>Feature sequence0001 184 1089 gene locus_tag LOCUS_00010 184 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1504 1100 gene locus_tag LOCUS_00020 1504 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1470 1742 gene locus_tag LOCUS_00030 1470 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1628 1858 gene locus_tag LOCUS_00040 1628 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2199 1885 gene locus_tag LOCUS_00050 2199 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3554 2196 gene locus_tag LOCUS_00060 3554 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5248 3563 gene locus_tag LOCUS_00070 5248 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5796 5245 gene locus_tag LOCUS_00080 5796 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 5903 7930 gene locus_tag LOCUS_00090 5903 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8038 9345 gene locus_tag LOCUS_00100 8038 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9342 10817 gene locus_tag LOCUS_00110 9342 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12339 11527 gene locus_tag LOCUS_00120 12339 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12595 12747 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtctgccacatattgagcca 14744 12789 gene locus_tag LOCUS_00130 14744 12789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16246 14735 gene locus_tag LOCUS_00140 16246 14735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16451 17524 gene locus_tag LOCUS_00150 16451 17524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19481 17514 gene locus_tag LOCUS_00160 19481 17514 CDS product nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272221.1 protein_id gnl|my_center|LOCUS_00160 19642 20838 gene locus_tag LOCUS_00170 19642 20838 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_00170 20835 21005 gene locus_tag LOCUS_00180 20835 21005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21007 22053 gene locus_tag LOCUS_00190 21007 22053 CDS product FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986905.1 protein_id gnl|my_center|LOCUS_00190 22050 23117 gene locus_tag LOCUS_00200 22050 23117 CDS product FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986905.1 protein_id gnl|my_center|LOCUS_00200 23146 23415 gene locus_tag LOCUS_00210 23146 23415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23437 25140 gene locus_tag LOCUS_00220 23437 25140 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_00220 25137 25370 gene locus_tag LOCUS_00230 gene tusA-1 25137 25370 CDS product tRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942005.1 protein_id gnl|my_center|LOCUS_00230 >Feature sequence0002 3201 1498 gene locus_tag LOCUS_00240 3201 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 3465 3268 gene locus_tag LOCUS_00250 3465 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 3448 4344 gene locus_tag LOCUS_00260 3448 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 6059 4290 gene locus_tag LOCUS_00270 6059 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 6196 7092 gene locus_tag LOCUS_00280 6196 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 7092 7850 gene locus_tag LOCUS_00290 7092 7850 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022003.1 protein_id gnl|my_center|LOCUS_00290 7900 8361 gene locus_tag LOCUS_00300 7900 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 8908 8444 gene locus_tag LOCUS_00310 8908 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 11528 9045 gene locus_tag LOCUS_00320 11528 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 13294 11600 gene locus_tag LOCUS_00330 13294 11600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 13872 13387 gene locus_tag LOCUS_00340 13872 13387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 14412 14017 gene locus_tag LOCUS_00350 14412 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 14612 16246 gene locus_tag LOCUS_00360 14612 16246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 17906 16251 gene locus_tag LOCUS_00370 17906 16251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 18469 17906 gene locus_tag LOCUS_00380 18469 17906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 >Feature sequence0003 1824 388 gene locus_tag LOCUS_00390 1824 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 2015 1821 gene locus_tag LOCUS_00400 2015 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 2326 2015 gene locus_tag LOCUS_00410 2326 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 2358 2522 gene locus_tag LOCUS_00420 2358 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 2519 2998 gene locus_tag LOCUS_00430 2519 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 4222 3140 gene locus_tag LOCUS_00440 4222 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 5691 4219 gene locus_tag LOCUS_00450 5691 4219 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776263.1 protein_id gnl|my_center|LOCUS_00450 5778 6134 gene locus_tag LOCUS_00460 5778 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 6200 7738 gene locus_tag LOCUS_00470 6200 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 7873 8916 gene locus_tag LOCUS_00480 7873 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 10571 8922 gene locus_tag LOCUS_00490 10571 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 10987 10568 gene locus_tag LOCUS_00500 10987 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 12221 11574 gene locus_tag LOCUS_00510 12221 11574 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531635.1 protein_id gnl|my_center|LOCUS_00510 12894 12565 gene locus_tag LOCUS_00520 12894 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 13382 12891 gene locus_tag LOCUS_00530 13382 12891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 14255 13491 gene locus_tag LOCUS_00540 14255 13491 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030890.1 protein_id gnl|my_center|LOCUS_00540 <15389 14245 gene locus_tag LOCUS_00550 <15389 14245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030889.1:transposase >Feature sequence0004 263 1222 gene locus_tag LOCUS_00560 263 1222 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969027.1 protein_id gnl|my_center|LOCUS_00560 3006 1219 gene locus_tag LOCUS_00570 gene nolO 3006 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887298.1 protein_id gnl|my_center|LOCUS_00570 3762 3025 gene locus_tag LOCUS_00580 3762 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 4840 3812 gene locus_tag LOCUS_00590 4840 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 5869 4931 gene locus_tag LOCUS_00600 gene hmgR 5869 4931 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072059.1 protein_id gnl|my_center|LOCUS_00600 7205 5892 gene locus_tag LOCUS_00610 7205 5892 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192100.1 protein_id gnl|my_center|LOCUS_00610 8125 7202 gene locus_tag LOCUS_00620 8125 7202 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_00620 8593 8189 gene locus_tag LOCUS_00630 8593 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 8845 10155 gene locus_tag LOCUS_00640 8845 10155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 11100 10165 gene locus_tag LOCUS_00650 11100 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 11929 11114 gene locus_tag LOCUS_00660 11929 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_00660 12303 11932 gene locus_tag LOCUS_00670 12303 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 13104 12406 gene locus_tag LOCUS_00680 13104 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 >Feature sequence0005 2658 1099 gene locus_tag LOCUS_00690 2658 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 3544 2705 gene locus_tag LOCUS_00700 3544 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 4046 3621 gene locus_tag LOCUS_00710 4046 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 4741 4334 gene locus_tag LOCUS_00720 4741 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933003.1 protein_id gnl|my_center|LOCUS_00720 5880 4786 gene locus_tag LOCUS_00730 gene purK 5880 4786 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ3 protein_id gnl|my_center|LOCUS_00730 6486 5881 gene locus_tag LOCUS_00740 gene purE 6486 5881 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CFL8 protein_id gnl|my_center|LOCUS_00740 7596 6640 gene locus_tag LOCUS_00750 7596 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 8756 7737 gene locus_tag LOCUS_00760 8756 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 10037 8844 gene locus_tag LOCUS_00770 10037 8844 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_00770 11019 10069 gene locus_tag LOCUS_00780 11019 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403097.1 protein_id gnl|my_center|LOCUS_00780 12612 11350 gene locus_tag LOCUS_00790 12612 11350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 >Feature sequence0006 3352 1835 gene locus_tag LOCUS_00800 3352 1835 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113631.1 protein_id gnl|my_center|LOCUS_00800 4536 3499 gene locus_tag LOCUS_00810 4536 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 4947 4756 gene locus_tag LOCUS_00820 4947 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 6331 5093 gene locus_tag LOCUS_00830 6331 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 6517 7074 gene locus_tag LOCUS_00840 6517 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 10495 7103 gene locus_tag LOCUS_00850 10495 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 11156 10533 gene locus_tag LOCUS_00860 11156 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 <12095 11315 gene locus_tag LOCUS_00870 <12095 11315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001682108.1:NADP-dependent oxidoreductase >Feature sequence0007 1323 436 gene locus_tag LOCUS_00880 1323 436 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXB0 protein_id gnl|my_center|LOCUS_00880 1516 4473 gene locus_tag LOCUS_00890 1516 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00890 4415 5182 gene locus_tag LOCUS_00900 4415 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 5200 9069 gene locus_tag LOCUS_00910 gene recB 5200 9069 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ58 protein_id gnl|my_center|LOCUS_00910 10402 11016 gene locus_tag LOCUS_00920 10402 11016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00920 >Feature sequence0008 563 790 gene locus_tag LOCUS_00930 563 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 870 1424 gene locus_tag LOCUS_00940 870 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 1448 1981 gene locus_tag LOCUS_00950 gene mobB 1448 1981 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969528.1 protein_id gnl|my_center|LOCUS_00950 2552 1974 gene locus_tag LOCUS_00960 2552 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 4649 2712 gene locus_tag LOCUS_00970 4649 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 4813 6132 gene locus_tag LOCUS_00980 4813 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 6203 7435 gene locus_tag LOCUS_00990 6203 7435 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530601.1 protein_id gnl|my_center|LOCUS_00990 7534 8367 gene locus_tag LOCUS_01000 7534 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 8971 8375 gene locus_tag LOCUS_01010 8971 8375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 9075 9527 gene locus_tag LOCUS_01020 9075 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404661.1 protein_id gnl|my_center|LOCUS_01020 10082 9579 gene locus_tag LOCUS_01030 10082 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 >Feature sequence0009 2236 947 gene locus_tag LOCUS_01040 2236 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 3720 2275 gene locus_tag LOCUS_01050 3720 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 4432 3725 gene locus_tag LOCUS_01060 4432 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 5179 4637 gene locus_tag LOCUS_01070 5179 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 5538 5221 gene locus_tag LOCUS_01080 5538 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 5607 6485 gene locus_tag LOCUS_01090 5607 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 6666 7529 gene locus_tag LOCUS_01100 6666 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 7580 8413 gene locus_tag LOCUS_01110 7580 8413 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530630.1 protein_id gnl|my_center|LOCUS_01110 >Feature sequence0010 2230 2859 gene locus_tag LOCUS_01120 2230 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 2796 3278 gene locus_tag LOCUS_01130 2796 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 3275 4219 gene locus_tag LOCUS_01140 3275 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 4361 4891 gene locus_tag LOCUS_01150 4361 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 5460 4915 gene locus_tag LOCUS_01160 5460 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 9230 5487 gene locus_tag LOCUS_01170 9230 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 >Feature sequence0011 318 893 gene locus_tag LOCUS_01180 318 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 1368 1003 gene locus_tag LOCUS_01190 1368 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 2254 1418 gene locus_tag LOCUS_01200 2254 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 3627 2332 gene locus_tag LOCUS_01210 3627 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 4491 4736 gene locus_tag LOCUS_01220 4491 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 4733 5986 gene locus_tag LOCUS_01230 4733 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 5976 7136 gene locus_tag LOCUS_01240 5976 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 7133 8887 gene locus_tag LOCUS_01250 7133 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 >Feature sequence0012 2551 3366 gene locus_tag LOCUS_01260 2551 3366 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706409.1 protein_id gnl|my_center|LOCUS_01260 3816 3376 gene locus_tag LOCUS_01270 3816 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 4021 5457 gene locus_tag LOCUS_01280 gene fliC 4021 5457 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV0 protein_id gnl|my_center|LOCUS_01280 5622 6572 gene locus_tag LOCUS_01290 5622 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 7740 6559 gene locus_tag LOCUS_01300 7740 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124147.1 protein_id gnl|my_center|LOCUS_01300 >Feature sequence0013 1228 680 gene locus_tag LOCUS_01310 1228 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 3170 1329 gene locus_tag LOCUS_01320 3170 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 3325 3179 gene locus_tag LOCUS_01330 3325 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 4383 3322 gene locus_tag LOCUS_01340 4383 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 5112 4393 gene locus_tag LOCUS_01350 5112 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 6689 5112 gene locus_tag LOCUS_01360 6689 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 7681 6701 gene locus_tag LOCUS_01370 7681 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 >Feature sequence0014 2092 1151 gene locus_tag LOCUS_01380 2092 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 3168 2089 gene locus_tag LOCUS_01390 3168 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 3134 3433 gene locus_tag LOCUS_01400 3134 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 3512 4072 gene locus_tag LOCUS_01410 3512 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 4518 4108 gene locus_tag LOCUS_01420 4518 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 4940 4515 gene locus_tag LOCUS_01430 4940 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 6289 4940 gene locus_tag LOCUS_01440 6289 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 6472 7833 gene locus_tag LOCUS_01450 6472 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 >Feature sequence0015 2 1180 gene locus_tag LOCUS_01460 2 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 1403 2569 gene locus_tag LOCUS_01470 1403 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 2594 3583 gene locus_tag LOCUS_01480 gene ribF 2594 3583 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1N9 protein_id gnl|my_center|LOCUS_01480 3580 4389 gene locus_tag LOCUS_01490 gene aroE 3580 4389 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI72 protein_id gnl|my_center|LOCUS_01490 4386 4820 gene locus_tag LOCUS_01500 4386 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 4867 5709 gene locus_tag LOCUS_01510 4867 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 6513 5722 gene locus_tag LOCUS_01520 6513 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 6736 7278 gene locus_tag LOCUS_01530 6736 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 7275 8336 gene locus_tag LOCUS_01540 7275 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 >Feature sequence0016 3021 181 gene locus_tag LOCUS_01550 3021 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 4960 3053 gene locus_tag LOCUS_01560 4960 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 5065 8028 gene locus_tag LOCUS_01570 5065 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 >Feature sequence0017 2550 1756 gene locus_tag LOCUS_01580 2550 1756 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_01580 4974 2599 gene locus_tag LOCUS_01590 4974 2599 CDS product copper-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_01590 5405 5067 gene locus_tag LOCUS_01600 5405 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 5728 5402 gene locus_tag LOCUS_01610 5728 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 6590 5862 gene locus_tag LOCUS_01620 6590 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 8286 6694 gene locus_tag LOCUS_01630 8286 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 >Feature sequence0018 1274 1516 gene locus_tag LOCUS_01640 1274 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 1667 3133 gene locus_tag LOCUS_01650 1667 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 4276 3209 gene locus_tag LOCUS_01660 4276 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 4710 4276 gene locus_tag LOCUS_01670 4710 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 4927 5652 gene locus_tag LOCUS_01680 4927 5652 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143308.1 protein_id gnl|my_center|LOCUS_01680 6408 5674 gene locus_tag LOCUS_01690 gene pcs 6408 5674 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE9 protein_id gnl|my_center|LOCUS_01690 >Feature sequence0019 962 1876 gene locus_tag LOCUS_01700 962 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 5740 1904 gene locus_tag LOCUS_01710 5740 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 7052 5931 gene locus_tag LOCUS_01720 7052 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 >Feature sequence0020 1096 329 gene locus_tag LOCUS_01730 1096 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 3186 1162 gene locus_tag LOCUS_01740 3186 1162 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_01740 3923 3396 gene locus_tag LOCUS_01750 3923 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 4659 4132 gene locus_tag LOCUS_01760 4659 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 5738 4683 gene locus_tag LOCUS_01770 5738 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 6332 5814 gene locus_tag LOCUS_01780 6332 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 6515 6901 gene locus_tag LOCUS_01790 6515 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 6951 7973 gene locus_tag LOCUS_01800 6951 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 >Feature sequence0021 1828 1433 gene locus_tag LOCUS_01810 1828 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 2937 1828 gene locus_tag LOCUS_01820 2937 1828 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846352.1 protein_id gnl|my_center|LOCUS_01820 3080 4012 gene locus_tag LOCUS_01830 3080 4012 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_01830 4109 5203 gene locus_tag LOCUS_01840 4109 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 5848 5237 gene locus_tag LOCUS_01850 5848 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 7085 5853 gene locus_tag LOCUS_01860 7085 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 >Feature sequence0022 88 1098 gene locus_tag LOCUS_01870 88 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 1530 1216 gene locus_tag LOCUS_01880 1530 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 1814 1527 gene locus_tag LOCUS_01890 1814 1527 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMD9 protein_id gnl|my_center|LOCUS_01890 2199 2714 gene locus_tag LOCUS_01900 2199 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 2711 3496 gene locus_tag LOCUS_01910 2711 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 4537 3527 gene locus_tag LOCUS_01920 4537 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 4833 4621 gene locus_tag LOCUS_01930 4833 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 4727 5614 gene locus_tag LOCUS_01940 4727 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 5611 6072 gene locus_tag LOCUS_01950 5611 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 7791 6100 gene locus_tag LOCUS_01960 7791 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 >Feature sequence0023 2207 1491 gene locus_tag LOCUS_01970 2207 1491 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_01970 5464 2384 gene locus_tag LOCUS_01980 5464 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 6429 5530 gene locus_tag LOCUS_01990 6429 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 >Feature sequence0024 713 1351 gene locus_tag LOCUS_02000 713 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 1345 1986 gene locus_tag LOCUS_02010 1345 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 2264 2614 gene locus_tag LOCUS_02020 2264 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 2625 2810 gene locus_tag LOCUS_02030 2625 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 2958 3428 gene locus_tag LOCUS_02040 2958 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02040 3343 4641 gene locus_tag LOCUS_02050 gene hutU 3343 4641 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81AC7 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02050 4896 4654 gene locus_tag LOCUS_02060 4896 4654 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BB7 protein_id gnl|my_center|LOCUS_02060 5334 5924 gene locus_tag LOCUS_02070 gene rpoE 5334 5924 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_02070 6181 6711 gene locus_tag LOCUS_02080 6181 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 6728 7840 gene locus_tag LOCUS_02090 6728 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 >Feature sequence0025 1719 3458 gene locus_tag LOCUS_02100 1719 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 5623 3548 gene locus_tag LOCUS_02110 5623 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 6615 5728 gene locus_tag LOCUS_02120 gene dapA 6615 5728 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RH76 protein_id gnl|my_center|LOCUS_02120 6996 6709 gene locus_tag