOCUS_13810 3415 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3894 4613 gene locus_tag LOCUS_13820 3894 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence0206 121 1164 gene locus_tag LOCUS_13830 121 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1280 1672 gene locus_tag LOCUS_13840 1280 1672 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_13840 1677 5207 gene locus_tag LOCUS_13850 1677 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence0207 1132 20 gene locus_tag LOCUS_13860 1132 20 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_13860 3186 1129 gene locus_tag LOCUS_13870 3186 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 4147 3206 gene locus_tag LOCUS_13880 4147 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 4901 4215 gene locus_tag LOCUS_13890 4901 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 <5660 4879 gene locus_tag LOCUS_13900 <5660 4879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731522.1:halogenase >Feature sequence0208 1539 418 gene locus_tag LOCUS_13910 1539 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2268 1597 gene locus_tag LOCUS_13920 2268 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 2317 4671 gene locus_tag LOCUS_13930 2317 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence0209 125 664 gene locus_tag LOCUS_13940 125 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 661 1656 gene locus_tag LOCUS_13950 661 1656 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_13950 1660 2565 gene locus_tag LOCUS_13960 1660 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259249.1 protein_id gnl|my_center|LOCUS_13960 2562 4289 gene locus_tag LOCUS_13970 2562 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence0210 1058 393 gene locus_tag LOCUS_13980 1058 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1111 2754 gene locus_tag LOCUS_13990 gene lysS 1111 2754 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X895 protein_id gnl|my_center|LOCUS_13990 3613 2759 gene locus_tag LOCUS_14000 3613 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3585 4382 gene locus_tag LOCUS_14010 gene thiD 3585 4382 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932848.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence0211 435 82 gene locus_tag LOCUS_14020 435 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1371 616 gene locus_tag LOCUS_14030 1371 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1543 3042 gene locus_tag LOCUS_14040 1543 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 3219 5477 gene locus_tag LOCUS_14050 gene acnA 3219 5477 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence0212 183 1103 gene locus_tag LOCUS_14060 183 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118168.1 protein_id gnl|my_center|LOCUS_14060 1648 1100 gene locus_tag LOCUS_14070 1648 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2141 1761 gene locus_tag LOCUS_14080 2141 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 3040 2138 gene locus_tag LOCUS_14090 3040 2138 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458890.1 protein_id gnl|my_center|LOCUS_14090 4207 3050 gene locus_tag LOCUS_14100 4207 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4893 4207 gene locus_tag LOCUS_14110 4893 4207 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528821.1 protein_id gnl|my_center|LOCUS_14110 5519 4890 gene locus_tag LOCUS_14120 5519 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence0213 1160 93 gene locus_tag LOCUS_14130 1160 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 4273 1217 gene locus_tag LOCUS_14140 4273 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence0214 2458 788 gene locus_tag LOCUS_14150 2458 788 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_14150 2506 3777 gene locus_tag LOCUS_14160 2506 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence0215 688 990 gene locus_tag LOCUS_14170 688 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 2127 1051 gene locus_tag LOCUS_14180 2127 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460509.1 protein_id gnl|my_center|LOCUS_14180 2162 3058 gene locus_tag LOCUS_14190 2162 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 4136 3060 gene locus_tag LOCUS_14200 4136 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence0216 1875 658 gene locus_tag LOCUS_14210 1875 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3710 1887 gene locus_tag LOCUS_14220 3710 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence0217 5539 1526 gene locus_tag LOCUS_14230 5539 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence0218 60 752 gene locus_tag LOCUS_14240 60 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1578 763 gene locus_tag LOCUS_14250 1578 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1611 2471 gene locus_tag LOCUS_14260 1611 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 3855 2386 gene locus_tag LOCUS_14270 3855 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4649 3834 gene locus_tag LOCUS_14280 4649 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 4724 5497 gene locus_tag LOCUS_14290 4724 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence0219 1870 1373 gene locus_tag LOCUS_14300 1870 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2676 2035 gene locus_tag LOCUS_14310 2676 2035 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072086.1 protein_id gnl|my_center|LOCUS_14310 3677 2673 gene locus_tag LOCUS_14320 3677 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 3676 4452 gene locus_tag LOCUS_14330 3676 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 4670 4449 gene locus_tag LOCUS_14340 4670 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 <5529 4667 gene locus_tag LOCUS_14350 <5529 4667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O54151:3-oxoacyl-[acyl-carrier-protein] synthase 3 protein 3 >Feature sequence0220 <1 650 gene locus_tag LOCUS_14360 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WJD1:iron-sulfur cluster carrier protein 650 1627 gene locus_tag LOCUS_14370 gene moaA 650 1627 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGL2 protein_id gnl|my_center|LOCUS_14370 1708 2715 gene locus_tag LOCUS_14380 1708 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2890 4233 gene locus_tag LOCUS_14390 2890 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 4280 5131 gene locus_tag LOCUS_14400 4280 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence0221 687 145 gene locus_tag LOCUS_14410 687 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1331 687 gene locus_tag LOCUS_14420 1331 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1501 2433 gene locus_tag LOCUS_14430 1501 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2435 3229 gene locus_tag LOCUS_14440 2435 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 3236 4567 gene locus_tag LOCUS_14450 3236 4567 CDS product type II/IV secretion system-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537977.1 protein_id gnl|my_center|LOCUS_14450 4569 5501 gene locus_tag LOCUS_14460 4569 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence0222 2263 1022 gene locus_tag LOCUS_14470 2263 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 <5501 2274 gene locus_tag LOCUS_14480 <5501 2274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709380.1:adenylate cyclase >Feature sequence0223 <1 897 gene locus_tag LOCUS_14490 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010951099.1:type III restriction endonuclease HindVIP subunit M 925 2550 gene locus_tag LOCUS_14500 gene fhs 925 2550 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FAG1 protein_id gnl|my_center|LOCUS_14500 3258 2551 gene locus_tag LOCUS_14510 3258 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255354.1 protein_id gnl|my_center|LOCUS_14510 4644 3268 gene locus_tag LOCUS_14520 4644 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 4698 5198 gene locus_tag LOCUS_14530 4698 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence0224 <1 2254 gene locus_tag LOCUS_14540 <1 2254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198575.1:peptidase 2328 3119 gene locus_tag LOCUS_14550 2328 3119 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5G3 protein_id gnl|my_center|LOCUS_14550 3116 3520 gene locus_tag LOCUS_14560 3116 3520 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence0225 883 158 gene locus_tag LOCUS_14570 883 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1046 2125 gene locus_tag LOCUS_14580 1046 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2125 2655 gene locus_tag LOCUS_14590 2125 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 2817 4208 gene locus_tag LOCUS_14600 2817 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence0226 1985 936 gene locus_tag LOCUS_14610 1985 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3735 2089 gene locus_tag LOCUS_14620 3735 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence0227 2 1252 gene locus_tag LOCUS_14630 2 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1263 1955 gene locus_tag LOCUS_14640 1263 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1983 3455 gene locus_tag LOCUS_14650 1983 3455 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_14650 3470 4423 gene locus_tag LOCUS_14660 3470 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 4465 5079 gene locus_tag LOCUS_14670 4465 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence0228 5060 396 gene locus_tag LOCUS_14680 5060 396 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706140.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence0229 1704 745 gene locus_tag LOCUS_14690 1704 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 3334 1790 gene locus_tag LOCUS_14700 gene purH 3334 1790 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUV9 protein_id gnl|my_center|LOCUS_14700 3851 3426 gene locus_tag LOCUS_14710 3851 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 5233 3839 gene locus_tag LOCUS_14720 5233 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence0230 383 1963 gene locus_tag LOCUS_14730 383 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1960 3012 gene locus_tag LOCUS_14740 1960 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3202 3951 gene locus_tag LOCUS_14750 3202 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence0231 1197 556 gene locus_tag LOCUS_14760 gene adk 1197 556 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR8 protein_id gnl|my_center|LOCUS_14760 2559 1207 gene locus_tag LOCUS_14770 gene secY 2559 1207 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A7 protein_id gnl|my_center|LOCUS_14770 3043 2591 gene locus_tag LOCUS_14780 gene rplO 3043 2591 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH7 protein_id gnl|my_center|LOCUS_14780 3262 3077 gene locus_tag LOCUS_14790 gene rpmD 3262 3077 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MCD0 protein_id gnl|my_center|LOCUS_14790 3880 3323 gene locus_tag LOCUS_14800 gene rpsE 3880 3323 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CG3 protein_id gnl|my_center|LOCUS_14800 4292 3921 gene locus_tag LOCUS_14810 gene rplR 4292 3921 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG31 protein_id gnl|my_center|LOCUS_14810 4840 4304 gene locus_tag LOCUS_14820 gene rplF 4840 4304 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5W0 protein_id gnl|my_center|LOCUS_14820 5245 4853 gene locus_tag LOCUS_14830 gene rpsH 5245 4853 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH0 protein_id gnl|my_center|LOCUS_14830 >Feature sequence0232 1228 2715 gene locus_tag LOCUS_14840 1228 2715 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058287.1 protein_id gnl|my_center|LOCUS_14840 3178 2720 gene locus_tag LOCUS_14850 3178 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3219 3554 gene locus_tag LOCUS_14860 3219 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence0233 499 89 gene locus_tag LOCUS_14870 499 89 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071479.1 protein_id gnl|my_center|LOCUS_14870 1141 524 gene locus_tag LOCUS_14880 1141 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 4350 1273 gene locus_tag LOCUS_14890 4350 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 5120 4518 gene locus_tag LOCUS_14900 5120 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 5406 5128 gene locus_tag LOCUS_14910 5406 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence0234 4739 1293 gene locus_tag LOCUS_14920 4739 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence0235 <1 700 gene locus_tag LOCUS_14930 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MHU1:argininosuccinate lyase 2338 716 gene locus_tag LOCUS_14940 gene thiC 2338 716 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHW3 protein_id gnl|my_center|LOCUS_14940 2874 2476 gene locus_tag LOCUS_14950 2874 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 3404 2892 gene locus_tag LOCUS_14960 3404 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 3581 3496 gene locus_tag LOCUS_t00040 3581 3496 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3630 3881 gene locus_tag LOCUS_14970 3630 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 3878 4375 gene locus_tag LOCUS_14980 3878 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 4816 4385 gene locus_tag LOCUS_14990 4816 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 5061 4825 gene locus_tag LOCUS_15000 5061 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence0236 1161 2549 gene locus_tag LOCUS_15010 1161 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2604 3314 gene locus_tag LOCUS_15020 2604 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4065 3331 gene locus_tag LOCUS_15030 4065 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence0237 2361 319 gene locus_tag LOCUS_15040 gene glyS 2361 319 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FM7 protein_id gnl|my_center|LOCUS_15040 3212 2358 gene locus_tag LOCUS_15050 gene glyQ 3212 2358 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FM8 protein_id gnl|my_center|LOCUS_15050 3303 3656 gene locus_tag LOCUS_15060 3303 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 4143 3724 gene locus_tag LOCUS_15070 4143 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 4422 4147 gene locus_tag LOCUS_15080 4422 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 5205 4489 gene locus_tag LOCUS_15090 5205 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence0238 2844 580 gene locus_tag LOCUS_15100 gene maeB 2844 580 CDS product bifunctional malic enzyme oxidoreductase/phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_15100 4352 3450 gene locus_tag LOCUS_15110 4352 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 4390 5091 gene locus_tag LOCUS_15120 4390 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 5161 5088 gene locus_tag LOCUS_t00050 5161 5088 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0239 839 237 gene locus_tag LOCUS_15130 839 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1701 1135 gene locus_tag LOCUS_15140 1701 1135 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHW8 protein_id gnl|my_center|LOCUS_15140 1725 3068 gene locus_tag LOCUS_15150 gene adcK4 1725 3068 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_15150 3142 3825 gene locus_tag LOCUS_15160 3142 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4393 3833 gene locus_tag LOCUS_15170 4393 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 <5305 4440 gene locus_tag LOCUS_15180 <5305 4440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976585.1:ABC transporter permease >Feature sequence0240 378 94 gene locus_tag LOCUS_15190 378 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 401 2548 gene locus_tag LOCUS_15200 401 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038019.1 protein_id gnl|my_center|LOCUS_15200 2583 3056 gene locus_tag LOCUS_15210 2583 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 4571 3060 gene locus_tag LOCUS_15220 4571 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 4823 4590 gene locus_tag LOCUS_15230 4823 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence0241 241 2247 gene locus_tag LOCUS_15240 241 2247 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_15240 2266 4218 gene locus_tag LOCUS_15250 2266 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 <5274 4231 gene locus_tag LOCUS_15260 <5274 4231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930546.1:ABC transporter ATP-binding protein >Feature sequence0242 >Feature sequence0243 188 1885 gene locus_tag LOCUS_15270 gene msbA 188 1885 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_15270 1882 2238 gene locus_tag LOCUS_15280 1882 2238 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680926.1 protein_id gnl|my_center|LOCUS_15280 2235 4142 gene locus_tag LOCUS_15290 2235 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 4142 4939 gene locus_tag LOCUS_15300 4142 4939 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708333.1 protein_id gnl|my_center|LOCUS_15300 4936 5109 gene locus_tag LOCUS_15310 4936 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence0244 2594 219 gene locus_tag LOCUS_15320 2594 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 2666 3085 gene locus_tag LOCUS_15330 2666 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3101 3643 gene locus_tag LOCUS_15340 3101 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4134 3613 gene locus_tag LOCUS_15350 4134 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 4939 4154 gene locus_tag LOCUS_15360 4939 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence0245 715 185 gene locus_tag LOCUS_15370 715 185 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817255.1 protein_id gnl|my_center|LOCUS_15370 1537 719 gene locus_tag LOCUS_15380 1537 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 3483 1573 gene locus_tag LOCUS_15390 3483 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 4140 3490 gene locus_tag LOCUS_15400 4140 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 4735 4277 gene locus_tag LOCUS_15410 4735 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence0246 1232 2590 gene locus_tag LOCUS_15420 1232 2590 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_15420 2616 3599 gene locus_tag LOCUS_15430 2616 3599 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_15430 3596 4561 gene locus_tag LOCUS_15440 3596 4561 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73N23 protein_id gnl|my_center|LOCUS_15440 4648 5157 gene locus_tag LOCUS_15450 gene rpoE 4648 5157 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence0247 3785 534 gene locus_tag LOCUS_15460 3785 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3813 4589 gene locus_tag LOCUS_15470 3813 4589 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535488.1 protein_id gnl|my_center|LOCUS_15470 4586 4846 gene locus_tag LOCUS_15480 4586 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence0248 1297 851 gene locus_tag LOCUS_15490 1297 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1780 1322 gene locus_tag LOCUS_15500 gene aroQ 1780 1322 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QP2 protein_id gnl|my_center|LOCUS_15500 2361 1783 gene locus_tag LOCUS_15510 2361 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3431 2364 gene locus_tag LOCUS_15520 gene aroB 3431 2364 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI75 protein_id gnl|my_center|LOCUS_15520 3907 3425 gene locus_tag LOCUS_15530 gene aroK 3907 3425 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI74 protein_id gnl|my_center|LOCUS_15530 <5151 3907 gene locus_tag LOCUS_15540 <5151 3907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942671.1:pilus modification protein PilQ >Feature sequence0249 457 1218 gene locus_tag LOCUS_15550 457 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1764 1237 gene locus_tag LOCUS_15560 1764 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2659 1781 gene locus_tag LOCUS_15570 2659 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 2758 3969 gene locus_tag LOCUS_15580 gene hutI 2758 3969 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUU1 protein_id gnl|my_center|LOCUS_15580 3983 4933 gene locus_tag LOCUS_15590 gene mtnA 3983 4933 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGQ8 protein_id gnl|my_center|LOCUS_15590 >Feature sequence0250 <1 517 gene locus_tag LOCUS_15600 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546105.1:twitching motility protein PilT 1130 507 gene locus_tag LOCUS_15610 1130 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2801 1263 gene locus_tag LOCUS_15620 2801 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3481 2798 gene locus_tag LOCUS_15630 3481 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 4802 3498 gene locus_tag LOCUS_15640 4802 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence0251 <1 908 gene locus_tag LOCUS_15650 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083417.1:DSBA oxidoreductase 931 4368 gene locus_tag LOCUS_15660 931 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence0252 2862 2116 gene locus_tag LOCUS_15670 2862 2116 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202330.1 protein_id gnl|my_center|LOCUS_15670 2894 4495 gene locus_tag LOCUS_15680 gene hutH 2894 4495 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA45 protein_id gnl|my_center|LOCUS_15680 >Feature sequence0253 604 134 gene locus_tag LOCUS_15690 gene smpB 604 134 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3DAB6 protein_id gnl|my_center|LOCUS_15690 789 1244 gene locus_tag LOCUS_15700 gene mraZ 789 1244 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07103 protein_id gnl|my_center|LOCUS_15700 1237 2121 gene locus_tag LOCUS_15710 gene rsmH 1237 2121 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT99 protein_id gnl|my_center|LOCUS_15710 2192 2521 gene locus_tag LOCUS_15720 2192 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2518 4542 gene locus_tag LOCUS_15730 gene ftsI 2518 4542 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence0254 629 267 gene locus_tag LOCUS_15740 629 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1692 622 gene locus_tag LOCUS_15750 gene serC 1692 622 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ66 protein_id gnl|my_center|LOCUS_15750 2904 1693 gene locus_tag LOCUS_15760 2904 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence0255 3999 1831 gene locus_tag LOCUS_15770 3999 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence0256 <1 1590 gene locus_tag LOCUS_15780 <1 1590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640352.1:penicillin-binding protein 1A 1587 2297 gene locus_tag LOCUS_15790 1587 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2300 4024 gene locus_tag LOCUS_15800 gene phoX 2300 4024 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036947.1 protein_id gnl|my_center|LOCUS_15800 5088 4039 gene locus_tag LOCUS_15810 5088 4039 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence0257 <1 1036 gene locus_tag LOCUS_15820 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390236.1:multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase 1046 1927 gene locus_tag LOCUS_15830 1046 1927 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939052.1 protein_id gnl|my_center|LOCUS_15830 2137 1943 gene locus_tag LOCUS_15840 2137 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 2485 2150 gene locus_tag LOCUS_15850 2485 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 3469 2555 gene locus_tag LOCUS_15860 3469 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3838 3488 gene locus_tag LOCUS_15870 3838 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 4603 4085 gene locus_tag LOCUS_15880 4603 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence0258 943 1863 gene locus_tag LOCUS_15890 943 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 3475 1844 gene locus_tag LOCUS_15900 3475 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 3530 4057 gene locus_tag LOCUS_15910 3530 4057 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_15910 4057 4389 gene locus_tag LOCUS_15920 4057 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence0259 627 1454 gene locus_tag LOCUS_15930 627 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1487 2173 gene locus_tag LOCUS_15940 1487 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2462 2181 gene locus_tag LOCUS_15950 2462 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 2990 2463 gene locus_tag LOCUS_15960 2990 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 4513 2987 gene locus_tag LOCUS_15970 4513 2987 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence0260 263 595 gene locus_tag LOCUS_15980 gene iscA 263 595 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E782 protein_id gnl|my_center|LOCUS_15980 609 1157 gene locus_tag LOCUS_15990 609 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1164 2996 gene locus_tag LOCUS_16000 gene hscA 1164 2996 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXG7 protein_id gnl|my_center|LOCUS_16000 4340 2997 gene locus_tag LOCUS_16010 4340 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 <5067 4337 gene locus_tag LOCUS_16020 <5067 4337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705066.1:putative fatty-acid-CoA synthetase FadD >Feature sequence0261 1829 39 gene locus_tag LOCUS_16030 1829 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2698 1850 gene locus_tag LOCUS_16040 2698 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 3172 2705 gene locus_tag LOCUS_16050 3172 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3675 3169 gene locus_tag LOCUS_16060 3675 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 4679 3672 gene locus_tag LOCUS_16070 gene gpsA 4679 3672 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61740 protein_id gnl|my_center|LOCUS_16070 >Feature sequence0262 942 1697 gene locus_tag LOCUS_16080 942 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1694 3127 gene locus_tag LOCUS_16090 1694 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3216 4163 gene locus_tag LOCUS_16100 3216 4163 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888319.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence0263 937 1434 gene locus_tag LOCUS_16110 937 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1431 2186 gene locus_tag LOCUS_16120 1431 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 3578 2190 gene locus_tag LOCUS_16130 3578 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3931 3668 gene locus_tag LOCUS_16140 3931 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence0264 <1 933 gene locus_tag LOCUS_16150 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255918.1:protein kinase 933 1493 gene locus_tag LOCUS_16160 933 1493 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368954.1 protein_id gnl|my_center|LOCUS_16160 2465 1506 gene locus_tag LOCUS_16170 2465 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 3355 2462 gene locus_tag LOCUS_16180 3355 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3876 3352 gene locus_tag LOCUS_16190 3876 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 3920 4837 gene locus_tag LOCUS_16200 3920 4837 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C45 protein_id gnl|my_center|LOCUS_16200 >Feature sequence0265 1501 347 gene locus_tag LOCUS_16210 gene deoB 1501 347 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RID0 protein_id gnl|my_center|LOCUS_16210 2355 1501 gene locus_tag LOCUS_16220 gene deoC 2355 1501 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MZ72 protein_id gnl|my_center|LOCUS_16220 2418 3167 gene locus_tag LOCUS_16230 2418 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence0266 162 2483 gene locus_tag LOCUS_16240 162 2483 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_16240 2559 2990 gene locus_tag LOCUS_16250 2559 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2996 4057 gene locus_tag LOCUS_16260 2996 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 4107 4562 gene locus_tag LOCUS_16270 4107 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence0267 <1 625 gene locus_tag LOCUS_16280 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000060578.1:multidrug MFS transporter 675 2264 gene locus_tag LOCUS_16290 675 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 2261 3238 gene locus_tag LOCUS_16300 2261 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 3371 4783 gene locus_tag LOCUS_16310 3371 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence0268 1540 2181 gene locus_tag LOCUS_16320 1540 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2582 2094 gene locus_tag LOCUS_16330 2582 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 2640 3122 gene locus_tag LOCUS_16340 2640 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 <5005 3131 gene locus_tag LOCUS_16350 <5005 3131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147051.1:serine/threonine protein kinase >Feature sequence0269 582 974 gene locus_tag LOCUS_16360 582 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 982 1140 gene locus_tag LOCUS_16370 982 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1300 1584 gene locus_tag LOCUS_16380 1300 1584 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FU4 protein_id gnl|my_center|LOCUS_16380 1581 2510 gene locus_tag LOCUS_16390 1581 2510 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887534.1 protein_id gnl|my_center|LOCUS_16390 2507 3271 gene locus_tag LOCUS_16400 2507 3271 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091874.1 protein_id gnl|my_center|LOCUS_16400 3268 4302 gene locus_tag LOCUS_16410 gene rlmN 3268 4302 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E53 protein_id gnl|my_center|LOCUS_16410 >Feature sequence0270 1105 536 gene locus_tag LOCUS_16420 1105 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1260 1102 gene locus_tag LOCUS_16430 1260 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2177 1329 gene locus_tag LOCUS_16440 2177 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 3250 2174 gene locus_tag LOCUS_16450 3250 2174 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142134.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence0271 181 3531 gene locus_tag LOCUS_16460 181 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence0272 278 1576 gene locus_tag LOCUS_16470 278 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2351 1503 gene locus_tag LOCUS_16480 gene trmJ 2351 1503 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX37 protein_id gnl|my_center|LOCUS_16480 4134 2356 gene locus_tag LOCUS_16490 gene dnaK 4134 2356 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_16490 <4948 4223 gene locus_tag LOCUS_16500 <4948 4223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009930756.1:galactitol-1-phosphate 5-dehydrogenase >Feature sequence0273 369 1286 gene locus_tag LOCUS_16510 369 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1286 1645 gene locus_tag LOCUS_16520 1286 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256413.1 protein_id gnl|my_center|LOCUS_16520 1642 3309 gene locus_tag LOCUS_16530 1642 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 3306 4259 gene locus_tag LOCUS_16540 3306 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence0274 1640 567 gene locus_tag LOCUS_16550 1640 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1741 3204 gene locus_tag LOCUS_16560 1741 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 3880 3218 gene locus_tag LOCUS_16570 3880 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 4786 3977 gene locus_tag LOCUS_16580 4786 3977 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089324.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence0275 1579 677 gene locus_tag LOCUS_16590 1579 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3009 1594 gene locus_tag LOCUS_16600 gene glgA 3009 1594 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIS8 protein_id gnl|my_center|LOCUS_16600 4615 3110 gene locus_tag LOCUS_16610 4615 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence0276 >Feature sequence0277 910 1704 gene locus_tag LOCUS_16620 910 1704 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 protein_id gnl|my_center|LOCUS_16620 1701 3545 gene locus_tag LOCUS_16630 gene uup 1701 3545 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence0278 <1 754 gene locus_tag LOCUS_16640 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766801.1:hybrid sensor histidine kinase/response regulator 792 1325 gene locus_tag LOCUS_16650 792 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1344 3014 gene locus_tag LOCUS_16660 1344 3014 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144132.1 protein_id gnl|my_center|LOCUS_16660 4364 3015 gene locus_tag LOCUS_16670 gene fadL 4364 3015 CDS product long-chain fatty acid transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4Y8 protein_id gnl|my_center|LOCUS_16670 >Feature sequence0279 4079 2343 gene locus_tag LOCUS_16680 4079 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence0280 1071 163 gene locus_tag LOCUS_16690 1071 163 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038750.1 protein_id gnl|my_center|LOCUS_16690 1177 1545 gene locus_tag LOCUS_16700 1177 1545 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122416.1 protein_id gnl|my_center|LOCUS_16700 2195 1536 gene locus_tag LOCUS_16710 2195 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16710 3029 2244 gene locus_tag LOCUS_16720 3029 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16720 3901 3026 gene locus_tag LOCUS_16730 3901 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence0281 161 2431 gene locus_tag LOCUS_16740 161 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 3313 2441 gene locus_tag LOCUS_16750 3313 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 4617 3316 gene locus_tag LOCUS_16760 4617 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence0282 285 1703 gene locus_tag LOCUS_16770 285 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1706 3100 gene locus_tag LOCUS_16780 1706 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3127 4287 gene locus_tag LOCUS_16790 3127 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 <4842 4241 gene locus_tag LOCUS_16800 <4842 4241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545377.1:LysR family transcriptional regulator >Feature sequence0283 2274 1267 gene locus_tag LOCUS_16810 2274 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3394 2264 gene locus_tag LOCUS_16820 3394 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 <4837 3426 gene locus_tag LOCUS_16830 <4837 3426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258472.1:cytochrome P450 >Feature sequence0284 33 278 gene locus_tag LOCUS_16840 33 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 400 1758 gene locus_tag LOCUS_16850 400 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1791 2633 gene locus_tag LOCUS_16860 gene dapA 1791 2633 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AX2 protein_id gnl|my_center|LOCUS_16860 2633 3361 gene locus_tag LOCUS_16870 gene dapB 2633 3361 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY36 protein_id gnl|my_center|LOCUS_16870 4316 3351 gene locus_tag LOCUS_16880 gene dusA 4316 3351 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAJ0 protein_id gnl|my_center|LOCUS_16880 >Feature sequence0285 975 1421 gene locus_tag LOCUS_16890 975 1421 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_16890 2906 1434 gene locus_tag LOCUS_16900 2906 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3029 3766 gene locus_tag LOCUS_16910 3029 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence0286 3150 1525 gene locus_tag LOCUS_16920 3150 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence0287 1808 852 gene locus_tag LOCUS_16930 1808 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1843 2406 gene locus_tag LOCUS_16940 1843 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 2814 2419 gene locus_tag LOCUS_16950 2814 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 3827 2814 gene locus_tag LOCUS_16960 3827 2814 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229262.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence0288 >Feature sequence0289 68 1366 gene locus_tag LOCUS_16970 68 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 2126 1536 gene locus_tag LOCUS_16980 2126 1536 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_16980 2806 2219 gene locus_tag LOCUS_16990 2806 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2841 3833 gene locus_tag LOCUS_17000 2841 3833 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143926.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence0290 969 490 gene locus_tag LOCUS_17010 969 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1002 2219 gene locus_tag LOCUS_17020 1002 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 3273 2299 gene locus_tag LOCUS_17030 3273 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 3324 3833 gene locus_tag LOCUS_17040 3324 3833 CDS product PhnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706207.1 protein_id gnl|my_center|LOCUS_17040 3837 4382 gene locus_tag LOCUS_17050 3837 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence0291 211 1047 gene locus_tag LOCUS_17060 211 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1087 3303 gene locus_tag LOCUS_17070 1087 3303 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 protein_id gnl|my_center|LOCUS_17070 3300 4319 gene locus_tag LOCUS_17080 3300 4319 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338853.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence0292 1824 1363 gene locus_tag LOCUS_17090 1824 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1933 2316 gene locus_tag LOCUS_17100 1933 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 <4774 2360 gene locus_tag LOCUS_17110 <4774 2360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein >Feature sequence0293 2305 173 gene locus_tag LOCUS_17120 2305 173 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4M5 protein_id gnl|my_center|LOCUS_17120 2446 3210 gene locus_tag LOCUS_17130 2446 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 4094 3183 gene locus_tag LOCUS_17140 4094 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 <4760 4095 gene locus_tag LOCUS_17150 <4760 4095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809389.1:aldo/keto reductase >Feature sequence0294 932 129 gene locus_tag LOCUS_17160 932 129 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67541 protein_id gnl|my_center|LOCUS_17160 2045 1035 gene locus_tag LOCUS_17170 2045 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2702 2082 gene locus_tag LOCUS_17180 gene rpoE 2702 2082 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E308 protein_id gnl|my_center|LOCUS_17180 3240 2785 gene locus_tag LOCUS_17190 3240 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 4208 3243 gene locus_tag LOCUS_17200 gene gshB 4208 3243 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CU65 protein_id gnl|my_center|LOCUS_17200 >Feature sequence0295 768 1667 gene locus_tag LOCUS_17210 768 1667 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_17210 2823 1678 gene locus_tag LOCUS_17220 2823 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 3141 2848 gene locus_tag LOCUS_17230 3141 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 <4732 3141 gene locus_tag LOCUS_17240 <4732 3141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249027.1:tungsten-containing oxidoreductase >Feature sequence0296 <1 951 gene locus_tag LOCUS_17250 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272456.1:two-component sensor histidine kinase 2984 933 gene locus_tag LOCUS_17260 2984 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 3998 3018 gene locus_tag LOCUS_17270 3998 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982215.1 protein_id gnl|my_center|LOCUS_17270 <4722 4032 gene locus_tag LOCUS_17280 <4722 4032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339409.1:aldehyde oxidase >Feature sequence0297 1683 508 gene locus_tag LOCUS_17290 1683 508 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403941.1 protein_id gnl|my_center|LOCUS_17290 2132 1899 gene locus_tag LOCUS_17300 2132 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3313 2489 gene locus_tag LOCUS_17310 3313 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3337 4023 gene locus_tag LOCUS_17320 3337 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 4716 4048 gene locus_tag LOCUS_17330 4716 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence0298 1908 2333 gene locus_tag LOCUS_17340 1908 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 2451 3095 gene locus_tag LOCUS_17350 gene msrA 2451 3095 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_17350 4056 3109 gene locus_tag LOCUS_17360 4056 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence0299 2380 995 gene locus_tag LOCUS_17370 2380 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 2573 2373 gene locus_tag LOCUS_17380 2573 2373 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_17380 3658 2570 gene locus_tag LOCUS_17390 gene pilT 3658 2570 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_17390 3641 4294 gene locus_tag LOCUS_17400 3641 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence0300 1215 667 gene locus_tag LOCUS_17410 1215 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 2083 1244 gene locus_tag LOCUS_17420 2083 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence0301 545 976 gene locus_tag LOCUS_17430 545 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 973 1953 gene locus_tag LOCUS_17440 973 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 2309 2034 gene locus_tag LOCUS_17450 gene rpst 2309 2034 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5G5 protein_id gnl|my_center|LOCUS_17450 2488 3795 gene locus_tag LOCUS_17460 gene ugd 2488 3795 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence0302 <1 586 gene locus_tag LOCUS_17470 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WPF3:alpha-pyrone synthesis polyketide synthase-like Pks11 595 1335 gene locus_tag LOCUS_17480 595 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1377 2054 gene locus_tag LOCUS_17490 1377 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3141 2059 gene locus_tag LOCUS_17500 3141 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence0303 1062 274 gene locus_tag LOCUS_17510 1062 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 1371 1108 gene locus_tag LOCUS_17520 1371 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1685 2530 gene locus_tag LOCUS_17530 1685 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2430 3365 gene locus_tag LOCUS_17540 2430 3365 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942950.1 protein_id gnl|my_center|LOCUS_17540 3454 4395 gene locus_tag LOCUS_17550 3454 4395 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence0304 1510 797 gene locus_tag LOCUS_17560 1510 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 2123 1521 gene locus_tag LOCUS_17570 2123 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2235 3842 gene locus_tag LOCUS_17580 2235 3842 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_17580 4263 3847 gene locus_tag LOCUS_17590 4263 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence0305 2133 895 gene locus_tag LOCUS_17600 2133 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 3633 2461 gene locus_tag LOCUS_17610 3633 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_17610 4421 3630 gene locus_tag LOCUS_17620 4421 3630 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence0306 <1 636 gene locus_tag LOCUS_17630 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391121.1:diguanylate cyclase 647 1273 gene locus_tag LOCUS_17640 647 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1384 2601 gene locus_tag LOCUS_17650 gene rho 1384 2601 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010790.2 protein_id gnl|my_center|LOCUS_17650 2676 2936 gene locus_tag LOCUS_17660 gene rpmE 2676 2936 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3N0Q3 protein_id gnl|my_center|LOCUS_17660 3028 4116 gene locus_tag LOCUS_17670 gene prfA 3028 4116 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence0307 1010 45 gene locus_tag LOCUS_17680 1010 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1009 4545 gene locus_tag LOCUS_17690 1009 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence0308 2071 1301 gene locus_tag LOCUS_17700 gene coaX 2071 1301 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EB4 protein_id gnl|my_center|LOCUS_17700 4268 2082 gene locus_tag LOCUS_17710 gene relA 4268 2082 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_17710 4611 4294 gene locus_tag LOCUS_17720 4611 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence0309 299 1159 gene locus_tag LOCUS_17730 299 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1156 2226 gene locus_tag LOCUS_17740 1156 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2392 2880 gene locus_tag LOCUS_17750 2392 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 3927 2989 gene locus_tag LOCUS_17760 3927 2989 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405050.1 protein_id gnl|my_center|LOCUS_17760 <4609 4064 gene locus_tag LOCUS_17770 <4609 4064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024413.1:dihydrofolate reductase >Feature sequence0310 325 921 gene locus_tag LOCUS_17780 325 921 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809919.1 protein_id gnl|my_center|LOCUS_17780 918 1967 gene locus_tag LOCUS_17790 918 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 3900 1978 gene locus_tag LOCUS_17800 3900 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence0311 1443 22 gene locus_tag LOCUS_17810 1443 22 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920467.1 protein_id gnl|my_center|LOCUS_17810 1925 1437 gene locus_tag LOCUS_17820 1925 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 2705 1935 gene locus_tag LOCUS_17830 2705 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2744 4231 gene locus_tag LOCUS_17840 2744 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence0312 322 924 gene locus_tag LOCUS_17850 322 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 926 1084 gene locus_tag LOCUS_17860 926 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1087 1707 gene locus_tag LOCUS_17870 1087 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2776 1718 gene locus_tag LOCUS_17880 2776 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 3753 2776 gene locus_tag LOCUS_17890 3753 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence0313 1641 403 gene locus_tag LOCUS_17900 gene argD 1641 403 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB46 protein_id gnl|my_center|LOCUS_17900 1681 3096 gene locus_tag LOCUS_17910 1681 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 4536 3097 gene locus_tag LOCUS_17920 gene mpl 4536 3097 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence0314 1910 1837 gene locus_tag LOCUS_t00060 1910 1837 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2909 2082 gene locus_tag LOCUS_17930 2909 2082 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942276.1 protein_id gnl|my_center|LOCUS_17930 3240 2917 gene locus_tag LOCUS_17940 3240 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 3282 4028 gene locus_tag LOCUS_17950 3282 4028 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976385.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence0315 3169 1778 gene locus_tag LOCUS_17960 gene pntB 3169 1778 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FVC3 protein_id gnl|my_center|LOCUS_17960 <4596 3169 gene locus_tag LOCUS_17970 <4596 3169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0E0Y0A7:NAD(P) transhydrogenase subunit alpha >Feature sequence0316 2291 1143 gene locus_tag LOCUS_17980 2291 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2939 2400 gene locus_tag LOCUS_17990 2939 2400 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_17990 4200 3076 gene locus_tag LOCUS_18000 4200 3076 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence0317 1569 856 gene locus_tag LOCUS_18010 1569 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2348 1569 gene locus_tag LOCUS_18020 gene scpA 2348 1569 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C43 protein_id gnl|my_center|LOCUS_18020 3312 2476 gene locus_tag LOCUS_18030 3312 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 3351 3899 gene locus_tag LOCUS_18040 3351 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence0318 887 1738 gene locus_tag LOCUS_18050 gene ubiA 887 1738 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964118.1 protein_id gnl|my_center|LOCUS_18050 1726 4314 gene locus_tag LOCUS_18060 1726 4314 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964119.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence0319 337 663 gene locus_tag LOCUS_18070 337 663 CDS product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707324.1 protein_id gnl|my_center|LOCUS_18070 675 827 gene locus_tag LOCUS_18080 675 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 871 1290 gene locus_tag LOCUS_18090 871 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1401 3146 gene locus_tag LOCUS_18100 1401 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 <4565 3192 gene locus_tag LOCUS_18110 <4565 3192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000200580.1:hemolysin >Feature sequence0320 1158 2639 gene locus_tag LOCUS_18120 1158 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224279.1 protein_id gnl|my_center|LOCUS_18120 3554 2640 gene locus_tag LOCUS_18130 3554 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 >Feature sequence0321 105 1229 gene locus_tag LOCUS_18140 105 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1296 2984 gene locus_tag LOCUS_18150 1296 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence0322 2281 806 gene locus_tag LOCUS_18160 2281 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 3071 2304 gene locus_tag LOCUS_18170 3071 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 4205 3090 gene locus_tag LOCUS_18180 4205 3090 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941287.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence0323 672 46 gene locus_tag LOCUS_18190 672 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1678 677 gene locus_tag LOCUS_18200 gene prs 1678 677 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MC73 protein_id gnl|my_center|LOCUS_18200 1720 3231 gene locus_tag LOCUS_18210 1720 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 3759 3232 gene locus_tag LOCUS_18220 3759 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 3771 4412 gene locus_tag LOCUS_18230 3771 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528995.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence0324 1053 1319 gene locus_tag LOCUS_18240 1053 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1376 1879 gene locus_tag LOCUS_18250 1376 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 2350 1817 gene locus_tag LOCUS_18260 2350 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 2799 2350 gene locus_tag LOCUS_18270 2799 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence0325 840 1553 gene locus_tag LOCUS_18280 840 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 3500 1572 gene locus_tag LOCUS_18290 3500 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 3855 3550 gene locus_tag LOCUS_18300 3855 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 >Feature sequence0326 678 124 gene locus_tag LOCUS_18310 678 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 1669 698 gene locus_tag LOCUS_18320 1669 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 3689 1707 gene locus_tag LOCUS_18330 3689 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 4408 3725 gene locus_tag LOCUS_18340 4408 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence0327 <1 1519 gene locus_tag LOCUS_18350 <1 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193111.1:GTP-binding protein 1548 2285 gene locus_tag LOCUS_18360 1548 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 3830 2286 gene locus_tag LOCUS_18370 3830 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence0328 531 361 gene locus_tag LOCUS_18380 531 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 896 621 gene locus_tag LOCUS_18390 896 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1425 955 gene locus_tag LOCUS_18400 1425 955 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972483.1 protein_id gnl|my_center|LOCUS_18400 2575 1433 gene locus_tag LOCUS_18410 2575 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 2782 3027 gene locus_tag LOCUS_18420 2782 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 3425 3102 gene locus_tag LOCUS_18430 3425 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 3858 3436 gene locus_tag LOCUS_18440 3858 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 4241 3855 gene locus_tag LOCUS_18450 4241 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence0329 700 2268 gene locus_tag LOCUS_18460 700 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 3198 2281 gene locus_tag LOCUS_18470 3198 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 3675 3208 gene locus_tag LOCUS_18480 3675 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence0330 294 1778 gene locus_tag LOCUS_18490 294 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18490 1786 2517 gene locus_tag LOCUS_18500 gene fixO1 1786 2517 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967643.1 protein_id gnl|my_center|LOCUS_18500 2514 2696 gene locus_tag LOCUS_18510 2514 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2689 3189 gene locus_tag LOCUS_18520 2689 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 3189 3359 gene locus_tag LOCUS_18530 3189 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence0331 1575 1165 gene locus_tag LOCUS_18540 1575 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2207 1674 gene locus_tag LOCUS_18550 2207 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2342 3364 gene locus_tag LOCUS_18560 2342 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3956 3402 gene locus_tag LOCUS_18570 3956 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence0332 992 255 gene locus_tag LOCUS_18580 992 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1930 989 gene locus_tag LOCUS_18590 1930 989 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903481.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence0333 2838 646 gene locus_tag LOCUS_18600 2838 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227758.1 protein_id gnl|my_center|LOCUS_18600 3918 2839 gene locus_tag LOCUS_18610 3918 2839 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence0334 263 1405 gene locus_tag LOCUS_18620 263 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3027 1408 gene locus_tag LOCUS_18630 3027 1408 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_18630 3063 4004 gene locus_tag LOCUS_18640 3063 4004 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNS3 protein_id gnl|my_center|LOCUS_18640 >Feature sequence0335 1599 355 gene locus_tag LOCUS_18650 1599 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2507 1596 gene locus_tag LOCUS_18660 2507 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 4141 2504 gene locus_tag LOCUS_18670 4141 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence0336 1923 1477 gene locus_tag LOCUS_18680 1923 1477 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_18680 3123 1933 gene locus_tag LOCUS_18690 3123 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 3392 3237 gene locus_tag LOCUS_18700 3392 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941645.1 protein_id gnl|my_center|LOCUS_18700 3757 3392 gene locus_tag LOCUS_18710 3757 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226671.1 protein_id gnl|my_center|LOCUS_18710 4261 3818 gene locus_tag LOCUS_18720 4261 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence0337 834 484 gene locus_tag LOCUS_18730 834 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 914 1495 gene locus_tag LOCUS_18740 914 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2063 1488 gene locus_tag LOCUS_18750 2063 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence0338 <1 799 gene locus_tag LOCUS_18760 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141986.1:penicillin amidase 888 1550 gene locus_tag LOCUS_18770 888 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1614 2108 gene locus_tag LOCUS_18780 1614 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 2136 3338 gene locus_tag LOCUS_18790 2136 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence0339 933 1532 gene locus_tag LOCUS_18800 933 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1532 1891 gene locus_tag LOCUS_18810 1532 1891 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_18810 1981 2772 gene locus_tag LOCUS_18820 1981 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2800 4095 gene locus_tag LOCUS_18830 2800 4095 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297122.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence0340 1409 810 gene locus_tag LOCUS_18840 1409 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1906 1631 gene locus_tag LOCUS_18850 1906 1631 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940232.1 protein_id gnl|my_center|LOCUS_18850 3295 2225 gene locus_tag LOCUS_18860 3295 2225 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_18860 4275 3562 gene locus_tag LOCUS_18870 4275 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence0341 3958 3545 gene locus_tag LOCUS_18880 3958 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 4385 4008 gene locus_tag LOCUS_18890 4385 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259291.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence0342 >Feature sequence0343 771 4 gene locus_tag LOCUS_18900 771 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 2690 822 gene locus_tag LOCUS_18910 2690 822 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026866.1 protein_id gnl|my_center|LOCUS_18910 2813 3898 gene locus_tag LOCUS_18920 2813 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 3902 4390 gene locus_tag LOCUS_18930 3902 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence0344 2282 1464 gene locus_tag LOCUS_18940 2282 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2319 3416 gene locus_tag LOCUS_18950 2319 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 3989 3522 gene locus_tag LOCUS_18960 3989 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence0345 892 464 gene locus_tag LOCUS_18970 892 464 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230741.1 protein_id gnl|my_center|LOCUS_18970 967 3063 gene locus_tag LOCUS_18980 967 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 3693 3112 gene locus_tag LOCUS_18990 3693 3112 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence0346 1702 2673 gene locus_tag LOCUS_19000 1702 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 3138 2695 gene locus_tag LOCUS_19010 3138 2695 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184408.1 protein_id gnl|my_center|LOCUS_19010 3566 3135 gene locus_tag LOCUS_19020 3566 3135 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_19020 3720 4205 gene locus_tag LOCUS_19030 3720 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence0347 2343 1033 gene locus_tag LOCUS_19040 2343 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2417 3682 gene locus_tag LOCUS_19050 2417 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence0348 2238 874 gene locus_tag LOCUS_19060 gene lpdA 2238 874 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S257 protein_id gnl|my_center|LOCUS_19060 3538 2240 gene locus_tag LOCUS_19070 gene aceF 3538 2240 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4N2 protein_id gnl|my_center|LOCUS_19070 4361 3540 gene locus_tag LOCUS_19080 gene acoB 4361 3540 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence0349 1279 338 gene locus_tag LOCUS_19090 1279 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1848 1276 gene locus_tag LOCUS_19100 1848 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 3237 1858 gene locus_tag LOCUS_19110 3237 1858 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence0350 <1 609 gene locus_tag LOCUS_19120 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259445.1:TIGR00374 family protein 1011 616 gene locus_tag LOCUS_19130 1011 616 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174007.1 protein_id gnl|my_center|LOCUS_19130 1051 1860 gene locus_tag LOCUS_19140 1051 1860 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339275.1 protein_id gnl|my_center|LOCUS_19140 2703 1861 gene locus_tag LOCUS_19150 2703 1861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_19150 3464 2703 gene locus_tag LOCUS_19160 3464 2703 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_19160 3934 3461 gene locus_tag LOCUS_19170 3934 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence0351 3318 577 gene locus_tag LOCUS_19180 3318 577 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902898.1 protein_id gnl|my_center|LOCUS_19180 4213 3407 gene locus_tag LOCUS_19190 4213 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence0352 525 1133 gene locus_tag LOCUS_19200 525 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1138 2463 gene locus_tag LOCUS_19210 1138 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123852.1 protein_id gnl|my_center|LOCUS_19210 3943 2528 gene locus_tag LOCUS_19220 3943 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence0353 2789 1830 gene locus_tag LOCUS_19230 2789 1830 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268875.1 protein_id gnl|my_center|LOCUS_19230 3432 2770 gene locus_tag LOCUS_19240 3432 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 3463 4197 gene locus_tag LOCUS_19250 3463 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence0354 <1 1743 gene locus_tag LOCUS_19260 <1 1743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704518.1:putative protease IV SppA 1851 2612 gene locus_tag LOCUS_19270 1851 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2644 3402 gene locus_tag LOCUS_19280 2644 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 3441 3668 gene locus_tag LOCUS_19290 3441 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 <4325 3678 gene locus_tag LOCUS_19300 <4325 3678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815002.1:hydrolase TatD >Feature sequence0355 649 1116 gene locus_tag LOCUS_19310 649 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 1178 1564 gene locus_tag LOCUS_19320 1178 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 1561 2319 gene locus_tag LOCUS_19330 1561 2319 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337272.1 protein_id gnl|my_center|LOCUS_19330 2351 2845 gene locus_tag LOCUS_19340 2351 2845 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833668.1 protein_id gnl|my_center|LOCUS_19340 2842 3219 gene locus_tag LOCUS_19350 2842 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 4011 3238 gene locus_tag LOCUS_19360 4011 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 >Feature sequence0356 882 190 gene locus_tag LOCUS_19370 gene phoB 882 190 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_19370 2072 954 gene locus_tag LOCUS_19380 2072 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2869 2270 gene locus_tag LOCUS_19390 2869 2270 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204341.1 protein_id gnl|my_center|LOCUS_19390 2913 3638 gene locus_tag LOCUS_19400 2913 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence0357 117 1187 gene locus_tag LOCUS_19410 117 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1219 2010 gene locus_tag LOCUS_19420 gene cobB2 1219 2010 CDS product NAD-dependent protein deacylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E1 protein_id gnl|my_center|LOCUS_19420 2038 3075 gene locus_tag LOCUS_19430 2038 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 3072 3785 gene locus_tag LOCUS_19440 3072 3785 CDS product molybdenum ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence0358 849 217 gene locus_tag LOCUS_19450 gene exbB 849 217 CDS product TolQ transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177702.1 protein_id gnl|my_center|LOCUS_19450 1083 1009 gene locus_tag LOCUS_t00070 1083 1009 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1213 2259 gene locus_tag LOCUS_19460 1213 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4037 2217 gene locus_tag LOCUS_19470 4037 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence0359 698 225 gene locus_tag LOCUS_19480 698 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 714 884 gene locus_tag LOCUS_19490 714 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 881 1228 gene locus_tag LOCUS_19500 881 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 1247 2851 gene locus_tag LOCUS_19510 1247 2851 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence0360 514 1125 gene locus_tag LOCUS_19520 514 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1188 1661 gene locus_tag LOCUS_19530 1188 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 1658 2104 gene locus_tag LOCUS_19540 1658 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 3034 2108 gene locus_tag LOCUS_19550 3034 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 3259 3038 gene locus_tag LOCUS_19560 3259 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 3280 4212 gene locus_tag LOCUS_19570 3280 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence0361 195 1292 gene locus_tag LOCUS_19580 195 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2325 1330 gene locus_tag LOCUS_19590 2325 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2368 3168 gene locus_tag LOCUS_19600 2368 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence0362 675 1376 gene locus_tag LOCUS_19610 675 1376 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_19610 1373 3115 gene locus_tag LOCUS_19620 1373 3115 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028428.1 protein_id gnl|my_center|LOCUS_19620 3133 3630 gene locus_tag LOCUS_19630 3133 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 3730 3915 gene locus_tag LOCUS_19640 3730 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence0363 <1 851 gene locus_tag LOCUS_19650 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256328.1:FAD-dependent oxidoreductase 966 3170 gene locus_tag LOCUS_19660 966 3170 CDS product tungsten formylmethanofuran dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403352.1 protein_id gnl|my_center|LOCUS_19660 3659 3210 gene locus_tag LOCUS_19670 3659 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence0364 <1 2197 gene locus_tag LOCUS_19680 <1 2197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122418.1:inter-alpha-trypsin inhibitor domain-containing protein 2605 2204 gene locus_tag LOCUS_19690 2605 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3466 2705 gene locus_tag LOCUS_19700 3466 2705 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869449.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence0365 2399 990 gene locus_tag LOCUS_19710 2399 990 CDS product sodium/panthothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098994.1 protein_id gnl|my_center|LOCUS_19710 3466 2396 gene locus_tag LOCUS_19720 3466 2396 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206330.1 protein_id gnl|my_center|LOCUS_19720 <4256 3463 gene locus_tag LOCUS_19730 <4256 3463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000206330.1:class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC >Feature sequence0366 2996 807 gene locus_tag LOCUS_19740 2996 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence0367 2042 1014 gene locus_tag LOCUS_19750 2042 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3779 2079 gene locus_tag LOCUS_19760 gene yidC 3779 2079 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Q2 protein_id gnl|my_center|LOCUS_19760 4041 3766 gene locus_tag LOCUS_19770 gene yrcB 4041 3766 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CF09 protein_id gnl|my_center|LOCUS_19770 >Feature sequence0368 2105 501 gene locus_tag LOCUS_19780 2105 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2486 2139 gene locus_tag LOCUS_19790 2486 2139 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084591.1 protein_id gnl|my_center|LOCUS_19790 3238 2909 gene locus_tag LOCUS_19800 3238 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence0369 529 834 gene locus_tag LOCUS_19810 529 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 881 1438 gene locus_tag LOCUS_19820 881 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 1506 2249 gene locus_tag LOCUS_19830 1506 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 3816 2251 gene locus_tag LOCUS_19840 3816 2251 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255965.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence0370 651 938 gene locus_tag LOCUS_19850 651 938 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257727.1 protein_id gnl|my_center|LOCUS_19850 1194 1748 gene locus_tag LOCUS_19860 1194 1748 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705173.1 protein_id gnl|my_center|LOCUS_19860 1745 3253 gene locus_tag LOCUS_19870 1745 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 <4235 3272 gene locus_tag LOCUS_19880 <4235 3272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:nuclease >Feature sequence0371 515 1582 gene locus_tag LOCUS_19890 515 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2815 1583 gene locus_tag LOCUS_19900 2815 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 3687 2836 gene locus_tag LOCUS_19910 3687 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence0372 837 316 gene locus_tag LOCUS_19920 837 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2171 837 gene locus_tag LOCUS_19930 gene dhs1 2171 837 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC31 protein_id gnl|my_center|LOCUS_19930 2250 3728 gene locus_tag LOCUS_19940 2250 3728 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764544.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence0373 1121 1687 gene locus_tag LOCUS_19950 gene TPX 1121 1687 CDS product 2-Cys peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326977.1 protein_id gnl|my_center|LOCUS_19950 1723 3819 gene locus_tag LOCUS_19960 1723 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence0374 737 1354 gene locus_tag LOCUS_19970 737 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1362 1817 gene locus_tag LOCUS_19980 1362 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 3138 1810 gene locus_tag LOCUS_19990 gene aspC 3138 1810 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4H3 protein_id gnl|my_center|LOCUS_19990 3246 4136 gene locus_tag LOCUS_20000 3246 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence0375 2 1249 gene locus_tag LOCUS_20010 2 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 1291 2034 gene locus_tag LOCUS_20020 1291 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20020 2025 2456 gene locus_tag LOCUS_20030 2025 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20030 2491 3363 gene locus_tag LOCUS_20040 gene cphB 2491 3363 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016692.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence0376 <1 960 gene locus_tag LOCUS_20050 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877386.1:B12-binding domain-containing radical SAM protein 983 2344 gene locus_tag LOCUS_20060 983 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2427 3737 gene locus_tag LOCUS_20070 2427 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence0377 131 1630 gene locus_tag LOCUS_20080 131 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 1659 2417 gene locus_tag LOCUS_20090 1659 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2414 3478 gene locus_tag LOCUS_20100 2414 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence0378 1859 588 gene locus_tag LOCUS_20110 1859 588 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404047.1 protein_id gnl|my_center|LOCUS_20110 3095 1905 gene locus_tag LOCUS_20120 3095 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 3653 3105 gene locus_tag LOCUS_20130 3653 3105 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK7 protein_id gnl|my_center|LOCUS_20130 <4198 3650 gene locus_tag LOCUS_20140 <4198 3650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C83:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence0379 567 106 gene locus_tag LOCUS_20150 567 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 1451 564 gene locus_tag LOCUS_20160 1451 564 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868825.1 protein_id gnl|my_center|LOCUS_20160 1466 2365 gene locus_tag LOCUS_20170 1466 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727868.1 protein_id gnl|my_center|LOCUS_20170 3195 2377 gene locus_tag LOCUS_20180 3195 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 4064 3201 gene locus_tag LOCUS_20190 4064 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence0380 3436 659 gene locus_tag LOCUS_20200 3436 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence0381 60 1082 gene locus_tag LOCUS_20210 60 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 1079 2689 gene locus_tag LOCUS_20220 1079 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 4078 2699 gene locus_tag LOCUS_20230 4078 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence0382 1115 60 gene locus_tag LOCUS_20240 1115 60 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081172.1 protein_id gnl|my_center|LOCUS_20240 1251 2480 gene locus_tag LOCUS_20250 1251 2480 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485071.1 protein_id gnl|my_center|LOCUS_20250 2563 2862 gene locus_tag LOCUS_20260 gene yhbY 2563 2862 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_20260 2870 3271 gene locus_tag LOCUS_20270 2870 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 3268 3603 gene locus_tag LOCUS_20280 3268 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 >Feature sequence0383 66 1031 gene locus_tag LOCUS_20290 66 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2142 1039 gene locus_tag LOCUS_20300 2142 1039 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_20300 3050 2139 gene locus_tag LOCUS_20310 gene arsA2 3050 2139 CDS product putative arsenical pump-driving ATPase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66674 protein_id gnl|my_center|LOCUS_20310 3934 3050 gene locus_tag LOCUS_20320 3934 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence0384 584 1522 gene locus_tag LOCUS_20330 584 1522 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089304.1 protein_id gnl|my_center|LOCUS_20330 1536 2441 gene locus_tag LOCUS_20340 1536 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2438 4081 gene locus_tag LOCUS_20350 2438 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence0385 828 1592 gene locus_tag LOCUS_20360 828 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 1593 2492 gene locus_tag LOCUS_20370 1593 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2516 3394 gene locus_tag LOCUS_20380 2516 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence0386 1353 826 gene locus_tag LOCUS_20390 gene apt 1353 826 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCV7 protein_id gnl|my_center|LOCUS_20390 1410 2075 gene locus_tag LOCUS_20400 1410 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2855 2091 gene locus_tag LOCUS_20410 gene surE 2855 2091 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ6 protein_id gnl|my_center|LOCUS_20410 2953 3333 gene locus_tag LOCUS_20420 2953 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 3330 4106 gene locus_tag LOCUS_20430 3330 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence0387 1802 1302 gene locus_tag LOCUS_20440 1802 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 3813 1813 gene locus_tag LOCUS_20450 gene dnaK 3813 1813 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963795.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence0388 2258 996 gene locus_tag LOCUS_20460 2258 996 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706362.1 protein_id gnl|my_center|LOCUS_20460 2935 2255 gene locus_tag LOCUS_20470 2935 2255 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544852.1 protein_id gnl|my_center|LOCUS_20470 3674 2991 gene locus_tag LOCUS_20480 3674 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 4145 3675 gene locus_tag LOCUS_20490 4145 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence0389 2615 426 gene locus_tag LOCUS_20500 2615 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 3447 2647 gene locus_tag LOCUS_20510 3447 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence0390 278 814 gene locus_tag LOCUS_20520 gene pyrE 278 814 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN6 protein_id gnl|my_center|LOCUS_20520 811 1380 gene locus_tag LOCUS_20530 811 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 1383 2780 gene locus_tag LOCUS_20540 1383 2780 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_20540 4142 2784 gene locus_tag LOCUS_20550 gene nadB 4142 2784 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C48 protein_id gnl|my_center|LOCUS_20550 >Feature sequence0391 251 2485 gene locus_tag LOCUS_20560 251 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 3446 2511 gene locus_tag LOCUS_20570 3446 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence0392 1163 1324 gene locus_tag LOCUS_20580 1163 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 1324 1515 gene locus_tag LOCUS_20590 1324 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 1832 1500 gene locus_tag LOCUS_20600 1832 1500 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2N7 protein_id gnl|my_center|LOCUS_20600 3340 1829 gene locus_tag LOCUS_20610 3340 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 <4132 3337 gene locus_tag LOCUS_20620 <4132 3337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RKU5:allantoinase >Feature sequence0393 1070 474 gene locus_tag LOCUS_20630 1070 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 1154 1378 gene locus_tag LOCUS_20640 1154 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2754 1723 gene locus_tag LOCUS_20650 2754 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence0394 <1 939 gene locus_tag LOCUS_20660 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038432.1:GGDEF domain-containing protein 949 1665 gene locus_tag LOCUS_20670 949 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2398 1643 gene locus_tag LOCUS_20680 2398 1643 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257381.1 protein_id gnl|my_center|LOCUS_20680 3581 2376 gene locus_tag LOCUS_20690 3581 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence0395 <1 853 gene locus_tag LOCUS_20700 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S528:UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase 2543 840 gene locus_tag LOCUS_20710 2543 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 3475 2540 gene locus_tag LOCUS_20720 3475 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 4005 3472 gene locus_tag LOCUS_20730 4005 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence0396 1156 1527 gene locus_tag LOCUS_20740 1156 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 1561 1830 gene locus_tag LOCUS_20750 1561 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1827 2810 gene locus_tag LOCUS_20760 1827 2810 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_20760 <4067 2814 gene locus_tag LOCUS_20770 <4067 2814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272522.1:flavocytochrome c >Feature sequence0397 104 1240 gene locus_tag LOCUS_20780 104 1240 CDS product MFS metabolite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_20780 1314 2813 gene locus_tag LOCUS_20790 1314 2813 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940915.1 protein_id gnl|my_center|LOCUS_20790 2918 3832 gene locus_tag LOCUS_20800 2918 3832 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036699.