LOCUS_02130 6996 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence0026 <1 1364 gene locus_tag LOCUS_02140 <1 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064383.1:type I secretion C-terminal target domain-containing protein 2360 1494 gene locus_tag LOCUS_02150 2360 1494 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_02150 2690 2385 gene locus_tag LOCUS_02160 2690 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 2820 3578 gene locus_tag LOCUS_02170 gene map 2820 3578 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX4 protein_id gnl|my_center|LOCUS_02170 5154 3616 gene locus_tag LOCUS_02180 5154 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 6467 5310 gene locus_tag LOCUS_02190 6467 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 7596 6538 gene locus_tag LOCUS_02200 7596 6538 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_02200 >Feature sequence0027 1564 1782 gene locus_tag LOCUS_02210 1564 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 2406 3641 gene locus_tag LOCUS_02220 2406 3641 CDS product IS1634 family transposase ISMac6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021645.1 protein_id gnl|my_center|LOCUS_02220 4862 4122 gene locus_tag LOCUS_02230 4862 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 6400 5123 gene locus_tag LOCUS_02240 6400 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 <7590 6525 gene locus_tag LOCUS_02250 <7590 6525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978340.1:phosphoglycerate mutase >Feature sequence0028 1290 103 gene locus_tag LOCUS_02260 1290 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 1638 2057 gene locus_tag LOCUS_02270 1638 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 2123 3517 gene locus_tag LOCUS_02280 2123 3517 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668604.1 protein_id gnl|my_center|LOCUS_02280 3520 4077 gene locus_tag LOCUS_02290 3520 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 4077 4889 gene locus_tag LOCUS_02300 4077 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 4953 5399 gene locus_tag LOCUS_02310 4953 5399 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_02310 6158 5484 gene locus_tag LOCUS_02320 6158 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 >Feature sequence0029 155 472 gene locus_tag LOCUS_02330 155 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 678 2294 gene locus_tag LOCUS_02340 678 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 3236 2397 gene locus_tag LOCUS_02350 3236 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 3205 3399 gene locus_tag LOCUS_02360 3205 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 3494 4111 gene locus_tag LOCUS_02370 3494 4111 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 protein_id gnl|my_center|LOCUS_02370 4770 4255 gene locus_tag LOCUS_02380 4770 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 5972 4800 gene locus_tag LOCUS_02390 5972 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 6273 6743 gene locus_tag LOCUS_02400 6273 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 7179 6955 gene locus_tag LOCUS_02410 7179 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 >Feature sequence0030 1134 292 gene locus_tag LOCUS_02420 1134 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 1885 1121 gene locus_tag LOCUS_02430 1885 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 1993 3327 gene locus_tag LOCUS_02440 1993 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 3547 3777 gene locus_tag LOCUS_02450 3547 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 5039 4047 gene locus_tag LOCUS_02460 5039 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 5516 6727 gene locus_tag LOCUS_02470 5516 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 >Feature sequence0031 895 2046 gene locus_tag LOCUS_02480 895 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 4710 2065 gene locus_tag LOCUS_02490 4710 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 4852 5361 gene locus_tag LOCUS_02500 4852 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 5528 6442 gene locus_tag LOCUS_02510 5528 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 6403 7170 gene locus_tag LOCUS_02520 6403 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 >Feature sequence0032 1889 1035 gene locus_tag LOCUS_02530 1889 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 2497 1880 gene locus_tag LOCUS_02540 2497 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 3813 2497 gene locus_tag LOCUS_02550 3813 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 4211 5119 gene locus_tag LOCUS_02560 4211 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 <7133 5136 gene locus_tag LOCUS_02570 <7133 5136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000730383.1:bacillolysin >Feature sequence0033 1506 703 gene locus_tag LOCUS_02580 1506 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 1811 2530 gene locus_tag LOCUS_02590 1811 2530 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262707.1 protein_id gnl|my_center|LOCUS_02590 3194 2550 gene locus_tag LOCUS_02600 3194 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 3308 5830 gene locus_tag LOCUS_02610 3308 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 >Feature sequence0034 985 1377 gene locus_tag LOCUS_02620 985 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 1374 2213 gene locus_tag LOCUS_02630 1374 2213 CDS product putative dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704240.1 protein_id gnl|my_center|LOCUS_02630 2226 3602 gene locus_tag LOCUS_02640 2226 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 3680 3976 gene locus_tag LOCUS_02650 3680 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 4078 6063 gene locus_tag LOCUS_02660 4078 6063 CDS product oligopeptide transporter, OPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114310.1 protein_id gnl|my_center|LOCUS_02660 6641 6973 gene locus_tag LOCUS_02670 6641 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 >Feature sequence0035 <1 1687 gene locus_tag LOCUS_02680 <1 1687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H75:transcription-repair-coupling factor 1690 2205 gene locus_tag LOCUS_02690 1690 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 3864 2215 gene locus_tag LOCUS_02700 3864 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 4579 4037 gene locus_tag LOCUS_02710 4579 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 5534 5067 gene locus_tag LOCUS_02720 5534 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 7011 5662 gene locus_tag LOCUS_02730 7011 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 >Feature sequence0036 808 143 gene locus_tag LOCUS_02740 808 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 851 1462 gene locus_tag LOCUS_02750 851 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 1459 2220 gene locus_tag LOCUS_02760 1459 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 2217 3851 gene locus_tag LOCUS_02770 2217 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 <6995 4240 gene locus_tag LOCUS_02780 <6995 4240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887549.1:hybrid sensor histidine kinase/response regulator >Feature sequence0037 834 298 gene locus_tag LOCUS_02790 gene rplF 834 298 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5W0 protein_id gnl|my_center|LOCUS_02790 1247 858 gene locus_tag LOCUS_02800 gene rpsH 1247 858 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q034Z7 protein_id gnl|my_center|LOCUS_02800 1490 1305 gene locus_tag LOCUS_02810 gene rpsZ 1490 1305 CDS product 30S ribosomal protein S14 type Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZAE6 protein_id gnl|my_center|LOCUS_02810 2070 1528 gene locus_tag LOCUS_02820 gene rplE 2070 1528 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH2 protein_id gnl|my_center|LOCUS_02820 2425 2108 gene locus_tag LOCUS_02830 gene rplX 2425 2108 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CG9 protein_id gnl|my_center|LOCUS_02830 2804 2436 gene locus_tag LOCUS_02840 gene rplN 2804 2436 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE28 protein_id gnl|my_center|LOCUS_02840 3116 2862 gene locus_tag LOCUS_02850 3116 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 3625 3299 gene locus_tag LOCUS_02860 3625 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 4041 3625 gene locus_tag LOCUS_02870 gene rplP 4041 3625 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z5 protein_id gnl|my_center|LOCUS_02870 4729 4082 gene locus_tag LOCUS_02880 gene rpsC 4729 4082 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z4 protein_id gnl|my_center|LOCUS_02880 5082 4729 gene locus_tag LOCUS_02890 gene rplV 5082 4729 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T08 protein_id gnl|my_center|LOCUS_02890 5377 5099 gene locus_tag LOCUS_02900 gene rpsS 5377 5099 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z2 protein_id gnl|my_center|LOCUS_02900 6220 5399 gene locus_tag LOCUS_02910 gene rplB 6220 5399 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH7 protein_id gnl|my_center|LOCUS_02910 6517 6230 gene locus_tag LOCUS_02920 gene rplW 6517 6230 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence0038 2190 1450 gene locus_tag LOCUS_02930 2190 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 3678 2197 gene locus_tag LOCUS_02940 3678 2197 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258272.1 protein_id gnl|my_center|LOCUS_02940 4394 3675 gene locus_tag LOCUS_02950 4394 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 5515 4391 gene locus_tag LOCUS_02960 5515 4391 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_02960 6615 5512 gene locus_tag LOCUS_02970 6615 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 >Feature sequence0039 2315 273 gene locus_tag LOCUS_02980 2315 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 2674 4197 gene locus_tag LOCUS_02990 2674 4197 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 protein_id gnl|my_center|LOCUS_02990 4258 4605 gene locus_tag LOCUS_03000 4258 4605 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862103.1 protein_id gnl|my_center|LOCUS_03000 4640 6127 gene locus_tag LOCUS_03010 4640 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 6309 6088 gene locus_tag LOCUS_03020 6309 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 >Feature sequence0040 1669 887 gene locus_tag LOCUS_03030 1669 887 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977059.1 protein_id gnl|my_center|LOCUS_03030 1728 2870 gene locus_tag LOCUS_03040 1728 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 3779 2874 gene locus_tag LOCUS_03050 3779 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 3921 4526 gene locus_tag LOCUS_03060 3921 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 5819 4545 gene locus_tag LOCUS_03070 5819 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 6459 5842 gene locus_tag LOCUS_03080 6459 5842 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704971.1 protein_id gnl|my_center|LOCUS_03080 >Feature sequence0041 2 1600 gene locus_tag LOCUS_03090 2 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 1776 4253 gene locus_tag LOCUS_03100 1776 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 4258 5520 gene locus_tag LOCUS_03110 4258 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence0042 1019 51 gene locus_tag LOCUS_03120 1019 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 1273 2190 gene locus_tag LOCUS_03130 1273 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 2191 3132 gene locus_tag LOCUS_03140 2191 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 3155 3916 gene locus_tag LOCUS_03150 3155 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 3926 5233 gene locus_tag LOCUS_03160 3926 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 5258 6643 gene locus_tag LOCUS_03170 5258 6643 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226762.1 protein_id gnl|my_center|LOCUS_03170 >Feature sequence0043 698 1675 gene locus_tag LOCUS_03180 698 1675 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459299.1 protein_id gnl|my_center|LOCUS_03180 1683 2210 gene locus_tag LOCUS_03190 1683 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 2207 3421 gene locus_tag LOCUS_03200 gene argJ 2207 3421 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN4 protein_id gnl|my_center|LOCUS_03200 3429 4298 gene locus_tag LOCUS_03210 gene argB 3429 4298 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GU4 protein_id gnl|my_center|LOCUS_03210 4791 5327 gene locus_tag LOCUS_03220 4791 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 5327 5863 gene locus_tag LOCUS_03230 5327 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 <6709 6150 gene locus_tag LOCUS_03240 <6709 6150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393062.1:twitching motility protein PilT >Feature sequence0044 1586 957 gene locus_tag LOCUS_03250 1586 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03250 1806 2984 gene locus_tag LOCUS_03260 gene hisS 1806 2984 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWM3 protein_id gnl|my_center|LOCUS_03260 4792 3002 gene locus_tag LOCUS_03270 4792 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 4898 5935 gene locus_tag LOCUS_03280 4898 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_03280 6664 5948 gene locus_tag LOCUS_03290 6664 5948 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF0 protein_id gnl|my_center|LOCUS_03290 >Feature sequence0045 400 939 gene locus_tag LOCUS_03300 400 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 3144 946 gene locus_tag LOCUS_03310 3144 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 3887 3141 gene locus_tag LOCUS_03320 3887 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 4456 3977 gene locus_tag LOCUS_03330 4456 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 4719 5852 gene locus_tag LOCUS_03340 4719 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086149.1 protein_id gnl|my_center|LOCUS_03340 5959 6144 gene locus_tag LOCUS_03350 5959 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 >Feature sequence0046 2023 524 gene locus_tag LOCUS_03360 2023 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 2113 3477 gene locus_tag LOCUS_03370 2113 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 4214 5920 gene locus_tag LOCUS_03380 4214 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence0047 1533 985 gene locus_tag LOCUS_03390 gene rluE 1533 985 CDS product ribosomal large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX48 protein_id gnl|my_center|LOCUS_03390 1672 2247 gene locus_tag LOCUS_03400 1672 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 3061 2270 gene locus_tag LOCUS_03410 3061 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181479.1 protein_id gnl|my_center|LOCUS_03410 3168 5375 gene locus_tag LOCUS_03420 3168 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 >Feature sequence0048 <1 1001 gene locus_tag LOCUS_03430 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477786.1:trypsin 2838 1117 gene locus_tag LOCUS_03440 2838 1117 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141198.1 protein_id gnl|my_center|LOCUS_03440 4479 2875 gene locus_tag LOCUS_03450 4479 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880130.1 protein_id gnl|my_center|LOCUS_03450 <6436 4627 gene locus_tag LOCUS_03460 <6436 4627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010906405.1:2-hydroxyglutaryl-CoA dehydratase >Feature sequence0049 2246 3091 gene locus_tag LOCUS_03470 2246 3091 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419748.1 protein_id gnl|my_center|LOCUS_03470 3118 3843 gene locus_tag LOCUS_03480 3118 3843 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227842.1 protein_id gnl|my_center|LOCUS_03480 4003 4200 gene locus_tag LOCUS_03490 4003 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 4267 6366 gene locus_tag LOCUS_03500 4267 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 >Feature sequence0050 2425 1871 gene locus_tag LOCUS_03510 2425 1871 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437759.1 protein_id gnl|my_center|LOCUS_03510 2555 4075 gene locus_tag LOCUS_03520 2555 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 4819 4097 gene locus_tag LOCUS_03530 4819 4097 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_03530 5447 4944 gene locus_tag LOCUS_03540 5447 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 >Feature sequence0051 2148 1075 gene locus_tag LOCUS_03550 2148 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 2594 2145 gene locus_tag LOCUS_03560 2594 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 4183 2591 gene locus_tag LOCUS_03570 4183 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 4414 5190 gene locus_tag LOCUS_03580 4414 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 >Feature sequence0052 47 1042 gene locus_tag LOCUS_03590 47 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 1080 1559 gene locus_tag LOCUS_03600 1080 1559 CDS product riboflavin-specific deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477591.1 protein_id gnl|my_center|LOCUS_03600 1584 2069 gene locus_tag LOCUS_03610 1584 2069 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B9 protein_id gnl|my_center|LOCUS_03610 3267 2086 gene locus_tag LOCUS_03620 3267 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 3439 5529 gene locus_tag LOCUS_03630 3439 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 >Feature sequence0053 921 118 gene locus_tag LOCUS_03640 921 118 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390794.1 protein_id gnl|my_center|LOCUS_03640 1161 2516 gene locus_tag LOCUS_03650 1161 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 4665 2497 gene locus_tag LOCUS_03660 4665 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 4906 6147 gene locus_tag LOCUS_03670 gene tnpA 4906 6147 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071025.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence0054 219 2171 gene locus_tag LOCUS_03680 219 2171 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_03680 2492 3754 gene locus_tag LOCUS_03690 2492 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 4216 3860 gene locus_tag LOCUS_03700 4216 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 4608 4339 gene locus_tag LOCUS_03710 4608 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 <6301 5217 gene locus_tag LOCUS_03720 <6301 5217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:signal transduction histidine kinase >Feature sequence0055 958 230 gene locus_tag LOCUS_03730 958 230 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720577.1 protein_id gnl|my_center|LOCUS_03730 1074 2462 gene locus_tag LOCUS_03740 1074 2462 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_03740 2495 3886 gene locus_tag LOCUS_03750 2495 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 4604 4065 gene locus_tag LOCUS_03760 4604 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence0056 1782 451 gene locus_tag LOCUS_03770 1782 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 3109 1964 gene locus_tag LOCUS_03780 3109 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 3659 3195 gene locus_tag LOCUS_03790 3659 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 5513 3753 gene locus_tag LOCUS_03800 5513 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence0057 2099 1362 gene locus_tag LOCUS_03810 2099 1362 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_03810 3628 2165 gene locus_tag LOCUS_03820 3628 2165 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_03820 3735 4523 gene locus_tag LOCUS_03830 3735 4523 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQS4 protein_id gnl|my_center|LOCUS_03830 5568 4549 gene locus_tag LOCUS_03840 5568 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 >Feature sequence0058 1396 164 gene locus_tag LOCUS_03850 1396 164 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140489.1 protein_id gnl|my_center|LOCUS_03850 1613 4471 gene locus_tag LOCUS_03860 1613 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 5421 4483 gene locus_tag LOCUS_03870 gene gumP 5421 4483 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368571.1 protein_id gnl|my_center|LOCUS_03870 >Feature sequence0059 1492 3393 gene locus_tag LOCUS_03880 gene uup 1492 3393 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 protein_id gnl|my_center|LOCUS_03880 3408 4631 gene locus_tag LOCUS_03890 3408 4631 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_03890 5057 4632 gene locus_tag LOCUS_03900 5057 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03900 6111 5059 gene locus_tag LOCUS_03910 6111 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03910 >Feature sequence0060 2189 321 gene locus_tag LOCUS_03920 2189 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 2288 3034 gene locus_tag LOCUS_03930 2288 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 4863 3049 gene locus_tag LOCUS_03940 4863 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 5087 4752 gene locus_tag LOCUS_03950 5087 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 5980 5090 gene locus_tag LOCUS_03960 5980 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_03960 >Feature sequence0061 <1 1627 gene locus_tag LOCUS_03970 <1 1627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267570.1:ABC transporter permease 1624 1881 gene locus_tag LOCUS_03980 1624 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 1875 3653 gene locus_tag LOCUS_03990 1875 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 3643 5535 gene locus_tag LOCUS_04000 3643 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 <6112 5587 gene locus_tag LOCUS_04010 <6112 5587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000395153.1:sodium:proton antiporter >Feature sequence0062 3321 4586 gene locus_tag LOCUS_04020 3321 4586 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_04020 4586 5083 gene locus_tag LOCUS_04030 4586 5083 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE43 protein_id gnl|my_center|LOCUS_04030 5108 5884 gene locus_tag LOCUS_04040 5108 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_04040 >Feature sequence0063 958 1632 gene locus_tag LOCUS_04050 958 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 1817 2989 gene locus_tag LOCUS_04060 1817 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 2989 4395 gene locus_tag LOCUS_04070 2989 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 4392 5129 gene locus_tag LOCUS_04080 4392 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942024.