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence0398 1179 1892 gene locus_tag LOCUS_20810 1179 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2297 1893 gene locus_tag LOCUS_20820 2297 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2324 3697 gene locus_tag LOCUS_20830 2324 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence0399 1888 482 gene locus_tag LOCUS_20840 1888 482 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_20840 2458 1889 gene locus_tag LOCUS_20850 2458 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 3075 2503 gene locus_tag LOCUS_20860 3075 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 3624 3088 gene locus_tag LOCUS_20870 3624 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence0400 1181 2356 gene locus_tag LOCUS_20880 1181 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2404 3855 gene locus_tag LOCUS_20890 2404 3855 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence0401 1099 221 gene locus_tag LOCUS_20900 1099 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 3492 1096 gene locus_tag LOCUS_20910 3492 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence0402 1093 503 gene locus_tag LOCUS_20920 1093 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 1313 2446 gene locus_tag LOCUS_20930 1313 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 3875 2460 gene locus_tag LOCUS_20940 3875 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence0403 1271 282 gene locus_tag LOCUS_20950 gene hemB 1271 282 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45622 protein_id gnl|my_center|LOCUS_20950 1334 3601 gene locus_tag LOCUS_20960 1334 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence0404 459 109 gene locus_tag LOCUS_20970 459 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 1141 2349 gene locus_tag LOCUS_20980 1141 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2346 3929 gene locus_tag LOCUS_20990 2346 3929 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706760.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence0405 2190 1324 gene locus_tag LOCUS_21000 2190 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901674.1 protein_id gnl|my_center|LOCUS_21000 2507 2187 gene locus_tag LOCUS_21010 2507 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 3116 2517 gene locus_tag LOCUS_21020 3116 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 <4010 3230 gene locus_tag LOCUS_21030 <4010 3230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66654:1,4-dihydroxy-6-naphtoate synthase >Feature sequence0406 2667 1549 gene locus_tag LOCUS_21040 2667 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 >Feature sequence0407 253 462 gene locus_tag LOCUS_21050 253 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 541 795 gene locus_tag LOCUS_21060 541 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 917 1732 gene locus_tag LOCUS_21070 gene rpsB 917 1732 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW1 protein_id gnl|my_center|LOCUS_21070 1820 2470 gene locus_tag LOCUS_21080 gene tsf 1820 2470 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61333 protein_id gnl|my_center|LOCUS_21080 2529 3242 gene locus_tag LOCUS_21090 gene pyrH 2529 3242 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59003 protein_id gnl|my_center|LOCUS_21090 3252 3815 gene locus_tag LOCUS_21100 3252 3815 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence0408 <1 645 gene locus_tag LOCUS_21110 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932750.1:thiol:disulfide interchange protein 1223 636 gene locus_tag LOCUS_21120 1223 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2474 1335 gene locus_tag LOCUS_21130 2474 1335 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_21130 3302 2502 gene locus_tag LOCUS_21140 gene crt 3302 2502 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52046 protein_id gnl|my_center|LOCUS_21140 <4002 3299 gene locus_tag LOCUS_21150 <4002 3299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272323.1:3-hydroxybutyryl-CoA dehydrogenase >Feature sequence0409 736 942 gene locus_tag LOCUS_21160 736 942 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_21160 939 1490 gene locus_tag LOCUS_21170 939 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 1487 2383 gene locus_tag LOCUS_21180 1487 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 3171 2515 gene locus_tag LOCUS_21190 3171 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887695.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence0410 2312 1194 gene locus_tag LOCUS_21200 2312 1194 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706241.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence0411 746 528 gene locus_tag LOCUS_21210 746 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1442 798 gene locus_tag LOCUS_21220 1442 798 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204014.1 protein_id gnl|my_center|LOCUS_21220 3073 1427 gene locus_tag LOCUS_21230 3073 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 <3979 3166 gene locus_tag LOCUS_21240 <3979 3166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942561.1:phosphatidate cytidylyltransferase >Feature sequence0412 2711 1758 gene locus_tag LOCUS_21250 gene ugpC 2711 1758 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IX40 protein_id gnl|my_center|LOCUS_21250 2815 3528 gene locus_tag LOCUS_21260 2815 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 3974 3543 gene locus_tag LOCUS_21270 3974 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 >Feature sequence0413 <1 2103 gene locus_tag LOCUS_21280 <1 2103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037293.1:transporter >Feature sequence0414 1410 13 gene locus_tag LOCUS_21290 1410 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 3086 1410 gene locus_tag LOCUS_21300 3086 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence0415 1182 265 gene locus_tag LOCUS_21310 1182 265 CDS product phosphopeptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543833.1 protein_id gnl|my_center|LOCUS_21310 2069 1227 gene locus_tag LOCUS_21320 2069 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 <3961 2066 gene locus_tag LOCUS_21330 <3961 2066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964341.1:transporter >Feature sequence0416 1535 729 gene locus_tag LOCUS_21340 1535 729 CDS product pilus assembly-related, exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523372.1 protein_id gnl|my_center|LOCUS_21340 1776 1570 gene locus_tag LOCUS_21350 1776 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 2276 1767 gene locus_tag LOCUS_21360 2276 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2438 2283 gene locus_tag LOCUS_21370 2438 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2502 2840 gene locus_tag LOCUS_21380 2502 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence0417 896 636 gene locus_tag LOCUS_21390 896 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 976 1524 gene locus_tag LOCUS_21400 gene def 976 1524 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93LE9 protein_id gnl|my_center|LOCUS_21400 1525 2874 gene locus_tag LOCUS_21410 1525 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 3591 2923 gene locus_tag LOCUS_21420 gene trmH 3591 2923 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SM16 protein_id gnl|my_center|LOCUS_21420 >Feature sequence0418 <1 993 gene locus_tag LOCUS_21430 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227995.1:isomerase 1915 1130 gene locus_tag LOCUS_21440 gene yaaA 1915 1130 CDS product UPF0246 protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9R5 protein_id gnl|my_center|LOCUS_21440 2100 3242 gene locus_tag LOCUS_21450 2100 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21450 <3946 3229 gene locus_tag LOCUS_21460 <3946 3229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947927.1:choline monooxygenase >Feature sequence0419 1967 1038 gene locus_tag LOCUS_21470 1967 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 2068 3099 gene locus_tag LOCUS_21480 2068 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence0420 1104 1853 gene locus_tag LOCUS_21490 1104 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1856 3253 gene locus_tag LOCUS_21500 1856 3253 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412946.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence0421 974 2548 gene locus_tag LOCUS_21510 974 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence0422 615 1715 gene locus_tag LOCUS_21520 615 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 1805 2422 gene locus_tag LOCUS_21530 1805 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence0423 185 1084 gene locus_tag LOCUS_21540 185 1084 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 protein_id gnl|my_center|LOCUS_21540 1702 1079 gene locus_tag LOCUS_21550 gene gstA 1702 1079 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 protein_id gnl|my_center|LOCUS_21550 3348 1771 gene locus_tag LOCUS_21560 3348 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence0424 743 3394 gene locus_tag LOCUS_21570 743 3394 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403080.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence0425 1911 1165 gene locus_tag LOCUS_21580 1911 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 1972 3267 gene locus_tag LOCUS_21590 1972 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 <3922 3264 gene locus_tag LOCUS_21600 <3922 3264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CR67:UTP--glucose-1-phosphate uridylyltransferase >Feature sequence0426 1042 1320 gene locus_tag LOCUS_21610 1042 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1496 2101 gene locus_tag LOCUS_21620 1496 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2136 3059 gene locus_tag LOCUS_21630 2136 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 3056 3919 gene locus_tag LOCUS_21640 3056 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence0427 3336 1375 gene locus_tag LOCUS_21650 3336 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence0428 862 1857 gene locus_tag LOCUS_21660 862 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 1854 3467 gene locus_tag LOCUS_21670 1854 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence0429 3163 1118 gene locus_tag LOCUS_21680 3163 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence0430 1832 1209 gene locus_tag LOCUS_21690 1832 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 1846 3003 gene locus_tag LOCUS_21700 1846 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence0431 225 521 gene locus_tag LOCUS_21710 225 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 548 1684 gene locus_tag LOCUS_21720 548 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 1681 2220 gene locus_tag LOCUS_21730 1681 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3014 2262 gene locus_tag LOCUS_21740 3014 2262 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_21740 3118 3873 gene locus_tag LOCUS_21750 3118 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence0432 318 782 gene locus_tag LOCUS_21760 318 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 785 1969 gene locus_tag LOCUS_21770 785 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2052 2777 gene locus_tag LOCUS_21780 2052 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 3329 2778 gene locus_tag LOCUS_21790 3329 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence0433 792 316 gene locus_tag LOCUS_21800 792 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403442.1 protein_id gnl|my_center|LOCUS_21800 3204 856 gene locus_tag LOCUS_21810 3204 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 <3872 3229 gene locus_tag LOCUS_21820 <3872 3229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141618.1:histone deacetylase >Feature sequence0434 1760 162 gene locus_tag LOCUS_21830 1760 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 3614 1770 gene locus_tag LOCUS_21840 gene mccA 3614 1770 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973075.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence0435 1983 1396 gene locus_tag LOCUS_21850 1983 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2568 2011 gene locus_tag LOCUS_21860 2568 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2617 3477 gene locus_tag LOCUS_21870 2617 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 >Feature sequence0436 >Feature sequence0437 94 429 gene locus_tag LOCUS_21880 94 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 467 805 gene locus_tag LOCUS_21890 467 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2331 1207 gene locus_tag LOCUS_21900 2331 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 <3857 2393 gene locus_tag LOCUS_21910 <3857 2393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003413541.1:peptidase S41 >Feature sequence0438 688 185 gene locus_tag LOCUS_21920 688 185 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869428.1 protein_id gnl|my_center|LOCUS_21920 1542 685 gene locus_tag LOCUS_21930 1542 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2006 1539 gene locus_tag LOCUS_21940 gene greB 2006 1539 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DW4 protein_id gnl|my_center|LOCUS_21940 2978 2034 gene locus_tag LOCUS_21950 2978 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 3009 3683 gene locus_tag LOCUS_21960 3009 3683 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948549.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence0439 1624 164 gene locus_tag LOCUS_21970 1624 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence0440 2039 690 gene locus_tag LOCUS_21980 2039 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 3730 2078 gene locus_tag LOCUS_21990 3730 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 >Feature sequence0441 <1 1016 gene locus_tag LOCUS_22000 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943442.1:histidine kinase 1122 2768 gene locus_tag LOCUS_22010 1122 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 3270 2941 gene locus_tag LOCUS_22020 3270 2941 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205685.1 protein_id gnl|my_center|LOCUS_22020 >Feature sequence0442 1175 108 gene locus_tag LOCUS_22030 1175 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 1251 3614 gene locus_tag LOCUS_22040 1251 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence0443 3 1520 gene locus_tag LOCUS_22050 3 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2365 1634 gene locus_tag LOCUS_22060 gene nadK 2365 1634 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX24 protein_id gnl|my_center|LOCUS_22060 2539 3414 gene locus_tag LOCUS_22070 gene dapF 2539 3414 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZX7 protein_id gnl|my_center|LOCUS_22070 >Feature sequence0444 1596 2336 gene locus_tag LOCUS_22080 1596 2336 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_22080 2489 3508 gene locus_tag LOCUS_22090 2489 3508 CDS product peptidyl-arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121927.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence0445 2831 2172 gene locus_tag LOCUS_22100 2831 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 2943 3437 gene locus_tag LOCUS_22110 2943 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 >Feature sequence0446 1361 198 gene locus_tag LOCUS_22120 gene gltA 1361 198 CDS product type I citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_22120 1477 2619 gene locus_tag LOCUS_22130 1477 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2763 2942 gene locus_tag LOCUS_22140 2763 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 <3818 2930 gene locus_tag LOCUS_22150 <3818 2930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P61946:S-adenosylmethionine synthase >Feature sequence0447 1453 125 gene locus_tag LOCUS_22160 1453 125 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763445.1 protein_id gnl|my_center|LOCUS_22160 1508 2293 gene locus_tag LOCUS_22170 1508 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 2434 3000 gene locus_tag LOCUS_22180 2434 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207867.1 protein_id gnl|my_center|LOCUS_22180 <3815 3004 gene locus_tag LOCUS_22190 <3815 3004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964304.1:agmatinase >Feature sequence0448 24 380 gene locus_tag LOCUS_22200 24 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 573 385 gene locus_tag LOCUS_22210 573 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 744 1712 gene locus_tag LOCUS_22220 744 1712 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_22220 1709 2593 gene locus_tag LOCUS_22230 1709 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2590 3021 gene locus_tag LOCUS_22240 2590 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence0449 194 877 gene locus_tag LOCUS_22250 194 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887695.1 protein_id gnl|my_center|LOCUS_22250 953 2005 gene locus_tag LOCUS_22260 953 2005 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240530.1 protein_id gnl|my_center|LOCUS_22260 1999 2754 gene locus_tag LOCUS_22270 1999 2754 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726989.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence0450 3058 1313 gene locus_tag LOCUS_22280 3058 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence0451 82 858 gene locus_tag LOCUS_22290 82 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 897 1331 gene locus_tag LOCUS_22300 gene moaC 897 1331 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG82 protein_id gnl|my_center|LOCUS_22300 2132 1332 gene locus_tag LOCUS_22310 2132 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 2785 2129 gene locus_tag LOCUS_22320 2785 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2797 3558 gene locus_tag LOCUS_22330 2797 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence0452 1612 482 gene locus_tag LOCUS_22340 1612 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 <3804 1667 gene locus_tag LOCUS_22350 <3804 1667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZTG0:error-prone DNA polymerase >Feature sequence0453 1998 2969 gene locus_tag LOCUS_22360 1998 2969 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_22360 3037 3456 gene locus_tag LOCUS_22370 3037 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence0454 1367 2923 gene locus_tag LOCUS_22380 1367 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence0455 <1 620 gene locus_tag LOCUS_22390 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BZ1:RNA polymerase sigma-54 factor 2377 713 gene locus_tag LOCUS_22400 2377 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2909 2421 gene locus_tag LOCUS_22410 2909 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 <3795 2906 gene locus_tag LOCUS_22420 <3795 2906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052279209.1:cytochrome c family protein >Feature sequence0456 1540 3246 gene locus_tag LOCUS_22430 1540 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence0457 1546 32 gene locus_tag LOCUS_22440 1546 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1649 3547 gene locus_tag LOCUS_22450 gene speA 1649 3547 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE10 protein_id gnl|my_center|LOCUS_22450 >Feature sequence0458 202 1632 gene locus_tag LOCUS_22460 202 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1619 2053 gene locus_tag LOCUS_22470 1619 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2535 2071 gene locus_tag LOCUS_22480 2535 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 3456 2578 gene locus_tag LOCUS_22490 3456 2578 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224028.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence0459 310 621 gene locus_tag LOCUS_22500 310 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 1150 611 gene locus_tag LOCUS_22510 1150 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 1240 1542 gene locus_tag LOCUS_22520 1240 1542 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140006.1 protein_id gnl|my_center|LOCUS_22520 1596 2039 gene locus_tag LOCUS_22530 1596 2039 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140005.1 protein_id gnl|my_center|LOCUS_22530 2106 2918 gene locus_tag LOCUS_22540 gene lgt 2106 2918 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1A4 protein_id gnl|my_center|LOCUS_22540 <3781 2824 gene locus_tag LOCUS_22550 <3781 2824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258143.1:MBL fold protein >Feature sequence0460 1309 59 gene locus_tag LOCUS_22560 1309 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2473 1376 gene locus_tag LOCUS_22570 2473 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 3459 2503 gene locus_tag LOCUS_22580 gene fabH 3459 2503 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833199.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence0461 2092 401 gene locus_tag LOCUS_22590 2092 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2580 2089 gene locus_tag LOCUS_22600 2580 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2611 3510 gene locus_tag LOCUS_22610 2611 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence0462 <1 1231 gene locus_tag LOCUS_22620 <1 1231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228654.1:cytochrome c biogenesis protein CcmF 1228 1767 gene locus_tag LOCUS_22630 1228 1767 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886990.1 protein_id gnl|my_center|LOCUS_22630 1764 2279 gene locus_tag LOCUS_22640 1764 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2279 3541 gene locus_tag LOCUS_22650 2279 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence0463 68 814 gene locus_tag LOCUS_22660 68 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 2551 818 gene locus_tag LOCUS_22670 2551 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 2829 2548 gene locus_tag LOCUS_22680 2829 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 3629 2877 gene locus_tag LOCUS_22690 3629 2877 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence0464 113 1705 gene locus_tag LOCUS_22700 113 1705 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_22700 2972 1725 gene locus_tag LOCUS_22710 2972 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3153 3740 gene locus_tag LOCUS_22720 3153 3740 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061632.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence0465 1428 442 gene locus_tag LOCUS_22730 1428 442 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_22730 2394 1546 gene locus_tag LOCUS_22740 2394 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence0466 681 10 gene locus_tag LOCUS_22750 681 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 1916 678 gene locus_tag LOCUS_22760 gene tthHB8IM 1916 678 CDS product modification methylase TthHB8I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29749 protein_id gnl|my_center|LOCUS_22760 2931 1918 gene locus_tag LOCUS_22770 gene hpnA 2931 1918 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_22770 <3757 2948 gene locus_tag LOCUS_22780 <3757 2948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000215329.1:acyl-CoA dehydrogenase >Feature sequence0467 1103 33 gene locus_tag LOCUS_22790 gene ldh 1103 33 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A392 protein_id gnl|my_center|LOCUS_22790 2703 1207 gene locus_tag LOCUS_22800 2703 1207 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence0468 1464 1907 gene locus_tag LOCUS_22810 1464 1907 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_22810 1904 2623 gene locus_tag LOCUS_22820 1904 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence0469 358 1062 gene locus_tag LOCUS_22830 358 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 1944 1090 gene locus_tag LOCUS_22840 gene mutM 1944 1090 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHE9 protein_id gnl|my_center|LOCUS_22840 1991 2578 gene locus_tag LOCUS_22850 1991 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2591 3421 gene locus_tag LOCUS_22860 2591 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence0470 >Feature sequence0471 1691 117 gene locus_tag LOCUS_22870 1691 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3045 1750 gene locus_tag LOCUS_22880 3045 1750 CDS product putative acetyl-CoA C-acyltransferase (thiolase) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701746.1 protein_id gnl|my_center|LOCUS_22880 <3739 3047 gene locus_tag LOCUS_22890 <3739 3047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207046.1:3-oxoacyl-ACP reductase >Feature sequence0472 197 1870 gene locus_tag LOCUS_22900 197 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 1922 3214 gene locus_tag LOCUS_22910 1922 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 3351 3275 gene locus_tag LOCUS_t00080 3351 3275 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0473 2515 1043 gene locus_tag LOCUS_22920 2515 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 3213 2506 gene locus_tag LOCUS_22930 3213 2506 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404002.1 protein_id gnl|my_center|LOCUS_22930 <3734 3213 gene locus_tag LOCUS_22940 <3734 3213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404003.1:multidrug ABC transporter ATP-binding protein >Feature sequence0474 1639 1406 gene locus_tag LOCUS_22950 1639 1406 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 protein_id gnl|my_center|LOCUS_22950 1748 2494 gene locus_tag LOCUS_22960 gene bvdR 1748 2494 CDS product biliverdin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140852.1 protein_id gnl|my_center|LOCUS_22960 2840 2514 gene locus_tag LOCUS_22970 2840 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 <3733 2888 gene locus_tag LOCUS_22980 <3733 2888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385500.1:permease >Feature sequence0475 1655 54 gene locus_tag LOCUS_22990 1655 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 2432 1665 gene locus_tag LOCUS_23000 gene thiG 2432 1665 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FL9 protein_id gnl|my_center|LOCUS_23000 2546 3019 gene locus_tag LOCUS_23010 2546 3019 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_23010 3100 3342 gene locus_tag LOCUS_23020 3100 3342 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003656.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence0476 1292 474 gene locus_tag LOCUS_23030 1292 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 1795 1292 gene locus_tag LOCUS_23040 1795 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2907 1792 gene locus_tag LOCUS_23050 2907 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 3317 2904 gene locus_tag LOCUS_23060 gene mceE 3317 2904 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence0477 3713 1125 gene locus_tag LOCUS_23070 3713 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence0478 <1 593 gene locus_tag LOCUS_23080 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000941223.1:single-stranded-DNA-specific exonuclease RecJ 1445 597 gene locus_tag LOCUS_23090 1445 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 1802 1455 gene locus_tag LOCUS_23100 1802 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 3463 1799 gene locus_tag LOCUS_23110 3463 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence0479 1429 482 gene locus_tag LOCUS_23120 gene ddl 1429 482 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNW1 protein_id gnl|my_center|LOCUS_23120 2250 1426 gene locus_tag LOCUS_23130 gene murB 2250 1426 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA6 protein_id gnl|my_center|LOCUS_23130 3623 2247 gene locus_tag LOCUS_23140 gene murC 3623 2247 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61679 protein_id gnl|my_center|LOCUS_23140 >Feature sequence0480 792 88 gene locus_tag LOCUS_23150 792 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 859 2673 gene locus_tag LOCUS_23160 859 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3445 2678 gene locus_tag LOCUS_23170 3445 2678 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530891.1 protein_id gnl|my_center|LOCUS_23170 3688 3503 gene locus_tag LOCUS_23180 3688 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence0481 357 31 gene locus_tag LOCUS_23190 357 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 860 411 gene locus_tag LOCUS_23200 860 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 1027 951 gene locus_tag LOCUS_t00090 1027 951 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1123 1050 gene locus_tag LOCUS_t00100 1123 1050 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1527 1246 gene locus_tag LOCUS_23210 1527 1246 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_23210 1907 1629 gene locus_tag LOCUS_23220 1907 1629 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_23220 <3705 2085 gene locus_tag LOCUS_23230 <3705 2085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72CE6:Lon protease >Feature sequence0482 401 1522 gene locus_tag LOCUS_23240 401 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 1519 1911 gene locus_tag LOCUS_23250 1519 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1908 2300 gene locus_tag LOCUS_23260 1908 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2313 2495 gene locus_tag LOCUS_23270 2313 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence0483 2 541 gene locus_tag LOCUS_23280 2 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 538 1371 gene locus_tag LOCUS_23290 538 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 1382 2749 gene locus_tag LOCUS_23300 1382 2749 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121061.1 protein_id gnl|my_center|LOCUS_23300 3129 2764 gene locus_tag LOCUS_23310 3129 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 3592 3134 gene locus_tag LOCUS_23320 3592 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence0484 443 808 gene locus_tag LOCUS_23330 443 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 1882 812 gene locus_tag LOCUS_23340 gene mtnA 1882 812 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI0 protein_id gnl|my_center|LOCUS_23340 2745 1897 gene locus_tag LOCUS_23350 2745 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence0485 599 120 gene locus_tag LOCUS_23360 599 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 883 596 gene locus_tag LOCUS_23370 883 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 1959 904 gene locus_tag LOCUS_23380 1959 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 <3695 1980 gene locus_tag LOCUS_23390 <3695 1980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to G5EBD4:chromosome partition protein Smc >Feature sequence0486 933 712 gene locus_tag LOCUS_23400 933 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 1879 980 gene locus_tag LOCUS_23410 gene ctaB 1879 980 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RM98 protein_id gnl|my_center|LOCUS_23410 2757 1876 gene locus_tag LOCUS_23420 gene ctaA 2757 1876 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087694.1 protein_id gnl|my_center|LOCUS_23420 <3687 2936 gene locus_tag LOCUS_23430 <3687 2936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973397.1:aldo/keto reductase >Feature sequence0487 122 1411 gene locus_tag LOCUS_23440 122 1411 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_23440 1421 2902 gene locus_tag LOCUS_23450 1421 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 <3680 2888 gene locus_tag LOCUS_23460 <3680 2888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259047.1:dehydrogenase >Feature sequence0488 2740 1460 gene locus_tag LOCUS_23470 2740 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 <3672 2737 gene locus_tag LOCUS_23480 <3672 2737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640165.1:2-hydroxychromene-2-carboxylate isomerase >Feature sequence0489 288 1172 gene locus_tag LOCUS_23490 288 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 1989 1177 gene locus_tag LOCUS_23500 1989 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2282 1989 gene locus_tag LOCUS_23510 2282 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 3653 2343 gene locus_tag LOCUS_23520 3653 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence0490 1694 936 gene locus_tag LOCUS_23530 1694 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 1752 2471 gene locus_tag LOCUS_23540 1752 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence0491 26 760 gene locus_tag LOCUS_23550 26 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 796 3093 gene locus_tag LOCUS_23560 796 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence0492 458 1513 gene locus_tag LOCUS_23570 458 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2427 1510 gene locus_tag LOCUS_23580 2427 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence0493 2180 558 gene locus_tag LOCUS_23590 2180 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 2905 2177 gene locus_tag LOCUS_23600 2905 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 3429 2902 gene locus_tag LOCUS_23610 3429 2902 CDS product Ecf-type RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810497.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence0494 <1 753 gene locus_tag LOCUS_23620 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258514.1:ABC transporter ATP-binding protein 750 1244 gene locus_tag LOCUS_23630 750 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 2379 1255 gene locus_tag LOCUS_23640 2379 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 <3629 2448 gene locus_tag LOCUS_23650 <3629 2448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WA05:histidine kinase >Feature sequence0495 1938 34 gene locus_tag LOCUS_23660 1938 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2728 1943 gene locus_tag LOCUS_23670 2728 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 3585 2770 gene locus_tag LOCUS_23680 3585 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence0496 349 978 gene locus_tag LOCUS_23690 349 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 978 1667 gene locus_tag LOCUS_23700 978 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2673 1729 gene locus_tag LOCUS_23710 2673 1729 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392016.1 protein_id gnl|my_center|LOCUS_23710 3293 2727 gene locus_tag LOCUS_23720 3293 2727 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XA08 protein_id gnl|my_center|LOCUS_23720 >Feature sequence0497 1076 1435 gene locus_tag LOCUS_23730 1076 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 2110 1439 gene locus_tag LOCUS_23740 2110 1439 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I694 protein_id gnl|my_center|LOCUS_23740 2955 2107 gene locus_tag LOCUS_23750 2955 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 3104 2952 gene locus_tag LOCUS_23760 3104 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence0498 <3620 1329 gene locus_tag LOCUS_23770 <3620 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538096.1:methionine synthase >Feature sequence0499 75 302 gene locus_tag LOCUS_23780 75 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 724 649 gene locus_tag LOCUS_t00110 724 649 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 857 2500 gene locus_tag LOCUS_23790 857 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence0500 1991 1209 gene locus_tag LOCUS_23800 1991 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 2039 2719 gene locus_tag LOCUS_23810 2039 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170954.1 protein_id gnl|my_center|LOCUS_23810 2739 3464 gene locus_tag LOCUS_23820 2739 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 >Feature sequence0501 1342 2520 gene locus_tag LOCUS_23830 1342 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2644 3369 gene locus_tag LOCUS_23840 gene fliA 2644 3369 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR18 protein_id gnl|my_center|LOCUS_23840 >Feature sequence0502 <3601 2238 gene locus_tag LOCUS_23850 <3601 2238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S415:leucine--tRNA ligase >Feature sequence0503 402 2117 gene locus_tag LOCUS_23860 402 2117 CDS product 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391777.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence0504 896 525 gene locus_tag LOCUS_23870 896 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 3302 906 gene locus_tag LOCUS_23880 gene dinG 3302 906 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941031.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence0505 623 1063 gene locus_tag LOCUS_23890 623 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1060 1911 gene locus_tag LOCUS_23900 1060 1911 CDS product antibiotic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411868.1 protein_id gnl|my_center|LOCUS_23900 2025 2789 gene locus_tag LOCUS_23910 2025 2789 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118645.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence0506 315 157 gene locus_tag LOCUS_23920 gene rpmH 315 157 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT3 protein_id gnl|my_center|LOCUS_23920 673 2013 gene locus_tag LOCUS_23930 gene dnaA 673 2013 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG6 protein_id gnl|my_center|LOCUS_23930 2308 3429 gene locus_tag LOCUS_23940 gene dnaN 2308 3429 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H91 protein_id gnl|my_center|LOCUS_23940 >Feature sequence0507 >Feature sequence0508 419 673 gene locus_tag LOCUS_23950 gene acpP-1 419 673 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940916.1 protein_id gnl|my_center|LOCUS_23950 675 1832 gene locus_tag LOCUS_23960 675 1832 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 protein_id gnl|my_center|LOCUS_23960 2350 1829 gene locus_tag LOCUS_23970 2350 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2732 2352 gene locus_tag LOCUS_23980 2732 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 3259 2789 gene locus_tag LOCUS_23990 3259 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence0509 464 1207 gene locus_tag LOCUS_24000 464 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 1209 1544 gene locus_tag LOCUS_24010 1209 1544 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_24010 1623 1967 gene locus_tag LOCUS_24020 1623 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2508 2014 gene locus_tag LOCUS_24030 2508 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 >Feature sequence0510 278 1090 gene locus_tag LOCUS_24040 gene kdsA 278 1090 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKN7 protein_id gnl|my_center|LOCUS_24040 1119 1841 gene locus_tag LOCUS_24050 1119 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 1879 3246 gene locus_tag LOCUS_24060 1879 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence0511 1314 478 gene locus_tag LOCUS_24070 1314 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2337 1378 gene locus_tag LOCUS_24080 2337 1378 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 protein_id gnl|my_center|LOCUS_24080 2997 2362 gene locus_tag LOCUS_24090 2997 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 3388 3002 gene locus_tag LOCUS_24100 3388 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 >Feature sequence0512 289 1449 gene locus_tag LOCUS_24110 289 1449 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031173.1 protein_id gnl|my_center|LOCUS_24110 1461 3020 gene locus_tag LOCUS_24120 1461 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 3441 2998 gene locus_tag LOCUS_24130 3441 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence0513 2081 1077 gene locus_tag LOCUS_24140 2081 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 <3551 2078 gene locus_tag LOCUS_24150 <3551 2078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259339.1:1-acyl-sn-glycerol-3-phosphate acyltransferase >Feature sequence0514 1216 332 gene locus_tag LOCUS_24160 gene accD 1216 332 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI4 protein_id gnl|my_center|LOCUS_24160 2259 1249 gene locus_tag LOCUS_24170 2259 1249 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031746.1 protein_id gnl|my_center|LOCUS_24170 3076 2249 gene locus_tag LOCUS_24180 3076 2249 CDS product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766897.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence0515 2240 387 gene locus_tag LOCUS_24190 2240 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 2310 2528 gene locus_tag LOCUS_24200 gene infA 2310 2528 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20458 protein_id gnl|my_center|LOCUS_24200 >Feature sequence0516 1077 121 gene locus_tag LOCUS_24210 1077 121 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_24210 1329 2876 gene locus_tag LOCUS_24220 1329 2876 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143047.1 protein_id gnl|my_center|LOCUS_24220 >Feature sequence0517 2531 1773 gene locus_tag LOCUS_24230 2531 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence0518 697 2406 gene locus_tag LOCUS_24240 697 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence0519 849 73 gene locus_tag LOCUS_24250 849 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 885 2708 gene locus_tag LOCUS_24260 885 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 2737 3381 gene locus_tag LOCUS_24270 2737 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence0520 457 1857 gene locus_tag LOCUS_24280 457 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 <3498 1842 gene locus_tag LOCUS_24290 <3498 1842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525117.1:two-component system sensor histidine kinase/response regulator >Feature sequence0521 1214 192 gene locus_tag LOCUS_24300 1214 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2092 1214 gene locus_tag LOCUS_24310 2092 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence0522 613 1704 gene locus_tag LOCUS_24320 613 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 1701 2084 gene locus_tag LOCUS_24330 1701 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2081 2482 gene locus_tag LOCUS_24340 2081 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 >Feature sequence0523 1925 480 gene locus_tag LOCUS_24350 gene ggt 1925 480 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_24350 2652 1915 gene locus_tag LOCUS_24360 2652 1915 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056496.1 protein_id gnl|my_center|LOCUS_24360 3322 2681 gene locus_tag LOCUS_24370 3322 2681 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence0524 <1 1524 gene locus_tag LOCUS_24380 <1 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886676.1:aminotransferase >Feature sequence0525 2629 848 gene locus_tag LOCUS_24390 2629 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence0526 1031 561 gene locus_tag LOCUS_24400 1031 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1108 2220 gene locus_tag LOCUS_24410 1108 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence0527 1231 803 gene locus_tag LOCUS_24420 1231 803 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259124.1 protein_id gnl|my_center|LOCUS_24420 1496 1254 gene locus_tag LOCUS_24430 1496 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 2413 1496 gene locus_tag LOCUS_24440 2413 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 <3476 2410 gene locus_tag LOCUS_24450 <3476 2410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393478.1:AMP-dependent ligase >Feature sequence0528 >Feature sequence0529 1559 477 gene locus_tag LOCUS_24460 1559 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256855.1 protein_id gnl|my_center|LOCUS_24460 <3464 1559 gene locus_tag LOCUS_24470 <3464 1559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256854.1:serine protein kinase >Feature sequence0530 1809 2510 gene locus_tag LOCUS_24480 1809 2510 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161827.1 protein_id gnl|my_center|LOCUS_24480 2514 3182 gene locus_tag LOCUS_24490 2514 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence0531 1245 157 gene locus_tag LOCUS_24500 1245 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 1857 1249 gene locus_tag LOCUS_24510 1857 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 1902 2771 gene locus_tag LOCUS_24520 1902 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence0532 2332 533 gene locus_tag LOCUS_24530 2332 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2421 3449 gene locus_tag LOCUS_24540 2421 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence0533 2491 3009 gene locus_tag LOCUS_24550 2491 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence0534 1119 2234 gene locus_tag LOCUS_24560 1119 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 3117 2245 gene locus_tag LOCUS_24570 3117 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence0535 >Feature sequence0536 1078 107 gene locus_tag LOCUS_24580 1078 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3228 1075 gene locus_tag LOCUS_24590 3228 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence0537 <1 1081 gene locus_tag LOCUS_24600 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257227.1:phosphodiesterase 1101 2846 gene locus_tag LOCUS_24610 1101 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence0538 1196 339 gene locus_tag LOCUS_24620 1196 339 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_24620 1662 1171 gene locus_tag LOCUS_24630 1662 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 2478 1723 gene locus_tag LOCUS_24640 2478 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence0539 1521 646 gene locus_tag LOCUS_24650 1521 646 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228419.1 protein_id gnl|my_center|LOCUS_24650 1807 2805 gene locus_tag LOCUS_24660 1807 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence0540 1557 937 gene locus_tag LOCUS_24670 gene kynB 1557 937 CDS product kynurenine formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYS5 protein_id gnl|my_center|LOCUS_24670 2942 1554 gene locus_tag LOCUS_24680 2942 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 >Feature sequence0541 1069 188 gene locus_tag LOCUS_24690 1069 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 1132 2718 gene locus_tag LOCUS_24700 1132 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 2706 3194 gene locus_tag LOCUS_24710 2706 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 >Feature sequence0542 <3423 2477 gene locus_tag LOCUS_24720 <3423 2477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H90:DNA replication and repair protein RecF >Feature sequence0543 1890 730 gene locus_tag LOCUS_24730 1890 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 2457 1900 gene locus_tag LOCUS_24740 2457 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 2584 3153 gene locus_tag LOCUS_24750 2584 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence0544 1505 279 gene locus_tag LOCUS_24760 1505 279 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_24760 1545 2471 gene locus_tag LOCUS_24770 1545 2471 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH43 protein_id gnl|my_center|LOCUS_24770 2471 2797 gene locus_tag LOCUS_24780 2471 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence0545 <1 550 gene locus_tag LOCUS_24790 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268374.1:alpha/beta hydrolase 2012 516 gene locus_tag LOCUS_24800 2012 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2726 2049 gene locus_tag LOCUS_24810 2726 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143203.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence0546 3092 132 gene locus_tag LOCUS_24820 3092 132 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_24820 >Feature sequence0547 159 1688 gene locus_tag LOCUS_24830 159 1688 CDS product NADH dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_24830 1685 3091 gene locus_tag LOCUS_24840 gene nuoN 1685 3091 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJT7 protein_id gnl|my_center|LOCUS_24840 >Feature sequence0548 684 2945 gene locus_tag LOCUS_24850 684 2945 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence0549 902 1345 gene locus_tag LOCUS_24860 902 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 1366 2196 gene locus_tag LOCUS_24870 1366 2196 CDS product fructosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403507.1 protein_id gnl|my_center|LOCUS_24870 2226 2744 gene locus_tag LOCUS_24880 2226 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence0550 130 2337 gene locus_tag LOCUS_24890 130 2337 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_24890 2349 3284 gene locus_tag LOCUS_24900 2349 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence0551 <1 1320 gene locus_tag LOCUS_24910 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767052.1:peptidase U62 1317 2636 gene locus_tag LOCUS_24920 1317 2636 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_24920 >Feature sequence0552 260 1426 gene locus_tag LOCUS_24930 260 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence0553 1236 229 gene locus_tag LOCUS_24940 1236 229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_24940 855 937 gene locus_tag LOCUS_t00120 855 937 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2222 1233 gene locus_tag LOCUS_24950 2222 1233 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_24950 3148 2219 gene locus_tag LOCUS_24960 3148 2219 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence0554 >Feature sequence0555 1194 733 gene locus_tag LOCUS_24970 gene argR 1194 733 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDE1 protein_id gnl|my_center|LOCUS_24970 1298 2011 gene locus_tag LOCUS_24980 1298 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2256 2008 gene locus_tag LOCUS_24990 2256 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2296 2445 gene locus_tag LOCUS_25000 2296 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 2578 3108 gene locus_tag LOCUS_25010 2578 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence0556 224 2365 gene locus_tag LOCUS_25020 224 2365 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390232.1 protein_id gnl|my_center|LOCUS_25020 2362 3279 gene locus_tag LOCUS_25030 2362 3279 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence0557 820 8 gene locus_tag LOCUS_25040 820 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2031 817 gene locus_tag LOCUS_25050 2031 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence0558 47 598 gene locus_tag LOCUS_25060 47 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 598 1035 gene locus_tag LOCUS_25070 598 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 1393 3126 gene locus_tag LOCUS_25080 1393 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence0559 2291 111 gene locus_tag LOCUS_25090 gene glnA 2291 111 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933078.1 protein_id gnl|my_center|LOCUS_25090 3191 2415 gene locus_tag LOCUS_25100 3191 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence0560 <1 1198 gene locus_tag LOCUS_25110 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFD0:dihydroorotase 2314 1295 gene locus_tag LOCUS_25120 gene recA 2314 1295 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62215 protein_id gnl|my_center|LOCUS_25120 2951 2532 gene locus_tag LOCUS_25130 2951 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence0561 264 1040 gene locus_tag LOCUS_25140 264 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 1661 1068 gene locus_tag LOCUS_25150 1661 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1660 2421 gene locus_tag LOCUS_25160 1660 2421 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_25160 2501 3295 gene locus_tag LOCUS_25170 2501 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence0562 667 1113 gene locus_tag LOCUS_25180 667 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 1113 2021 gene locus_tag LOCUS_25190 1113 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2517 2026 gene locus_tag LOCUS_25200 2517 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 3212 2514 gene locus_tag LOCUS_25210 3212 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence0563 2217 1276 gene locus_tag LOCUS_25220 2217 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2339 3271 gene locus_tag LOCUS_25230 2339 3271 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_25230 >Feature sequence0564 1711 542 gene locus_tag LOCUS_25240 1711 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 2112 1711 gene locus_tag LOCUS_25250 2112 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2217 2606 gene locus_tag LOCUS_25260 2217 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 3306 2629 gene locus_tag LOCUS_25270 3306 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 >Feature sequence0565 59 700 gene locus_tag LOCUS_25280 gene rpsC 59 700 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z4 protein_id gnl|my_center|LOCUS_25280 731 1147 gene locus_tag LOCUS_25290 gene rplP 731 1147 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z5 protein_id gnl|my_center|LOCUS_25290 1147 1464 gene locus_tag LOCUS_25300 1147 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 1702 1968 gene locus_tag LOCUS_25310 gene rpsQ 1702 1968 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_25310 1984 2352 gene locus_tag LOCUS_25320 gene rplN 1984 2352 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH0 protein_id gnl|my_center|LOCUS_25320 2352 2666 gene locus_tag LOCUS_25330 gene rplX 2352 2666 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE29 protein_id gnl|my_center|LOCUS_25330 2678 3220 gene locus_tag LOCUS_25340 2678 3220 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence0566 518 1852 gene locus_tag LOCUS_25350 518 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 1950 2381 gene locus_tag LOCUS_25360 1950 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 3302 2412 gene locus_tag LOCUS_25370 3302 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence0567 3236 2313 gene locus_tag LOCUS_25380 3236 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence0568 <3298 2144 gene locus_tag LOCUS_25390 <3298 2144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJD6:UPF0182 protein >Feature sequence0569 <1 1384 gene locus_tag LOCUS_25400 <1 1384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122418.1:inter-alpha-trypsin inhibitor domain-containing protein 1387 2961 gene locus_tag LOCUS_25410 1387 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence0570 833 171 gene locus_tag LOCUS_25420 833 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970038.1 protein_id gnl|my_center|LOCUS_25420 944 1549 gene locus_tag LOCUS_25430 944 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 1553 2077 gene locus_tag LOCUS_25440 1553 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 2746 2114 gene locus_tag LOCUS_25450 2746 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 >Feature sequence0571 1920 976 gene locus_tag LOCUS_25460 gene ansA 1920 976 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230730.1 protein_id gnl|my_center|LOCUS_25460 2762 1917 gene locus_tag LOCUS_25470 2762 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence0572 <1 968 gene locus_tag LOCUS_25480 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143344.1:methyltransferase type 11 1429 965 gene locus_tag LOCUS_25490 1429 965 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_25490 2517 1444 gene locus_tag LOCUS_25500 2517 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 3031 2402 gene locus_tag LOCUS_25510 3031 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence0573 246 1655 gene locus_tag LOCUS_25520 246 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 1807 2169 gene locus_tag LOCUS_25530 1807 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 2166 2525 gene locus_tag LOCUS_25540 2166 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence0574 1246 539 gene locus_tag LOCUS_25550 1246 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_25550 1297 1944 gene locus_tag LOCUS_25560 1297 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 2850 1945 gene locus_tag LOCUS_25570 2850 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 >Feature sequence0575 1301 519 gene locus_tag LOCUS_25580 1301 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 1354 2595 gene locus_tag LOCUS_25590 1354 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 2609 2893 gene locus_tag LOCUS_25600 2609 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 >Feature sequence0576 756 1772 gene locus_tag LOCUS_25610 756 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 3234 1747 gene locus_tag LOCUS_25620 3234 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence0577 668 1504 gene locus_tag LOCUS_25630 668 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 1589 2350 gene locus_tag LOCUS_25640 1589 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 2343 3026 gene locus_tag LOCUS_25650 2343 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 >Feature sequence0578 1036 2055 gene locus_tag LOCUS_25660 1036 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 3042 2059 gene locus_tag LOCUS_25670 3042 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence0579 >Feature sequence0580 <1 1331 gene locus_tag LOCUS_25680 <1 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393900.1:thioether cross-link-forming SCIFF peptide maturase 1351 2379 gene locus_tag LOCUS_25690 1351 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence0581 115 513 gene locus_tag LOCUS_25700 115 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 583 1842 gene locus_tag LOCUS_25710 583 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 2068 1859 gene locus_tag LOCUS_25720 2068 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 2631 2137 gene locus_tag LOCUS_25730 2631 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 >Feature sequence0582 <1 1244 gene locus_tag LOCUS_25740 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8RGV7:GTPase Der 1248 3071 gene locus_tag LOCUS_25750 gene mutL 1248 3071 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP0 protein_id gnl|my_center|LOCUS_25750 >Feature sequence0583 191 1978 gene locus_tag LOCUS_25760 191 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 1969 2808 gene locus_tag LOCUS_25770 1969 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_25770 >Feature sequence0584 1913 969 gene locus_tag LOCUS_25780 1913 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 2803 1910 gene locus_tag LOCUS_25790 2803 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 3223 2894 gene locus_tag LOCUS_25800 3223 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence0585 <1 898 gene locus_tag LOCUS_25810 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083900.1:benzoyl-CoA-dihydrodiol lyase 936 2351 gene locus_tag LOCUS_25820 936 2351 CDS product benzoyl-CoA oxygenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230333.1 protein_id gnl|my_center|LOCUS_25820 2361 2579 gene locus_tag LOCUS_25830 2361 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence0586 415 59 gene locus_tag LOCUS_25840 415 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_25840 1114 509 gene locus_tag LOCUS_25850 gene cysC 1114 509 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88X60 protein_id gnl|my_center|LOCUS_25850 2617 1124 gene locus_tag LOCUS_25860 2617 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 3096 2620 gene locus_tag LOCUS_25870 3096 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence0587 1430 315 gene locus_tag LOCUS_25880 1430 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 1542 1892 gene locus_tag LOCUS_25890 1542 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 1972 2727 gene locus_tag LOCUS_25900 1972 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338694.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence0588 261 800 gene locus_tag LOCUS_25910 261 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 801 1181 gene locus_tag LOCUS_25920 801 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 1183 1560 gene locus_tag LOCUS_25930 1183 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence0589 523 2178 gene locus_tag LOCUS_25940 523 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 >Feature sequence0590 1533 409 gene locus_tag LOCUS_25950 1533 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 2330 1536 gene locus_tag LOCUS_25960 2330 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 3038 2334 gene locus_tag LOCUS_25970 3038 2334 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence0591 <1 707 gene locus_tag LOCUS_25980 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259446.1:FAD-dependent oxidoreductase 1051 716 gene locus_tag LOCUS_25990 1051 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 1686 1081 gene locus_tag LOCUS_26000 1686 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 1818 2210 gene locus_tag LOCUS_26010 1818 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2267 3181 gene locus_tag LOCUS_26020 2267 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 >Feature sequence0592 2 1054 gene locus_tag LOCUS_26030 2 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 1064 2266 gene locus_tag LOCUS_26040 1064 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 <3239 2271 gene locus_tag LOCUS_26050 <3239 2271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022185.1:cellulosomal protein >Feature sequence0593 1095 2783 gene locus_tag LOCUS_26060 1095 2783 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933296.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence0594 1115 2422 gene locus_tag LOCUS_26070 gene mtaD 1115 2422 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ51 protein_id gnl|my_center|LOCUS_26070 2419 3207 gene locus_tag LOCUS_26080 2419 3207 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870123.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence0595 1078 2007 gene locus_tag LOCUS_26090 gene glk 1078 2007 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI98 protein_id gnl|my_center|LOCUS_26090 2018 2791 gene locus_tag LOCUS_26100 2018 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 3232 2711 gene locus_tag LOCUS_26110 3232 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence0596 1720 842 gene locus_tag LOCUS_26120 gene dhlA 1720 842 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122685.1 protein_id gnl|my_center|LOCUS_26120 2737 1721 gene locus_tag LOCUS_26130 2737 1721 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259366.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence0597 392 1075 gene locus_tag LOCUS_26140 392 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 1075 1548 gene locus_tag LOCUS_26150 1075 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2302 1517 gene locus_tag LOCUS_26160 2302 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence0598 <1 1322 gene locus_tag LOCUS_26170 <1 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YKD3:Lon protease 1326 2837 gene locus_tag LOCUS_26180 gene accC 1326 2837 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence0599 1 1275 gene locus_tag LOCUS_26190 1 1275 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_26190 1272 1520 gene locus_tag LOCUS_26200 1272 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 >Feature sequence0600 832 263 gene locus_tag LOCUS_26210 832 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 900 2594 gene locus_tag LOCUS_26220 900 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057740.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence0601 171 1217 gene locus_tag LOCUS_26230 171 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1226 1996 gene locus_tag LOCUS_26240 1226 1996 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_26240 1996 2511 gene locus_tag LOCUS_26250 1996 2511 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816077.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence0602 >Feature sequence0603 1617 904 gene locus_tag LOCUS_26260 1617 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2996 1614 gene locus_tag LOCUS_26270 2996 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence0604 836 396 gene locus_tag LOCUS_26280 836 396 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_26280 1179 2570 gene locus_tag LOCUS_26290 gene norM 1179 2570 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZS2 protein_id gnl|my_center|LOCUS_26290 >Feature sequence0605 2163 1369 gene locus_tag LOCUS_26300 2163 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence0606 52 2667 gene locus_tag LOCUS_26310 gene polA 52 2667 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34996 protein_id gnl|my_center|LOCUS_26310 2781 3161 gene locus_tag LOCUS_26320 2781 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 >Feature sequence0607 1 426 gene locus_tag LOCUS_26330 1 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 445 1521 gene locus_tag LOCUS_26340 gene pfk-1 445 1521 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CH0 protein_id gnl|my_center|LOCUS_26340 1990 1523 gene locus_tag LOCUS_26350 1990 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 1989 2993 gene locus_tag LOCUS_26360 1989 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence0608 1022 309 gene locus_tag LOCUS_26370 1022 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 2154 1084 gene locus_tag LOCUS_26380 2154 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 2407 2162 gene locus_tag LOCUS_26390 2407 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 2477 3001 gene locus_tag LOCUS_26400 2477 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 >Feature sequence0609 >Feature sequence0610 1244 1041 gene locus_tag LOCUS_26410 1244 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence0611 1382 534 gene locus_tag LOCUS_26420 1382 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence0612 <1 778 gene locus_tag LOCUS_26430 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938712.1:sigma-54-dependent Fis family transcriptional regulator 775 1878 gene locus_tag LOCUS_26440 775 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 2725 1829 gene locus_tag LOCUS_26450 2725 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence0613 1847 3067 gene locus_tag LOCUS_26460 1847 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 >Feature sequence0614 15 1082 gene locus_tag LOCUS_26470 gene yeiM 15 1082 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_26470 1320 1093 gene locus_tag LOCUS_26480 1320 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 1406 1918 gene locus_tag LOCUS_26490 1406 1918 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687524.1 protein_id gnl|my_center|LOCUS_26490 2634 1915 gene locus_tag LOCUS_26500 2634 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 >Feature sequence0615 1659 1252 gene locus_tag LOCUS_26510 1659 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 2401 1670 gene locus_tag LOCUS_26520 2401 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 <3158 2415 gene locus_tag LOCUS_26530 <3158 2415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74E52:S-methyl-5'-thioadenosine phosphorylase >Feature sequence0616 319 636 gene locus_tag LOCUS_26540 319 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 636 1358 gene locus_tag LOCUS_26550 636 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1355 2536 gene locus_tag LOCUS_26560 gene rsmB 1355 2536 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917991.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence0617 200 1687 gene locus_tag LOCUS_26570 200 1687 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887940.1 protein_id gnl|my_center|LOCUS_26570 1759 3006 gene locus_tag LOCUS_26580 1759 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence0618 2539 635 gene locus_tag LOCUS_26590 2539 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 2599 3030 gene locus_tag LOCUS_26600 2599 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222744.1 protein_id gnl|my_center|LOCUS_26600 >Feature sequence0619 1107 169 gene locus_tag LOCUS_26610 1107 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2837 1203 gene locus_tag LOCUS_26620 2837 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence0620 617 2263 gene locus_tag LOCUS_26630 617 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence0621 >Feature sequence0622 820 8 gene locus_tag LOCUS_26640 gene norQ 820 8 CDS product nitric oxide reductase NorQ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_26640 859 2133 gene locus_tag LOCUS_26650 859 2133 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068542.1 protein_id gnl|my_center|LOCUS_26650 2130 3089 gene locus_tag LOCUS_26660 gene nadA 2130 3089 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_26660 >Feature sequence0623 1018 1755 gene locus_tag LOCUS_26670 gene rfbD 1018 1755 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222918.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence0624 725 1477 gene locus_tag LOCUS_26680 gene speA 725 1477 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_26680 1494 2426 gene locus_tag LOCUS_26690 1494 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence0625 327 746 gene locus_tag LOCUS_26700 327 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 2496 913 gene locus_tag LOCUS_26710 2496 913 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887080.1 protein_id gnl|my_center|LOCUS_26710 2920 2561 gene locus_tag LOCUS_26720 2920 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 >Feature sequence0626 1561 1337 gene locus_tag LOCUS_26730 1561 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2328 1558 gene locus_tag LOCUS_26740 2328 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence0627 356 1249 gene locus_tag LOCUS_26750 356 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 1809 1192 gene locus_tag LOCUS_26760 1809 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2312 1806 gene locus_tag LOCUS_26770 2312 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 2725 2363 gene locus_tag LOCUS_26780 2725 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 >Feature sequence0628 <1 759 gene locus_tag LOCUS_26790 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010908854.1:polyketide synthase >Feature sequence0629 212 1210 gene locus_tag LOCUS_26800 gene fabH2 212 1210 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_26800 1204 2151 gene locus_tag LOCUS_26810 1204 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 >Feature sequence0630 1276 1704 gene locus_tag LOCUS_26820 1276 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 >Feature sequence0631 247 2301 gene locus_tag LOCUS_26830 gene fusA1 247 2301 CDS product elongation factor G 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A61 protein_id gnl|my_center|LOCUS_26830 2535 2726 gene locus_tag LOCUS_26840 2535 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 3107 2799 gene locus_tag LOCUS_26850 3107 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence0632 16 357 gene locus_tag LOCUS_26860 16 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 1050 604 gene locus_tag LOCUS_26870 1050 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 1075 1413 gene locus_tag LOCUS_26880 1075 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 1561 2274 gene locus_tag LOCUS_26890 1561 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 2543 2627 gene locus_tag LOCUS_t00130 2543 2627 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0633 1080 349 gene locus_tag LOCUS_26900 1080 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 1079 1939 gene locus_tag LOCUS_26910 1079 1939 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939818.1 protein_id gnl|my_center|LOCUS_26910 2047 2268 gene locus_tag LOCUS_26920 2047 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence0634 1430 1071 gene locus_tag LOCUS_26930 1430 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 1454 1849 gene locus_tag LOCUS_26940 1454 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 2263 1859 gene locus_tag LOCUS_26950 2263 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 >Feature sequence0635 393 983 gene locus_tag LOCUS_26960 393 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 983 2341 gene locus_tag LOCUS_26970 983 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence0636 <1 528 gene locus_tag LOCUS_26980 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383122.1:ABC transporter ATP-binding protein 525 1298 gene locus_tag LOCUS_26990 525 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 1307 2557 gene locus_tag LOCUS_27000 1307 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 >Feature sequence0637 <1 2159 gene locus_tag LOCUS_27010 <1 2159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BJ6:valine--tRNA ligase 2156 2977 gene locus_tag LOCUS_27020 2156 2977 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence0638 1223 516 gene locus_tag LOCUS_27030 1223 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 1210 1950 gene locus_tag LOCUS_27040 1210 1950 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969776.1 protein_id gnl|my_center|LOCUS_27040 2344 1913 gene locus_tag LOCUS_27050 2344 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 3083 2529 gene locus_tag LOCUS_27060 3083 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence0639 <1 688 gene locus_tag LOCUS_27070 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121327.1:ABC transporter permease <3085 681 gene locus_tag LOCUS_27080 <3085 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123208.1:serine/threonine protein kinase >Feature sequence0640 1714 458 gene locus_tag LOCUS_27090 1714 458 CDS product hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391508.1 protein_id gnl|my_center|LOCUS_27090 2913 1741 gene locus_tag LOCUS_27100 2913 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence0641 952 1875 gene locus_tag LOCUS_27110 952 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 3081 1876 gene locus_tag LOCUS_27120 3081 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence0642 >Feature sequence0643 <1 1504 gene locus_tag LOCUS_27130 <1 1504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KF74:DNA ligase 1565 2722 gene locus_tag LOCUS_27140 1565 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 >Feature sequence0644 1 831 gene locus_tag LOCUS_27150 1 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 828 2054 gene locus_tag LOCUS_27160 828 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence0645 1553 474 gene locus_tag LOCUS_27170 1553 474 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892860.1 protein_id gnl|my_center|LOCUS_27170 1654 2355 gene locus_tag LOCUS_27180 1654 2355 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_27180 >Feature sequence0646 855 1595 gene locus_tag LOCUS_27190 855 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257299.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence0647 1976 2788 gene locus_tag LOCUS_27200 1976 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence0648 >Feature sequence0649 1298 450 gene locus_tag LOCUS_27210 1298 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 2108 1551 gene locus_tag LOCUS_27220 2108 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 2188 2877 gene locus_tag LOCUS_27230 2188 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 >Feature sequence0650 <1 1310 gene locus_tag LOCUS_27240 <1 1310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889584.1:N-glycosidase F 1319 2734 gene locus_tag LOCUS_27250 1319 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence0651 598 903 gene locus_tag LOCUS_27260 598 903 CDS product divalent ion tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 protein_id gnl|my_center|LOCUS_27260 <3040 904 gene locus_tag LOCUS_27270 <3040 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXN2:phosphoribosylformylglycinamidine synthase >Feature sequence0652 1300 752 gene locus_tag LOCUS_27280 1300 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 1725 1297 gene locus_tag LOCUS_27290 1725 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence0653 2496 1546 gene locus_tag LOCUS_27300 2496 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence0654 1223 390 gene locus_tag LOCUS_27310 gene fliC 1223 390 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748G4 protein_id gnl|my_center|LOCUS_27310 2209 1328 gene locus_tag LOCUS_27320 2209 1328 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460796.1 protein_id gnl|my_center|LOCUS_27320 2627 2259 gene locus_tag LOCUS_27330 2627 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence0655 2324 735 gene locus_tag LOCUS_27340 2324 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 <3018 2321 gene locus_tag LOCUS_27350 <3018 2321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266757.1:metal-dependent phosphohydrolase >Feature sequence0656 1886 36 gene locus_tag LOCUS_27360 1886 36 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768135.1 protein_id gnl|my_center|LOCUS_27360 2253 1936 gene locus_tag LOCUS_27370 2253 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence0657 2277 2537 gene locus_tag LOCUS_27380 2277 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence0658 2023 725 gene locus_tag LOCUS_27390 2023 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 >Feature sequence0659 533 1144 gene locus_tag LOCUS_27400 533 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence0660 1352 72 gene locus_tag LOCUS_27410 1352 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 2142 1360 gene locus_tag LOCUS_27420 2142 1360 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 protein_id gnl|my_center|LOCUS_27420 >Feature sequence0661 239 1237 gene locus_tag LOCUS_27430 239 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1748 1239 gene locus_tag LOCUS_27440 1748 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 >Feature sequence0662 123 1418 gene locus_tag LOCUS_27450 123 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 2289 1441 gene locus_tag LOCUS_27460 2289 1441 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence0663 >Feature sequence0664 762 2861 gene locus_tag LOCUS_27470 762 2861 CDS product putative Na+/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705362.