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence0064 3742 227 gene locus_tag LOCUS_04090 3742 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence0065 252 689 gene locus_tag LOCUS_04100 252 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 686 1483 gene locus_tag LOCUS_04110 gene truC 686 1483 CDS product tRNA pseudouridine synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943781.1 protein_id gnl|my_center|LOCUS_04110 1483 1920 gene locus_tag LOCUS_04120 1483 1920 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCF8 protein_id gnl|my_center|LOCUS_04120 2151 2948 gene locus_tag LOCUS_04130 2151 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 <6005 2955 gene locus_tag LOCUS_04140 <6005 2955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123155.1:serine/threonine protein kinase >Feature sequence0066 <1 927 gene locus_tag LOCUS_04150 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IY57:DNA gyrase subunit B 1023 2015 gene locus_tag LOCUS_04160 gene fabH2 1023 2015 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_04160 2087 3043 gene locus_tag LOCUS_04170 2087 3043 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230565.1 protein_id gnl|my_center|LOCUS_04170 3040 4203 gene locus_tag LOCUS_04180 3040 4203 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_04180 4683 4225 gene locus_tag LOCUS_04190 4683 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 <5978 4680 gene locus_tag LOCUS_04200 <5978 4680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704468.1:glycosidase >Feature sequence0067 <1 511 gene locus_tag LOCUS_04210 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705254.1:acriflavine resistance protein B 508 1725 gene locus_tag LOCUS_04220 508 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 1899 2786 gene locus_tag LOCUS_04230 1899 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 5604 2842 gene locus_tag LOCUS_04240 gene ppc 5604 2842 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV3 protein_id gnl|my_center|LOCUS_04240 >Feature sequence0068 1781 624 gene locus_tag LOCUS_04250 1781 624 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_04250 2020 4695 gene locus_tag LOCUS_04260 gene polA 2020 4695 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00582 protein_id gnl|my_center|LOCUS_04260 4756 5427 gene locus_tag LOCUS_04270 4756 5427 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_04270 >Feature sequence0069 173 862 gene locus_tag LOCUS_04280 173 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 887 4042 gene locus_tag LOCUS_04290 887 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 4281 5636 gene locus_tag LOCUS_04300 4281 5636 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227167.1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence0070 <1 529 gene locus_tag LOCUS_04310 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_720343.1:type II DNA modification methyltransferase 2496 550 gene locus_tag LOCUS_04320 gene acsA 2496 550 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3L1 protein_id gnl|my_center|LOCUS_04320 2659 3597 gene locus_tag LOCUS_04330 2659 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 4633 3629 gene locus_tag LOCUS_04340 4633 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982215.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence0071 3975 1753 gene locus_tag LOCUS_04350 3975 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 5142 4024 gene locus_tag LOCUS_04360 5142 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 5232 5570 gene locus_tag LOCUS_04370 5232 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence0072 2148 4196 gene locus_tag LOCUS_04380 2148 4196 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_04380 4233 5282 gene locus_tag LOCUS_04390 4233 5282 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941541.1 protein_id gnl|my_center|LOCUS_04390 5672 5289 gene locus_tag LOCUS_04400 5672 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence0073 3 212 gene locus_tag LOCUS_04410 3 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 2036 216 gene locus_tag LOCUS_04420 2036 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 5634 2077 gene locus_tag LOCUS_04430 5634 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence0074 4806 2836 gene locus_tag LOCUS_04440 4806 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence0075 497 2149 gene locus_tag LOCUS_04450 497 2149 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_04450 2188 2799 gene locus_tag LOCUS_04460 2188 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 3185 2784 gene locus_tag LOCUS_04470 3185 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 4419 3187 gene locus_tag LOCUS_04480 4419 3187 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142387.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence0076 215 619 gene locus_tag LOCUS_04490 215 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 1000 695 gene locus_tag LOCUS_04500 1000 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 1234 1500 gene locus_tag LOCUS_04510 1234 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 2076 1516 gene locus_tag LOCUS_04520 2076 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 2340 3359 gene locus_tag LOCUS_04530 2340 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 3573 5735 gene locus_tag LOCUS_04540 3573 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence0077 917 2161 gene locus_tag LOCUS_04550 917 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_04550 2244 2669 gene locus_tag LOCUS_04560 2244 2669 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_04560 2702 4045 gene locus_tag LOCUS_04570 2702 4045 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_04570 4496 4071 gene locus_tag LOCUS_04580 4496 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 4410 4772 gene locus_tag LOCUS_04590 4410 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 5290 5090 gene locus_tag LOCUS_04600 5290 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence0078 1793 444 gene locus_tag LOCUS_04610 gene mnmE 1793 444 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P340 protein_id gnl|my_center|LOCUS_04610 2686 1799 gene locus_tag LOCUS_04620 2686 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 4414 2723 gene locus_tag LOCUS_04630 gene yidC 4414 2723 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Q2 protein_id gnl|my_center|LOCUS_04630 4836 4417 gene locus_tag LOCUS_04640 4836 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 5258 4833 gene locus_tag LOCUS_04650 5258 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 5556 5401 gene locus_tag LOCUS_04660 gene rpmH 5556 5401 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT3 protein_id gnl|my_center|LOCUS_04660 >Feature sequence0079 1854 142 gene locus_tag LOCUS_04670 1854 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 3878 2109 gene locus_tag LOCUS_04680 3878 2109 CDS product 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391777.1 protein_id gnl|my_center|LOCUS_04680 4002 5051 gene locus_tag LOCUS_04690 4002 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 >Feature sequence0080 424 1158 gene locus_tag LOCUS_04700 424 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 1155 2840 gene locus_tag LOCUS_04710 1155 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 2837 3208 gene locus_tag LOCUS_04720 2837 3208 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490570.1 protein_id gnl|my_center|LOCUS_04720 4654 3218 gene locus_tag LOCUS_04730 4654 3218 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 protein_id gnl|my_center|LOCUS_04730 5277 4651 gene locus_tag LOCUS_04740 5277 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence0081 1976 3406 gene locus_tag LOCUS_04750 1976 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 3465 4187 gene locus_tag LOCUS_04760 3465 4187 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259013.1 protein_id gnl|my_center|LOCUS_04760 5042 4197 gene locus_tag LOCUS_04770 5042 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 >Feature sequence0082 3909 2002 gene locus_tag LOCUS_04780 3909 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 4966 4262 gene locus_tag LOCUS_04790 4966 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 >Feature sequence0083 1996 800 gene locus_tag LOCUS_04800 1996 800 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123111.1 protein_id gnl|my_center|LOCUS_04800 3519 1993 gene locus_tag LOCUS_04810 gene ibeB 3519 1993 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815451.1 protein_id gnl|my_center|LOCUS_04810 4112 3516 gene locus_tag LOCUS_04820 4112 3516 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887380.1 protein_id gnl|my_center|LOCUS_04820 5083 4253 gene locus_tag LOCUS_04830 5083 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703699.1 protein_id gnl|my_center|LOCUS_04830 >Feature sequence0084 759 1586 gene locus_tag LOCUS_04840 759 1586 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225973.1 protein_id gnl|my_center|LOCUS_04840 1583 2323 gene locus_tag LOCUS_04850 1583 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 2320 3135 gene locus_tag LOCUS_04860 2320 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 4388 3162 gene locus_tag LOCUS_04870 gene kbl 4388 3162 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L232 protein_id gnl|my_center|LOCUS_04870 >Feature sequence0085 1026 571 gene locus_tag LOCUS_04880 1026 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 985 3729 gene locus_tag LOCUS_04890 985 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 3911 4834 gene locus_tag LOCUS_04900 3911 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 >Feature sequence0086 1047 112 gene locus_tag LOCUS_04910 1047 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 1601 1044 gene locus_tag LOCUS_04920 1601 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 1857 1642 gene locus_tag LOCUS_04930 1857 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 1992 2216 gene locus_tag LOCUS_04940 1992 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 3056 2241 gene locus_tag LOCUS_04950 3056 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 >Feature sequence0087 2379 451 gene locus_tag LOCUS_04960 2379 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 4337 2430 gene locus_tag LOCUS_04970 4337 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 5190 4339 gene locus_tag LOCUS_04980 5190 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121086.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence0088 549 2867 gene locus_tag LOCUS_04990 549 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 4391 2856 gene locus_tag LOCUS_05000 4391 2856 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887940.1 protein_id gnl|my_center|LOCUS_05000 4586 5404 gene locus_tag LOCUS_05010 4586 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 >Feature sequence0089 465 214 gene locus_tag LOCUS_05020 465 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 478 735 gene locus_tag LOCUS_05030 478 735 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_05030 872 2500 gene locus_tag LOCUS_05040 872 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 2528 2827 gene locus_tag LOCUS_05050 2528 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 2828 4078 gene locus_tag LOCUS_05060 2828 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 protein_id gnl|my_center|LOCUS_05060 4280 4903 gene locus_tag LOCUS_05070 4280 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 >Feature sequence0090 1196 2059 gene locus_tag LOCUS_05080 1196 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 2104 2655 gene locus_tag LOCUS_05090 2104 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114630.1 protein_id gnl|my_center|LOCUS_05090 3328 2696 gene locus_tag LOCUS_05100 3328 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 4808 3399 gene locus_tag LOCUS_05110 4808 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 5440 4850 gene locus_tag LOCUS_05120 5440 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence0091 3864 4877 gene locus_tag LOCUS_05130 3864 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence0092 3834 3196 gene locus_tag LOCUS_05140 3834 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 5080 3932 gene locus_tag LOCUS_05150 5080 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 >Feature sequence0093 25 924 gene locus_tag LOCUS_05160 25 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 921 1700 gene locus_tag LOCUS_05170 921 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 1697 2470 gene locus_tag LOCUS_05180 gene wbqC 1697 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073072.1 protein_id gnl|my_center|LOCUS_05180 3305 2424 gene locus_tag LOCUS_05190 3305 2424 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887497.1 protein_id gnl|my_center|LOCUS_05190 4447 3302 gene locus_tag LOCUS_05200 4447 3302 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940160.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence0094 1131 1799 gene locus_tag LOCUS_05210 1131 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 3842 1824 gene locus_tag LOCUS_05220 gene uvrB 3842 1824 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747K3 protein_id gnl|my_center|LOCUS_05220 >Feature sequence0095 1856 1365 gene locus_tag LOCUS_05230 1856 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 2422 1898 gene locus_tag LOCUS_05240 2422 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 5032 2453 gene locus_tag LOCUS_05250 5032 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 >Feature sequence0096 1295 1972 gene locus_tag LOCUS_05260 1295 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 2140 1976 gene locus_tag LOCUS_05270 2140 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 3400 2327 gene locus_tag LOCUS_05280 3400 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05280 3622 4566 gene locus_tag LOCUS_05290 3622 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence0097 2257 1559 gene locus_tag LOCUS_05300 2257 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3195 2254 gene locus_tag LOCUS_05310 3195 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 4826 3195 gene locus_tag LOCUS_05320 4826 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 >Feature sequence0098 1575 496 gene locus_tag LOCUS_05330 1575 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 2792 1572 gene locus_tag LOCUS_05340 2792 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 4472 2835 gene locus_tag LOCUS_05350 4472 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 >Feature sequence0099 <1 831 gene locus_tag LOCUS_05360 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224400.1:delta fatty acid desaturase 1917 841 gene locus_tag LOCUS_05370 gene ypgB 1917 841 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906016.1 protein_id gnl|my_center|LOCUS_05370 2008 2214 gene locus_tag LOCUS_05380 2008 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 2233 2781 gene locus_tag LOCUS_05390 2233 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 4005 2818 gene locus_tag LOCUS_05400 4005 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 4625 4002 gene locus_tag LOCUS_05410 4625 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 5275 4721 gene locus_tag LOCUS_05420 5275 4721 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_05420 >Feature sequence0100 3 623 gene locus_tag LOCUS_05430 3 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 1160 711 gene locus_tag LOCUS_05440 1160 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 2482 1157 gene locus_tag LOCUS_05450 2482 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 4265 2703 gene locus_tag LOCUS_05460 4265 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 >Feature sequence0101 9 191 gene locus_tag LOCUS_05470 9 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 193 819 gene locus_tag LOCUS_05480 gene motB2 193 819 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263084.1 protein_id gnl|my_center|LOCUS_05480 819 2567 gene locus_tag LOCUS_05490 819 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 2564 4621 gene locus_tag LOCUS_05500 2564 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence0102 3 536 gene locus_tag LOCUS_05510 3 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 1508 543 gene locus_tag LOCUS_05520 1508 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 1389 1655 gene locus_tag LOCUS_05530 1389 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 3472 1724 gene locus_tag LOCUS_05540 3472 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 3779 4420 gene locus_tag LOCUS_05550 3779 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence0103 1057 230 gene locus_tag LOCUS_05560 1057 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 2600 1098 gene locus_tag LOCUS_05570 2600 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 <5186 2834 gene locus_tag LOCUS_05580 <5186 2834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036244.1:penicillin-binding protein 1C >Feature sequence0104 1927 950 gene locus_tag LOCUS_05590 1927 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942340.1 protein_id gnl|my_center|LOCUS_05590 2895 1924 gene locus_tag LOCUS_05600 2895 1924 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_05600 3566 2991 gene locus_tag LOCUS_05610 3566 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 >Feature sequence0105 2135 1296 gene locus_tag LOCUS_05620 2135 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 3609 2125 gene locus_tag LOCUS_05630 3609 2125 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence0106 1 1050 gene locus_tag LOCUS_05640 1 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1031 1951 gene locus_tag LOCUS_05650 gene pstC 1031 1951 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_05650 1948 2856 gene locus_tag LOCUS_05660 gene pstA 1948 2856 CDS product phosphate ABC transporter, permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020933.1 protein_id gnl|my_center|LOCUS_05660 2850 3644 gene locus_tag LOCUS_05670 gene pstB 2850 3644 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180A5 protein_id gnl|my_center|LOCUS_05670 3637 4434 gene locus_tag LOCUS_05680 3637 4434 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence0107 1536 2540 gene locus_tag LOCUS_05690 1536 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 2667 3260 gene locus_tag LOCUS_05700 gene algU 2667 3260 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_05700 3257 4252 gene locus_tag LOCUS_05710 3257 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 >Feature sequence0108 2 667 gene locus_tag LOCUS_05720 2 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 1002 2534 gene locus_tag LOCUS_05730 1002 2534 CDS product reverse transcriptase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_05730 3086 2550 gene locus_tag LOCUS_05740 3086 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 3675 3130 gene locus_tag LOCUS_05750 3675 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 4583 3672 gene locus_tag LOCUS_05760 4583 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence0109 3 203 gene locus_tag LOCUS_05770 3 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 2352 238 gene locus_tag LOCUS_05780 2352 238 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391643.1 protein_id gnl|my_center|LOCUS_05780 4019 2439 gene locus_tag LOCUS_05790 4019 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 4734 4372 gene locus_tag LOCUS_05800 4734 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 >Feature sequence0110 <1 1319 gene locus_tag LOCUS_05810 <1 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256390.1:protein kinase 1380 3590 gene locus_tag LOCUS_05820 1380 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence0111 >Feature sequence0112 876 1658 gene locus_tag LOCUS_05830 gene fabG-2 876 1658 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_05830 1879 2736 gene locus_tag LOCUS_05840 1879 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869902.1 protein_id gnl|my_center|LOCUS_05840 2727 4169 gene locus_tag LOCUS_05850 2727 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence0113 1011 553 gene locus_tag LOCUS_05860 1011 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 1521 2915 gene locus_tag LOCUS_05870 1521 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 3392 4396 gene locus_tag LOCUS_05880 3392 4396 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405050.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence0114 471 286 gene locus_tag LOCUS_05890 471 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 1841 471 gene locus_tag LOCUS_05900 gene ccoG 1841 471 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074321.1 protein_id gnl|my_center|LOCUS_05900 2420 3937 gene locus_tag LOCUS_05910 2420 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 <4946 4003 gene locus_tag LOCUS_05920 <4946 4003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228453.1:iron-sulfur-binding protein >Feature sequence0115 12 1640 gene locus_tag LOCUS_05930 12 1640 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026866.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence0116 281 1459 gene locus_tag LOCUS_05940 281 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 1485 1955 gene locus_tag LOCUS_05950 1485 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120329.1 protein_id gnl|my_center|LOCUS_05950 3462 1960 gene locus_tag LOCUS_05960 gene hutH 3462 1960 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCB3 protein_id gnl|my_center|LOCUS_05960 <4903 3459 gene locus_tag LOCUS_05970 <4903 3459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NCB3:histidine ammonia-lyase >Feature sequence0117 114 602 gene locus_tag LOCUS_05980 114 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 1852 620 gene locus_tag LOCUS_05990 1852 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 2062 2283 gene locus_tag LOCUS_06000 2062 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2325 3188 gene locus_tag LOCUS_06010 2325 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3190 4578 gene locus_tag LOCUS_06020 3190 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence0118 2633 1371 gene locus_tag LOCUS_06030 gene sbcD 2633 1371 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWB9 protein_id gnl|my_center|LOCUS_06030 2767 3576 gene locus_tag LOCUS_06040 2767 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence0119 1521 2828 gene locus_tag LOCUS_06050 1521 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 4323 2842 gene locus_tag LOCUS_06060 4323 2842 CDS product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230822.