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence0665 768 541 gene locus_tag LOCUS_27480 768 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 >Feature sequence0666 581 324 gene locus_tag LOCUS_27490 581 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 1043 663 gene locus_tag LOCUS_27500 1043 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 1220 1296 gene locus_tag LOCUS_t00140 1220 1296 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1397 2251 gene locus_tag LOCUS_27510 1397 2251 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_27510 2248 2607 gene locus_tag LOCUS_27520 2248 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence0667 440 781 gene locus_tag LOCUS_27530 440 781 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140042.1 protein_id gnl|my_center|LOCUS_27530 984 1934 gene locus_tag LOCUS_27540 984 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 1974 2330 gene locus_tag LOCUS_27550 1974 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence0668 1000 626 gene locus_tag LOCUS_27560 1000 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2403 1141 gene locus_tag LOCUS_27570 gene hemL 2403 1141 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA9 protein_id gnl|my_center|LOCUS_27570 <2968 2437 gene locus_tag LOCUS_27580 <2968 2437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000841351.1:thermonuclease family protein >Feature sequence0669 1512 94 gene locus_tag LOCUS_27590 1512 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence0670 2537 1158 gene locus_tag LOCUS_27600 2537 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence0671 <1 920 gene locus_tag LOCUS_27610 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969509.1:guanylyl cyclase 1400 921 gene locus_tag LOCUS_27620 1400 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 1451 1948 gene locus_tag LOCUS_27630 1451 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 2089 2610 gene locus_tag LOCUS_27640 2089 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 >Feature sequence0672 265 26 gene locus_tag LOCUS_27650 265 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 325 1014 gene locus_tag LOCUS_27660 325 1014 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339032.1 protein_id gnl|my_center|LOCUS_27660 1386 1177 gene locus_tag LOCUS_27670 1386 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 <2952 1383 gene locus_tag LOCUS_27680 <2952 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000042798.1:helicase >Feature sequence0673 >Feature sequence0674 1 894 gene locus_tag LOCUS_27690 1 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 1885 953 gene locus_tag LOCUS_27700 1885 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 2014 2490 gene locus_tag LOCUS_27710 2014 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 >Feature sequence0675 2213 1611 gene locus_tag LOCUS_27720 2213 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 >Feature sequence0676 1335 322 gene locus_tag LOCUS_27730 1335 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 <2941 1440 gene locus_tag LOCUS_27740 <2941 1440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FQW7:alanine--tRNA ligase >Feature sequence0677 2800 440 gene locus_tag LOCUS_27750 2800 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence0678 2254 986 gene locus_tag LOCUS_27760 2254 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence0679 1176 526 gene locus_tag LOCUS_27770 1176 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 1754 1179 gene locus_tag LOCUS_27780 1754 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2338 1754 gene locus_tag LOCUS_27790 2338 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence0680 1315 689 gene locus_tag LOCUS_27800 1315 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 2623 1325 gene locus_tag LOCUS_27810 2623 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 >Feature sequence0681 2362 536 gene locus_tag LOCUS_27820 2362 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence0682 578 1918 gene locus_tag LOCUS_27830 578 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 2749 1919 gene locus_tag LOCUS_27840 2749 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 >Feature sequence0683 1101 283 gene locus_tag LOCUS_27850 1101 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703681.1 protein_id gnl|my_center|LOCUS_27850 1161 2357 gene locus_tag LOCUS_27860 1161 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence0684 <2917 1303 gene locus_tag LOCUS_27870 <2917 1303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966095.1:glucoamylase >Feature sequence0685 323 886 gene locus_tag LOCUS_27880 323 886 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257076.1 protein_id gnl|my_center|LOCUS_27880 883 1575 gene locus_tag LOCUS_27890 883 1575 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_27890 2580 1540 gene locus_tag LOCUS_27900 2580 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 >Feature sequence0686 365 973 gene locus_tag LOCUS_27910 gene ruvA 365 973 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E87 protein_id gnl|my_center|LOCUS_27910 973 2052 gene locus_tag LOCUS_27920 gene ruvB 973 2052 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61532 protein_id gnl|my_center|LOCUS_27920 2052 2471 gene locus_tag LOCUS_27930 2052 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 >Feature sequence0687 955 353 gene locus_tag LOCUS_27940 gene def 955 353 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP01 protein_id gnl|my_center|LOCUS_27940 1012 1185 gene locus_tag LOCUS_27950 1012 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 1182 2156 gene locus_tag LOCUS_27960 1182 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence0688 >Feature sequence0689 1237 2010 gene locus_tag LOCUS_27970 gene norQ 1237 2010 CDS product nitric oxide reductase NorQ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_27970 >Feature sequence0690 1560 193 gene locus_tag LOCUS_27980 1560 193 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104117.1 protein_id gnl|my_center|LOCUS_27980 1582 2298 gene locus_tag LOCUS_27990 1582 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence0691 295 729 gene locus_tag LOCUS_28000 295 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 730 1560 gene locus_tag LOCUS_28010 730 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 2104 2028 gene locus_tag LOCUS_t00150 2104 2028 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0692 494 883 gene locus_tag LOCUS_28020 494 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 870 2285 gene locus_tag LOCUS_28030 870 2285 CDS product putative GMC-type oxidoreductase y4nJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55582 protein_id gnl|my_center|LOCUS_28030 >Feature sequence0693 742 2346 gene locus_tag LOCUS_28040 742 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2797 2351 gene locus_tag LOCUS_28050 2797 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence0694 750 85 gene locus_tag LOCUS_28060 750 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 1641 844 gene locus_tag LOCUS_28070 1641 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 2786 1656 gene locus_tag LOCUS_28080 2786 1656 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence0695 479 1144 gene locus_tag LOCUS_28090 479 1144 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227430.1 protein_id gnl|my_center|LOCUS_28090 2683 1154 gene locus_tag LOCUS_28100 2683 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 >Feature sequence0696 2194 1268 gene locus_tag LOCUS_28110 2194 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 <2895 2194 gene locus_tag LOCUS_28120 <2895 2194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962292.1:outer membrane protein >Feature sequence0697 149 757 gene locus_tag LOCUS_28130 149 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 1007 741 gene locus_tag LOCUS_28140 1007 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 >Feature sequence0698 630 1634 gene locus_tag LOCUS_28150 630 1634 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_28150 >Feature sequence0699 1213 395 gene locus_tag LOCUS_28160 1213 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 2400 1210 gene locus_tag LOCUS_28170 gene fabF 2400 1210 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence0700 <1 591 gene locus_tag LOCUS_28180 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74AE2:octanoyltransferase 627 699 gene locus_tag LOCUS_t00160 627 699 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 828 1025 gene locus_tag LOCUS_28190 gene rpmI 828 1025 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKP7 protein_id gnl|my_center|LOCUS_28190 1125 1475 gene locus_tag LOCUS_28200 gene rplT 1125 1475 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBC9 protein_id gnl|my_center|LOCUS_28200 1559 1966 gene locus_tag LOCUS_28210 1559 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 2024 2389 gene locus_tag LOCUS_28220 2024 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 2386 2790 gene locus_tag LOCUS_28230 2386 2790 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408375.1 protein_id gnl|my_center|LOCUS_28230 2806 2882 gene locus_tag LOCUS_t00170 2806 2882 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0701 >Feature sequence0702 957 1958 gene locus_tag LOCUS_28240 957 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 <2880 1944 gene locus_tag LOCUS_28250 <2880 1944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257672.1:glycosyl transferase family 1 >Feature sequence0703 1679 225 gene locus_tag LOCUS_28260 1679 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 2450 1686 gene locus_tag LOCUS_28270 2450 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence0704 <1 603 gene locus_tag LOCUS_28280 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WF18:GDP-L-fucose synthase 717 1595 gene locus_tag LOCUS_28290 717 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 2154 1678 gene locus_tag LOCUS_28300 2154 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence0705 1474 200 gene locus_tag LOCUS_28310 1474 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2748 1474 gene locus_tag LOCUS_28320 2748 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence0706 1850 402 gene locus_tag LOCUS_28330 1850 402 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHK0 protein_id gnl|my_center|LOCUS_28330 >Feature sequence0707 385 2037 gene locus_tag LOCUS_28340 385 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 >Feature sequence0708 1475 402 gene locus_tag LOCUS_28350 1475 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence0709 1982 1461 gene locus_tag LOCUS_28360 1982 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence0710 458 2458 gene locus_tag LOCUS_28370 458 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence0711 769 68 gene locus_tag LOCUS_28380 769 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 809 1537 gene locus_tag LOCUS_28390 809 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence0712 2086 857 gene locus_tag LOCUS_28400 gene ivd 2086 857 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202093.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence0713 >Feature sequence0714 1459 425 gene locus_tag LOCUS_28410 1459 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1584 2114 gene locus_tag LOCUS_28420 1584 2114 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_28420 2124 2837 gene locus_tag LOCUS_28430 2124 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence0715 799 1551 gene locus_tag LOCUS_28440 799 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 >Feature sequence0716 95 1183 gene locus_tag LOCUS_28450 95 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 1180 2427 gene locus_tag LOCUS_28460 1180 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence0717 1441 1845 gene locus_tag LOCUS_28470 1441 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 2226 1861 gene locus_tag LOCUS_28480 2226 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence0718 1457 123 gene locus_tag LOCUS_28490 1457 123 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119512.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28490 1662 1420 gene locus_tag LOCUS_28500 1662 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 2050 1688 gene locus_tag LOCUS_28510 2050 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2830 2123 gene locus_tag LOCUS_28520 2830 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence0719 519 2018 gene locus_tag LOCUS_28530 gene opuD 519 2018 CDS product glycine/betaine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230127.1 protein_id gnl|my_center|LOCUS_28530 >Feature sequence0720 1547 285 gene locus_tag LOCUS_28540 gene glmM 1547 285 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5C2 protein_id gnl|my_center|LOCUS_28540 2544 1558 gene locus_tag LOCUS_28550 2544 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence0721 2676 1681 gene locus_tag LOCUS_28560 2676 1681 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259367.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence0722 264 812 gene locus_tag LOCUS_28570 264 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 1173 913 gene locus_tag LOCUS_28580 gene minE 1173 913 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B11 protein_id gnl|my_center|LOCUS_28580 1985 1173 gene locus_tag LOCUS_28590 1985 1173 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_28590 <2818 2010 gene locus_tag LOCUS_28600 <2818 2010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97JM5:putative septum site-determining protein MinC >Feature sequence0723 >Feature sequence0724 943 110 gene locus_tag LOCUS_28610 943 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 2194 944 gene locus_tag LOCUS_28620 2194 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 >Feature sequence0725 875 2146 gene locus_tag LOCUS_28630 875 2146 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC96 protein_id gnl|my_center|LOCUS_28630 >Feature sequence0726 246 2471 gene locus_tag LOCUS_28640 246 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence0727 1958 1269 gene locus_tag LOCUS_28650 1958 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 <2808 1962 gene locus_tag LOCUS_28660 <2808 1962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I1M0:lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex >Feature sequence0728 838 1608 gene locus_tag LOCUS_28670 838 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 1608 2390 gene locus_tag LOCUS_28680 1608 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 2512 2754 gene locus_tag LOCUS_28690 2512 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 >Feature sequence0729 1508 402 gene locus_tag LOCUS_28700 1508 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 2800 1505 gene locus_tag LOCUS_28710 2800 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence0730 1973 1035 gene locus_tag LOCUS_28720 1973 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 2026 2430 gene locus_tag LOCUS_28730 2026 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 >Feature sequence0731 >Feature sequence0732 1361 618 gene locus_tag LOCUS_28740 1361 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 <2787 1361 gene locus_tag LOCUS_28750 <2787 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DB6:DNA-directed DNA polymerase >Feature sequence0733 >Feature sequence0734 <2787 628 gene locus_tag LOCUS_28760 <2787 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P96736:PGA synthase CapB >Feature sequence0735 <2785 685 gene locus_tag LOCUS_28770 <2785 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74AT3:outer membrane protein assembly factor BamA >Feature sequence0736 1052 402 gene locus_tag LOCUS_28780 1052 402 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_28780 2767 1106 gene locus_tag LOCUS_28790 2767 1106 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388138.1 protein_id gnl|my_center|LOCUS_28790 >Feature sequence0737 1516 2559 gene locus_tag LOCUS_28800 1516 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence0738 2396 633 gene locus_tag LOCUS_28810 2396 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence0739 158 565 gene locus_tag LOCUS_28820 158 565 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356374.1 protein_id gnl|my_center|LOCUS_28820 562 1866 gene locus_tag LOCUS_28830 562 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 >Feature sequence0740 <1 619 gene locus_tag LOCUS_28840 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258380.1:SAM-dependent methyltransferase 2156 624 gene locus_tag LOCUS_28850 2156 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 >Feature sequence0741 1119 454 gene locus_tag LOCUS_28860 1119 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 1283 2170 gene locus_tag LOCUS_28870 1283 2170 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731536.1 protein_id gnl|my_center|LOCUS_28870 >Feature sequence0742 2382 1405 gene locus_tag LOCUS_28880 2382 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 2476 2724 gene locus_tag LOCUS_28890 2476 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 >Feature sequence0743 418 1662 gene locus_tag LOCUS_28900 418 1662 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGF9 protein_id gnl|my_center|LOCUS_28900 2271 1651 gene locus_tag LOCUS_28910 2271 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141352.1 protein_id gnl|my_center|LOCUS_28910 >Feature sequence0744 158 736 gene locus_tag LOCUS_28920 gene maf-2 158 736 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WS4 protein_id gnl|my_center|LOCUS_28920 733 1431 gene locus_tag LOCUS_28930 733 1431 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105285.1 protein_id gnl|my_center|LOCUS_28930 2690 1446 gene locus_tag LOCUS_28940 2690 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence0745 >Feature sequence0746 247 1368 gene locus_tag LOCUS_28950 247 1368 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_28950 2687 1512 gene locus_tag LOCUS_28960 2687 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 >Feature sequence0747 255 1019 gene locus_tag LOCUS_28970 255 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 1016 2326 gene locus_tag LOCUS_28980 gene tolB 1016 2326 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H67 protein_id gnl|my_center|LOCUS_28980 >Feature sequence0748 704 180 gene locus_tag LOCUS_28990 gene nadD 704 180 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0V3 protein_id gnl|my_center|LOCUS_28990 666 1409 gene locus_tag LOCUS_29000 gene ftsE 666 1409 CDS product putative cell-division ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_268888.1 protein_id gnl|my_center|LOCUS_29000 1406 2296 gene locus_tag LOCUS_29010 gene ftsX 1406 2296 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CA0 protein_id gnl|my_center|LOCUS_29010 >Feature sequence0749 1317 217 gene locus_tag LOCUS_29020 1317 217 CDS product dihydropyrimidine dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_29020 1364 2524 gene locus_tag LOCUS_29030 1364 2524 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338164.1 protein_id gnl|my_center|LOCUS_29030 >Feature sequence0750 29 1588 gene locus_tag LOCUS_29040 29 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 1989 2258 gene locus_tag LOCUS_29050 1989 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence0751 >Feature sequence0752 859 2346 gene locus_tag LOCUS_29060 859 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence0753 979 506 gene locus_tag LOCUS_29070 979 506 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258337.1 protein_id gnl|my_center|LOCUS_29070 2437 989 gene locus_tag LOCUS_29080 2437 989 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI85 protein_id gnl|my_center|LOCUS_29080 >Feature sequence0754 >Feature sequence0755 528 1325 gene locus_tag LOCUS_29090 528 1325 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098462.1 protein_id gnl|my_center|LOCUS_29090 1318 2085 gene locus_tag LOCUS_29100 1318 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 >Feature sequence0756 1599 607 gene locus_tag LOCUS_29110 gene gapA 1599 607 CDS product glyceraldehyde-3-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P09124 protein_id gnl|my_center|LOCUS_29110 >Feature sequence0757 449 1396 gene locus_tag LOCUS_29120 449 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 1393 2400 gene locus_tag LOCUS_29130 1393 2400 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence0758 829 1839 gene locus_tag LOCUS_29140 gene mutY 829 1839 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_29140 2736 1846 gene locus_tag LOCUS_29150 2736 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence0759 1834 2367 gene locus_tag LOCUS_29160 1834 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 >Feature sequence0760 1096 2010 gene locus_tag LOCUS_29170 1096 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence0761 <1 627 gene locus_tag LOCUS_29180 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein 1482 592 gene locus_tag LOCUS_29190 1482 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 2353 1487 gene locus_tag LOCUS_29200 2353 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence0762 1404 475 gene locus_tag LOCUS_29210 1404 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143966.1 protein_id gnl|my_center|LOCUS_29210 1857 1408 gene locus_tag LOCUS_29220 1857 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 >Feature sequence0763 599 2023 gene locus_tag LOCUS_29230 599 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 >Feature sequence0764 <1 508 gene locus_tag LOCUS_29240 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UU72:DNA topoisomerase (ATP-hydrolyzing) 505 2313 gene locus_tag LOCUS_29250 505 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 2728 2318 gene locus_tag LOCUS_29260 2728 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 >Feature sequence0765 1297 338 gene locus_tag LOCUS_29270 1297 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073065.1 protein_id gnl|my_center|LOCUS_29270 >Feature sequence0766 1123 59 gene locus_tag LOCUS_29280 1123 59 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_29280 2376 1120 gene locus_tag LOCUS_29290 2376 1120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_29290 >Feature sequence0767 <2723 258 gene locus_tag LOCUS_29300 <2723 258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941727.1:pilus assembly protein PilY >Feature sequence0768 <2723 592 gene locus_tag LOCUS_29310 <2723 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D452:Fused isobutyryl-CoA mutase >Feature sequence0769 425 805 gene locus_tag LOCUS_29320 gene rimI 425 805 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB7 protein_id gnl|my_center|LOCUS_29320 802 2031 gene locus_tag LOCUS_29330 802 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 >Feature sequence0770 1361 819 gene locus_tag LOCUS_29340 1361 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 <2719 1361 gene locus_tag LOCUS_29350 <2719 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P96738:PGA biosynthesis protein CapA >Feature sequence0771 534 1151 gene locus_tag LOCUS_29360 534 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 1151 1954 gene locus_tag LOCUS_29370 1151 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 >Feature sequence0772 1506 307 gene locus_tag LOCUS_29380 1506 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144052.1 protein_id gnl|my_center|LOCUS_29380 1583 2368 gene locus_tag LOCUS_29390 1583 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence0773 2157 1216 gene locus_tag LOCUS_29400 2157 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 >Feature sequence0774 625 2664 gene locus_tag LOCUS_29410 625 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 >Feature sequence0775 109 1023 gene locus_tag LOCUS_29420 gene ilvA 109 1023 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227667.1 protein_id gnl|my_center|LOCUS_29420 1116 2570 gene locus_tag LOCUS_29430 1116 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence0776 1543 1034 gene locus_tag LOCUS_29440 1543 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 2297 1572 gene locus_tag LOCUS_29450 2297 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_29450 >Feature sequence0777 >Feature sequence0778 1046 1378 gene locus_tag LOCUS_29460 1046 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 1375 1770 gene locus_tag LOCUS_29470 1375 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence0779 <2701 411 gene locus_tag LOCUS_29480 <2701 411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391423.1:C4-dicarboxylate ABC transporter permease >Feature sequence0780 2404 875 gene locus_tag LOCUS_29490 2404 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence0781 1601 360 gene locus_tag LOCUS_29500 gene nqrA 1601 360 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNZ8 protein_id gnl|my_center|LOCUS_29500 2525 1803 gene locus_tag LOCUS_29510 2525 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 >Feature sequence0782 270 479 gene locus_tag LOCUS_29520 270 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 1240 404 gene locus_tag LOCUS_29530 gene phhA 1240 404 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404797.1 protein_id gnl|my_center|LOCUS_29530 1268 1819 gene locus_tag LOCUS_29540 1268 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2165 1812 gene locus_tag LOCUS_29550 2165 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 2134 2445 gene locus_tag LOCUS_29560 2134 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence0783 1066 2181 gene locus_tag LOCUS_29570 1066 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence0784 1033 410 gene locus_tag LOCUS_29580 1033 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 >Feature sequence0785 >Feature sequence0786 316 1377 gene locus_tag LOCUS_29590 316 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence0787 >Feature sequence0788 1319 498 gene locus_tag LOCUS_29600 1319 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 >Feature sequence0789 <1 2346 gene locus_tag LOCUS_29610 <1 2346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S2H4:DNA topoisomerase (ATP-hydrolyzing) >Feature sequence0790 739 284 gene locus_tag LOCUS_29620 739 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 2178 736 gene locus_tag LOCUS_29630 2178 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence0791 57 869 gene locus_tag LOCUS_29640 57 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 863 1234 gene locus_tag LOCUS_29650 863 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 1302 2075 gene locus_tag LOCUS_29660 1302 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 >Feature sequence0792 >Feature sequence0793 1038 394 gene locus_tag LOCUS_29670 1038 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 2058 1039 gene locus_tag LOCUS_29680 gene fliG 2058 1039 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1V6 protein_id gnl|my_center|LOCUS_29680 2676 2074 gene locus_tag LOCUS_29690 2676 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence0794 237 1211 gene locus_tag LOCUS_29700 gene galE 237 1211 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938655.1 protein_id gnl|my_center|LOCUS_29700 2486 1227 gene locus_tag LOCUS_29710 2486 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 >Feature sequence0795 <1 851 gene locus_tag LOCUS_29720 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402848.1:alpha/beta hydrolase 1548 856 gene locus_tag LOCUS_29730 1548 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 2051 1590 gene locus_tag LOCUS_29740 2051 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 >Feature sequence0796 2350 1685 gene locus_tag LOCUS_29750 2350 1685 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537552.1 protein_id gnl|my_center|LOCUS_29750 >Feature sequence0797 1 1008 gene locus_tag LOCUS_29760 1 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 1005 2429 gene locus_tag LOCUS_29770 1005 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 >Feature sequence0798 <1 1107 gene locus_tag LOCUS_29780 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000783536.1:MATE family efflux transporter 1109 1909 gene locus_tag LOCUS_29790 1109 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 2396 1911 gene locus_tag LOCUS_29800 2396 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 >Feature sequence0799 935 465 gene locus_tag LOCUS_29810 gene fabZ 935 465 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1I0 protein_id gnl|my_center|LOCUS_29810 2157 928 gene locus_tag LOCUS_29820 gene fabB 2157 928 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_29820 >Feature sequence0800 2257 368 gene locus_tag LOCUS_29830 2257 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 >Feature sequence0801 345 1295 gene locus_tag LOCUS_29840 345 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 >Feature sequence0802 >Feature sequence0803 1600 695 gene locus_tag LOCUS_29850 1600 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 2632 1655 gene locus_tag LOCUS_29860 gene dnaJ1 2632 1655 CDS product chaperone protein DnaJ 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLW9 protein_id gnl|my_center|LOCUS_29860 >Feature sequence0804 474 121 gene locus_tag LOCUS_29870 474 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 1319 471 gene locus_tag LOCUS_29880 1319 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 1744 1382 gene locus_tag LOCUS_29890 1744 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 2037 1762 gene locus_tag LOCUS_29900 2037 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 2083 2334 gene locus_tag LOCUS_29910 2083 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 >Feature sequence0805 1428 769 gene locus_tag LOCUS_29920 1428 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 1584 2093 gene locus_tag LOCUS_29930 1584 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence0806 1217 528 gene locus_tag LOCUS_29940 1217 528 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709525.1 protein_id gnl|my_center|LOCUS_29940 1724 1227 gene locus_tag LOCUS_29950 1724 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 2656 1835 gene locus_tag LOCUS_29960 2656 1835 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389061.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence0807 346 1110 gene locus_tag LOCUS_29970 346 1110 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259198.1 protein_id gnl|my_center|LOCUS_29970 1115 2149 gene locus_tag LOCUS_29980 1115 2149 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BQ0 protein_id gnl|my_center|LOCUS_29980 >Feature sequence0808 >Feature sequence0809 2163 1375 gene locus_tag LOCUS_29990 2163 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 >Feature sequence0810 <1 532 gene locus_tag LOCUS_30000 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72AV5:aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B 1469 540 gene locus_tag LOCUS_30010 1469 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 >Feature sequence0811 1024 2166 gene locus_tag LOCUS_30020 1024 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 >Feature sequence0812 755 1159 gene locus_tag LOCUS_30030 755 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 1845 1147 gene locus_tag LOCUS_30040 1845 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082464.1 protein_id gnl|my_center|LOCUS_30040 >Feature sequence0813 572 1831 gene locus_tag LOCUS_30050 572 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 772 866 gene locus_tag LOCUS_t00180 772 866 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0814 1611 922 gene locus_tag LOCUS_30060 1611 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 <2643 1857 gene locus_tag LOCUS_30070 <2643 1857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091272.1:D-alanyl-D-alanine carboxypeptidase >Feature sequence0815 <1 2043 gene locus_tag LOCUS_30080 <1 2043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0PC08:outer membrane protein assembly factor BamA >Feature sequence0816 301 2091 gene locus_tag LOCUS_30090 301 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 <2618 2092 gene locus_tag LOCUS_30100 <2618 2092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869971.1:phosphohydrolase >Feature sequence0817 1638 520 gene locus_tag LOCUS_30110 gene hisC 1638 520 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_30110 1773 2090 gene locus_tag LOCUS_30120 1773 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 2118 2417 gene locus_tag LOCUS_30130 2118 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence0818 1527 640 gene locus_tag LOCUS_30140 1527 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 1757 2050 gene locus_tag LOCUS_30150 gene hup2 1757 2050 CDS product SPBc2 prophage-derived DNA-binding protein HU 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P68573 protein_id gnl|my_center|LOCUS_30150 2165 2479 gene locus_tag LOCUS_30160 2165 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence0819 <1 1250 gene locus_tag LOCUS_30170 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459869.1:Trk system potassium transport protein TrkA >Feature sequence0820 <1 2039 gene locus_tag LOCUS_30180 <1 2039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272843.1:helicase 2036 2308 gene locus_tag LOCUS_30190 2036 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 >Feature sequence0821 2326 1694 gene locus_tag LOCUS_30200 2326 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 >Feature sequence0822 1099 464 gene locus_tag LOCUS_30210 1099 464 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919946.1 protein_id gnl|my_center|LOCUS_30210 <2604 1155 gene locus_tag LOCUS_30220 <2604 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390236.1:multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase >Feature sequence0823 >Feature sequence0824 >Feature sequence0825 434 1363 gene locus_tag LOCUS_30230 434 1363 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_30230 1360 2076 gene locus_tag LOCUS_30240 1360 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 >Feature sequence0826 236 868 gene locus_tag LOCUS_30250 236 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 1419 898 gene locus_tag LOCUS_30260 1419 898 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JZ5 protein_id gnl|my_center|LOCUS_30260 2039 1449 gene locus_tag LOCUS_30270 2039 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 >Feature sequence0827 528 1961 gene locus_tag LOCUS_30280 528 1961 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868057.1 protein_id gnl|my_center|LOCUS_30280 >Feature sequence0828 2350 887 gene locus_tag LOCUS_30290 2350 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 >Feature sequence0829 1 711 gene locus_tag LOCUS_30300 1 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 1678 752 gene locus_tag LOCUS_30310 1678 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 2151 1675 gene locus_tag LOCUS_30320 2151 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 >Feature sequence0830 1153 236 gene locus_tag LOCUS_30330 gene lipA 1153 236 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLQ4 protein_id gnl|my_center|LOCUS_30330 1570 1226 gene locus_tag LOCUS_30340 1570 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 >Feature sequence0831 1887 925 gene locus_tag LOCUS_30350 1887 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 >Feature sequence0832 137 880 gene locus_tag LOCUS_30360 137 880 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705948.1 protein_id gnl|my_center|LOCUS_30360 2467 863 gene locus_tag LOCUS_30370 2467 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 >Feature sequence0833 <2569 1028 gene locus_tag LOCUS_30380 <2569 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein >Feature sequence0834 2236 1115 gene locus_tag LOCUS_30390 gene acrA 2236 1115 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339206.1 protein_id gnl|my_center|LOCUS_30390 >Feature sequence0835 1026 1628 gene locus_tag LOCUS_30400 1026 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 2447 1704 gene locus_tag LOCUS_30410 2447 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 >Feature sequence0836 574 1137 gene locus_tag LOCUS_30420 574 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 1134 2141 gene locus_tag LOCUS_30430 1134 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 >Feature sequence0837 173 796 gene locus_tag LOCUS_30440 gene rplD 173 796 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EH9 protein_id gnl|my_center|LOCUS_30440 800 1096 gene locus_tag LOCUS_30450 gene rplW 800 1096 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z1 protein_id gnl|my_center|LOCUS_30450 1125 1955 gene locus_tag LOCUS_30460 gene rplB 1125 1955 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60401 protein_id gnl|my_center|LOCUS_30460 1965 2249 gene locus_tag LOCUS_30470 gene rpsS 1965 2249 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z2 protein_id gnl|my_center|LOCUS_30470 >Feature sequence0838 694 98 gene locus_tag LOCUS_30480 gene algU 694 98 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIP2 protein_id gnl|my_center|LOCUS_30480 <2562 716 gene locus_tag LOCUS_30490 <2562 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74FR5:DNA polymerase >Feature sequence0839 >Feature sequence0840 >Feature sequence0841 1585 371 gene locus_tag LOCUS_30500 1585 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 2330 1575 gene locus_tag LOCUS_30510 2330 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence0842 444 1226 gene locus_tag LOCUS_30520 gene rsmI 444 1226 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCU9 protein_id gnl|my_center|LOCUS_30520 1595 1239 gene locus_tag LOCUS_30530 1595 1239 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXE2 protein_id gnl|my_center|LOCUS_30530 2036 1602 gene locus_tag LOCUS_30540 2036 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence0843 >Feature sequence0844 <1 1194 gene locus_tag LOCUS_30550 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122176.1:thiol-disulfide isomerase >Feature sequence0845 1141 203 gene locus_tag LOCUS_30560 1141 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 1528 1145 gene locus_tag LOCUS_30570 gene rbfA 1528 1145 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_30570 >Feature sequence0846 2124 334 gene locus_tag LOCUS_30580 2124 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 2504 2121 gene locus_tag LOCUS_30590 2504 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 >Feature sequence0847 >Feature sequence0848 <1 683 gene locus_tag LOCUS_30600 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097940.1:D-alanyl-D-alanine endopeptidase 732 2012 gene locus_tag LOCUS_30610 732 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 >Feature sequence0849 <2534 1322 gene locus_tag LOCUS_30620 <2534 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708730.1:NADH-quinone oxidoreductase subunit F >Feature sequence0850 2345 996 gene locus_tag LOCUS_30630 gene murF 2345 996 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9Q4 protein_id gnl|my_center|LOCUS_30630 2533 2342 gene locus_tag LOCUS_30640 2533 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 >Feature sequence0851 378 680 gene locus_tag LOCUS_30650 378 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 885 688 gene locus_tag LOCUS_30660 885 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 2162 876 gene locus_tag LOCUS_30670 2162 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 >Feature sequence0852 868 257 gene locus_tag LOCUS_30680 gene bioD 868 257 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Y24 protein_id gnl|my_center|LOCUS_30680 1377 871 gene locus_tag LOCUS_30690 1377 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 2159 1374 gene locus_tag LOCUS_30700 2159 1374 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338062.1 protein_id gnl|my_center|LOCUS_30700 >Feature sequence0853 >Feature sequence0854 523 1881 gene locus_tag LOCUS_30710 523 1881 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546410.1 protein_id gnl|my_center|LOCUS_30710 >Feature sequence0855 1199 879 gene locus_tag LOCUS_30720 1199 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 1928 1254 gene locus_tag LOCUS_30730 1928 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 2385 2008 gene locus_tag LOCUS_30740 2385 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 >Feature sequence0856 1563 319 gene locus_tag LOCUS_30750 gene gspF 1563 319 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704542.1 protein_id gnl|my_center|LOCUS_30750 <2514 1567 gene locus_tag LOCUS_30760 <2514 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070564.1:type II secretion system protein GspE >Feature sequence0857 2 322 gene locus_tag LOCUS_30770 2 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 330 845 gene locus_tag LOCUS_30780 330 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 1978 851 gene locus_tag LOCUS_30790 1978 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 >Feature sequence0858 1706 717 gene locus_tag LOCUS_30800 1706 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703860.1 protein_id gnl|my_center|LOCUS_30800 >Feature sequence0859 <1 582 gene locus_tag LOCUS_30810 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63W96:segregation and condensation protein A 1390 575 gene locus_tag LOCUS_30820 1390 575 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531135.1 protein_id gnl|my_center|LOCUS_30820 2355 1387 gene locus_tag LOCUS_30830 2355 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence0860 919 2019 gene locus_tag LOCUS_30840 919 2019 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886817.1 protein_id gnl|my_center|LOCUS_30840 >Feature sequence0861 75 239 gene locus_tag LOCUS_30850 75 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 1709 270 gene locus_tag LOCUS_30860 1709 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 2377 1706 gene locus_tag LOCUS_30870 gene phoB 2377 1706 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_30870 >Feature sequence0862 1364 1744 gene locus_tag LOCUS_30880 1364 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 1967 2389 gene locus_tag LOCUS_30890 gene flgC 1967 2389 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72F99 protein_id gnl|my_center|LOCUS_30890 >Feature sequence0863 75 1139 gene locus_tag LOCUS_30900 75 1139 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256493.1 protein_id gnl|my_center|LOCUS_30900 >Feature sequence0864 <1 695 gene locus_tag LOCUS_30910 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256856.1:SpoVR family protein 692 1150 gene locus_tag LOCUS_30920 692 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 2195 1152 gene locus_tag LOCUS_30930 gene rsgA 2195 1152 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFS8 protein_id gnl|my_center|LOCUS_30930 >Feature sequence0865 >Feature sequence0866 <1 1667 gene locus_tag LOCUS_30940 <1 1667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946756.1:MBL fold hydrolase >Feature sequence0867 221 1702 gene locus_tag LOCUS_30950 221 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence0868 45 389 gene locus_tag LOCUS_30960 45 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 405 728 gene locus_tag LOCUS_30970 405 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 <2481 735 gene locus_tag LOCUS_30980 <2481 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039157.1:type II secretion system protein E >Feature sequence0869 130 1053 gene locus_tag LOCUS_30990 130 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 1710 1042 gene locus_tag LOCUS_31000 1710 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 >Feature sequence0870 770 1738 gene locus_tag LOCUS_31010 770 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 <2477 1740 gene locus_tag LOCUS_31020 <2477 1740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DAZ7:hercynine oxygenase >Feature sequence0871 >Feature sequence0872 2170 722 gene locus_tag LOCUS_31030 2170 722 CDS product UDP-phosphate galactose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_31030 >Feature sequence0873 108 662 gene locus_tag LOCUS_31040 108 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 584 841 gene locus_tag LOCUS_31050 584 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 >Feature sequence0874 598 413 gene locus_tag LOCUS_31060 598 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 745 1281 gene locus_tag LOCUS_31070 745 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 2128 1292 gene locus_tag LOCUS_31080 2128 1292 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086042.1 protein_id gnl|my_center|LOCUS_31080 >Feature sequence0875 <2460 1186 gene locus_tag LOCUS_31090 <2460 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022506.1:phycocyanobilin lyase >Feature sequence0876 306 1580 gene locus_tag LOCUS_31100 gene aroA 306 1580 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLY3 protein_id gnl|my_center|LOCUS_31100 1577 2260 gene locus_tag LOCUS_31110 gene cmk 1577 2260 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749Y7 protein_id gnl|my_center|LOCUS_31110 >Feature sequence0877 <2457 269 gene locus_tag LOCUS_31120 <2457 269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071903.1:cytochrome c >Feature sequence0878 1005 2216 gene locus_tag LOCUS_31130 1005 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 >Feature sequence0879 >Feature sequence0880 488 1717 gene locus_tag LOCUS_31140 488 1717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_31140 >Feature sequence0881 >Feature sequence0882 567 1760 gene locus_tag LOCUS_31150 567 1760 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259674.1 protein_id gnl|my_center|LOCUS_31150 1884 1809 gene locus_tag LOCUS_t00190 1884 1809 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0883 736 1455 gene locus_tag LOCUS_31160 736 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 >Feature sequence0884 2062 1121 gene locus_tag LOCUS_31170 gene gshB 2062 1121 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UFD2 protein_id gnl|my_center|LOCUS_31170 >Feature sequence0885 1354 1028 gene locus_tag LOCUS_31180 1354 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 1632 1351 gene locus_tag LOCUS_31190 1632 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 2368 1679 gene locus_tag LOCUS_31200 2368 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence0886 329 1327 gene locus_tag LOCUS_31210 329 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 2257 1331 gene locus_tag LOCUS_31220 2257 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 >Feature sequence0887 1748 408 gene locus_tag LOCUS_31230 gene miaB 1748 408 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B44 protein_id gnl|my_center|LOCUS_31230 >Feature sequence0888 1250 480 gene locus_tag LOCUS_31240 1250 480 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028181.1 protein_id gnl|my_center|LOCUS_31240 1642 1250 gene locus_tag LOCUS_31250 1642 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 >Feature sequence0889 <1 953 gene locus_tag LOCUS_31260 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KEP3:chaperone protein DnaK >Feature sequence0890 2373 1000 gene locus_tag LOCUS_31270 2373 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 >Feature sequence0891 1322 504 gene locus_tag LOCUS_31280 1322 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 1926 1333 gene locus_tag LOCUS_31290 1926 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 2424 1981 gene locus_tag LOCUS_31300 2424 1981 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I690 protein_id gnl|my_center|LOCUS_31300 >Feature sequence0892 1016 1621 gene locus_tag LOCUS_31310 1016 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 2071 1655 gene locus_tag LOCUS_31320 gene recX 2071 1655 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37860 protein_id gnl|my_center|LOCUS_31320 2331 2140 gene locus_tag LOCUS_31330 gene rpmG 2331 2140 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH99 protein_id gnl|my_center|LOCUS_31330 >Feature sequence0893 454 705 gene locus_tag LOCUS_31340 454 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 1005 2081 gene locus_tag LOCUS_31350 1005 2081 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280808.1 protein_id gnl|my_center|LOCUS_31350 >Feature sequence0894 1216 194 gene locus_tag LOCUS_31360 1216 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 >Feature sequence0895 901 2289 gene locus_tag LOCUS_31370 901 2289 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_31370 >Feature sequence0896 >Feature sequence0897 81 542 gene locus_tag LOCUS_31380 81 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 562 1218 gene locus_tag LOCUS_31390 562 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 1215 2297 gene locus_tag LOCUS_31400 1215 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence0898 5 757 gene locus_tag LOCUS_31410 5 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 801 1451 gene locus_tag LOCUS_31420 801 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 1441 1953 gene locus_tag LOCUS_31430 1441 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939730.1 protein_id gnl|my_center|LOCUS_31430 >Feature sequence0899 <2413 487 gene locus_tag LOCUS_31440 <2413 487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023607.1:cell surface protein >Feature sequence0900 437 18 gene locus_tag LOCUS_31450 437 18 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887201.1 protein_id gnl|my_center|LOCUS_31450 754 434 gene locus_tag LOCUS_31460 754 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 2190 781 gene locus_tag LOCUS_31470 2190 781 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063882.1 protein_id gnl|my_center|LOCUS_31470 >Feature sequence0901 <2411 1265 gene locus_tag LOCUS_31480 <2411 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072024.1:RND transporter MFP subunit >Feature sequence0902 257 859 gene locus_tag LOCUS_31490 257 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 1705 866 gene locus_tag LOCUS_31500 1705 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 >Feature sequence0903 1805 774 gene locus_tag LOCUS_31510 gene fabH2 1805 774 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_31510 <2404 1834 gene locus_tag LOCUS_31520 <2404 1834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UGP4:endonuclease III >Feature sequence0904 <1 1113 gene locus_tag LOCUS_31530 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003021315.1:cyanophycin synthetase >Feature sequence0905 <1 1279 gene locus_tag LOCUS_31540 <1 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:nuclease 2399 1284 gene locus_tag LOCUS_31550 2399 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 >Feature sequence0906 >Feature sequence0907 921 1523 gene locus_tag LOCUS_31560 921 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 1525 1929 gene locus_tag LOCUS_31570 1525 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 >Feature sequence0908 52 1152 gene locus_tag LOCUS_31580 52 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 >Feature sequence0909 1446 2102 gene locus_tag LOCUS_31590 1446 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence0910 1148 228 gene locus_tag LOCUS_31600 1148 228 CDS product S-adenosyl-L-methionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBQ8 protein_id gnl|my_center|LOCUS_31600 >Feature sequence0911 109 183 gene locus_tag LOCUS_t00200 109 183 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 297 1118 gene locus_tag LOCUS_31610 297 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 <2381 1119 gene locus_tag LOCUS_31620 <2381 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090347.1:two-component sensor histidine kinase >Feature sequence0912 2108 2018 gene locus_tag LOCUS_t00210 2108 2018 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0913 <2374 116 gene locus_tag LOCUS_31630 <2374 116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967670.1:protein norD >Feature sequence0914 1316 51 gene locus_tag LOCUS_31640 1316 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 1392 2291 gene locus_tag LOCUS_31650 1392 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 >Feature sequence0915 538 1005 gene locus_tag LOCUS_31660 538 1005 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902983.1 protein_id gnl|my_center|LOCUS_31660 >Feature sequence0916 747 1781 gene locus_tag LOCUS_31670 747 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 >Feature sequence0917 <1 824 gene locus_tag LOCUS_31680 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876951.1:peptidyl-prolyl cis-trans isomerase 1959 796 gene locus_tag LOCUS_31690 1959 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390211.1 protein_id gnl|my_center|LOCUS_31690 >Feature sequence0918 >Feature sequence0919 565 1638 gene locus_tag LOCUS_31700 565 1638 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_31700 >Feature sequence0920 956 60 gene locus_tag LOCUS_31710 956 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 >Feature sequence0921 989 1666 gene locus_tag LOCUS_31720 989 1666 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_31720 2289 1663 gene locus_tag LOCUS_31730 2289 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 >Feature sequence0922 <1 590 gene locus_tag LOCUS_31740 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B9X1:glutamine--fructose-6-phosphate aminotransferase [isomerizing] 1775 597 gene locus_tag LOCUS_31750 1775 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 >Feature sequence0923 >Feature sequence0924 1920 280 gene locus_tag LOCUS_31760 1920 280 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193195.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence0925 564 316 gene locus_tag LOCUS_31770 564 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 1954 542 gene locus_tag LOCUS_31780 1954 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 >Feature sequence0926 486 1283 gene locus_tag LOCUS_31790 gene trpA 486 1283 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AJ6 protein_id gnl|my_center|LOCUS_31790 >Feature sequence0927 1944 931 gene locus_tag LOCUS_31800 gene pheS 1944 931 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883H8 protein_id gnl|my_center|LOCUS_31800 >Feature sequence0928 270 1730 gene locus_tag LOCUS_31810 gene cobQ 270 1730 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDV6 protein_id gnl|my_center|LOCUS_31810 >Feature sequence0929 1348 644 gene locus_tag LOCUS_31820 gene murI 1348 644 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66662 protein_id gnl|my_center|LOCUS_31820 <2340 1345 gene locus_tag LOCUS_31830 <2340 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224710.1:methyltransferase >Feature sequence0930 525 157 gene locus_tag LOCUS_31840 525 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 582 1313 gene locus_tag LOCUS_31850 582 1313 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_31850 <2338 1331 gene locus_tag LOCUS_31860 <2338 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CK61:N-succinylglutamate 5-semialdehyde dehydrogenase >Feature sequence0931 1282 212 gene locus_tag LOCUS_31870 1282 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 1421 1828 gene locus_tag LOCUS_31880 1421 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence0932 >Feature sequence0933 481 1737 gene locus_tag LOCUS_31890 481 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 >Feature sequence0934 830 1750 gene locus_tag LOCUS_31900 830 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 >Feature sequence0935 227 1027 gene locus_tag LOCUS_31910 227 1027 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191253.1 protein_id gnl|my_center|LOCUS_31910 1037 1474 gene locus_tag LOCUS_31920 1037 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 1471 2145 gene locus_tag LOCUS_31930 1471 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 >Feature sequence0936 1496 267 gene locus_tag LOCUS_31940 1496 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 >Feature sequence0937 1688 735 gene locus_tag LOCUS_31950 1688 735 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057039.1 protein_id gnl|my_center|LOCUS_31950 2319 1699 gene locus_tag LOCUS_31960 2319 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 >Feature sequence0938 338 754 gene locus_tag LOCUS_31970 338 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 2319 742 gene locus_tag LOCUS_31980 2319 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence0939 2 1090 gene locus_tag LOCUS_31990 2 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 1083 1709 gene locus_tag LOCUS_32000 1083 1709 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6E5 protein_id gnl|my_center|LOCUS_32000 1709 2107 gene locus_tag LOCUS_32010 1709 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 2104 2307 gene locus_tag LOCUS_32020 2104 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 >Feature sequence0940 1992 484 gene locus_tag LOCUS_32030 1992 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 >Feature sequence0941 412 1662 gene locus_tag LOCUS_32040 412 1662 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124897.1 protein_id gnl|my_center|LOCUS_32040 >Feature sequence0942 644 1105 gene locus_tag LOCUS_32050 644 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 2173 1124 gene locus_tag LOCUS_32060 2173 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 >Feature sequence0943 <1 949 gene locus_tag LOCUS_32070 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P44837:trigger factor 1109 1675 gene locus_tag LOCUS_32080 gene clpP 1109 1675 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA83 protein_id gnl|my_center|LOCUS_32080 >Feature sequence0944 174 1286 gene locus_tag LOCUS_32090 174 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 >Feature sequence0945 <1 1391 gene locus_tag LOCUS_32100 <1 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118042.1:heparan N-sulfatase <2306 1467 gene locus_tag LOCUS_32110 <2306 1467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888137.1:sulfatase modifying factor 2 >Feature sequence0946 <2305 875 gene locus_tag LOCUS_32120 <2305 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403054.1:transketolase >Feature sequence0947 <1 874 gene locus_tag LOCUS_32130 <1 874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941162.1:(4Fe-4S)-binding protein 871 2277 gene locus_tag LOCUS_32140 871 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 >Feature sequence0948 253 1521 gene locus_tag LOCUS_32150 253 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 >Feature sequence0949 519 136 gene locus_tag LOCUS_32160 519 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 720 1403 gene locus_tag LOCUS_32170 720 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 1429 2265 gene locus_tag LOCUS_32180 gene panB 1429 2265 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q833S5 protein_id gnl|my_center|LOCUS_32180 >Feature sequence0950 928 2061 gene locus_tag LOCUS_32190 928 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 >Feature sequence0951 >Feature sequence0952 1465 242 gene locus_tag LOCUS_32200 gene iscS 1465 242 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SN1 protein_id gnl|my_center|LOCUS_32200 1952 1479 gene locus_tag LOCUS_32210 1952 1479 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226817.1 protein_id gnl|my_center|LOCUS_32210 >Feature sequence0953 >Feature sequence0954 1363 1887 gene locus_tag LOCUS_32220 1363 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 >Feature sequence0955 123 2264 gene locus_tag LOCUS_32230 123 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 >Feature sequence0956 <1 551 gene locus_tag LOCUS_32240 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038826.1:LPS biosynthesis protein 548 1591 gene locus_tag LOCUS_32250 548 1591 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 protein_id gnl|my_center|LOCUS_32250 >Feature sequence0957 357 1226 gene locus_tag LOCUS_32260 357 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 >Feature sequence0958 1109 357 gene locus_tag LOCUS_32270 1109 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 1249 1989 gene locus_tag LOCUS_32280 1249 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 >Feature sequence0959 >Feature sequence0960 1201 386 gene locus_tag LOCUS_32290 1201 386 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887563.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32290 >Feature sequence0961 1089 262 gene locus_tag LOCUS_32300 1089 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 1971 1096 gene locus_tag LOCUS_32310 1971 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 >Feature sequence0962 >Feature sequence0963 <1 1661 gene locus_tag LOCUS_32320 <1 1661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017026.1:OmpA family lipoprotein >Feature sequence0964 198 1244 gene locus_tag LOCUS_32330 198 1244 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_32330 1252 2193 gene locus_tag LOCUS_32340 gene rfbB 1252 2193 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023679.1 protein_id gnl|my_center|LOCUS_32340 >Feature sequence0965 <2244 454 gene locus_tag LOCUS_32350 <2244 454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943139.1:spermidine synthase >Feature sequence0966 >Feature sequence0967 <1 578 gene locus_tag LOCUS_32360 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921289.1:amidohydrolase 596 805 gene locus_tag LOCUS_32370 596 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 997 815 gene locus_tag LOCUS_32380 997 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 2209 1208 gene locus_tag LOCUS_32390 2209 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 >Feature sequence0968 <1 735 gene locus_tag LOCUS_32400 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200682.1:GDL motif peptide-associated radical SAM/SPASM maturase 1613 741 gene locus_tag LOCUS_32410 1613 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 1979 1626 gene locus_tag LOCUS_32420 1979 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 >Feature sequence0969 >Feature sequence0970 <1 518 gene locus_tag LOCUS_32430 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804111.1:3-hydroxybutyryl-CoA dehydratase 1386 529 gene locus_tag LOCUS_32440 gene mscS-2 1386 529 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942953.1 protein_id gnl|my_center|LOCUS_32440 >Feature sequence0971 2171 2084 gene locus_tag LOCUS_t00220 2171 2084 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0972 587 1651 gene locus_tag LOCUS_32450 587 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 2107 1628 gene locus_tag LOCUS_32460 2107 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence0973 1317 2201 gene locus_tag LOCUS_32470 gene murI 1317 2201 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E4 protein_id gnl|my_center|LOCUS_32470 >Feature sequence0974 913 398 gene locus_tag LOCUS_32480 913 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 967 1563 gene locus_tag LOCUS_32490 967 1563 CDS product phosphatidylethanolamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_32490 >Feature sequence0975 1724 1008 gene locus_tag LOCUS_32500 gene lptB 1724 1008 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_32500 2113 1721 gene locus_tag LOCUS_32510 2113 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 >Feature sequence0976 >Feature sequence0977 1643 738 gene locus_tag LOCUS_32520 1643 738 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_32520 2030 1647 gene locus_tag LOCUS_32530 2030 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 >Feature sequence0978 >Feature sequence0979 >Feature sequence0980 602 15 gene locus_tag LOCUS_32540 602 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 1307 804 gene locus_tag LOCUS_32550 1307 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 1942 1304 gene locus_tag LOCUS_32560 1942 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 >Feature sequence0981 >Feature sequence0982 1663 239 gene locus_tag LOCUS_32570 1663 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 <2215 1660 gene locus_tag LOCUS_32580 <2215 1660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RME8:ribosomal RNA small subunit methyltransferase A >Feature sequence0983 >Feature sequence0984 <1 880 gene locus_tag LOCUS_32590 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5I748:tyrosine--tRNA ligase <2210 892 gene locus_tag LOCUS_32600 <2210 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147051.1:serine/threonine protein kinase >Feature sequence0985 >Feature sequence0986 919 1518 gene locus_tag LOCUS_32610 gene rpsH 919 1518 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW29 protein_id gnl|my_center|LOCUS_32610 >Feature sequence0987 2037 631 gene locus_tag LOCUS_32620 2037 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 >Feature sequence0988 275 1036 gene locus_tag LOCUS_32630 275 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence0989 >Feature sequence0990 3 527 gene locus_tag LOCUS_32640 gene pilO 3 527 CDS product pilus assembly protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_32640 524 1027 gene locus_tag LOCUS_32650 524 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 >Feature sequence0991 469 1674 gene locus_tag LOCUS_32660 469 1674 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL80 protein_id gnl|my_center|LOCUS_32660 >Feature sequence0992 266 1498 gene locus_tag LOCUS_32670 266 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence0993 2100 655 gene locus_tag LOCUS_32680 2100 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 >Feature sequence0994 264 1139 gene locus_tag LOCUS_32690 264 1139 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405474.1 protein_id gnl|my_center|LOCUS_32690 2129 1140 gene locus_tag LOCUS_32700 2129 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 >Feature sequence0995 <1 676 gene locus_tag LOCUS_32710 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250274.1:glycosyl transferase 1299 658 gene locus_tag LOCUS_32720 gene can 1299 658 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB3 protein_id gnl|my_center|LOCUS_32720 2123 1356 gene locus_tag LOCUS_32730 2123 1356 CDS product UDP-N-acetyl-D-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_32730 >Feature sequence0996 >Feature sequence0997 1297 200 gene locus_tag LOCUS_32740 1297 200 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 protein_id gnl|my_center|LOCUS_32740 1389 1922 gene locus_tag LOCUS_32750 1389 1922 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903106.1 protein_id gnl|my_center|LOCUS_32750 >Feature sequence0998 1704 1105 gene locus_tag LOCUS_32760 1704 1105 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_32760 >Feature sequence0999 2 637 gene locus_tag LOCUS_32770 2 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 >Feature sequence1000 450 1523 gene locus_tag LOCUS_32780 gene dnaJ 450 1523 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H58 protein_id gnl|my_center|LOCUS_32780 >Feature sequence1001 >Feature sequence1002 2038 980 gene locus_tag LOCUS_32790 2038 980 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_32790 >Feature sequence1003 >Feature sequence1004 2073 1234 gene locus_tag LOCUS_32800 2073 1234 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence1005 22 1416 gene locus_tag LOCUS_32810 gene fumC 22 1416 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNE6 protein_id gnl|my_center|LOCUS_32810 1790 1611 gene locus_tag LOCUS_32820 1790 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 >Feature sequence1006 2087 1398 gene locus_tag LOCUS_32830 2087 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 >Feature sequence1007 332 949 gene locus_tag LOCUS_32840 332 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 1493 960 gene locus_tag LOCUS_32850 1493 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 >Feature sequence1008 1232 1906 gene locus_tag LOCUS_32860 1232 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 >Feature sequence1009 92 949 gene locus_tag LOCUS_32870 92 949 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226491.1 protein_id gnl|my_center|LOCUS_32870 >Feature sequence1010 >Feature sequence1011 1036 266 gene locus_tag LOCUS_32880 gene motA-1 1036 266 CDS product chemotaxis protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_32880 <2146 1127 gene locus_tag LOCUS_32890 <2146 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74G30:flagellar hook protein FlgE >Feature sequence1012 163 1050 gene locus_tag LOCUS_32900 163 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 >Feature sequence1013 240 548 gene locus_tag LOCUS_32910 240 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 <2142 685 gene locus_tag LOCUS_32920 <2142 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747E4:polyphosphate kinase >Feature sequence1014 >Feature sequence1015 990 211 gene locus_tag LOCUS_32930 990 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_32930 1736 987 gene locus_tag LOCUS_32940 1736 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 >Feature sequence1016 1278 2096 gene locus_tag LOCUS_32950 1278 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence1017 1158 154 gene locus_tag LOCUS_32960 1158 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 1197 1718 gene locus_tag LOCUS_32970 1197 1718 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223682.1 protein_id gnl|my_center|LOCUS_32970 2131 1703 gene locus_tag LOCUS_32980 2131 1703 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939520.1 protein_id gnl|my_center|LOCUS_32980 >Feature sequence1018 44 445 gene locus_tag LOCUS_32990 44 445 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_32990 442 1917 gene locus_tag LOCUS_33000 442 1917 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_33000 >Feature sequence1019 1518 130 gene locus_tag LOCUS_33010 1518 130 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_33010 <2132 1515 gene locus_tag LOCUS_33020 <2132 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898564.1:signal peptide peptidase SppA >Feature sequence1020 457 1533 gene locus_tag LOCUS_33030 457 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143497.1 protein_id gnl|my_center|LOCUS_33030 >Feature sequence1021 1258 635 gene locus_tag LOCUS_33040 gene pgsA 1258 635 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_33040 1871 1266 gene locus_tag LOCUS_33050 1871 1266 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_33050 >Feature sequence1022 480 49 gene locus_tag LOCUS_33060 gene rplK 480 49 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM28 protein_id gnl|my_center|LOCUS_33060 1094 552 gene locus_tag LOCUS_33070 gene nusG 1094 552 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y1 protein_id gnl|my_center|LOCUS_33070 1518 1138 gene locus_tag LOCUS_33080 1518 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 >Feature sequence1023 498 1124 gene locus_tag LOCUS_33090 498 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 1232 1774 gene locus_tag LOCUS_33100 1232 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 >Feature sequence1024 1448 351 gene locus_tag LOCUS_33110 1448 351 CDS product protein NnrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 protein_id gnl|my_center|LOCUS_33110 1488 1844 gene locus_tag LOCUS_33120 1488 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 >Feature sequence1025 452 1927 gene locus_tag LOCUS_33130 gene ffh 452 1927 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1Q1 protein_id gnl|my_center|LOCUS_33130 >Feature sequence1026 1613 282 gene locus_tag LOCUS_33140 1613 282 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_33140 <2115 1613 gene locus_tag LOCUS_33150 <2115 1613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087698.1:cation efflux system protein >Feature sequence1027 454 29 gene locus_tag LOCUS_33160 454 29 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722083.1 protein_id gnl|my_center|LOCUS_33160 >Feature sequence1028 >Feature sequence1029 298 663 gene locus_tag LOCUS_33170 gene nudG 298 663 CDS product CTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77788 protein_id gnl|my_center|LOCUS_33170 >Feature sequence1030 >Feature sequence1031 1277 21 gene locus_tag LOCUS_33180 1277 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 1997 1389 gene locus_tag LOCUS_33190 1997 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 >Feature sequence1032 356 129 gene locus_tag LOCUS_33200 356 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 907 422 gene locus_tag LOCUS_33210 907 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 1899 925 gene locus_tag LOCUS_33220 1899 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141130.1 protein_id gnl|my_center|LOCUS_33220 >Feature sequence1033 348 1127 gene locus_tag LOCUS_33230 348 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 1503 1087 gene locus_tag LOCUS_33240 1503 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 >Feature sequence1034 >Feature sequence1035 967 308 gene locus_tag LOCUS_33250 967 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 1497 1036 gene locus_tag LOCUS_33260 1497 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 >Feature sequence1036 >Feature sequence1037 544 95 gene locus_tag LOCUS_33270 gene rplM 544 95 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZ33 protein_id gnl|my_center|LOCUS_33270 >Feature sequence1038 <2094 709 gene locus_tag LOCUS_33280 <2094 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P59173:putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence1039 >Feature sequence1040 164 1162 gene locus_tag LOCUS_33290 164 1162 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC70 protein_id gnl|my_center|LOCUS_33290 1230 1781 gene locus_tag LOCUS_33300 1230 1781 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_33300 >Feature sequence1041 721 1539 gene locus_tag LOCUS_33310 721 1539 CDS product adenine nucleotide alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_33310 >Feature sequence1042 <2089 1027 gene locus_tag LOCUS_33320 <2089 1027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881269.1:serine protease >Feature sequence1043 1832 1239 gene locus_tag LOCUS_33330 1832 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 >Feature sequence1044 >Feature sequence1045 >Feature sequence1046 1080 100 gene locus_tag LOCUS_33340 1080 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 1964 1185 gene locus_tag LOCUS_33350 1964 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 >Feature sequence1047 1658 798 gene locus_tag LOCUS_33360 1658 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 >Feature sequence1048 1091 186 gene locus_tag LOCUS_33370 1091 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 >Feature sequence1049 1354 884 gene locus_tag LOCUS_33380 1354 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence1050 <2075 1414 gene locus_tag LOCUS_33390 <2075 1414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679924.1:membrane protein >Feature sequence1051 1368 844 gene locus_tag LOCUS_33400 1368 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 >Feature sequence1052 <1 1737 gene locus_tag LOCUS_33410 <1 1737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WMV7:putative GMC-type oxidoreductase >Feature sequence1053 1357 215 gene locus_tag LOCUS_33420 1357 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 2069 1440 gene locus_tag LOCUS_33430 2069 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 >Feature sequence1054 698 1495 gene locus_tag LOCUS_33440 698 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 >Feature sequence1055 334 1164 gene locus_tag LOCUS_33450 334 1164 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_33450 1154 1906 gene locus_tag LOCUS_33460 1154 1906 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_33460 >Feature sequence1056 1072 77 gene locus_tag LOCUS_33470 1072 77 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870152.1 protein_id gnl|my_center|LOCUS_33470 1873 1091 gene locus_tag LOCUS_33480 1873 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence1057 1548 136 gene locus_tag LOCUS_33490 1548 136 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 protein_id gnl|my_center|LOCUS_33490 >Feature sequence1058 <2061 436 gene locus_tag LOCUS_33500 <2061 436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114865.1:carbamoyltransferase >Feature sequence1059 >Feature sequence1060 1732 1055 gene locus_tag LOCUS_33510 1732 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 >Feature sequence1061 476 21 gene locus_tag LOCUS_33520 gene tadA 476 21 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H28 protein_id gnl|my_center|LOCUS_33520 1961 810 gene locus_tag LOCUS_33530 1961 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 >Feature sequence1062 251 1402 gene locus_tag LOCUS_33540 251 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 >Feature sequence1063 3 281 gene locus_tag LOCUS_33550 3 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 >Feature sequence1064 1618 959 gene locus_tag LOCUS_33560 gene trpF 1618 959 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UGP7 protein_id gnl|my_center|LOCUS_33560 1881 1618 gene locus_tag LOCUS_33570 1881 1618 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815785.1 protein_id gnl|my_center|LOCUS_33570 >Feature sequence1065 <1 914 gene locus_tag LOCUS_33580 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141553.1:peptidase S8 911 1123 gene locus_tag LOCUS_33590 911 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 2048 1128 gene locus_tag LOCUS_33600 2048 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 >Feature sequence1066 1086 1934 gene locus_tag LOCUS_33610 1086 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 >Feature sequence1067 951 1796 gene locus_tag LOCUS_33620 951 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 >Feature