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence0120 174 815 gene locus_tag LOCUS_06070 174 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06070 1044 1253 gene locus_tag LOCUS_06080 gene rpsR 1044 1253 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBX4 protein_id gnl|my_center|LOCUS_06080 1990 1370 gene locus_tag LOCUS_06090 1990 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 2124 3515 gene locus_tag LOCUS_06100 2124 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence0121 <1 1327 gene locus_tag LOCUS_06110 <1 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940637.1:PAS domain-containing sensor histidine kinase 2475 1402 gene locus_tag LOCUS_06120 2475 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 2808 2623 gene locus_tag LOCUS_06130 2808 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 <4850 2771 gene locus_tag LOCUS_06140 <4850 2771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919283.1:copper-translocating P-type ATPase >Feature sequence0122 1473 67 gene locus_tag LOCUS_06150 1473 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 1563 2057 gene locus_tag LOCUS_06160 1563 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 3317 2097 gene locus_tag LOCUS_06170 3317 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 3572 3399 gene locus_tag LOCUS_06180 3572 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 4255 3980 gene locus_tag LOCUS_06190 4255 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence0123 502 2637 gene locus_tag LOCUS_06200 502 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 3559 2639 gene locus_tag LOCUS_06210 3559 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4104 3715 gene locus_tag LOCUS_06220 gene atpC 4104 3715 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05434 protein_id gnl|my_center|LOCUS_06220 <4816 4108 gene locus_tag LOCUS_06230 <4816 4108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GY0:ATP synthase subunit beta >Feature sequence0124 611 87 gene locus_tag LOCUS_06240 611 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 908 1177 gene locus_tag LOCUS_06250 908 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 1177 1623 gene locus_tag LOCUS_06260 1177 1623 CDS product molybdopterin converting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257742.1 protein_id gnl|my_center|LOCUS_06260 1620 2366 gene locus_tag LOCUS_06270 gene trmB 1620 2366 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67504 protein_id gnl|my_center|LOCUS_06270 >Feature sequence0125 125 958 gene locus_tag LOCUS_06280 125 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 1474 962 gene locus_tag LOCUS_06290 1474 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 2016 1471 gene locus_tag LOCUS_06300 2016 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 4560 2047 gene locus_tag LOCUS_06310 4560 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence0126 4205 3126 gene locus_tag LOCUS_06320 4205 3126 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698132.1 protein_id gnl|my_center|LOCUS_06320 4798 4226 gene locus_tag LOCUS_06330 4798 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence0127 149 388 gene locus_tag LOCUS_06340 149 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 618 1988 gene locus_tag LOCUS_06350 618 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3979 2015 gene locus_tag LOCUS_06360 3979 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence0128 896 582 gene locus_tag LOCUS_06370 896 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 975 1919 gene locus_tag LOCUS_06380 975 1919 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704700.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence0129 <1 1094 gene locus_tag LOCUS_06390 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005458266.1:NAD-glutamate dehydrogenase 1091 1735 gene locus_tag LOCUS_06400 1091 1735 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888032.1 protein_id gnl|my_center|LOCUS_06400 1746 2357 gene locus_tag LOCUS_06410 1746 2357 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJ26 protein_id gnl|my_center|LOCUS_06410 2354 3064 gene locus_tag LOCUS_06420 gene yggS 2354 3064 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_06420 3283 3789 gene locus_tag LOCUS_06430 3283 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 3904 4233 gene locus_tag LOCUS_06440 3904 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence0130 2949 2023 gene locus_tag LOCUS_06450 2949 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4730 2964 gene locus_tag LOCUS_06460 4730 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 >Feature sequence0131 2 412 gene locus_tag LOCUS_06470 2 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 447 2081 gene locus_tag LOCUS_06480 447 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2100 3371 gene locus_tag LOCUS_06490 2100 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 3414 3806 gene locus_tag LOCUS_06500 3414 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 3803 4435 gene locus_tag LOCUS_06510 3803 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence0132 1571 525 gene locus_tag LOCUS_06520 1571 525 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_06520 2271 1774 gene locus_tag LOCUS_06530 2271 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3358 2465 gene locus_tag LOCUS_06540 3358 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 3868 3407 gene locus_tag LOCUS_06550 3868 3407 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891973.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence0133 1486 731 gene locus_tag LOCUS_06560 1486 731 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948549.1 protein_id gnl|my_center|LOCUS_06560 1681 2343 gene locus_tag LOCUS_06570 gene tpm 1681 2343 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I011 protein_id gnl|my_center|LOCUS_06570 2536 3420 gene locus_tag LOCUS_06580 2536 3420 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_06580 3906 3487 gene locus_tag LOCUS_06590 3906 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 4056 4724 gene locus_tag LOCUS_06600 4056 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 >Feature sequence0134 <1 1400 gene locus_tag LOCUS_06610 <1 1400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088552.1:signal transduction histidine kinase 1738 3387 gene locus_tag LOCUS_06620 1738 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence0135 629 156 gene locus_tag LOCUS_06630 629 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 1111 632 gene locus_tag LOCUS_06640 1111 632 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529146.1 protein_id gnl|my_center|LOCUS_06640 1718 1089 gene locus_tag LOCUS_06650 1718 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 2630 1803 gene locus_tag LOCUS_06660 2630 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 2777 3520 gene locus_tag LOCUS_06670 2777 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 4709 4251 gene locus_tag LOCUS_06680 4709 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence0136 629 1972 gene locus_tag LOCUS_06690 gene lysA1 629 1972 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_06690 1969 3978 gene locus_tag LOCUS_06700 1969 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence0137 1783 1508 gene locus_tag LOCUS_06710 1783 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2179 1832 gene locus_tag LOCUS_06720 2179 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 2322 4136 gene locus_tag LOCUS_06730 2322 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 >Feature sequence0138 984 394 gene locus_tag LOCUS_06740 984 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 1703 987 gene locus_tag LOCUS_06750 1703 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 1919 2506 gene locus_tag LOCUS_06760 1919 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 2503 4638 gene locus_tag LOCUS_06770 2503 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence0139 332 2752 gene locus_tag LOCUS_06780 332 2752 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_06780 2766 3371 gene locus_tag LOCUS_06790 2766 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 3770 3384 gene locus_tag LOCUS_06800 3770 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072996.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence0140 722 3526 gene locus_tag LOCUS_06810 722 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence0141 493 1962 gene locus_tag LOCUS_06820 gene glpK 493 1962 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749I1 protein_id gnl|my_center|LOCUS_06820 1986 2366 gene locus_tag LOCUS_06830 1986 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 4428 2377 gene locus_tag LOCUS_06840 4428 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence0142 2025 823 gene locus_tag LOCUS_06850 2025 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence0143 2291 2704 gene locus_tag LOCUS_06860 2291 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 3948 2740 gene locus_tag LOCUS_06870 3948 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 >Feature sequence0144 717 1214 gene locus_tag LOCUS_06880 717 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 2926 1259 gene locus_tag LOCUS_06890 gene lap 2926 1259 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZQ8 protein_id gnl|my_center|LOCUS_06890 3095 3982 gene locus_tag LOCUS_06900 3095 3982 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948306.1 protein_id gnl|my_center|LOCUS_06900 4404 4003 gene locus_tag LOCUS_06910 4404 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence0145 1653 844 gene locus_tag LOCUS_06920 gene lpxC 1653 844 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUQ9 protein_id gnl|my_center|LOCUS_06920 2189 1689 gene locus_tag LOCUS_06930 2189 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 3235 2186 gene locus_tag LOCUS_06940 gene ruvB 3235 2186 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61532 protein_id gnl|my_center|LOCUS_06940 3832 3242 gene locus_tag LOCUS_06950 gene ruvA 3832 3242 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA87 protein_id gnl|my_center|LOCUS_06950 4440 3829 gene locus_tag LOCUS_06960 4440 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence0146 <1 564 gene locus_tag LOCUS_06970 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q59646:nitric oxide reductase subunit C 578 1948 gene locus_tag LOCUS_06980 gene norB 578 1948 CDS product nitric oxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085999.1 protein_id gnl|my_center|LOCUS_06980 1985 2773 gene locus_tag LOCUS_06990 gene norQ 1985 2773 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence0147 2741 930 gene locus_tag LOCUS_07000 2741 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 4585 2738 gene locus_tag LOCUS_07010 4585 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence0148 1608 385 gene locus_tag LOCUS_07020 1608 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 2156 1605 gene locus_tag LOCUS_07030 2156 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 2745 3266 gene locus_tag LOCUS_07040 2745 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence0149 1122 736 gene locus_tag LOCUS_07050 1122 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 1790 1119 gene locus_tag LOCUS_07060 1790 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 2294 1908 gene locus_tag LOCUS_07070 2294 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 4154 2313 gene locus_tag LOCUS_07080 4154 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence0150 1326 169 gene locus_tag LOCUS_07090 1326 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 1416 4418 gene locus_tag LOCUS_07100 1416 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 >Feature sequence0151 1362 190 gene locus_tag LOCUS_07110 1362 190 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_07110 2913 1429 gene locus_tag LOCUS_07120 2913 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 3893 2913 gene locus_tag LOCUS_07130 3893 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence0152 271 2313 gene locus_tag LOCUS_07140 271 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 2310 2612 gene locus_tag LOCUS_07150 2310 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 2593 3711 gene locus_tag LOCUS_07160 2593 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3851 4306 gene locus_tag LOCUS_07170 3851 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4580 4296 gene locus_tag LOCUS_07180 4580 4296 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943600.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence0153 171 827 gene locus_tag LOCUS_07190 171 827 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_07190 1663 836 gene locus_tag LOCUS_07200 1663 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 3609 2953 gene locus_tag LOCUS_07210 3609 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 3787 4164 gene locus_tag LOCUS_07220 3787 4164 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070678.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence0154 1589 2956 gene locus_tag LOCUS_07230 1589 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 >Feature sequence0155 800 477 gene locus_tag LOCUS_07240 800 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 2234 1020 gene locus_tag LOCUS_07250 2234 1020 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_07250 3929 2430 gene locus_tag LOCUS_07260 3929 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence0156 192 878 gene locus_tag LOCUS_07270 192 878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_07270 1103 2260 gene locus_tag LOCUS_07280 1103 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 4129 2285 gene locus_tag LOCUS_07290 4129 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 >Feature sequence0157 30 1532 gene locus_tag LOCUS_07300 30 1532 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886676.1 protein_id gnl|my_center|LOCUS_07300 2714 1653 gene locus_tag LOCUS_07310 2714 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 4170 2917 gene locus_tag LOCUS_07320 4170 2917 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence0158 113 2599 gene locus_tag LOCUS_07330 113 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3150 3461 gene locus_tag LOCUS_07340 gene rplU 3150 3461 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FJF9 protein_id gnl|my_center|LOCUS_07340 3472 3735 gene locus_tag LOCUS_07350 gene rpmA 3472 3735 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPR5 protein_id gnl|my_center|LOCUS_07350 >Feature sequence0159 985 89 gene locus_tag LOCUS_07360 985 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1074 1931 gene locus_tag LOCUS_07370 1074 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 3214 1934 gene locus_tag LOCUS_07380 3214 1934 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103387.1 protein_id gnl|my_center|LOCUS_07380 3319 4020 gene locus_tag LOCUS_07390 3319 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence0160 1202 204 gene locus_tag LOCUS_07400 1202 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 2758 1199 gene locus_tag LOCUS_07410 2758 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 3646 2876 gene locus_tag LOCUS_07420 3646 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 4291 3650 gene locus_tag LOCUS_07430 4291 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388406.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence0161 887 78 gene locus_tag LOCUS_07440 gene cobB 887 78 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R145 protein_id gnl|my_center|LOCUS_07440 1064 2362 gene locus_tag LOCUS_07450 1064 2362 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036400.1 protein_id gnl|my_center|LOCUS_07450 2996 2445 gene locus_tag LOCUS_07460 2996 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence0162 611 195 gene locus_tag LOCUS_07470 611 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 1095 2258 gene locus_tag LOCUS_07480 1095 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3264 2317 gene locus_tag LOCUS_07490 3264 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4031 3261 gene locus_tag LOCUS_07500 4031 3261 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082892.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence0163 561 1571 gene locus_tag LOCUS_07510 561 1571 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865320.1 protein_id gnl|my_center|LOCUS_07510 1706 2884 gene locus_tag LOCUS_07520 1706 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 2881 3306 gene locus_tag LOCUS_07530 2881 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 3303 3737 gene locus_tag LOCUS_07540 3303 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence0164 465 1220 gene locus_tag LOCUS_07550 465 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 1412 3358 gene locus_tag LOCUS_07560 1412 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence0165 1416 667 gene locus_tag LOCUS_07570 gene yngF 1416 667 CDS product putative enoyl-CoA hydratase/isomerase YngF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34893 protein_id gnl|my_center|LOCUS_07570 2481 1426 gene locus_tag LOCUS_07580 2481 1426 CDS product 1,3,6,8-tetrahydroxynaphthalene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FCA7 protein_id gnl|my_center|LOCUS_07580 2637 3119 gene locus_tag LOCUS_07590 2637 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 3959 3138 gene locus_tag LOCUS_07600 3959 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 4528 4094 gene locus_tag LOCUS_07610 4528 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence0166 2618 507 gene locus_tag LOCUS_07620 2618 507 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_07620 2730 3638 gene locus_tag LOCUS_07630 2730 3638 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RWL5 protein_id gnl|my_center|LOCUS_07630 3791 4396 gene locus_tag LOCUS_07640 3791 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence0167 713 534 gene locus_tag LOCUS_07650 713 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1022 810 gene locus_tag LOCUS_07660 1022 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 1148 1303 gene locus_tag LOCUS_07670 1148 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3515 1356 gene locus_tag LOCUS_07680 3515 1356 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_07680 4046 3528 gene locus_tag LOCUS_07690 4046 3528 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence0168 2714 1539 gene locus_tag LOCUS_07700 2714 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 3062 4336 gene locus_tag LOCUS_07710 3062 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence0169 2078 762 gene locus_tag LOCUS_07720 2078 762 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875867.1 protein_id gnl|my_center|LOCUS_07720 3721 2075 gene locus_tag LOCUS_07730 gene betA 3721 2075 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGN2 protein_id gnl|my_center|LOCUS_07730 4496 3894 gene locus_tag LOCUS_07740 4496 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence0170 1273 2538 gene locus_tag LOCUS_07750 1273 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 3730 2549 gene locus_tag LOCUS_07760 gene corA 3730 2549 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 protein_id gnl|my_center|LOCUS_07760 4155 3877 gene locus_tag LOCUS_07770 4155 3877 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225051.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence0171 698 3841 gene locus_tag LOCUS_07780 698 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence0172 <1 521 gene locus_tag LOCUS_07790 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SM16:tRNA (guanosine(18)-2'-O)-methyltransferase 1780 506 gene locus_tag LOCUS_07800 1780 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 2373 1780 gene locus_tag LOCUS_07810 gene def 2373 1780 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVK0 protein_id gnl|my_center|LOCUS_07810 2498 2761 gene locus_tag LOCUS_07820 2498 2761 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence0173 3072 679 gene locus_tag LOCUS_07830 3072 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 3456 3145 gene locus_tag LOCUS_07840 3456 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 3566 4192 gene locus_tag LOCUS_07850 3566 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence0174 <1 644 gene locus_tag LOCUS_07860 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EZP1:polyamine aminopropyltransferase 1 1043 672 gene locus_tag LOCUS_07870 1043 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 1354 1043 gene locus_tag LOCUS_07880 1354 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07880 3255 1351 gene locus_tag LOCUS_07890 3255 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07890 >Feature sequence0175 1231 479 gene locus_tag LOCUS_07900 gene rnc 1231 479 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT93 protein_id gnl|my_center|LOCUS_07900 1454 1792 gene locus_tag LOCUS_07910 1454 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 2521 1805 gene locus_tag LOCUS_07920 2521 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 2638 3951 gene locus_tag LOCUS_07930 2638 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence0176 27 416 gene locus_tag LOCUS_07940 27 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 463 1023 gene locus_tag LOCUS_07950 463 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 1120 2502 gene locus_tag LOCUS_07960 1120 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 2499 4301 gene locus_tag LOCUS_07970 2499 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence0177 2082 3344 gene locus_tag LOCUS_07980 2082 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3491 4285 gene locus_tag LOCUS_07990 3491 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence0178 2907 235 gene locus_tag LOCUS_08000 2907 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 3434 2904 gene locus_tag LOCUS_08010 3434 2904 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710172.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence0179 1397 615 gene locus_tag LOCUS_08020 1397 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 1532 2350 gene locus_tag LOCUS_08030 1532 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 2965 2360 gene locus_tag LOCUS_08040 2965 2360 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704794.1 protein_id gnl|my_center|LOCUS_08040 <4428 2962 gene locus_tag LOCUS_08050 <4428 2962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080510933.1:formate dehydrogenase subunit alpha >Feature sequence0180 2070 625 gene locus_tag LOCUS_08060 2070 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 2725 2171 gene locus_tag LOCUS_08070 2725 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2945 3412 gene locus_tag LOCUS_08080 2945 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 4007 3561 gene locus_tag LOCUS_08090 4007 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence0181 1635 127 gene locus_tag LOCUS_08100 1635 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 2931 1828 gene locus_tag LOCUS_08110 gene serC 2931 1828 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ66 protein_id gnl|my_center|LOCUS_08110 3849 2932 gene locus_tag LOCUS_08120 3849 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08120 >Feature sequence0182 1089 280 gene locus_tag LOCUS_08130 1089 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1199 1531 gene locus_tag LOCUS_08140 1199 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1528 1977 gene locus_tag LOCUS_08150 1528 1977 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095464.1 protein_id gnl|my_center|LOCUS_08150 1974 3467 gene locus_tag LOCUS_08160 1974 3467 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence0183 75 581 gene locus_tag LOCUS_08170 75 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1776 562 gene locus_tag LOCUS_08180 1776 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390211.1 protein_id gnl|my_center|LOCUS_08180 1775 2719 gene locus_tag LOCUS_08190 1775 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 3530 2709 gene locus_tag LOCUS_08200 3530 2709 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190784.1 protein_id gnl|my_center|LOCUS_08200 <4381 3499 gene locus_tag LOCUS_08210 <4381 3499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206917.1:aminoglycoside phosphotransferase >Feature sequence0184 3482 2082 gene locus_tag LOCUS_08220 3482 2082 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142768.1 protein_id gnl|my_center|LOCUS_08220 3587 4219 gene locus_tag LOCUS_08230 3587 4219 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089232.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence0185 >Feature sequence0186 3 584 gene locus_tag LOCUS_08240 3 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 672 1757 gene locus_tag LOCUS_08250 672 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1759 3408 gene locus_tag LOCUS_08260 1759 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 >Feature sequence0187 330 503 gene locus_tag LOCUS_08270 330 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 470 1846 gene locus_tag LOCUS_08280 470 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1770 3335 gene locus_tag LOCUS_08290 1770 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence0188 71 2065 gene locus_tag LOCUS_08300 71 2065 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_08300 2059 2913 gene locus_tag LOCUS_08310 2059 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 2935 3228 gene locus_tag LOCUS_08320 2935 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence0189 1089 148 gene locus_tag LOCUS_08330 1089 148 CDS product metallo-mystery pair system four-Cys motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538118.1 protein_id gnl|my_center|LOCUS_08330 1673 1131 gene locus_tag LOCUS_08340 1673 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 2697 1729 gene locus_tag LOCUS_08350 2697 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 3663 2851 gene locus_tag LOCUS_08360 3663 2851 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191253.1 protein_id gnl|my_center|LOCUS_08360 4277 3660 gene locus_tag LOCUS_08370 4277 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence0190 519 67 gene locus_tag LOCUS_08380 519 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1251 562 gene locus_tag LOCUS_08390 gene eda 1251 562 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719793.1 protein_id gnl|my_center|LOCUS_08390 3067 1244 gene locus_tag LOCUS_08400 3067 1244 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706900.1 protein_id gnl|my_center|LOCUS_08400 3768 3064 gene locus_tag LOCUS_08410 3768 3064 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974508.1 protein_id gnl|my_center|LOCUS_08410 <4323 3768 gene locus_tag LOCUS_08420 <4323 3768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TM53:glucose-6-phosphate 1-dehydrogenase >Feature sequence0191 2121 1579 gene locus_tag LOCUS_08430 2121 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 >Feature sequence0192 <1 2396 gene locus_tag LOCUS_08440 <1 2396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950658.1:helicase HelZ note possible pseudo, internal stop codon, frameshifted 2303 2698 gene locus_tag LOCUS_08450 2303 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08450 >Feature sequence0193 <1 577 gene locus_tag LOCUS_08460 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114083.1:sigma-54-dependent Fis family transcriptional regulator 698 2227 gene locus_tag LOCUS_08470 698 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 2224 3189 gene locus_tag LOCUS_08480 2224 3189 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230079.1 protein_id gnl|my_center|LOCUS_08480 3182 4099 gene locus_tag LOCUS_08490 3182 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088167.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence0194 588 1469 gene locus_tag LOCUS_08500 588 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1612 3270 gene locus_tag LOCUS_08510 1612 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 3823 3245 gene locus_tag LOCUS_08520 3823 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence0195 3599 978 gene locus_tag LOCUS_08530 3599 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence0196 492 1493 gene locus_tag LOCUS_08540 gene purM 492 1493 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB6 protein_id gnl|my_center|LOCUS_08540 1490 2131 gene locus_tag LOCUS_08550 gene purN 1490 2131 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB5 protein_id gnl|my_center|LOCUS_08550 4269 2152 gene locus_tag LOCUS_08560 gene relA 4269 2152 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence0197 >Feature sequence0198 1377 265 gene locus_tag LOCUS_08570 gene rfbG 1377 265 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205408.1 protein_id gnl|my_center|LOCUS_08570 2168 1353 gene locus_tag LOCUS_08580 gene gcd1 2168 1353 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859505.1 protein_id gnl|my_center|LOCUS_08580 2285 3277 gene locus_tag LOCUS_08590 2285 3277 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766463.1 protein_id gnl|my_center|LOCUS_08590 3908 3309 gene locus_tag LOCUS_08600 3908 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence0199 671 1729 gene locus_tag LOCUS_08610 671 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1779 3752 gene locus_tag LOCUS_08620 1779 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 4234 3824 gene locus_tag LOCUS_08630 4234 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence0200 3676 2525 gene locus_tag LOCUS_08640 3676 2525 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085418.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence0201 <1 761 gene locus_tag LOCUS_08650 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942130.1:murein transglycosylase 1592 783 gene locus_tag LOCUS_08660 1592 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1736 3247 gene locus_tag LOCUS_08670 1736 3247 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104117.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence0202 963 262 gene locus_tag LOCUS_08680 963 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 1419 1976 gene locus_tag LOCUS_08690 1419 1976 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_08690 2009 2680 gene locus_tag LOCUS_08700 2009 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2853 3149 gene locus_tag LOCUS_08710 2853 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 3276 3854 gene locus_tag LOCUS_08720 3276 3854 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223840.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence0203 1298 297 gene locus_tag LOCUS_08730 gene fabH 1298 297 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833199.1 protein_id gnl|my_center|LOCUS_08730 2284 1295 gene locus_tag LOCUS_08740 2284 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 3666 2281 gene locus_tag LOCUS_08750 3666 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence0204 2887 1178 gene locus_tag LOCUS_08760 2887 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3019 3423 gene locus_tag LOCUS_08770 3019 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 3541 3981 gene locus_tag LOCUS_08780 3541 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence0205 2 235 gene locus_tag LOCUS_08790 2 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 905 2953 gene locus_tag LOCUS_08800 905 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 4024 3155 gene locus_tag LOCUS_08810 4024 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence0206 2014 998 gene locus_tag LOCUS_08820 2014 998 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229391.1 protein_id gnl|my_center|LOCUS_08820 2187 3401 gene locus_tag LOCUS_08830 2187 3401 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329168.1 protein_id gnl|my_center|LOCUS_08830 3398 3943 gene locus_tag LOCUS_08840 3398 3943 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329169.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence0207 491 946 gene locus_tag LOCUS_08850 491 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 943 1395 gene locus_tag LOCUS_08860 943 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1463 2746 gene locus_tag LOCUS_08870 1463 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 3683 2748 gene locus_tag LOCUS_08880 3683 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence0208 1351 920 gene locus_tag LOCUS_08890 1351 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3948 1348 gene locus_tag LOCUS_08900 gene plsB 3948 1348 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEQ0 protein_id gnl|my_center|LOCUS_08900 >Feature sequence0209 1485 532 gene locus_tag LOCUS_08910 1485 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 4133 2178 gene locus_tag LOCUS_08920 4133 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence0210 417 809 gene locus_tag LOCUS_08930 417 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 845 1777 gene locus_tag LOCUS_08940 gene fmt 845 1777 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_08940 1809 2474 gene locus_tag LOCUS_08950 gene rpe 1809 2474 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE8 protein_id gnl|my_center|LOCUS_08950 2572 2648 gene locus_tag LOCUS_t00010 2572 2648 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3116 3319 gene locus_tag LOCUS_08960 3116 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 3397 4086 gene locus_tag LOCUS_08970 3397 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence0211 2347 857 gene locus_tag LOCUS_08980 2347 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence0212 2476 269 gene locus_tag LOCUS_08990 2476 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence0213 700 1944 gene locus_tag LOCUS_09000 700 1944 CDS product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528894.1 protein_id gnl|my_center|LOCUS_09000 1941 2603 gene locus_tag LOCUS_09010 1941 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence0214 <1 902 gene locus_tag LOCUS_09020 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877828.1:glycosyl transferase 1607 2134 gene locus_tag LOCUS_09030 1607 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2728 2195 gene locus_tag LOCUS_09040 2728 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 3495 2827 gene locus_tag LOCUS_09050 3495 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence0215 779 1927 gene locus_tag LOCUS_09060 gene mauG 779 1927 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_09060 1940 3760 gene locus_tag LOCUS_09070 1940 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence0216 347 727 gene locus_tag LOCUS_09080 347 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 714 1544 gene locus_tag LOCUS_09090 gene kdsA2 714 1544 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RA1 protein_id gnl|my_center|LOCUS_09090 2151 1561 gene locus_tag LOCUS_09100 2151 1561 CDS product pyrrolidone-carboxylate peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868563.1 protein_id gnl|my_center|LOCUS_09100 2481 3038 gene locus_tag LOCUS_09110 gene rpoE 2481 3038 CDS product ECF RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYV6 protein_id gnl|my_center|LOCUS_09110 3119 3781 gene locus_tag LOCUS_09120 3119 3781 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388479.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence0217 2452 1634 gene locus_tag LOCUS_09130 2452 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 2646 3542 gene locus_tag LOCUS_09140 2646 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 3911 3549 gene locus_tag LOCUS_09150 3911 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence0218 138 899 gene locus_tag LOCUS_09160 138 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3251 903 gene locus_tag LOCUS_09170 3251 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402856.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence0219 670 17 gene locus_tag LOCUS_09180 670 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 1235 672 gene locus_tag LOCUS_09190 1235 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1770 1309 gene locus_tag LOCUS_09200 1770 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 3942 1897 gene locus_tag LOCUS_09210 3942 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence0220 935 120 gene locus_tag LOCUS_09220 935 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3018 925 gene locus_tag LOCUS_09230 3018 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3772 3011 gene locus_tag LOCUS_09240 3772 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 4032 3769 gene locus_tag LOCUS_09250 4032 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence0221 553 1767 gene locus_tag LOCUS_09260 gene tdh 553 1767 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31776 protein_id gnl|my_center|LOCUS_09260 2069 1995 gene locus_tag LOCUS_t00020 2069 1995 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2220 2131 gene locus_tag LOCUS_t00030 2220 2131 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2322 2236 gene locus_tag LOCUS_t00040 2322 2236 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3096 2440 gene locus_tag LOCUS_09270 gene lipB 3096 2440 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND22 protein_id gnl|my_center|LOCUS_09270 >Feature sequence0222 <1 629 gene locus_tag LOCUS_09280 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KRP1:galactokinase 1312 644 gene locus_tag LOCUS_09290 1312 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 3112 1463 gene locus_tag LOCUS_09300 3112 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence0223 1732 236 gene locus_tag LOCUS_09310 1732 236 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI85 protein_id gnl|my_center|LOCUS_09310 2112 2264 gene locus_tag LOCUS_09320 2112 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 2611 3720 gene locus_tag LOCUS_09330 2611 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence0224 1735 710 gene locus_tag LOCUS_09340 1735 710 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071748.1 protein_id gnl|my_center|LOCUS_09340 3183 1732 gene locus_tag LOCUS_09350 3183 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence0225 158 790 gene locus_tag LOCUS_09360 158 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2163 802 gene locus_tag LOCUS_09370 2163 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2727 3515 gene locus_tag LOCUS_09380 2727 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence0226 416 1306 gene locus_tag LOCUS_09390 416 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1306 2358 gene locus_tag LOCUS_09400 gene ddl 1306 2358 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNW1 protein_id gnl|my_center|LOCUS_09400 2664 3386 gene locus_tag LOCUS_09410 2664 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 >Feature sequence0227 579 3929 gene locus_tag LOCUS_09420 579 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence0228 185 1489 gene locus_tag LOCUS_09430 185 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 2199 1525 gene locus_tag LOCUS_09440 2199 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2581 2108 gene locus_tag LOCUS_09450 2581 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 2861 2631 gene locus_tag LOCUS_09460 2861 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3158 2940 gene locus_tag LOCUS_09470 3158 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 3304 3774 gene locus_tag LOCUS_09480 3304 3774 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_09480 4056 3799 gene locus_tag LOCUS_09490 4056 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence0229 905 1846 gene locus_tag LOCUS_09500 905 1846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_09500 1843 2568 gene locus_tag LOCUS_09510 gene gldF 1843 2568 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence0230 <1 994 gene locus_tag LOCUS_09520 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919974.1:farnesyltranstransferase 1277 1747 gene locus_tag LOCUS_09530 1277 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09530 1744 2325 gene locus_tag LOCUS_09540 1744 2325 CDS product phenolic acid decarboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence0231 357 1691 gene locus_tag LOCUS_09550 357 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1903 2946 gene locus_tag LOCUS_09560 1903 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence0232 <1 589 gene locus_tag LOCUS_09570 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867555.1:protoporphyrinogen oxidase 1127 639 gene locus_tag LOCUS_09580 1127 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2140 1028 gene locus_tag LOCUS_09590 2140 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3011 2160 gene locus_tag LOCUS_09600 3011 2160 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267906.1 protein_id gnl|my_center|LOCUS_09600 3173 3862 gene locus_tag LOCUS_09610 3173 3862 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811176.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence0233 1926 1039 gene locus_tag LOCUS_09620 1926 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2309 1920 gene locus_tag LOCUS_09630 2309 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 3080 2319 gene locus_tag LOCUS_09640 3080 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 4031 3150 gene locus_tag LOCUS_09650 gene ilvE 4031 3150 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence0234 <4028 2485 gene locus_tag LOCUS_09660 <4028 2485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867156.1:sodium:proline symporter >Feature sequence0235 2525 3073 gene locus_tag LOCUS_09670 2525 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3172 3969 gene locus_tag LOCUS_09680 3172 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence0236 3137 594 gene locus_tag LOCUS_09690 3137 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence0237 <1 2150 gene locus_tag LOCUS_09700 <1 2150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123208.1:serine/threonine protein kinase >Feature sequence0238 <1 1384 gene locus_tag LOCUS_09710 <1 1384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404630.1:peptidase 2728 1388 gene locus_tag LOCUS_09720 2728 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2823 3554 gene locus_tag LOCUS_09730 2823 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964914.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence0239 2397 694 gene locus_tag LOCUS_09740 2397 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2973 2464 gene locus_tag LOCUS_09750 2973 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 3044 3937 gene locus_tag LOCUS_09760 3044 3937 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141901.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence0240 1299 247 gene locus_tag LOCUS_09770 1299 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1501 3540 gene locus_tag LOCUS_09780 1501 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence0241 655 146 gene locus_tag LOCUS_09790 655 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369584.1 protein_id gnl|my_center|LOCUS_09790 2413 884 gene locus_tag LOCUS_09800 2413 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2892 3473 gene locus_tag LOCUS_09810 2892 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence0242 854 27 gene locus_tag LOCUS_09820 854 27 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013356.1 protein_id gnl|my_center|LOCUS_09820 1876 851 gene locus_tag LOCUS_09830 1876 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2748 1873 gene locus_tag LOCUS_09840 2748 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 <3974 2808 gene locus_tag LOCUS_09850 <3974 2808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861071.1:spore coat protein >Feature sequence0243 443 1573 gene locus_tag LOCUS_09860 443 1573 CDS product deoxyhypusine synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKP1 protein_id gnl|my_center|LOCUS_09860 1649 3721 gene locus_tag LOCUS_09870 1649 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 >Feature sequence0244 122 1486 gene locus_tag LOCUS_09880 122 1486 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_09880 1503 2453 gene locus_tag LOCUS_09890 1503 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 2808 2431 gene locus_tag LOCUS_09900 2808 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2911 3453 gene locus_tag LOCUS_09910 2911 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence0245 875 63 gene locus_tag LOCUS_09920 875 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1017 3695 gene locus_tag LOCUS_09930 1017 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09930 >Feature sequence0246 2297 1203 gene locus_tag LOCUS_09940 2297 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 3105 2290 gene locus_tag LOCUS_09950 3105 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505558.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence0247 <1 701 gene locus_tag LOCUS_09960 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BY3:CTP synthase 811 2268 gene locus_tag LOCUS_09970 gene rpoN 811 2268 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ1 protein_id gnl|my_center|LOCUS_09970 2384 3580 gene locus_tag LOCUS_09980 2384 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence0248 981 202 gene locus_tag LOCUS_09990 981 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2063 1101 gene locus_tag LOCUS_10000 2063 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2614 2060 gene locus_tag LOCUS_10010 2614 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 3600 2617 gene locus_tag LOCUS_10020 3600 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence0249 <1 1087 gene locus_tag LOCUS_10030 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070883.1:sensor histidine kinase 1121 1549 gene locus_tag LOCUS_10040 1121 1549 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889463.1 protein_id gnl|my_center|LOCUS_10040 1714 2439 gene locus_tag LOCUS_10050 1714 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2552 3010 gene locus_tag LOCUS_10060 2552 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3760 3041 gene locus_tag LOCUS_10070 3760 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence0250 166 1884 gene locus_tag LOCUS_10080 166 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 2035 2283 gene locus_tag LOCUS_10090 2035 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2283 2990 gene locus_tag LOCUS_10100 2283 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 3236 3006 gene locus_tag LOCUS_10110 3236 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence0251 2024 2383 gene locus_tag LOCUS_10120 2024 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 3502 2414 gene locus_tag LOCUS_10130 3502 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence0252 1989 1084 gene locus_tag LOCUS_10140 1989 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 2639 1986 gene locus_tag LOCUS_10150 gene ftsE 2639 1986 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_10150 3034 2636 gene locus_tag LOCUS_10160 3034 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10160 3490 3068 gene locus_tag LOCUS_10170 3490 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10170 >Feature sequence0253 612 1181 gene locus_tag LOCUS_10180 612 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1178 2707 gene locus_tag LOCUS_10190 gene mviN-1 1178 2707 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938470.1 protein_id gnl|my_center|LOCUS_10190 2704 3840 gene locus_tag LOCUS_10200 2704 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence0254 223 828 gene locus_tag LOCUS_10210 223 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 909 1520 gene locus_tag LOCUS_10220 909 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 2459 1536 gene locus_tag LOCUS_10230 2459 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 >Feature sequence0255 868 470 gene locus_tag LOCUS_10240 868 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1026 1922 gene locus_tag LOCUS_10250 1026 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence0256 226 810 gene locus_tag LOCUS_10260 226 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 810 2855 gene locus_tag LOCUS_10270 810 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence0257 799 1272 gene locus_tag LOCUS_10280 799 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3223 1655 gene locus_tag LOCUS_10290 3223 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 3315 3731 gene locus_tag LOCUS_10300 3315 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence0258 1355 984 gene locus_tag LOCUS_10310 1355 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 3028 1352 gene locus_tag LOCUS_10320 3028 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120249.1 protein_id gnl|my_center|LOCUS_10320 3545 3021 gene locus_tag LOCUS_10330 3545 3021 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902983.