sequence1068 <1 1748 gene locus_tag LOCUS_33630 <1 1748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNC6:acetyl-coenzyme A synthetase >Feature sequence1069 647 1468 gene locus_tag LOCUS_33640 647 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 1531 1836 gene locus_tag LOCUS_33650 1531 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 >Feature sequence1070 893 456 gene locus_tag LOCUS_33660 893 456 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 protein_id gnl|my_center|LOCUS_33660 <2045 931 gene locus_tag LOCUS_33670 <2045 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SLM3:thermostable carboxypeptidase 1 >Feature sequence1071 863 279 gene locus_tag LOCUS_33680 863 279 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395055.1 protein_id gnl|my_center|LOCUS_33680 943 1404 gene locus_tag LOCUS_33690 943 1404 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_33690 1405 1887 gene locus_tag LOCUS_33700 1405 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence1072 399 1268 gene locus_tag LOCUS_33710 399 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 >Feature sequence1073 >Feature sequence1074 1009 734 gene locus_tag LOCUS_33720 1009 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 >Feature sequence1075 <1 1627 gene locus_tag LOCUS_33730 <1 1627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144121.1:ABC transporter >Feature sequence1076 >Feature sequence1077 >Feature sequence1078 1006 344 gene locus_tag LOCUS_33740 1006 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 1135 1389 gene locus_tag LOCUS_33750 1135 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 1391 1705 gene locus_tag LOCUS_33760 1391 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 >Feature sequence1079 <1 955 gene locus_tag LOCUS_33770 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HHS9:DNA helicase >Feature sequence1080 1313 1231 gene locus_tag LOCUS_t00230 1313 1231 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1714 1508 gene locus_tag LOCUS_33780 1714 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 >Feature sequence1081 1316 675 gene locus_tag LOCUS_33790 1316 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 1976 1386 gene locus_tag LOCUS_33800 1976 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 >Feature sequence1082 898 140 gene locus_tag LOCUS_33810 898 140 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174155.1 protein_id gnl|my_center|LOCUS_33810 <2031 961 gene locus_tag LOCUS_33820 <2031 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940636.1:acetoacetate metabolism regulatory protein AtoC >Feature sequence1083 393 758 gene locus_tag LOCUS_33830 gene rpsM 393 758 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B0 protein_id gnl|my_center|LOCUS_33830 774 1166 gene locus_tag LOCUS_33840 gene rpsK 774 1166 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B1 protein_id gnl|my_center|LOCUS_33840 >Feature sequence1084 <1 762 gene locus_tag LOCUS_33850 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BP1:tRNA dimethylallyltransferase 859 1476 gene locus_tag LOCUS_33860 859 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 >Feature sequence1085 <2026 1441 gene locus_tag LOCUS_33870 <2026 1441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005772090.1:membrane protein >Feature sequence1086 >Feature sequence1087 414 330 gene locus_tag LOCUS_t00240 414 330 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 500 1204 gene locus_tag LOCUS_33880 500 1204 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_33880 1201 2016 gene locus_tag LOCUS_33890 gene fabD 1201 2016 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNG5 protein_id gnl|my_center|LOCUS_33890 >Feature sequence1088 1695 346 gene locus_tag LOCUS_33900 1695 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 >Feature sequence1089 290 922 gene locus_tag LOCUS_33910 290 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 >Feature sequence1090 >Feature sequence1091 >Feature sequence1092 62 1312 gene locus_tag LOCUS_33920 gene pncC 62 1312 CDS product nicotinamide-nucleotide amidohydrolase PncC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK32 protein_id gnl|my_center|LOCUS_33920 >Feature sequence1093 >Feature sequence1094 1280 825 gene locus_tag LOCUS_33930 1280 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 1350 1760 gene locus_tag LOCUS_33940 1350 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 >Feature sequence1095 1508 525 gene locus_tag LOCUS_33950 gene purM 1508 525 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB6 protein_id gnl|my_center|LOCUS_33950 >Feature sequence1096 >Feature sequence1097 713 1246 gene locus_tag LOCUS_33960 713 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 >Feature sequence1098 321 1421 gene locus_tag LOCUS_33970 321 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 >Feature sequence1099 >Feature sequence1100 1030 1320 gene locus_tag LOCUS_33980 1030 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 >Feature sequence1101 <1 667 gene locus_tag LOCUS_33990 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002195950.1:tyrosine protein kinase >Feature sequence1102 583 1500 gene locus_tag LOCUS_34000 583 1500 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_34000 >Feature sequence1103 <1987 684 gene locus_tag LOCUS_34010 <1987 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037292.1:transporter >Feature sequence1104 <1983 121 gene locus_tag LOCUS_34020 <1983 121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962267.1:glycosyl hydrolase >Feature sequence1105 991 317 gene locus_tag LOCUS_34030 991 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 >Feature sequence1106 1811 678 gene locus_tag LOCUS_34040 1811 678 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_34040 >Feature sequence1107 <1979 34 gene locus_tag LOCUS_34050 <1979 34 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RKU9:malate synthase >Feature sequence1108 <1976 553 gene locus_tag LOCUS_34060 <1976 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392259.1:peptidase M1 >Feature sequence1109 1375 512 gene locus_tag LOCUS_34070 1375 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 >Feature sequence1110 689 1642 gene locus_tag LOCUS_34080 gene trxB 689 1642 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ75 protein_id gnl|my_center|LOCUS_34080 >Feature sequence1111 >Feature sequence1112 1005 1442 gene locus_tag LOCUS_34090 1005 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 >Feature sequence1113 1730 267 gene locus_tag LOCUS_34100 1730 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 1968 1744 gene locus_tag LOCUS_34110 1968 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 >Feature sequence1114 697 1911 gene locus_tag LOCUS_34120 697 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 >Feature sequence1115 >Feature sequence1116 <1964 1039 gene locus_tag LOCUS_34130 <1964 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403405.1:epimerase >Feature sequence1117 >Feature sequence1118 <1 628 gene locus_tag LOCUS_34140 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72DN4:ATP-dependent RecD-like DNA helicase 678 1808 gene locus_tag LOCUS_34150 gene rlmN 678 1808 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E53 protein_id gnl|my_center|LOCUS_34150 >Feature sequence1119 >Feature sequence1120 1214 1732 gene locus_tag LOCUS_34160 1214 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 1951 1799 gene locus_tag LOCUS_34170 1951 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 >Feature sequence1121 215 1471 gene locus_tag LOCUS_34180 215 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 >Feature sequence1122 1508 234 gene locus_tag LOCUS_34190 1508 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 >Feature sequence1123 >Feature sequence1124 317 1750 gene locus_tag LOCUS_34200 317 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34200 >Feature sequence1125 1460 1560 gene locus_tag LOCUS_t00250 1460 1560 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1911 1639 gene locus_tag LOCUS_34210 1911 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 >Feature sequence1126 >Feature sequence1127 1688 225 gene locus_tag LOCUS_34220 1688 225 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257638.1 protein_id gnl|my_center|LOCUS_34220 >Feature sequence1128 1735 1013 gene locus_tag LOCUS_34230 1735 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 >Feature sequence1129 1924 1694 gene locus_tag LOCUS_34240 1924 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 >Feature sequence1130 1560 556 gene locus_tag LOCUS_34250 1560 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 >Feature sequence1131 >Feature sequence1132 >Feature sequence1133 >Feature sequence1134 675 1505 gene locus_tag LOCUS_34260 675 1505 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_34260 >Feature sequence1135 <1 730 gene locus_tag LOCUS_34270 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404896.1:ATPase 750 1259 gene locus_tag LOCUS_34280 750 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34280 1272 1616 gene locus_tag LOCUS_34290 1272 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34290 >Feature sequence1136 1041 709 gene locus_tag LOCUS_34300 1041 709 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391240.1 protein_id gnl|my_center|LOCUS_34300 1918 1061 gene locus_tag LOCUS_34310 1918 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 >Feature sequence1137 1211 540 gene locus_tag LOCUS_34320 1211 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 1698 1219 gene locus_tag LOCUS_34330 1698 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 >Feature sequence1138 >Feature sequence1139 >Feature sequence1140 >Feature sequence1141 >Feature sequence1142 1547 927 gene locus_tag LOCUS_34340 gene nqrE 1547 927 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_34340 >Feature sequence1143 <1 892 gene locus_tag LOCUS_34350 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E184:asparagine--tRNA ligase 902 1762 gene locus_tag LOCUS_34360 902 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 >Feature sequence1144 <1 823 gene locus_tag LOCUS_34370 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249955.1:NDP-sugar dehydratase or epimerase >Feature sequence1145 <1906 371 gene locus_tag LOCUS_34380 <1906 371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9K496:ribonucleoside-diphosphate reductase >Feature sequence1146 1308 1904 gene locus_tag LOCUS_34390 1308 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 >Feature sequence1147 766 1125 gene locus_tag LOCUS_34400 766 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 >Feature sequence1148 1542 901 gene locus_tag LOCUS_34410 1542 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 >Feature sequence1149 154 1185 gene locus_tag LOCUS_34420 154 1185 CDS product L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530659.1 protein_id gnl|my_center|LOCUS_34420 >Feature sequence1150 >Feature sequence1151 >Feature sequence1152 586 38 gene locus_tag LOCUS_34430 586 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 1827 586 gene locus_tag LOCUS_34440 gene proA 1827 586 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU1 protein_id gnl|my_center|LOCUS_34440 >Feature sequence1153 <1 913 gene locus_tag LOCUS_34450 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943603.1:bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase 983 1666 gene locus_tag LOCUS_34460 983 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 >Feature sequence1154 <1 754 gene locus_tag LOCUS_34470 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNG7:DNA repair protein RadA >Feature sequence1155 597 1511 gene locus_tag LOCUS_34480 597 1511 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BQ0 protein_id gnl|my_center|LOCUS_34480 >Feature sequence1156 >Feature sequence1157 864 1052 gene locus_tag LOCUS_34490 864 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 1454 1065 gene locus_tag LOCUS_34500 1454 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 >Feature sequence1158 809 1333 gene locus_tag LOCUS_34510 809 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 1341 1526 gene locus_tag LOCUS_34520 gene rpmF 1341 1526 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS3 protein_id gnl|my_center|LOCUS_34520 1633 1872 gene locus_tag LOCUS_34530 gene acpP 1633 1872 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5N7 protein_id gnl|my_center|LOCUS_34530 >Feature sequence1159 242 1195 gene locus_tag LOCUS_34540 242 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 >Feature sequence1160 <1 858 gene locus_tag LOCUS_34550 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P8Y7:coproporphyrinogen-III oxidase 888 1394 gene locus_tag LOCUS_34560 888 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 >Feature sequence1161 1728 1039 gene locus_tag LOCUS_34570 1728 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 >Feature sequence1162 >Feature sequence1163 646 825 gene locus_tag LOCUS_34580 646 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 >Feature sequence1164 625 1482 gene locus_tag LOCUS_34590 625 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089214.1 protein_id gnl|my_center|LOCUS_34590 >Feature sequence1165 <1 1279 gene locus_tag LOCUS_34600 <1 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747K3:UvrABC system protein B 1312 1608 gene locus_tag LOCUS_34610 1312 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 >Feature sequence1166 1724 882 gene locus_tag LOCUS_34620 1724 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 >Feature sequence1167 795 205 gene locus_tag LOCUS_34630 795 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 828 1304 gene locus_tag LOCUS_34640 828 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 >Feature sequence1168 946 140 gene locus_tag LOCUS_34650 gene yfhR 946 140 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207718.1 protein_id gnl|my_center|LOCUS_34650 1608 943 gene locus_tag LOCUS_34660 1608 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 >Feature sequence1169 <1 1387 gene locus_tag LOCUS_34670 <1 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122252.1:SWF/SNF family helicase >Feature sequence1170 <1 1281 gene locus_tag LOCUS_34680 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973184.1:zinc protease >Feature sequence1171 1808 363 gene locus_tag LOCUS_34690 1808 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 >Feature sequence1172 1325 975 gene locus_tag LOCUS_34700 1325 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence1173 1752 199 gene locus_tag LOCUS_34710 1752 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 >Feature sequence1174 >Feature sequence1175 1488 337 gene locus_tag LOCUS_34720 1488 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 >Feature sequence1176 399 1142 gene locus_tag LOCUS_34730 399 1142 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_34730 >Feature sequence1177 <1845 1178 gene locus_tag LOCUS_34740 <1845 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940822.1:twitching motility protein PilT >Feature sequence1178 <1 1434 gene locus_tag LOCUS_34750 <1 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972394.1:acetolactate synthase >Feature sequence1179 843 1664 gene locus_tag LOCUS_34760 843 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 >Feature sequence1180 611 255 gene locus_tag LOCUS_34770 611 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 1800 619 gene locus_tag LOCUS_34780 1800 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 >Feature sequence1181 997 35 gene locus_tag LOCUS_34790 gene tadB 997 35 CDS product TadB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932126.1 protein_id gnl|my_center|LOCUS_34790 <1837 1001 gene locus_tag LOCUS_34800 <1837 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939399.1:type II/IV secretion system protein >Feature sequence1182 155 964 gene locus_tag LOCUS_34810 155 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 >Feature sequence1183 915 145 gene locus_tag LOCUS_34820 915 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 1693 944 gene locus_tag LOCUS_34830 1693 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 >Feature sequence1184 >Feature sequence1185 423 103 gene locus_tag LOCUS_34840 423 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 446 1282 gene locus_tag LOCUS_34850 446 1282 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226695.1 protein_id gnl|my_center|LOCUS_34850 1780 1316 gene locus_tag LOCUS_34860 1780 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 >Feature sequence1186 613 1311 gene locus_tag LOCUS_34870 613 1311 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_34870 >Feature sequence1187 <1 811 gene locus_tag LOCUS_34880 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122885.1:alanine glycine permease <1814 830 gene locus_tag LOCUS_34890 <1814 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948187.1:sodium:proton antiporter >Feature sequence1188 503 1552 gene locus_tag LOCUS_34900 gene mnmA 503 1552 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A22 protein_id gnl|my_center|LOCUS_34900 >Feature sequence1189 151 972 gene locus_tag LOCUS_34910 151 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 <1812 958 gene locus_tag LOCUS_34920 <1812 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001250026.1:metallophosphatase >Feature sequence1190 1164 79 gene locus_tag LOCUS_34930 1164 79 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_34930 >Feature sequence1191 >Feature sequence1192 >Feature sequence1193 >Feature sequence1194 1452 1526 gene locus_tag LOCUS_t00260 1452 1526 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1195 >Feature sequence1196 377 1336 gene locus_tag LOCUS_34940 gene etfA 377 1336 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_34940 >Feature sequence1197 1759 608 gene locus_tag LOCUS_34950 1759 608 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_34950 >Feature sequence1198 1801 155 gene locus_tag LOCUS_34960 1801 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 >Feature sequence1199 >Feature sequence1200 702 1553 gene locus_tag LOCUS_34970 702 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 >Feature sequence1201 >Feature sequence1202 >Feature sequence1203 944 573 gene locus_tag LOCUS_34980 944 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 >Feature sequence1204 1796 1110 gene locus_tag LOCUS_34990 1796 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 >Feature sequence1205 >Feature sequence1206 154 897 gene locus_tag LOCUS_35000 154 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 >Feature sequence1207 570 1133 gene locus_tag LOCUS_35010 570 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 1581 1105 gene locus_tag LOCUS_35020 1581 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 >Feature sequence1208 1682 546 gene locus_tag LOCUS_35030 1682 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 >Feature sequence1209 1210 557 gene locus_tag LOCUS_35040 1210 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 >Feature sequence1210 >Feature sequence1211 >Feature sequence1212 >Feature sequence1213 980 324 gene locus_tag LOCUS_35050 980 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 1783 980 gene locus_tag LOCUS_35060 1783 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 >Feature sequence1214 1280 339 gene locus_tag LOCUS_35070 1280 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 1501 1653 gene locus_tag LOCUS_35080 1501 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 >Feature sequence1215 1077 1367 gene locus_tag LOCUS_35090 1077 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 >Feature sequence1216 990 199 gene locus_tag LOCUS_35100 990 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 1053 1400 gene locus_tag LOCUS_35110 1053 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 >Feature sequence1217 1124 603 gene locus_tag LOCUS_35120 1124 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_35120 1190 1654 gene locus_tag LOCUS_35130 1190 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 >Feature sequence1218 >Feature sequence1219 <1777 733 gene locus_tag LOCUS_35140 <1777 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943733.1:DNA translocase FtsK >Feature sequence1220 1431 166 gene locus_tag LOCUS_35150 1431 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 >Feature sequence1221 >Feature sequence1222 421 1734 gene locus_tag LOCUS_35160 421 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 >Feature sequence1223 >Feature sequence1224 1137 205 gene locus_tag LOCUS_35170 1137 205 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_35170 >Feature sequence1225 863 1645 gene locus_tag LOCUS_35180 863 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114171.1 protein_id gnl|my_center|LOCUS_35180 >Feature sequence1226 709 1515 gene locus_tag LOCUS_35190 709 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 >Feature sequence1227 854 1396 gene locus_tag LOCUS_35200 854 1396 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810219.1 protein_id gnl|my_center|LOCUS_35200 >Feature sequence1228 749 1030 gene locus_tag LOCUS_35210 gene hup 749 1030 CDS product DNA-binding protein HU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67461 protein_id gnl|my_center|LOCUS_35210 <1762 1033 gene locus_tag LOCUS_35220 <1762 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NFD4:UvrABC system protein C >Feature sequence1229 384 1115 gene locus_tag LOCUS_35230 384 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 >Feature sequence1230 1669 1139 gene locus_tag LOCUS_35240 1669 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 >Feature sequence1231 992 147 gene locus_tag LOCUS_35250 gene thiL 992 147 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM5 protein_id gnl|my_center|LOCUS_35250 >Feature sequence1232 132 689 gene locus_tag LOCUS_35260 132 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 760 1011 gene locus_tag LOCUS_35270 760 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 >Feature sequence1233 450 1295 gene locus_tag LOCUS_35280 450 1295 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939242.1 protein_id gnl|my_center|LOCUS_35280 >Feature sequence1234 >Feature sequence1235 1533 64 gene locus_tag LOCUS_35290 1533 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 >Feature sequence1236 662 901 gene locus_tag LOCUS_35300 662 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 1566 796 gene locus_tag LOCUS_35310 gene mutM 1566 796 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121456.1 protein_id gnl|my_center|LOCUS_35310 >Feature sequence1237 1363 572 gene locus_tag LOCUS_35320 1363 572 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_35320 1737 1360 gene locus_tag LOCUS_35330 1737 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 >Feature sequence1238 105 1430 gene locus_tag LOCUS_35340 105 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 >Feature sequence1239 >Feature sequence1240 211 285 gene locus_tag LOCUS_t00270 211 285 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1550 372 gene locus_tag LOCUS_35350 1550 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 1734 1543 gene locus_tag LOCUS_35360 1734 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 >Feature sequence1241 655 449 gene locus_tag LOCUS_35370 655 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35370 1440 655 gene locus_tag LOCUS_35380 1440 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 >Feature sequence1242 <1733 991 gene locus_tag LOCUS_35390 <1733 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404295.1:thioredoxin domain-containing protein >Feature sequence1243 <1 1327 gene locus_tag LOCUS_35400 <1 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942995.1:glycoside hydrolase >Feature sequence1244 191 1180 gene locus_tag LOCUS_35410 191 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 1190 1651 gene locus_tag LOCUS_35420 1190 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 >Feature sequence1245 1622 807 gene locus_tag LOCUS_35430 1622 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 >Feature sequence1246 >Feature sequence1247 1487 486 gene locus_tag LOCUS_35440 1487 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 1726 1487 gene locus_tag LOCUS_35450 1726 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 >Feature sequence1248 375 953 gene locus_tag LOCUS_35460 gene trpG 375 953 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_35460 >Feature sequence1249 >Feature sequence1250 >Feature sequence1251 <1 1115 gene locus_tag LOCUS_35470 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66682:(R)-citramalate synthase 1581 1123 gene locus_tag LOCUS_35480 1581 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 >Feature sequence1252 >Feature sequence1253 <1 1294 gene locus_tag LOCUS_35490 <1 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986707.1:oligopeptide transporter, OPT family protein >Feature sequence1254 <1 1017 gene locus_tag LOCUS_35500 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222260.1:NADPH-dependent 2,4-dienoyl-CoA reductase >Feature sequence1255 1556 327 gene locus_tag LOCUS_35510 1556 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 >Feature sequence1256 <1 936 gene locus_tag LOCUS_35520 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392295.1:EscN/YscN/HrcN family type III secretion system ATPase 948 1538 gene locus_tag LOCUS_35530 948 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 >Feature sequence1257 1550 540 gene locus_tag LOCUS_35540 gene hpnA 1550 540 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_35540 >Feature sequence1258 <1 1184 gene locus_tag LOCUS_35550 <1 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747R0:ribosomal protein S12 methylthiotransferase RimO >Feature sequence1259 492 986 gene locus_tag LOCUS_35560 492 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 >Feature sequence1260 >Feature sequence1261 <1 1247 gene locus_tag LOCUS_35570 <1 1247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702602.1:putative fatty-acid-CoA ligase FadD >Feature sequence1262 <1 913 gene locus_tag LOCUS_35580 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525377.1:PAS domain-containing sensor histidine kinase >Feature sequence1263 >Feature sequence1264 >Feature sequence1265 1244 123 gene locus_tag LOCUS_35590 1244 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 >Feature sequence1266 1614 388 gene locus_tag LOCUS_35600 gene dinB 1614 388 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY04 protein_id gnl|my_center|LOCUS_35600 >Feature sequence1267 444 932 gene locus_tag LOCUS_35610 444 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 1294 1623 gene locus_tag LOCUS_35620 1294 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 >Feature sequence1268 >Feature sequence1269 53 553 gene locus_tag LOCUS_35630 53 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 592 1236 gene locus_tag LOCUS_35640 592 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 >Feature sequence1270 268 1320 gene locus_tag LOCUS_35650 268 1320 CDS product putative metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRY7 protein_id gnl|my_center|LOCUS_35650 >Feature sequence1271 1 498 gene locus_tag LOCUS_35660 1 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 558 902 gene locus_tag LOCUS_35670 558 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 >Feature sequence1272 146 1240 gene locus_tag LOCUS_35680 gene prfB 146 1240 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AS3 protein_id gnl|my_center|LOCUS_35680 >Feature sequence1273 >Feature sequence1274 949 338 gene locus_tag LOCUS_35690 gene lipB 949 338 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DM3 protein_id gnl|my_center|LOCUS_35690 >Feature sequence1275 394 1098 gene locus_tag LOCUS_35700 394 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 1108 1527 gene locus_tag LOCUS_35710 gene exbD-2 1108 1527 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768982.1 protein_id gnl|my_center|LOCUS_35710 >Feature sequence1276 1668 1387 gene locus_tag LOCUS_35720 1668 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 >Feature sequence1277 885 394 gene locus_tag LOCUS_35730 885 394 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SM89 protein_id gnl|my_center|LOCUS_35730 1493 882 gene locus_tag LOCUS_35740 1493 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 >Feature sequence1278 1152 664 gene locus_tag LOCUS_35750 1152 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 >Feature sequence1279 >Feature sequence1280 1148 132 gene locus_tag LOCUS_35760 1148 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 >Feature sequence1281 <1 884 gene locus_tag LOCUS_35770 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931254.1:peptidase M23 >Feature sequence1282 286 894 gene locus_tag LOCUS_35780 286 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762447.1 protein_id gnl|my_center|LOCUS_35780 904 1071 gene locus_tag LOCUS_35790 904 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 >Feature sequence1283 >Feature sequence1284 >Feature sequence1285 1515 652 gene locus_tag LOCUS_35800 1515 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 >Feature sequence1286 <1 848 gene locus_tag LOCUS_35810 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404575.1:aspartate-semialdehyde dehydrogenase >Feature sequence1287 >Feature sequence1288 807 1322 gene locus_tag LOCUS_35820 807 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 >Feature sequence1289 233 1225 gene locus_tag LOCUS_35830 233 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 >Feature sequence1290 >Feature sequence1291 833 279 gene locus_tag LOCUS_35840 833 279 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_35840 884 1150 gene locus_tag LOCUS_35850 884 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 >Feature sequence1292 >Feature sequence1293 219 1481 gene locus_tag LOCUS_35860 219 1481 CDS product chlorohydrolase/aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705208.1 protein_id gnl|my_center|LOCUS_35860 >Feature sequence1294 1142 276 gene locus_tag LOCUS_35870 1142 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 <1641 1139 gene locus_tag LOCUS_35880 <1641 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975510.1:glycosyl transferase family 1 >Feature sequence1295 >Feature sequence1296 <1 1054 gene locus_tag LOCUS_35890 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393971.1:PAS domain-containing sensor histidine kinase >Feature sequence1297 952 143 gene locus_tag LOCUS_35900 gene dapD 952 143 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_35900 <1640 940 gene locus_tag LOCUS_35910 <1640 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064034.1:succinyldiaminopimelate transaminase >Feature sequence1298 391 861 gene locus_tag LOCUS_35920 391 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 866 1360 gene locus_tag LOCUS_35930 866 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 >Feature sequence1299 >Feature sequence1300 1196 303 gene locus_tag LOCUS_35940 1196 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 >Feature sequence1301 331 915 gene locus_tag LOCUS_35950 gene thiE 331 915 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKG9 protein_id gnl|my_center|LOCUS_35950 <1628 885 gene locus_tag LOCUS_35960 <1628 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009314634.1:aminodeoxychorismate synthase component I >Feature sequence1302 770 552 gene locus_tag LOCUS_35970 770 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 >Feature sequence1303 1600 833 gene locus_tag LOCUS_35980 1600 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence1304 >Feature sequence1305 <1623 482 gene locus_tag LOCUS_35990 <1623 482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943547.1:two-component sensor histidine kinase >Feature sequence1306 1620 1303 gene locus_tag LOCUS_36000 1620 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 >Feature sequence1307 813 1226 gene locus_tag LOCUS_36010 813 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 >Feature sequence1308 867 1061 gene locus_tag LOCUS_36020 867 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 >Feature sequence1309 1432 836 gene locus_tag LOCUS_36030 1432 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 >Feature sequence1310 851 333 gene locus_tag LOCUS_36040 851 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836309.1 protein_id gnl|my_center|LOCUS_36040 >Feature sequence1311 531 1202 gene locus_tag LOCUS_36050 531 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 >Feature sequence1312 >Feature sequence1313 >Feature sequence1314 >Feature sequence1315 <1 765 gene locus_tag LOCUS_36060 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072705.1:acyl-CoA dehydrogenase >Feature sequence1316 1136 252 gene locus_tag LOCUS_36070 1136 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 1579 1133 gene locus_tag LOCUS_36080 1579 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 >Feature sequence1317 >Feature sequence1318 <1 510 gene locus_tag LOCUS_36090 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K0MCS6:transport permease protein >Feature sequence1319 <1 904 gene locus_tag LOCUS_36100 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808174.1:DNA-binding response regulator 1610 897 gene locus_tag LOCUS_36110 1610 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 >Feature sequence1320 >Feature sequence1321 >Feature sequence1322 2 211 gene locus_tag LOCUS_36120 2 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 208 1437 gene locus_tag LOCUS_36130 208 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594898.1 protein_id gnl|my_center|LOCUS_36130 >Feature sequence1323 961 605 gene locus_tag LOCUS_36140 961 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 >Feature sequence1324 >Feature sequence1325 >Feature sequence1326 >Feature sequence1327 >Feature sequence1328 <1 1570 gene locus_tag LOCUS_36150 <1 1570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140627.1:prolyl endopeptidase >Feature sequence1329 953 30 gene locus_tag LOCUS_36160 953 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 >Feature sequence1330 748 62 gene locus_tag LOCUS_36170 gene truA 748 62 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5V8 protein_id gnl|my_center|LOCUS_36170 >Feature sequence1331 >Feature sequence1332 361 933 gene locus_tag LOCUS_36180 361 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 1581 964 gene locus_tag LOCUS_36190 1581 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 >Feature sequence1333 393 992 gene locus_tag LOCUS_36200 393 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_36200 1412 996 gene locus_tag LOCUS_36210 1412 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 >Feature sequence1334 <1 657 gene locus_tag LOCUS_36220 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089193.1:ABC transporter ATP-binding protein 654 1397 gene locus_tag LOCUS_36230 654 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 >Feature sequence1335 1545 607 gene locus_tag LOCUS_36240 1545 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 >Feature sequence1336 1063 431 gene locus_tag LOCUS_36250 1063 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 >Feature sequence1337 <1596 794 gene locus_tag LOCUS_36260 <1596 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259612.1:radical SAM protein >Feature sequence1338 246 19 gene locus_tag LOCUS_36270 246 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 1306 287 gene locus_tag LOCUS_36280 gene apbE 1306 287 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WC52 protein_id gnl|my_center|LOCUS_36280 >Feature sequence1339 1382 990 gene locus_tag LOCUS_36290 gene rpsG 1382 990 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5E1 protein_id gnl|my_center|LOCUS_36290 >Feature sequence1340 >Feature sequence1341 >Feature sequence1342 637 218 gene locus_tag LOCUS_36300 637 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 1308 661 gene locus_tag LOCUS_36310 1308 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 >Feature sequence1343 >Feature sequence1344 522 1403 gene locus_tag LOCUS_36320 522 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 >Feature sequence1345 >Feature sequence1346 >Feature sequence1347 >Feature sequence1348 <1 583 gene locus_tag LOCUS_36330 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TP86:histidine kinase <1578 578 gene locus_tag LOCUS_36340 <1578 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105802.1:RND transporter >Feature sequence1349 885 1574 gene locus_tag LOCUS_36350 885 1574 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707332.1 protein_id gnl|my_center|LOCUS_36350 >Feature sequence1350 471 872 gene locus_tag LOCUS_36360 471 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 >Feature sequence1351 <1572 952 gene locus_tag LOCUS_36370 <1572 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q748G4:flagellin >Feature sequence1352 839 426 gene locus_tag LOCUS_36380 839 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 >Feature sequence1353 1246 716 gene locus_tag LOCUS_36390 1246 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 >Feature sequence1354 628 200 gene locus_tag LOCUS_36400 628 200 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289494.1 protein_id gnl|my_center|LOCUS_36400 1080 634 gene locus_tag LOCUS_36410 1080 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36410 >Feature sequence1355 >Feature sequence1356 >Feature sequence1357 123 797 gene locus_tag LOCUS_36420 123 797 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_36420 >Feature sequence1358 >Feature sequence1359 529 245 gene locus_tag LOCUS_36430 gene grxC 529 245 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 protein_id gnl|my_center|LOCUS_36430 <1565 508 gene locus_tag LOCUS_36440 <1565 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886697.1:rRNA (guanine-N2)-methyltransferase >Feature sequence1360 259 522 gene locus_tag LOCUS_36450 259 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 529 858 gene locus_tag LOCUS_36460 529 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 >Feature sequence1361 <1562 457 gene locus_tag LOCUS_36470 <1562 457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SLN7:putative cytosol aminopeptidase >Feature sequence1362 94 411 gene locus_tag LOCUS_36480 94 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 >Feature sequence1363 <1 504 gene locus_tag LOCUS_36490 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3EAN6:aminotransferase 1180 521 gene locus_tag LOCUS_36500 1180 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 >Feature sequence1364 1418 456 gene locus_tag LOCUS_36510 1418 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_012228.2 protein_id gnl|my_center|LOCUS_36510 >Feature sequence1365 <1554 362 gene locus_tag LOCUS_36520 <1554 362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402874.1:pyridine nucleotide-disulfide oxidoreductase >Feature sequence1366 1250 273 gene locus_tag LOCUS_36530 gene phoH 1250 273 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840510.1 protein_id gnl|my_center|LOCUS_36530 >Feature sequence1367 <1550 864 gene locus_tag LOCUS_36540 <1550 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038493.1:two-component sensor histidine kinase >Feature sequence1368 1301 579 gene locus_tag LOCUS_36550 1301 579 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198065.1 protein_id gnl|my_center|LOCUS_36550 >Feature sequence1369 1285 170 gene locus_tag LOCUS_36560 1285 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence1370 >Feature sequence1371 >Feature sequence1372 >Feature sequence1373 713 1349 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaggagtccccgatgccgtcg >Feature sequence1374 >Feature sequence1375 119 727 gene locus_tag LOCUS_36570 119 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 733 1134 gene locus_tag LOCUS_36580 733 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 >Feature sequence1376 >Feature sequence1377 >Feature sequence1378 277 1377 gene locus_tag LOCUS_36590 277 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 >Feature sequence1379 <1528 215 gene locus_tag LOCUS_36600 <1528 215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886881.1:6-aminohexanoate-cyclic-dimer hydrolase >Feature sequence1380 <1527 631 gene locus_tag LOCUS_36610 <1527 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071171.1:GMC family oxidoreductase >Feature sequence1381 1332 214 gene locus_tag LOCUS_36620 1332 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974706.1 protein_id gnl|my_center|LOCUS_36620 >Feature sequence1382 <1524 188 gene locus_tag LOCUS_36630 <1524 188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94605:DNA gyrase subunit A >Feature sequence1383 >Feature sequence1384 >Feature sequence1385 123 587 gene locus_tag LOCUS_36640 123 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766044.1 protein_id gnl|my_center|LOCUS_36640 589 873 gene locus_tag LOCUS_36650 589 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 1300 941 gene locus_tag LOCUS_36660 1300 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 >Feature sequence1386 764 129 gene locus_tag LOCUS_36670 764 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 >Feature sequence1387 >Feature sequence1388 1033 479 gene locus_tag LOCUS_36680 1033 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 1256 1044 gene locus_tag LOCUS_36690 1256 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 >Feature sequence1389 340 152 gene locus_tag LOCUS_36700 340 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 1088 483 gene locus_tag LOCUS_36710 1088 483 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022123.1 protein_id gnl|my_center|LOCUS_36710 >Feature sequence1390 >Feature sequence1391 915 421 gene locus_tag LOCUS_36720 gene purE 915 421 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CC72 protein_id gnl|my_center|LOCUS_36720 <1516 925 gene locus_tag LOCUS_36730 <1516 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGV0:phosphoribosylamine--glycine ligase >Feature sequence1392 454 47 gene locus_tag LOCUS_36740 454 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 >Feature sequence1393 <1516 241 gene locus_tag LOCUS_36750 <1516 241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390236.1:multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase >Feature sequence1394 529 26 gene locus_tag LOCUS_36760 529 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 >Feature sequence1395 >Feature sequence1396 1411 548 gene locus_tag LOCUS_36770 1411 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945818.1 protein_id gnl|my_center|LOCUS_36770 >Feature sequence1397 415 1221 gene locus_tag LOCUS_36780 415 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 >Feature sequence1398 <1513 672 gene locus_tag LOCUS_36790 <1513 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143421.1:sensor histidine kinase >Feature sequence1399 2 241 gene locus_tag LOCUS_36800 2 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 231 1154 gene locus_tag LOCUS_36810 gene xerD 231 1154 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C56 protein_id gnl|my_center|LOCUS_36810 >Feature sequence1400 >Feature sequence1401 <1511 192 gene locus_tag LOCUS_36820 <1511 192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143675.1:peptidase M16 >Feature sequence1402 >Feature sequence1403 1208 525 gene locus_tag LOCUS_36830 1208 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 >Feature sequence1404 >Feature sequence1405 1282 470 gene locus_tag LOCUS_36840 1282 470 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_36840 >Feature sequence1406 >Feature sequence1407 305 1201 gene locus_tag LOCUS_36850 305 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 >Feature sequence1408 601 1350 gene locus_tag LOCUS_36860 gene aat 601 1350 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BN2 protein_id gnl|my_center|LOCUS_36860 >Feature sequence1409 286 1200 gene locus_tag LOCUS_36870 286 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 >Feature sequence1410 55 684 gene locus_tag LOCUS_36880 55 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 >Feature sequence1411 253 1404 gene locus_tag LOCUS_36890 253 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 >Feature sequence1412 >Feature sequence1413 332 1441 gene locus_tag LOCUS_36900 332 1441 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_36900 >Feature sequence1414 776 306 gene locus_tag LOCUS_36910 776 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 1413 784 gene locus_tag LOCUS_36920 1413 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 >Feature sequence1415 1126 146 gene locus_tag LOCUS_36930 1126 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 >Feature sequence1416 289 125 gene locus_tag LOCUS_36940 289 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 1310 504 gene locus_tag LOCUS_36950 1310 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 >Feature sequence1417 583 918 gene locus_tag LOCUS_36960 583 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 >Feature sequence1418 353 940 gene locus_tag LOCUS_36970 353 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 >Feature sequence1419 >Feature sequence1420 >Feature sequence1421 >Feature sequence1422 >Feature sequence1423 196 459 gene locus_tag LOCUS_36980 gene rpsP 196 459 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4M6 protein_id gnl|my_center|LOCUS_36980 459 716 gene locus_tag LOCUS_36990 459 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 766 1212 gene locus_tag LOCUS_37000 766 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 >Feature sequence1424 >Feature sequence1425 1440 910 gene locus_tag LOCUS_37010 1440 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 >Feature sequence1426 220 146 gene locus_tag LOCUS_t00280 220 146 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 300 225 gene locus_tag LOCUS_t00290 300 225 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 442 358 gene locus_tag LOCUS_t00300 442 358 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 553 478 gene locus_tag LOCUS_t00310 553 478 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1427 614 934 gene locus_tag LOCUS_37020 614 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 945 1340 gene locus_tag LOCUS_37030 945 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 >Feature sequence1428 506 54 gene locus_tag LOCUS_37040 506 54 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_37040 1066 521 gene locus_tag LOCUS_37050 1066 521 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328224.1 protein_id gnl|my_center|LOCUS_37050 1427 1056 gene locus_tag LOCUS_37060 1427 1056 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_37060 >Feature sequence1429 146 1063 gene locus_tag LOCUS_37070 146 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 >Feature sequence1430 1467 193 gene locus_tag LOCUS_37080 1467 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030910.1 protein_id gnl|my_center|LOCUS_37080 >Feature sequence1431 1 564 gene locus_tag LOCUS_37090 1 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 >Feature sequence1432 >Feature sequence1433 378 719 gene locus_tag LOCUS_37100 378 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 813 1271 gene locus_tag LOCUS_37110 813 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 >Feature sequence1434 >Feature sequence1435 606 97 gene locus_tag LOCUS_37120 606 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 872 603 gene locus_tag LOCUS_37130 872 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 1462 872 gene locus_tag LOCUS_37140 1462 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 >Feature sequence1436 338 1192 gene locus_tag LOCUS_37150 338 1192 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409654.1 protein_id gnl|my_center|LOCUS_37150 >Feature sequence1437 1076 726 gene locus_tag LOCUS_37160 1076 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 1461 1084 gene locus_tag LOCUS_37170 1461 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 >Feature sequence1438 >Feature sequence1439 >Feature sequence1440 1060 335 gene locus_tag LOCUS_37180 gene lolD 1060 335 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT2 protein_id gnl|my_center|LOCUS_37180 1457 1053 gene locus_tag LOCUS_37190 1457 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 >Feature sequence1441 >Feature sequence1442 3 323 gene locus_tag LOCUS_37200 3 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 >Feature sequence1443 >Feature sequence1444 >Feature sequence1445 1029 502 gene locus_tag LOCUS_37210 1029 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 >Feature sequence1446 >Feature sequence1447 >Feature sequence1448 >Feature sequence1449 >Feature sequence1450 >Feature sequence1451 >Feature sequence1452 841 212 gene locus_tag LOCUS_37220 841 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 >Feature sequence1453 >Feature sequence1454 683 93 gene locus_tag LOCUS_37230 683 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 1327 680 gene locus_tag LOCUS_37240 1327 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 >Feature sequence1455 <1 662 gene locus_tag LOCUS_37250 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227564.1:carbon-monoxide dehydrogenase medium subunit >Feature sequence1456 >Feature sequence1457 772 128 gene locus_tag LOCUS_37260 772 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 861 1316 gene locus_tag LOCUS_37270 861 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 >Feature sequence1458 100 444 gene locus_tag LOCUS_37280 gene yajC 100 444 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545404.1 protein_id gnl|my_center|LOCUS_37280 >Feature sequence1459 943 230 gene locus_tag LOCUS_37290 943 230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190866.1 protein_id gnl|my_center|LOCUS_37290 >Feature sequence1460 >Feature sequence1461 425 1234 gene locus_tag LOCUS_37300 425 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 >Feature sequence1462 >Feature sequence1463 <1432 430 gene locus_tag LOCUS_37310 <1432 430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIS7:putative K(+)-stimulated pyrophosphate-energized sodium pump >Feature sequence1464 478 2 gene locus_tag LOCUS_37320 478 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 882 541 gene locus_tag LOCUS_37330 882 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 1322 879 gene locus_tag LOCUS_37340 gene nusB 1322 879 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHQ2 protein_id gnl|my_center|LOCUS_37340 >Feature sequence1465 454 5 gene locus_tag LOCUS_37350 454 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 >Feature sequence1466 >Feature sequence1467 >Feature sequence1468 485 1318 gene locus_tag LOCUS_37360 485 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 >Feature sequence1469 225 1256 gene locus_tag LOCUS_37370 gene lpxD 225 1256 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT5 protein_id gnl|my_center|LOCUS_37370 >Feature sequence1470 1369 869 gene locus_tag LOCUS_37380 1369 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 >Feature sequence1471 >Feature sequence1472 957 1268 gene locus_tag LOCUS_37390 957 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 >Feature sequence1473 >Feature sequence1474 >Feature sequence1475 >Feature sequence1476 <1 904 gene locus_tag LOCUS_37400 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WJ72:GDP-mannose 4,6-dehydratase >Feature sequence1477 1244 1169 gene locus_tag LOCUS_t00320 1244 1169 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1321 1249 gene locus_tag LOCUS_t00330 1321 1249 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1478 <1412 708 gene locus_tag LOCUS_37410 <1412 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74B17:histidine kinase >Feature sequence1479 <1 805 gene locus_tag LOCUS_37420 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920032.1:cyclic nucleotide-binding protein >Feature sequence1480 204 1154 gene locus_tag LOCUS_37430 gene mvaD 204 1154 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_37430 >Feature sequence1481 1408 347 gene locus_tag LOCUS_37440 1408 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 >Feature sequence1482 >Feature sequence1483 >Feature sequence1484 >Feature sequence1485 622 801 gene locus_tag LOCUS_37450 622 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 1407 832 gene locus_tag LOCUS_37460 1407 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 >Feature sequence1486 298 209 gene locus_tag LOCUS_t00340 298 209 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1487 >Feature sequence1488 <1 876 gene locus_tag LOCUS_37470 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63X23:nicotinate phosphoribosyltransferase >Feature sequence1489 233 766 gene locus_tag LOCUS_37480 233 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 1194 805 gene locus_tag LOCUS_37490 1194 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 >Feature sequence1490 >Feature sequence1491 340 47 gene locus_tag LOCUS_37500 340 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 >Feature sequence1492 >Feature sequence1493 >Feature sequence1494 >Feature sequence1495 1 567 gene locus_tag LOCUS_37510 1 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 570 1331 gene locus_tag LOCUS_37520 gene tpiA 570 1331 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP89 protein_id gnl|my_center|LOCUS_37520 >Feature sequence1496 <1 625 gene locus_tag LOCUS_37530 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CT7:biotin synthase >Feature sequence1497 328 801 gene locus_tag LOCUS_37540 gene fur 328 801 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_37540 976 889 gene locus_tag LOCUS_t00350 976 889 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1498 >Feature sequence1499 89 1144 gene locus_tag LOCUS_37550 89 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 >Feature sequence1500 <1387 677 gene locus_tag LOCUS_37560 <1387 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256101.1:histidine kinase >Feature sequence1501 >Feature sequence1502 102 974 gene locus_tag LOCUS_37570 102 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 >Feature sequence1503 84 170 gene locus_tag LOCUS_t00360 84 170 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1504 745 1206 gene locus_tag LOCUS_37580 745 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 >Feature sequence1505 >Feature sequence1506 >Feature sequence1507 >Feature sequence1508 >Feature sequence1509 1011 100 gene locus_tag LOCUS_37590 1011 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 >Feature sequence1510 <1374 787 gene locus_tag LOCUS_37600 <1374 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein >Feature sequence1511 >Feature sequence1512 >Feature sequence1513 >Feature sequence1514 1367 471 gene locus_tag LOCUS_37610 1367 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 >Feature sequence1515 1133 354 gene locus_tag LOCUS_37620 gene nqrC 1133 354 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBZ2 protein_id gnl|my_center|LOCUS_37620 >Feature sequence1516 >Feature sequence1517 >Feature sequence1518 >Feature sequence1519 >Feature sequence1520 >Feature sequence1521 >Feature sequence1522 >Feature sequence1523 1187 429 gene locus_tag LOCUS_37630 1187 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 >Feature sequence1524 469 804 gene locus_tag LOCUS_37640 469 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 >Feature sequence1525 1199 435 gene locus_tag LOCUS_37650 1199 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_37650 >Feature sequence1526 1315 200 gene locus_tag LOCUS_37660 1315 200 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706019.1 protein_id gnl|my_center|LOCUS_37660 >Feature sequence1527 >Feature sequence1528 >Feature sequence1529 >Feature sequence1530 >Feature sequence1531 1127 666 gene locus_tag LOCUS_37670 1127 666 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8F4 protein_id gnl|my_center|LOCUS_37670 >Feature sequence1532 32 511 gene locus_tag LOCUS_37680 32 511 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969634.1 protein_id gnl|my_center|LOCUS_37680 >Feature sequence1533 >Feature sequence1534 >Feature sequence1535 <1341 587 gene locus_tag LOCUS_37690 <1341 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000600562.1:glycosyl transferase >Feature sequence1536 >Feature sequence1537 >Feature sequence1538 >Feature sequence1539 479 405 gene locus_tag LOCUS_t00370 479 405 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1309 536 gene locus_tag LOCUS_37700 gene uppP4 1309 536 CDS product undecaprenyl-diphosphatase 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI21 protein_id gnl|my_center|LOCUS_37700 >Feature sequence1540 151 573 gene locus_tag LOCUS_37710 gene moaE 151 573 CDS product molybdopterin converting factor, subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149970.1 protein_id gnl|my_center|LOCUS_37710 530 1267 gene locus_tag LOCUS_37720 gene trmB 530 1267 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3N659 protein_id gnl|my_center|LOCUS_37720 >Feature sequence1541 777 523 gene locus_tag LOCUS_37730 777 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 >Feature sequence1542 <1334 159 gene locus_tag LOCUS_37740 <1334 159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122303.1:serine/threonine protein kinase >Feature sequence1543 514 975 gene locus_tag LOCUS_37750 514 975 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545060.1 protein_id gnl|my_center|LOCUS_37750 >Feature sequence1544 1293 79 gene locus_tag LOCUS_37760 1293 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 >Feature sequence1545 109 717 gene locus_tag LOCUS_37770 gene ydeI 109 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 protein_id gnl|my_center|LOCUS_37770 >Feature sequence1546 >Feature sequence1547 >Feature sequence1548 <1326 250 gene locus_tag LOCUS_37780 <1326 250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H75:transcription-repair-coupling factor >Feature sequence1549 >Feature sequence1550 315 1019 gene locus_tag LOCUS_37790 315 1019 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289348.1 protein_id gnl|my_center|LOCUS_37790 >Feature sequence1551 484 1230 gene locus_tag LOCUS_37800 484 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37800 >Feature sequence1552 >Feature sequence1553 680 447 gene locus_tag LOCUS_37810 680 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 >Feature sequence1554 535 975 gene locus_tag LOCUS_37820 535 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 1129 968 gene locus_tag LOCUS_37830 1129 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 >Feature sequence1555 <1 674 gene locus_tag LOCUS_37840 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535488.1:short-chain dehydrogenase/reductase 1310 1065 gene locus_tag LOCUS_37850 1310 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 >Feature sequence1556 209 1252 gene locus_tag LOCUS_37860 209 1252 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903126.1 protein_id gnl|my_center|LOCUS_37860 >Feature sequence1557 1063 368 gene locus_tag LOCUS_37870 1063 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 >Feature sequence1558 <1 1300 gene locus_tag LOCUS_37880 <1 1300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941105.1:twitching motility protein PilT >Feature sequence1559 >Feature sequence1560 <1 982 gene locus_tag LOCUS_37890 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817287.1:cell signaling regulator >Feature sequence1561 <1302 406 gene locus_tag LOCUS_37900 <1302 406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9UP39:3-oxoacyl-[acyl-carrier-protein] synthase 2 >Feature sequence1562 <1 795 gene locus_tag LOCUS_37910 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727717.1:flotillin family protein >Feature sequence1563 >Feature sequence1564 <1301 367 gene locus_tag LOCUS_37920 <1301 367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000552081.1:acetyl-CoA acetyltransferase >Feature sequence1565 >Feature sequence1566 925 410 gene locus_tag LOCUS_37930 925 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 >Feature sequence1567 271 714 gene locus_tag LOCUS_37940 271 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 >Feature sequence1568 <1 904 gene locus_tag LOCUS_37950 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141859.1:aminotransferase DegT >Feature sequence1569 550 2 gene locus_tag LOCUS_37960 550 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 >Feature sequence1570 >Feature sequence1571 >Feature sequence1572 <1 688 gene locus_tag LOCUS_37970 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940843.1:cell division protein Fic >Feature sequence1573 <1283 758 gene locus_tag LOCUS_37980 <1283 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942207.1:penicillin-binding protein 1A >Feature sequence1574 <1283 363 gene locus_tag LOCUS_37990 <1283 363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940912.1:B12-binding domain-containing radical SAM protein >Feature sequence1575 >Feature sequence1576 <1 1063 gene locus_tag LOCUS_38000 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122176.1:thiol-disulfide isomerase >Feature sequence1577 >Feature sequence1578 1 834 gene locus_tag LOCUS_38010 1 834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932339.1 protein_id gnl|my_center|LOCUS_38010 >Feature sequence1579 >Feature sequence1580 >Feature sequence1581 >Feature sequence1582 <1275 460 gene locus_tag LOCUS_38020 <1275 460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KEW0:alanine dehydrogenase >Feature sequence1583 >Feature sequence1584 >Feature sequence1585 >Feature sequence1586 441 857 gene locus_tag LOCUS_38030 441 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 >Feature sequence1587 806 60 gene locus_tag LOCUS_38040 806 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 >Feature sequence1588 >Feature sequence1589 <1265 177 gene locus_tag LOCUS_38050 <1265 177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875981.1:succinoglycan biosynthesis transporter >Feature sequence1590 >Feature sequence1591 >Feature sequence1592 >Feature sequence1593 >Feature sequence1594 >Feature sequence1595 >Feature sequence1596 2 343 gene locus_tag LOCUS_38060 2 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 410 619 gene locus_tag LOCUS_38070 410 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 >Feature sequence1597 >Feature sequence1598 >Feature sequence1599 327 416 gene locus_tag LOCUS_t00380 327 416 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1600 >Feature sequence1601 >Feature sequence1602 >Feature sequence1603 >Feature sequence1604 <1 990 gene locus_tag LOCUS_38080 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403440.1:D-3-phosphoglycerate dehydrogenase >Feature sequence1605 997 137 gene locus_tag LOCUS_38090 997 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 >Feature sequence1606 >Feature sequence1607 >Feature sequence1608 628 23 gene locus_tag LOCUS_38100 628 23 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 protein_id gnl|my_center|LOCUS_38100 >Feature sequence1609 >Feature sequence1610 >Feature sequence1611 1204 905 gene locus_tag LOCUS_38110 1204 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 >Feature sequence1612 315 1022 gene locus_tag LOCUS_38120 315 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 >Feature sequence1613 1013 201 gene locus_tag LOCUS_38130 1013 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 >Feature sequence1614 >Feature sequence1615 >Feature sequence1616 >Feature sequence1617 963 1148 gene locus_tag LOCUS_38140 963 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 >Feature sequence1618 1138 275 gene locus_tag LOCUS_38150 gene gnnA 1138 275 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_38150 >Feature sequence1619 >Feature sequence1620 2 277 gene locus_tag LOCUS_38160 2 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 1080 421 gene locus_tag LOCUS_38170 gene msrA 1080 421 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHL9 protein_id gnl|my_center|LOCUS_38170 >Feature sequence1621 1235 183 gene locus_tag LOCUS_38180 1235 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 >Feature sequence1622 >Feature sequence1623 >Feature sequence1624 1011 385 gene locus_tag LOCUS_38190 1011 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 >Feature sequence1625 >Feature sequence1626 >Feature sequence1627 >Feature sequence1628 >Feature sequence1629 1173 337 gene locus_tag LOCUS_38200 1173 337 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_38200 >Feature sequence1630 <1 1178 gene locus_tag LOCUS_38210 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259590.1:glycosyl transferase family 1 >Feature sequence1631 <1222 381 gene locus_tag LOCUS_38220 <1222 381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120799.1:choline-sulfatase >Feature sequence1632 >Feature sequence1633 1079 288 gene locus_tag LOCUS_38230 1079 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 >Feature sequence1634 <1 1177 gene locus_tag LOCUS_38240 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026979.1:alpha-galactosidase >Feature sequence1635 153 1079 gene locus_tag LOCUS_38250 153 1079 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228198.1 protein_id gnl|my_center|LOCUS_38250 >Feature sequence1636 >Feature sequence1637 >Feature sequence1638 >Feature sequence1639 >Feature sequence1640 1031 747 gene locus_tag LOCUS_38260 1031 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 >Feature sequence1641 >Feature sequence1642 >Feature sequence1643 >Feature sequence1644 111 890 gene locus_tag LOCUS_38270 111 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 >Feature sequence1645 >Feature sequence1646 >Feature sequence1647 581 660 gene locus_tag LOCUS_t00390 581 660 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1648 >Feature sequence1649 746 138 gene locus_tag LOCUS_38280 746 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 >Feature sequence1650 606 322 gene locus_tag LOCUS_38290 606 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 <1197 603 gene locus_tag LOCUS_38300 <1197 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458877.1:B12-binding domain-containing radical SAM protein >Feature sequence1651 130 474 gene locus_tag LOCUS_38310 130 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 1190 471 gene locus_tag LOCUS_38320 1190 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 >Feature sequence1652 >Feature sequence1653 161 607 gene locus_tag LOCUS_38330 gene dut 161 607 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52597 protein_id gnl|my_center|LOCUS_38330 >Feature sequence1654 1046 324 gene locus_tag LOCUS_38340 gene natA 1046 324 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 protein_id gnl|my_center|LOCUS_38340 >Feature sequence1655 >Feature sequence1656 520 1185 gene locus_tag LOCUS_38350 520 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 >Feature sequence1657 <1 1082 gene locus_tag LOCUS_38360 <1 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403751.1:C4-dicarboxylate ABC transporter >Feature sequence1658 >Feature sequence1659 >Feature sequence1660 682 996 gene locus_tag LOCUS_38370 682 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 >Feature sequence1661 684 331 gene locus_tag LOCUS_38380 684 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 >Feature sequence1662 >Feature sequence1663 <1 691 gene locus_tag LOCUS_38390 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931900.1:uracil-DNA glycosylase 688 1032 gene locus_tag LOCUS_38400 688 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 >Feature sequence1664 >Feature sequence1665 >Feature sequence1666 >Feature sequence1667 158 925 gene locus_tag LOCUS_38410 158 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 >Feature sequence1668 >Feature sequence1669 >Feature sequence1670 >Feature sequence1671 908 201 gene locus_tag LOCUS_38420 908 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 >Feature sequence1672 >Feature sequence1673 >Feature sequence1674 576 271 gene locus_tag LOCUS_38430 576 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 >Feature sequence1675 1053 754 gene locus_tag LOCUS_38440 1053 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 >Feature sequence1676 >Feature sequence1677 <1157 464 gene locus_tag LOCUS_38450 <1157 464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937687.1:sulfatase >Feature sequence1678 >Feature sequence1679 >Feature sequence1680 >Feature sequence1681 >Feature sequence1682 >Feature sequence1683 >Feature sequence1684 468 833 gene locus_tag LOCUS_38460 468 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 >Feature sequence1685 <1 702 gene locus_tag LOCUS_38470 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056474.1:diguanylate cyclase note possible pseudo, frameshifted >Feature sequence1686 1066 437 gene locus_tag LOCUS_38480 1066 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 >Feature sequence1687 >Feature sequence1688 945 400 gene locus_tag LOCUS_38490 945 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 >Feature sequence1689 >Feature sequence1690 <1 755 gene locus_tag LOCUS_38500 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74AT9:lipid-A-disaccharide synthase >Feature sequence1691 >Feature sequence1692 >Feature sequence1693 980 417 gene locus_tag LOCUS_38510 980 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 >Feature sequence1694 <1129 232 gene locus_tag LOCUS_38520 <1129 232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206099.1:Xaa-Pro aminopeptidase >Feature sequence1695 144 566 gene locus_tag LOCUS_38530 144 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 >Feature sequence1696 >Feature sequence1697 827 423 gene locus_tag LOCUS_38540 827 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 >Feature sequence1698 367 83 gene locus_tag LOCUS_38550 367 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 <1123 398 gene locus_tag LOCUS_38560 <1123 398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259719.1:isocitrate lyase >Feature sequence1699 >Feature sequence1700 1093 695 gene locus_tag LOCUS_38570 1093 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 >Feature sequence1701 156 230 gene locus_tag LOCUS_t00400 156 230 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 604 329 gene locus_tag LOCUS_38580 604 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 >Feature sequence1702 1065 532 gene locus_tag LOCUS_38590 1065 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 >Feature sequence1703 846 142 gene locus_tag LOCUS_38600 846 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 >Feature sequence1704 >Feature sequence1705 >Feature sequence1706 >Feature sequence1707 >Feature sequence1708 >Feature sequence1709 >Feature sequence1710 <1 805 gene locus_tag LOCUS_38610 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957337.1:short-chain dehydrogenase >Feature sequence1711 1093 695 gene locus_tag LOCUS_38620 1093 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 >Feature sequence1712 1090 419 gene locus_tag LOCUS_38630 gene cyoC 1090 419 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100797.1 protein_id gnl|my_center|LOCUS_38630 >Feature sequence1713 358 59 gene locus_tag LOCUS_38640 358 59 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_38640 825 355 gene locus_tag LOCUS_38650 825 355 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_38650 >Feature sequence1714 <1107 505 gene locus_tag LOCUS_38660 <1107 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122148.1:ATPase AAA >Feature sequence1715 <1 658 gene locus_tag LOCUS_38670 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YJZ3:glutamyl-tRNA reductase >Feature sequence1716 >Feature sequence1717 >Feature sequence1718 >Feature sequence1719 >Feature sequence1720 >Feature sequence1721 >Feature sequence1722 <1 597 gene locus_tag LOCUS_38680 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727205.1:polyketide synthase >Feature sequence1723 >Feature sequence1724 >Feature sequence1725 >Feature sequence1726 >Feature sequence1727 >Feature sequence1728 >Feature sequence1729 >Feature sequence1730 >Feature sequence1731 <1 777 gene locus_tag LOCUS_38690 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941744.1:virion core protein >Feature sequence1732 >Feature sequence1733 >Feature sequence1734 >Feature sequence1735 810 70 gene locus_tag LOCUS_38700 810 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 >Feature sequence1736 >Feature sequence1737 >Feature sequence1738 1003 359 gene locus_tag LOCUS_38710 1003 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 >Feature sequence1739 >Feature sequence1740 <1075 216 gene locus_tag LOCUS_38720 <1075 216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KII7:tRNA N6-adenosine threonylcarbamoyltransferase >Feature sequence1741 >Feature sequence1742 >Feature sequence1743 308 805 gene locus_tag LOCUS_38730 308 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 >Feature sequence1744 >Feature sequence1745 >Feature sequence1746 <1069 266 gene locus_tag LOCUS_38740 <1069 266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001890295.1:peptidase M16 >Feature sequence1747 >Feature sequence1748 >Feature sequence1749 862 68 gene locus_tag LOCUS_38750 gene aroK 862 68 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VG9 protein_id gnl|my_center|LOCUS_38750 >Feature sequence1750 >Feature sequence1751 912 523 gene locus_tag LOCUS_38760 912 523 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424232.1 protein_id gnl|my_center|LOCUS_38760 >Feature sequence1752 >Feature sequence1753 <1 999 gene locus_tag LOCUS_38770 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531306.1:protein translocase subunit SecDF >Feature sequence1754 34 474 gene locus_tag LOCUS_38780 34 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 >Feature sequence1755 >Feature sequence1756 >Feature sequence1757 <1061 534 gene locus_tag LOCUS_38790 <1061 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74B14:dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex >Feature sequence1758 787 134 gene locus_tag LOCUS_38800 787 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 >Feature sequence1759 766 416 gene locus_tag LOCUS_38810 766 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 >Feature sequence1760 >Feature sequence1761 278 703 gene locus_tag LOCUS_38820 278 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 >Feature sequence1762 >Feature sequence1763 >Feature sequence1764 <1 896 gene locus_tag LOCUS_38830 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392656.1:elongation factor G >Feature sequence1765 130 960 gene locus_tag LOCUS_38840 130 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 >Feature sequence1766 498 806 gene locus_tag LOCUS_38850 498 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 >Feature sequence1767 <1 913 gene locus_tag LOCUS_38860 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930806.1:cardiolipin synthetase >Feature sequence1768 >Feature sequence1769 >Feature sequence1770 >Feature sequence1771 <1051 132 gene locus_tag LOCUS_38870 <1051 132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405282.1:VWA domain-containing protein >Feature sequence1772 >Feature sequence1773 795 643 gene locus_tag LOCUS_38880 795 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 >Feature sequence1774 <1047 9 gene locus_tag LOCUS_38890 <1047 9 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532679.1:choline-sulfatase >Feature sequence1775 >Feature sequence1776 >Feature sequence1777 >Feature sequence1778 <1043 520 gene locus_tag LOCUS_38900 <1043 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224651.1:C-5 sterol desaturase >Feature sequence1779 <1042 529 gene locus_tag LOCUS_38910 <1042 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5C3:dihydropteroate synthase >Feature sequence1780 218 970 gene locus_tag LOCUS_38920 218 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_38920 >Feature sequence1781 1 450 gene locus_tag LOCUS_38930 1 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 >Feature sequence1782 >Feature sequence1783 >Feature sequence1784 >Feature sequence1785 >Feature sequence1786 >Feature sequence1787 >Feature sequence1788 >Feature sequence1789 >Feature sequence1790 >Feature sequence1791 <1 649 gene locus_tag LOCUS_38940 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 >Feature sequence1792 >Feature sequence1793 <1 603 gene locus_tag LOCUS_38950 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PCH5:adenosylhomocysteinase >Feature sequence1794 >Feature sequence1795 6 251 gene locus_tag LOCUS_38960 6 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 1019 252 gene locus_tag LOCUS_38970 gene proC 1019 252 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFV0 protein_id gnl|my_center|LOCUS_38970 >Feature sequence1796 >Feature sequence1797 >Feature sequence1798 >Feature sequence1799 >Feature sequence1800 <1 640 gene locus_tag LOCUS_38980 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72B50:RNA polymerase sigma factor RpoD >Feature sequence1801 >Feature sequence1802 >Feature sequence1803 976 287 gene locus_tag LOCUS_38990 976 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141416.1 protein_id gnl|my_center|LOCUS_38990 >Feature sequence1804 >Feature sequence1805 870 439 gene locus_tag LOCUS_39000 870 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 >Feature sequence1806 >Feature sequence1807 >Feature sequence1808 >Feature sequence1809 1009 707 gene locus_tag LOCUS_39010 1009 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 >Feature sequence1810 >Feature sequence1811 >Feature sequence1812 50 817 gene locus_tag LOCUS_39020 50 817 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058915.1 protein_id gnl|my_center|LOCUS_39020 >Feature sequence1813 247 172 gene locus_tag LOCUS_t00410 247 172 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 336 261 gene locus_tag LOCUS_t00420 336 261 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 885 391 gene locus_tag LOCUS_39030 885 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 >Feature sequence1814 >Feature sequence1815 <1 694 gene locus_tag LOCUS_39040 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66627:prolipoprotein diacylglyceryl transferase >Feature sequence1816 315 995 gene locus_tag LOCUS_39050 315 995 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250526.1 protein_id gnl|my_center|LOCUS_39050 >Feature sequence1817 641 162 gene locus_tag LOCUS_39060 641 162 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGN7 protein_id gnl|my_center|LOCUS_39060 1000 764 gene locus_tag LOCUS_39070 1000 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070