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence0259 <1 806 gene locus_tag LOCUS_10340 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263947.1:ATP-dependent DNA helicase RecQ 996 1889 gene locus_tag LOCUS_10350 996 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence0260 3264 1045 gene locus_tag LOCUS_10360 3264 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence0261 1117 230 gene locus_tag LOCUS_10370 1117 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1236 2648 gene locus_tag LOCUS_10380 1236 2648 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_10380 2652 3026 gene locus_tag LOCUS_10390 2652 3026 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_10390 3061 3228 gene locus_tag LOCUS_10400 3061 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 3231 3566 gene locus_tag LOCUS_10410 3231 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence0262 <1 866 gene locus_tag LOCUS_10420 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403440.1:D-3-phosphoglycerate dehydrogenase 2461 992 gene locus_tag LOCUS_10430 2461 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 2814 3692 gene locus_tag LOCUS_10440 2814 3692 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence0263 1041 82 gene locus_tag LOCUS_10450 gene lpxD 1041 82 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729I2 protein_id gnl|my_center|LOCUS_10450 2522 1038 gene locus_tag LOCUS_10460 gene glgA 2522 1038 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729V4 protein_id gnl|my_center|LOCUS_10460 3488 2586 gene locus_tag LOCUS_10470 3488 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence0264 3430 2975 gene locus_tag LOCUS_10480 3430 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence0265 1028 150 gene locus_tag LOCUS_10490 1028 150 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900432.1 protein_id gnl|my_center|LOCUS_10490 1835 1071 gene locus_tag LOCUS_10500 1835 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2319 2002 gene locus_tag LOCUS_10510 2319 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 2566 3027 gene locus_tag LOCUS_10520 2566 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence0266 843 1244 gene locus_tag LOCUS_10530 843 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1228 2217 gene locus_tag LOCUS_10540 1228 2217 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 protein_id gnl|my_center|LOCUS_10540 2214 3011 gene locus_tag LOCUS_10550 2214 3011 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084146.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence0267 566 1216 gene locus_tag LOCUS_10560 566 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1345 2481 gene locus_tag LOCUS_10570 1345 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 3539 2442 gene locus_tag LOCUS_10580 3539 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence0268 1129 308 gene locus_tag LOCUS_10590 1129 308 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_10590 1959 1303 gene locus_tag LOCUS_10600 1959 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence0269 334 1614 gene locus_tag LOCUS_10610 334 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 2929 1679 gene locus_tag LOCUS_10620 2929 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence0270 914 3043 gene locus_tag LOCUS_10630 914 3043 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118217.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence0271 224 1003 gene locus_tag LOCUS_10640 224 1003 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF36 protein_id gnl|my_center|LOCUS_10640 1578 1354 gene locus_tag LOCUS_10650 1578 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1794 1603 gene locus_tag LOCUS_10660 1794 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 2033 2620 gene locus_tag LOCUS_10670 2033 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 2701 3639 gene locus_tag LOCUS_10680 2701 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence0272 2411 1002 gene locus_tag LOCUS_10690 2411 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence0273 519 2003 gene locus_tag LOCUS_10700 519 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence0274 1459 515 gene locus_tag LOCUS_10710 1459 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence0275 262 999 gene locus_tag LOCUS_10720 262 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1044 1724 gene locus_tag LOCUS_10730 1044 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 <3769 1759 gene locus_tag LOCUS_10740 <3769 1759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073607.1:peptidase M13 >Feature sequence0276 1611 2351 gene locus_tag LOCUS_10750 1611 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 2986 2363 gene locus_tag LOCUS_10760 2986 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence0277 121 813 gene locus_tag LOCUS_10770 121 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 820 1557 gene locus_tag LOCUS_10780 820 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 2767 1571 gene locus_tag LOCUS_10790 2767 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 3745 2846 gene locus_tag LOCUS_10800 3745 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence0278 728 432 gene locus_tag LOCUS_10810 728 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1867 767 gene locus_tag LOCUS_10820 1867 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2707 1871 gene locus_tag LOCUS_10830 2707 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 3741 2704 gene locus_tag LOCUS_10840 gene rlmN 3741 2704 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X240 protein_id gnl|my_center|LOCUS_10840 >Feature sequence0279 2796 1030 gene locus_tag LOCUS_10850 2796 1030 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_10850 3574 2879 gene locus_tag LOCUS_10860 3574 2879 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KER3 protein_id gnl|my_center|LOCUS_10860 >Feature sequence0280 752 78 gene locus_tag LOCUS_10870 752 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 3132 862 gene locus_tag LOCUS_10880 3132 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence0281 1283 582 gene locus_tag LOCUS_10890 1283 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 2170 1370 gene locus_tag LOCUS_10900 2170 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 3723 2167 gene locus_tag LOCUS_10910 3723 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence0282 51 944 gene locus_tag LOCUS_10920 51 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1596 949 gene locus_tag LOCUS_10930 1596 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1996 3081 gene locus_tag LOCUS_10940 gene dsbG 1996 3081 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence0283 674 2188 gene locus_tag LOCUS_10950 gene gltB2 674 2188 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_10950 2190 2849 gene locus_tag LOCUS_10960 2190 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence0284 393 2240 gene locus_tag LOCUS_10970 393 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2814 2308 gene locus_tag LOCUS_10980 2814 2308 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932479.1 protein_id gnl|my_center|LOCUS_10980 3112 3438 gene locus_tag LOCUS_10990 3112 3438 CDS product phage shock protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481539.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence0285 1870 860 gene locus_tag LOCUS_11000 gene gapA 1870 860 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CP4 protein_id gnl|my_center|LOCUS_11000 >Feature sequence0286 2157 1261 gene locus_tag LOCUS_11010 2157 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3377 2172 gene locus_tag LOCUS_11020 3377 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709181.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence0287 244 2565 gene locus_tag LOCUS_11030 244 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence0288 606 1391 gene locus_tag LOCUS_11040 606 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1313 2554 gene locus_tag LOCUS_11050 1313 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2551 3150 gene locus_tag LOCUS_11060 2551 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3144 3425 gene locus_tag LOCUS_11070 3144 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence0289 2774 1338 gene locus_tag LOCUS_11080 2774 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3685 2897 gene locus_tag LOCUS_11090 3685 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence0290 2159 957 gene locus_tag LOCUS_11100 2159 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2251 3183 gene locus_tag LOCUS_11110 2251 3183 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223258.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence0291 <1 564 gene locus_tag LOCUS_11120 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q51567:succinate--CoA ligase [ADP-forming] subunit alpha 846 1274 gene locus_tag LOCUS_11130 846 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1499 2338 gene locus_tag LOCUS_11140 1499 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence0292 1668 652 gene locus_tag LOCUS_11150 1668 652 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640075.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence0293 173 370 gene locus_tag LOCUS_11160 173 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1044 2657 gene locus_tag LOCUS_11170 1044 2657 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881759.1 protein_id gnl|my_center|LOCUS_11170 2979 3317 gene locus_tag LOCUS_11180 2979 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence0294 3 758 gene locus_tag LOCUS_11190 3 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 776 2257 gene locus_tag LOCUS_11200 776 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence0295 2709 1303 gene locus_tag LOCUS_11210 2709 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3426 2731 gene locus_tag LOCUS_11220 3426 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence0296 105 551 gene locus_tag LOCUS_11230 105 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1304 582 gene locus_tag LOCUS_11240 1304 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1730 1398 gene locus_tag LOCUS_11250 1730 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1908 1720 gene locus_tag LOCUS_11260 1908 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 2690 2004 gene locus_tag LOCUS_11270 2690 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_11270 <3656 2690 gene locus_tag LOCUS_11280 <3656 2690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861820.1:C4-dicarboxylate ABC transporter >Feature sequence0297 976 296 gene locus_tag LOCUS_11290 976 296 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949128.1 protein_id gnl|my_center|LOCUS_11290 1131 1673 gene locus_tag LOCUS_11300 1131 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_11300 1763 2287 gene locus_tag LOCUS_11310 1763 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence0298 2 394 gene locus_tag LOCUS_11320 2 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 435 2726 gene locus_tag LOCUS_11330 435 2726 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 protein_id gnl|my_center|LOCUS_11330 3575 2757 gene locus_tag LOCUS_11340 3575 2757 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence0299 2512 1103 gene locus_tag LOCUS_11350 2512 1103 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence0300 2 625 gene locus_tag LOCUS_11360 2 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 772 698 gene locus_tag LOCUS_t00050 772 698 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2266 1109 gene locus_tag LOCUS_11370 2266 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence0301 3154 3570 gene locus_tag LOCUS_11380 3154 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence0302 2853 49 gene locus_tag LOCUS_11390 2853 49 CDS product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DV4 protein_id gnl|my_center|LOCUS_11390 3634 2960 gene locus_tag LOCUS_11400 3634 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence0303 <1 678 gene locus_tag LOCUS_11410 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63V75:polyphosphate kinase 2222 729 gene locus_tag LOCUS_11420 gene ppx 2222 729 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZN70 protein_id gnl|my_center|LOCUS_11420 3292 2219 gene locus_tag LOCUS_11430 3292 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence0304 1824 829 gene locus_tag LOCUS_11440 1824 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 2850 1906 gene locus_tag LOCUS_11450 2850 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence0305 2644 848 gene locus_tag LOCUS_11460 2644 848 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 protein_id gnl|my_center|LOCUS_11460 3207 2641 gene locus_tag LOCUS_11470 3207 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence0306 1747 3258 gene locus_tag LOCUS_11480 1747 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 3535 3266 gene locus_tag LOCUS_11490 3535 3266 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTF7 protein_id gnl|my_center|LOCUS_11490 >Feature sequence0307 <1 793 gene locus_tag LOCUS_11500 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037307.1:CDP-diacylglycerol--serine O-phosphatidyltransferase <3600 821 gene locus_tag LOCUS_11510 <3600 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141986.1:penicillin amidase >Feature sequence0308 1227 418 gene locus_tag LOCUS_11520 1227 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 2177 1299 gene locus_tag LOCUS_11530 2177 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 2906 2184 gene locus_tag LOCUS_11540 2906 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence0309 926 39 gene locus_tag LOCUS_11550 926 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1868 1149 gene locus_tag LOCUS_11560 1868 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2009 2638 gene locus_tag LOCUS_11570 2009 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence0310 >Feature sequence0311 565 239 gene locus_tag LOCUS_11580 gene arsR 565 239 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119398.1 protein_id gnl|my_center|LOCUS_11580 1240 656 gene locus_tag LOCUS_11590 1240 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 <3578 1538 gene locus_tag LOCUS_11600 <3578 1538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250640.1:alkaline serine protease >Feature sequence0312 3048 1408 gene locus_tag LOCUS_11610 3048 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence0313 2549 810 gene locus_tag LOCUS_11620 2549 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 <3570 2558 gene locus_tag LOCUS_11630 <3570 2558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258512.1:protein phosphatase >Feature sequence0314 380 1192 gene locus_tag LOCUS_11640 380 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1171 2670 gene locus_tag LOCUS_11650 1171 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence0315 1309 1722 gene locus_tag LOCUS_11660 1309 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1792 2010 gene locus_tag LOCUS_11670 1792 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 <3557 2047 gene locus_tag LOCUS_11680 <3557 2047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:cation transporter >Feature sequence0316 2309 1341 gene locus_tag LOCUS_11690 2309 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence0317 265 8 gene locus_tag LOCUS_11700 265 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1378 305 gene locus_tag LOCUS_11710 gene apbE 1378 305 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WC52 protein_id gnl|my_center|LOCUS_11710 2611 1385 gene locus_tag LOCUS_11720 gene nqrF 2611 1385 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6X5 protein_id gnl|my_center|LOCUS_11720 3256 2642 gene locus_tag LOCUS_11730 gene nqrE 3256 2642 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_11730 3551 3264 gene locus_tag LOCUS_11740 3551 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence0318 >Feature sequence0319 <1 1129 gene locus_tag LOCUS_11750 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257018.1:protein phosphatase note possible pseudo, internal stop codon, frameshifted 1183 3099 gene locus_tag LOCUS_11760 gene metF-2 1183 3099 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence0320 415 2028 gene locus_tag LOCUS_11770 415 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 2329 2913 gene locus_tag LOCUS_11780 2329 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 2980 3384 gene locus_tag LOCUS_11790 2980 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence0321 >Feature sequence0322 417 2741 gene locus_tag LOCUS_11800 417 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 <3543 2844 gene locus_tag LOCUS_11810 <3543 2844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974111.1:aconitate hydratase >Feature sequence0323 246 1628 gene locus_tag LOCUS_11820 246 1628 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_11820 3541 1775 gene locus_tag LOCUS_11830 3541 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence0324 1179 415 gene locus_tag LOCUS_11840 1179 415 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0T4 protein_id gnl|my_center|LOCUS_11840 2507 1239 gene locus_tag LOCUS_11850 2507 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence0325 354 136 gene locus_tag LOCUS_11860 354 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 846 412 gene locus_tag LOCUS_11870 846 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1647 1003 gene locus_tag LOCUS_11880 1647 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2774 1896 gene locus_tag LOCUS_11890 2774 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415118.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence0326 1598 921 gene locus_tag LOCUS_11900 1598 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 3091 1595 gene locus_tag LOCUS_11910 3091 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence0327 2826 103 gene locus_tag LOCUS_11920 2826 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence0328 <1 839 gene locus_tag LOCUS_11930 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223908.1:RNA polymerase subunit sigma-24 1569 859 gene locus_tag LOCUS_11940 1569 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 3266 1578 gene locus_tag LOCUS_11950 gene glnS 3266 1578 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727A5 protein_id gnl|my_center|LOCUS_11950 >Feature sequence0329 454 633 gene locus_tag LOCUS_11960 454 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 818 970 gene locus_tag LOCUS_11970 818 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1680 1051 gene locus_tag LOCUS_11980 1680 1051 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106298.1 protein_id gnl|my_center|LOCUS_11980 2407 1754 gene locus_tag LOCUS_11990 2407 1754 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385122.1 protein_id gnl|my_center|LOCUS_11990 <3490 2739 gene locus_tag LOCUS_12000 <3490 2739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035678.1:RNA helicase >Feature sequence0330 456 752 gene locus_tag LOCUS_12010 456 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1127 768 gene locus_tag LOCUS_12020 1127 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1619 2068 gene locus_tag LOCUS_12030 1619 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2265 2855 gene locus_tag LOCUS_12040 2265 2855 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941355.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence0331 <1 525 gene locus_tag LOCUS_12050 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143308.1:N-acetylmuramoyl-L-alanine amidase 893 540 gene locus_tag LOCUS_12060 893 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 917 1150 gene locus_tag LOCUS_12070 917 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2484 1477 gene locus_tag LOCUS_12080 2484 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence0332 1350 349 gene locus_tag LOCUS_12090 1350 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1506 2201 gene locus_tag LOCUS_12100 1506 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2538 2227 gene locus_tag LOCUS_12110 2538 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 3476 2538 gene locus_tag LOCUS_12120 3476 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence0333 1130 414 gene locus_tag LOCUS_12130 1130 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1247 2863 gene locus_tag LOCUS_12140 gene pgm 1247 2863 CDS product phosphoglucomutase, alpha-D-glucose phosphate-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence0334 <1 1867 gene locus_tag LOCUS_12150 <1 1867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:sulfurtransferase 2034 3029 gene locus_tag LOCUS_12160 2034 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence0335 658 1821 gene locus_tag LOCUS_12170 658 1821 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186349.1 protein_id gnl|my_center|LOCUS_12170 2661 1837 gene locus_tag LOCUS_12180 2661 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 <3459 2740 gene locus_tag LOCUS_12190 <3459 2740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889584.1:N-glycosidase F >Feature sequence0336 1082 1528 gene locus_tag LOCUS_12200 1082 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2800 1559 gene locus_tag LOCUS_12210 2800 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 <3456 2832 gene locus_tag LOCUS_12220 <3456 2832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867386.1:short-chain dehydrogenase >Feature sequence0337 1356 460 gene locus_tag LOCUS_12230 1356 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1489 1896 gene locus_tag LOCUS_12240 1489 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 3453 1954 gene locus_tag LOCUS_12250 3453 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence0338 499 173 gene locus_tag LOCUS_12260 499 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 714 496 gene locus_tag LOCUS_12270 714 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1913 795 gene locus_tag LOCUS_12280 1913 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 3385 1862 gene locus_tag LOCUS_12290 3385 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence0339 1101 607 gene locus_tag LOCUS_12300 1101 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1703 1098 gene locus_tag LOCUS_12310 1703 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 2038 1712 gene locus_tag LOCUS_12320 2038 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530736.1 protein_id gnl|my_center|LOCUS_12320 2302 2631 gene locus_tag LOCUS_12330 2302 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2625 3005 gene locus_tag LOCUS_12340 2625 3005 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622997.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence0340 1583 333 gene locus_tag LOCUS_12350 1583 333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263565.1 protein_id gnl|my_center|LOCUS_12350 2812 1583 gene locus_tag LOCUS_12360 2812 1583 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517213.1 protein_id gnl|my_center|LOCUS_12360 3441 2809 gene locus_tag LOCUS_12370 3441 2809 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence0341 564 157 gene locus_tag LOCUS_12380 564 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1323 814 gene locus_tag LOCUS_12390 1323 814 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028640.1 protein_id gnl|my_center|LOCUS_12390 1387 1932 gene locus_tag LOCUS_12400 1387 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence0342 1669 230 gene locus_tag LOCUS_12410 1669 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3143 1662 gene locus_tag LOCUS_12420 3143 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence0343 589 1407 gene locus_tag LOCUS_12430 589 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2529 1411 gene locus_tag LOCUS_12440 2529 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence0344 670 248 gene locus_tag LOCUS_12450 670 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 2521 980 gene locus_tag LOCUS_12460 2521 980 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_12460 2893 3417 gene locus_tag LOCUS_12470 2893 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence0345 639 190 gene locus_tag LOCUS_12480 639 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 791 1468 gene locus_tag LOCUS_12490 791 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence0346 1899 538 gene locus_tag LOCUS_12500 1899 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2454 1960 gene locus_tag LOCUS_12510 gene bfr 2454 1960 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2S8 protein_id gnl|my_center|LOCUS_12510 2720 2529 gene locus_tag LOCUS_12520 2720 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence0347 <1 906 gene locus_tag LOCUS_12530 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MHY7:amidophosphoribosyltransferase 935 1915 gene locus_tag LOCUS_12540 935 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 2856 1918 gene locus_tag LOCUS_12550 gene kka 2856 1918 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972041.1 protein_id gnl|my_center|LOCUS_12550 <3424 2876 gene locus_tag LOCUS_12560 <3424 2876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071688.1:MFS transporter >Feature sequence0348 324 845 gene locus_tag LOCUS_12570 324 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12570 >Feature sequence0349 >Feature sequence0350 1520 2476 gene locus_tag LOCUS_12580 1520 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence0351 <1 799 gene locus_tag LOCUS_12590 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975752.1:NAD(P)-dependent oxidoreductase 1066 809 gene locus_tag LOCUS_12600 1066 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1535 1089 gene locus_tag LOCUS_12610 1535 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence0352 <1 504 gene locus_tag LOCUS_12620 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726989.1:enoyl-CoA hydratase 501 1070 gene locus_tag LOCUS_12630 501 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2805 1024 gene locus_tag LOCUS_12640 2805 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence0353 2131 65 gene locus_tag LOCUS_12650 gene fusA-2 2131 65 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939087.1 protein_id gnl|my_center|LOCUS_12650 2263 3339 gene locus_tag LOCUS_12660 gene carA 2263 3339 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK41 protein_id gnl|my_center|LOCUS_12660 >Feature sequence0354 2197 671 gene locus_tag LOCUS_12670 2197 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 <3399 2254 gene locus_tag LOCUS_12680 <3399 2254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010907909.1:DNA methylase >Feature sequence0355 628 167 gene locus_tag LOCUS_12690 628 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 2482 692 gene locus_tag LOCUS_12700 2482 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2549 3382 gene locus_tag LOCUS_12710 2549 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence0356 <1 1082 gene locus_tag LOCUS_12720 <1 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226592.1:argininosuccinate lyase 2028 1135 gene locus_tag LOCUS_12730 2028 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2600 2088 gene locus_tag LOCUS_12740 2600 2088 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence0357 135 1139 gene locus_tag LOCUS_12750 135 1139 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947351.1 protein_id gnl|my_center|LOCUS_12750 1164 1760 gene locus_tag LOCUS_12760 1164 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1901 2203 gene locus_tag LOCUS_12770 1901 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 2253 2768 gene locus_tag LOCUS_12780 2253 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence0358 <1 1349 gene locus_tag LOCUS_12790 <1 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000666317.1:TonB-dependent receptor 1349 2254 gene locus_tag LOCUS_12800 1349 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 2654 2274 gene locus_tag LOCUS_12810 2654 2274 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122416.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence0359 2820 418 gene locus_tag LOCUS_12820 gene pheT 2820 418 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKP4 protein_id gnl|my_center|LOCUS_12820 3378 2890 gene locus_tag LOCUS_12830 3378 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence0360 615 2879 gene locus_tag LOCUS_12840 gene uvrA 615 2879 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK42 protein_id gnl|my_center|LOCUS_12840 >Feature sequence0361 165 1940 gene locus_tag LOCUS_12850 165 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence0362 444 989 gene locus_tag LOCUS_12860 444 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1457 993 gene locus_tag LOCUS_12870 1457 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1577 2260 gene locus_tag LOCUS_12880 1577 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 2276 2797 gene locus_tag LOCUS_12890 2276 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence0363 391 1215 gene locus_tag LOCUS_12900 391 1215 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_12900 2485 1268 gene locus_tag LOCUS_12910 2485 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence0364 1911 976 gene locus_tag LOCUS_12920 1911 976 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093339.1 protein_id gnl|my_center|LOCUS_12920 2636 1911 gene locus_tag LOCUS_12930 2636 1911 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKH4 protein_id gnl|my_center|LOCUS_12930 >Feature sequence0365 437 2431 gene locus_tag LOCUS_12940 437 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence0366 1115 30 gene locus_tag LOCUS_12950 1115 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 2433 1333 gene locus_tag LOCUS_12960 2433 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 2534 2971 gene locus_tag LOCUS_12970 2534 2971 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977512.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence0367 563 261 gene locus_tag LOCUS_12980 563 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 691 3210 gene locus_tag LOCUS_12990 gene leuS 691 3210 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S415 protein_id gnl|my_center|LOCUS_12990 >Feature sequence0368 <1 2300 gene locus_tag LOCUS_13000 <1 2300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NFE9:chaperone protein ClpB 2311 3084 gene locus_tag LOCUS_13010 2311 3084 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986927.1 protein_id gnl|my_center|LOCUS_13010 3357 3115 gene locus_tag LOCUS_13020 3357 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence0369 275 1537 gene locus_tag LOCUS_13030 275 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1534 2259 gene locus_tag LOCUS_13040 1534 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2551 2838 gene locus_tag LOCUS_13050 2551 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence0370 <3338 783 gene locus_tag LOCUS_13060 <3338 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228762.1:propionyl-CoA carboxylase subunit beta >Feature sequence0371 >Feature sequence0372 1862 825 gene locus_tag LOCUS_13070 1862 825 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence0373 1448 195 gene locus_tag LOCUS_13080 1448 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 2622 1543 gene locus_tag LOCUS_13090 2622 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 2761 3102 gene locus_tag LOCUS_13100 2761 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence0374 245 1072 gene locus_tag LOCUS_13110 245 1072 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_13110 2185 1358 gene locus_tag LOCUS_13120 2185 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 2609 2175 gene locus_tag LOCUS_13130 2609 2175 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143594.1 protein_id gnl|my_center|LOCUS_13130 3125 2640 gene locus_tag LOCUS_13140 3125 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence0375 <1 584 gene locus_tag LOCUS_13150 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9K3J3:malate dehydrogenase 858 2414 gene locus_tag LOCUS_13160 858 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence0376 967 1581 gene locus_tag LOCUS_13170 967 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1654 2181 gene locus_tag LOCUS_13180 1654 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2193 2762 gene locus_tag LOCUS_13190 2193 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 3174 2743 gene locus_tag LOCUS_13200 3174 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence0377 <1 1491 gene locus_tag LOCUS_13210 <1 1491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_709080.1:insertion sequence element ISSfl4 transposase >Feature sequence0378 >Feature sequence0379 2438 633 gene locus_tag LOCUS_13220 2438 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence0380 929 1642 gene locus_tag LOCUS_13230 929 1642 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831066.1 protein_id gnl|my_center|LOCUS_13230 1702 3048 gene locus_tag LOCUS_13240 1702 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence0381 2972 1707 gene locus_tag LOCUS_13250 gene bioA 2972 1707 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810375.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence0382 1167 16 gene locus_tag LOCUS_13260 1167 16 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_13260 2136 1210 gene locus_tag LOCUS_13270 2136 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence0383 2814 97 gene locus_tag LOCUS_13280 2814 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence0384 1506 1994 gene locus_tag LOCUS_13290 1506 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 2003 2401 gene locus_tag LOCUS_13300 2003 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence0385 2700 244 gene locus_tag LOCUS_13310 2700 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence0386 1861 374 gene locus_tag LOCUS_13320 1861 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 <3304 1898 gene locus_tag LOCUS_13330 <3304 1898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0A6Z2:chaperone protein HscA >Feature sequence0387 <1 1311 gene locus_tag LOCUS_13340 <1 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103336.1:membrane protein 2700 1348 gene locus_tag LOCUS_13350 2700 1348 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence0388 26 802 gene locus_tag LOCUS_13360 26 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 881 2644 gene locus_tag LOCUS_13370 881 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence0389 1431 1195 gene locus_tag LOCUS_13380 1431 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1838 1482 gene locus_tag LOCUS_13390 1838 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 2101 1793 gene locus_tag LOCUS_13400 2101 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence0390 336 824 gene locus_tag LOCUS_13410 336 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1289 837 gene locus_tag LOCUS_13420 1289 837 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256747.1 protein_id gnl|my_center|LOCUS_13420 1567 1974 gene locus_tag LOCUS_13430 1567 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence0391 438 157 gene locus_tag LOCUS_13440 438 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 2452 584 gene locus_tag LOCUS_13450 gene rpsA 2452 584 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_13450 <3286 2636 gene locus_tag LOCUS_13460 <3286 2636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KJ92:cytidylate kinase >Feature sequence0392 634 1083 gene locus_tag LOCUS_13470 634 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1481 2917 gene locus_tag LOCUS_13480 1481 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence0393 1978 932 gene locus_tag LOCUS_13490 1978 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence0394 1140 1664 gene locus_tag LOCUS_13500 1140 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_13500 1686 2189 gene locus_tag LOCUS_13510 1686 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence0395 229 774 gene locus_tag LOCUS_13520 229 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 834 3182 gene locus_tag LOCUS_13530 834 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence0396 295 906 gene locus_tag LOCUS_13540 295 906 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726F4 protein_id gnl|my_center|LOCUS_13540 937 1488 gene locus_tag LOCUS_13550 937 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 2397 1558 gene locus_tag LOCUS_13560 2397 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 3054 2413 gene locus_tag LOCUS_13570 3054 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence0397 989 681 gene locus_tag LOCUS_13580 989 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 2018 1086 gene locus_tag LOCUS_13590 gene rsmH 2018 1086 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG80 protein_id gnl|my_center|LOCUS_13590 2577 2023 gene locus_tag LOCUS_13600 2577 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence0398 2 967 gene locus_tag LOCUS_13610 2 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1095 1499 gene locus_tag LOCUS_13620 1095 1499 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083958.1 protein_id gnl|my_center|LOCUS_13620 1533 2831 gene locus_tag LOCUS_13630 1533 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 3184 2816 gene locus_tag LOCUS_13640 gene trxC 3184 2816 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811007.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence0399 1416 2435 gene locus_tag LOCUS_13650 1416 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 <3253 2518 gene locus_tag LOCUS_13660 <3253 2518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_233096.2:sensor protein TorS >Feature sequence0400 696 73 gene locus_tag LOCUS_13670 gene ribC 696 73 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262006.1 protein_id gnl|my_center|LOCUS_13670 1131 889 gene locus_tag LOCUS_13680 1131 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13680 2941 1121 gene locus_tag LOCUS_13690 gene glyS 2941 1121 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXQ5 protein_id gnl|my_center|LOCUS_13690 >Feature sequence0401 <1 1311 gene locus_tag LOCUS_13700 <1 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140479.1:magnesium chelatase 1606 2655 gene locus_tag LOCUS_13710 gene recA 1606 2655 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0DH59 protein_id gnl|my_center|LOCUS_13710 >Feature sequence0402 4 1362 gene locus_tag LOCUS_13720 4 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1981 1415 gene locus_tag LOCUS_13730 1981 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence0403 >Feature sequence0404 >Feature sequence0405 1258 2595 gene locus_tag LOCUS_13740 gene hflX 1258 2595 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD7 protein_id gnl|my_center|LOCUS_13740 >Feature sequence0406 1491 580 gene locus_tag LOCUS_13750 1491 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1654 2766 gene locus_tag LOCUS_13760 gene rhlE-2 1654 2766 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence0407 >Feature sequence0408 1458 2246 gene locus_tag LOCUS_13770 gene cobB2 1458 2246 CDS product NAD-dependent protein deacylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885X7 protein_id gnl|my_center|LOCUS_13770 >Feature sequence0409 78 728 gene locus_tag LOCUS_13780 78 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 762 1571 gene locus_tag LOCUS_13790 762 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3172 1583 gene locus_tag LOCUS_13800 3172 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence0410 2283 1006 gene locus_tag LOCUS_13810 2283 1006 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403883.1 protein_id gnl|my_center|LOCUS_13810 3206 2280 gene locus_tag LOCUS_13820 3206 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13820 >Feature sequence0411 46 1083 gene locus_tag LOCUS_13830 46 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1058 1717 gene locus_tag LOCUS_13840 1058 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 1727 2701 gene locus_tag LOCUS_13850 1727 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence0412 2343 535 gene locus_tag LOCUS_13860 2343 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence0413 743 210 gene locus_tag LOCUS_13870 743 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1192 884 gene locus_tag LOCUS_13880 1192 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 2491 1214 gene locus_tag LOCUS_13890 2491 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3175 2495 gene locus_tag LOCUS_13900 3175 2495 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709525.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence0414 2495 3 gene locus_tag LOCUS_13910 2495 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2580 3005 gene locus_tag LOCUS_13920 2580 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence0415 540 2870 gene locus_tag LOCUS_13930 540 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence0416 1624 725 gene locus_tag LOCUS_13940 1624 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2247 1624 gene locus_tag LOCUS_13950 2247 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 2661 3095 gene locus_tag LOCUS_13960 2661 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence0417 >Feature sequence0418 139 363 gene locus_tag LOCUS_13970 139 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 360 1064 gene locus_tag LOCUS_13980 360 1064 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 protein_id gnl|my_center|LOCUS_13980 1061 2266 gene locus_tag LOCUS_13990 1061 2266 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339253.1 protein_id gnl|my_center|LOCUS_13990 2832 2326 gene locus_tag LOCUS_14000 2832 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence0419 2618 885 gene locus_tag LOCUS_14010 2618 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence0420 500 9 gene locus_tag LOCUS_14020 500 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 745 572 gene locus_tag LOCUS_14030 745 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1927 746 gene locus_tag LOCUS_14040 1927 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 3080 2019 gene locus_tag LOCUS_14050 3080 2019 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727207.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence0421 1469 684 gene locus_tag LOCUS_14060 1469 684 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107567.1 protein_id gnl|my_center|LOCUS_14060 2742 1504 gene locus_tag LOCUS_14070 2742 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence0422 825 109 gene locus_tag LOCUS_14080 825 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 904 2043 gene locus_tag LOCUS_14090 904 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2651 2741 gene locus_tag LOCUS_t00060 2651 2741 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0423 924 91 gene locus_tag LOCUS_14100 924 91 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_14100 2495 921 gene locus_tag LOCUS_14110 2495 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence0424 73 594 gene locus_tag LOCUS_14120 gene rnhA 73 594 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH79 protein_id gnl|my_center|LOCUS_14120 2142 757 gene locus_tag LOCUS_14130 2142 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence0425 >Feature sequence0426 1977 1513 gene locus_tag LOCUS_14140 1977 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence0427 303 1037 gene locus_tag LOCUS_14150 303 1037 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401656.1 protein_id gnl|my_center|LOCUS_14150 1034 1312 gene locus_tag LOCUS_14160 1034 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1230 1775 gene locus_tag LOCUS_14170 1230 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence0428 1434 2519 gene locus_tag LOCUS_14180 1434 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence0429 506 1708 gene locus_tag LOCUS_14190 506 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence0430 813 70 gene locus_tag LOCUS_14200 813 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1869 829 gene locus_tag LOCUS_14210 1869 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence0431 651 391 gene locus_tag LOCUS_14220 651 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2085 1189 gene locus_tag LOCUS_14230 2085 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 2940 2248 gene locus_tag LOCUS_14240 2940 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence0432 1692 1859 gene locus_tag LOCUS_14250 1692 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1861 2382 gene locus_tag LOCUS_14260 1861 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence0433 <1 1130 gene locus_tag LOCUS_14270 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CT7:biotin synthase 1131 2249 gene locus_tag LOCUS_14280 gene bioF 1131 2249 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749W3 protein_id gnl|my_center|LOCUS_14280 >Feature sequence0434 795 1799 gene locus_tag LOCUS_14290 795 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1880 2584 gene locus_tag LOCUS_14300 1880 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence0435 337 951 gene locus_tag LOCUS_14310 337 951 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_14310 948 1454 gene locus_tag LOCUS_14320 948 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2841 1456 gene locus_tag LOCUS_14330 2841 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence0436 1627 1328 gene locus_tag LOCUS_14340 1627 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2025 1627 gene locus_tag LOCUS_14350 2025 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 2795 2025 gene locus_tag LOCUS_14360 2795 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence0437 590 252 gene locus_tag LOCUS_14370 590 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1926 652 gene locus_tag LOCUS_14380 gene hemL 1926 652 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPI4 protein_id gnl|my_center|LOCUS_14380 >Feature sequence0438 296 3055 gene locus_tag LOCUS_14390 296 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence0439 3 1019 gene locus_tag LOCUS_14400 3 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1979 1092 gene locus_tag LOCUS_14410 gene pilD 1979 1092 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ8 protein_id gnl|my_center|LOCUS_14410 3052 1976 gene locus_tag LOCUS_14420 3052 1976 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056557.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence0440 230 748 gene locus_tag LOCUS_14430 230 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 745 1272 gene locus_tag LOCUS_14440 745 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence0441 473 1363 gene locus_tag LOCUS_14450 473 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence0442 1973 588 gene locus_tag LOCUS_14460 1973 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence0443 >Feature sequence0444 <1 1088 gene locus_tag LOCUS_14470 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886881.1:6-aminohexanoate-cyclic-dimer hydrolase 1095 2510 gene locus_tag LOCUS_14480 gene norM 1095 2510 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943751.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence0445 963 1808 gene locus_tag LOCUS_14490 963 1808 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527134.1 protein_id gnl|my_center|LOCUS_14490 <3051 1889 gene locus_tag LOCUS_14500 <3051 1889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72BQ0:RNA polymerase sigma factor >Feature sequence0446 355 14 gene locus_tag LOCUS_14510 355 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14510 1275 436 gene locus_tag LOCUS_14520 1275 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14520 1561 2142 gene locus_tag LOCUS_14530 1561 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2129 2839 gene locus_tag LOCUS_14540 2129 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence0447 <1 560 gene locus_tag LOCUS_14550 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942523.1:two-component sensor histidine kinase 557 1321 gene locus_tag LOCUS_14560 557 1321 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121044.1 protein_id gnl|my_center|LOCUS_14560 1322 1687 gene locus_tag LOCUS_14570 gene bolA 1322 1687 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 protein_id gnl|my_center|LOCUS_14570 <3044 1693 gene locus_tag LOCUS_14580 <3044 1693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001130104.1:two-component sensor histidine kinase >Feature sequence0448 2711 1437 gene locus_tag LOCUS_14590 2711 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence0449 1220 321 gene locus_tag LOCUS_14600 1220 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1463 2098 gene locus_tag LOCUS_14610 1463 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2108 2275 gene locus_tag LOCUS_14620 2108 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 2272 2943 gene locus_tag LOCUS_14630 2272 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence0450 652 29 gene locus_tag LOCUS_14640 652 29 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_14640 830 1363 gene locus_tag LOCUS_14650 830 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1485 1817 gene locus_tag LOCUS_14660 1485 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1920 2759 gene locus_tag LOCUS_14670 1920 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence0451 2148 2810 gene locus_tag LOCUS_14680 2148 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence0452 1410 46 gene locus_tag LOCUS_14690 1410 46 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942633.1 protein_id gnl|my_center|LOCUS_14690 2798 1407 gene locus_tag LOCUS_14700 2798 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence0453 877 2631 gene locus_tag LOCUS_14710 877 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence0454 1632 661 gene locus_tag LOCUS_14720 1632 661 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769151.1 protein_id gnl|my_center|LOCUS_14720 2584 1625 gene locus_tag LOCUS_14730 2584 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence0455 <1 893 gene locus_tag LOCUS_14740 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GG6:chromosomal replication initiator protein DnaA 1514 2632 gene locus_tag LOCUS_14750 gene dnaN 1514 2632 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H91 protein_id gnl|my_center|LOCUS_14750 >Feature sequence0456 1899 955 gene locus_tag LOCUS_14760 1899 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 <3013 1981 gene locus_tag LOCUS_14770 <3013 1981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000572082.1:acyl-CoA dehydrogenase >Feature sequence0457 416 1174 gene locus_tag LOCUS_14780 416 1174 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_14780 1171 1635 gene locus_tag LOCUS_14790 1171 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence0458 588 2018 gene locus_tag LOCUS_14800 588 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 2051 2575 gene locus_tag LOCUS_14810 2051 2575 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073611.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence0459 >Feature sequence0460 423 190 gene locus_tag LOCUS_14820 423 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 2196 619 gene locus_tag LOCUS_14830 2196 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 2963 2193 gene locus_tag LOCUS_14840 gene truA 2963 2193 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60350 protein_id gnl|my_center|LOCUS_14840 >Feature sequence0461 810 328 gene locus_tag LOCUS_14850 810 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2855 807 gene locus_tag LOCUS_14860 2855 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence0462 829 1986 gene locus_tag LOCUS_14870 829 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2647 2003 gene locus_tag LOCUS_14880 gene omt 2647 2003 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880979.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence0463 1566 625 gene locus_tag LOCUS_14890 1566 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1674 2714 gene locus_tag LOCUS_14900 1674 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence0464 840 274 gene locus_tag LOCUS_14910 840 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1879 851 gene locus_tag LOCUS_14920 1879 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 <2993 1876 gene locus_tag LOCUS_14930 <2993 1876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390553.1:radical SAM protein >Feature sequence0465 >Feature sequence0466 1168 389 gene locus_tag LOCUS_14940 1168 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence0467 79 1047 gene locus_tag LOCUS_14950 79 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1226 2050 gene locus_tag LOCUS_14960 1226 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 2841 2062 gene locus_tag LOCUS_14970 2841 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence0468 <2987 1889 gene locus_tag LOCUS_14980 <2987 1889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265799.1:N-methylhydantoinase HyuB >Feature sequence0469 460 867 gene locus_tag LOCUS_14990 460 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 2359 890 gene locus_tag LOCUS_15000 2359 890 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776263.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence0470 371 697 gene locus_tag LOCUS_15010 371 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 912 1250 gene locus_tag LOCUS_15020 912 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 <2985 1364 gene locus_tag LOCUS_15030 <2985 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941243.1:pyruvate, phosphate dikinase >Feature sequence0471 <1 1595 gene locus_tag LOCUS_15040 <1 1595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533619.1:histone deacetylase 2348 1620 gene locus_tag LOCUS_15050 2348 1620 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140009.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence0472 2 1102 gene locus_tag LOCUS_15060 2 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1954 1175 gene locus_tag LOCUS_15070 1954 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2059 2532 gene locus_tag LOCUS_15080 2059 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence0473 397 1113 gene locus_tag LOCUS_15090 gene rplA 397 1113 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y3 protein_id gnl|my_center|LOCUS_15090 1124 1666 gene locus_tag LOCUS_15100 gene rplJ 1124 1666 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y4 protein_id gnl|my_center|LOCUS_15100 1754 2131 gene locus_tag LOCUS_15110 gene rplL 1754 2131 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PI32 protein_id gnl|my_center|LOCUS_15110 2358 2155 gene locus_tag LOCUS_15120 2358 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence0474 927 244 gene locus_tag LOCUS_15130 927 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2299 983 gene locus_tag LOCUS_15140 2299 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence0475 1 1287 gene locus_tag LOCUS_15150 1 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1297 1920 gene locus_tag LOCUS_15160 gene tdk 1297 1920 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZH4 protein_id gnl|my_center|LOCUS_15160 2412 1942 gene locus_tag LOCUS_15170 2412 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence0476 923 54 gene locus_tag LOCUS_15180 923 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1395 814 gene locus_tag LOCUS_15190 1395 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1394 1609 gene locus_tag LOCUS_15200 1394 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence0477 522 1088 gene locus_tag LOCUS_15210 522 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1276 2829 gene locus_tag LOCUS_15220 gene paaN 1276 2829 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709127.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence0478 817 2259 gene locus_tag LOCUS_15230 817 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence0479 2763 1051 gene locus_tag LOCUS_15240 2763 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence0480 456 1868 gene locus_tag LOCUS_15250 456 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence0481 1351 2622 gene locus_tag LOCUS_15260 gene serS 1351 2622 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE34 protein_id gnl|my_center|LOCUS_15260 >Feature sequence0482 2167 1307 gene locus_tag LOCUS_15270 2167 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_15270 <2933 2190 gene locus_tag LOCUS_15280 <2933 2190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775844.1:cation diffusion facilitator transporter >Feature sequence0483 1282 872 gene locus_tag LOCUS_15290 1282 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1431 2219 gene locus_tag LOCUS_15300 1431 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 2152 2349 gene locus_tag LOCUS_15310 2152 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence0484 1016 1936 gene locus_tag LOCUS_15320 1016 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence0485 183 1019 gene locus_tag LOCUS_15330 183 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1174 2049 gene locus_tag LOCUS_15340 1174 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404420.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence0486 257 1126 gene locus_tag LOCUS_15350 257 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1158 2360 gene locus_tag LOCUS_15360 1158 2360 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942641.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence0487 2402 423 gene locus_tag LOCUS_15370 2402 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence0488 2812 1619 gene locus_tag LOCUS_15380 2812 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence0489 1201 1692 gene locus_tag LOCUS_15390 1201 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2688 1783 gene locus_tag LOCUS_15400 2688 1783 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728098.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence0490 191 1633 gene locus_tag LOCUS_15410 191 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence0491 688 1953 gene locus_tag LOCUS_15420 688 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 2832 1981 gene locus_tag LOCUS_15430 2832 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence0492 2188 101 gene locus_tag LOCUS_15440 gene fusA 2188 101 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence0493 >Feature sequence0494 946 1689 gene locus_tag LOCUS_15450 946 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 <2915 2205 gene locus_tag LOCUS_15460 <2915 2205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228363.1:RNA polymerase sigma factor SigJ >Feature sequence0495 27 710 gene locus_tag LOCUS_15470 27 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 2507 1119 gene locus_tag LOCUS_15480 2507 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence0496 705 157 gene locus_tag LOCUS_15490 705 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1096 1299 gene locus_tag LOCUS_15500 1096 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1360 1668 gene locus_tag LOCUS_15510 1360 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 2210 1671 gene locus_tag LOCUS_15520 2210 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938961.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence0497 686 1426 gene locus_tag LOCUS_15530 686 1426 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence0498 <1 2073 gene locus_tag LOCUS_15540 <1 2073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943139.1:spermidine synthase 2796 2083 gene locus_tag LOCUS_15550 2796 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15550 >Feature sequence0499 585 100 gene locus_tag LOCUS_15560 585 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1201 878 gene locus_tag LOCUS_15570 1201 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1775 1275 gene locus_tag LOCUS_15580 1775 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 2061 2387 gene locus_tag LOCUS_15590 2061 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence0500 >Feature sequence0501 1962 280 gene locus_tag LOCUS_15600 1962 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 <2888 2227 gene locus_tag LOCUS_15610 <2888 2227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006310172.1:coproporphyrinogen III oxidase >Feature sequence0502 1478 645 gene locus_tag LOCUS_15620 1478 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1951 2391 gene locus_tag LOCUS_15630 1951 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence0503 1895 2617 gene locus_tag LOCUS_15640 1895 2617 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence0504 >Feature sequence0505 1671 1354 gene locus_tag LOCUS_15650 gene ccmL 1671 1354 CDS product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_15650 2157 1864 gene locus_tag LOCUS_15660 gene cchA 2157 1864 CDS product ethanolamine utilization protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_15660 <2862 2232 gene locus_tag LOCUS_15670 <2862 2232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141518.1:BMC domain-containing protein >Feature sequence0506 1739 48 gene locus_tag LOCUS_15680 1739 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence0507 2846 2349 gene locus_tag LOCUS_15690 2846 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence0508 >Feature sequence0509 123 728 gene locus_tag LOCUS_15700 123 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 800 2617 gene locus_tag LOCUS_15710 800 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence0510 426 2381 gene locus_tag LOCUS_15720 426 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2436 2669 gene locus_tag LOCUS_15730 2436 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence0511 <2848 1011 gene locus_tag LOCUS_15740 <2848 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393062.1:twitching motility protein PilT >Feature sequence0512 201 653 gene locus_tag LOCUS_15750 201 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 667 1722 gene locus_tag LOCUS_15760 667 1722 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_15760 1762 2478 gene locus_tag LOCUS_15770 1762 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence0513 464 766 gene locus_tag LOCUS_15780 464 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 1716 856 gene locus_tag LOCUS_15790 1716 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2694 1780 gene locus_tag LOCUS_15800 gene pyrF 2694 1780 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 protein_id gnl|my_center|LOCUS_15800 >Feature sequence0514 2818 2375 gene locus_tag LOCUS_15810 2818 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence0515 >Feature sequence0516 <1 1167 gene locus_tag LOCUS_15820 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FKG0:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD 1440 1994 gene locus_tag LOCUS_15830 1440 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence0517 1307 1816 gene locus_tag LOCUS_15840 1307 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence0518 1258 317 gene locus_tag LOCUS_15850 1258 317 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970167.1 protein_id gnl|my_center|LOCUS_15850 1354 2145 gene locus_tag LOCUS_15860 1354 2145 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UDY5 protein_id gnl|my_center|LOCUS_15860 >Feature sequence0519 51 497 gene locus_tag LOCUS_15870 51 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_15870 612 1961 gene locus_tag LOCUS_15880 612 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2748 1987 gene locus_tag LOCUS_15890 2748 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence0520 2159 2758 gene locus_tag LOCUS_15900 2159 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence0521 1895 1428 gene locus_tag LOCUS_15910 1895 1428 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894042.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence0522 1273 1980 gene locus_tag LOCUS_15920 1273 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence0523 613 1383 gene locus_tag LOCUS_15930 613 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence0524 701 228 gene locus_tag LOCUS_15940 gene ccmE 701 228 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIG4 protein_id gnl|my_center|LOCUS_15940 853 698 gene locus_tag LOCUS_15950 853 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1589 855 gene locus_tag LOCUS_15960 1589 855 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_15960 2266 1586 gene locus_tag LOCUS_15970 gene ccmB 2266 1586 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938347.1 protein_id gnl|my_center|LOCUS_15970 <2827 2263 gene locus_tag LOCUS_15980 <2827 2263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028963.1:daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein >Feature sequence0525 2730 1849 gene locus_tag LOCUS_15990 2730 1849 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence0526 1488 2369 gene locus_tag LOCUS_16000 gene cynR 1488 2369 CDS product HTH-type transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X4M5 protein_id gnl|my_center|LOCUS_16000 >Feature sequence0527 <1 1535 gene locus_tag LOCUS_16010 <1 1535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K0MM66:Lon protease 1561 1902 gene locus_tag LOCUS_16020 1561 1902 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence0528 1056 61 gene locus_tag LOCUS_16030 1056 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence0529 1658 876 gene locus_tag LOCUS_16040 1658 876 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425498.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence0530 648 2342 gene locus_tag LOCUS_16050 648 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence0531 1169 2572 gene locus_tag LOCUS_16060 1169 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence0532 >Feature sequence0533 764 2110 gene locus_tag LOCUS_16070 764 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence0534 420 1211 gene locus_tag LOCUS_16080 gene fdhD 420 1211 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNU3 protein_id gnl|my_center|LOCUS_16080 1213 2358 gene locus_tag LOCUS_16090 1213 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence0535 3 884 gene locus_tag LOCUS_16100 3 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 969 1853 gene locus_tag LOCUS_16110 969 1853 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388612.1 protein_id gnl|my_center|LOCUS_16110 <2796 1876 gene locus_tag LOCUS_16120 <2796 1876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921391.1:CoA transferase >Feature sequence0536 1114 218 gene locus_tag LOCUS_16130 1114 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 2511 1132 gene locus_tag LOCUS_16140 2511 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence0537 2794 2009 gene locus_tag LOCUS_16150 2794 2009 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLZ4 protein_id gnl|my_center|LOCUS_16150 >Feature sequence0538 2410 419 gene locus_tag LOCUS_16160 gene uvrd 2410 419 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S575 protein_id gnl|my_center|LOCUS_16160 >Feature sequence0539 >Feature sequence0540 170 2068 gene locus_tag LOCUS_16170 170 2068 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039037.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence0541 1318 965 gene locus_tag LOCUS_16180 gene clpS 1318 965 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BN4 protein_id gnl|my_center|LOCUS_16180 2396 1386 gene locus_tag LOCUS_16190 2396 1386 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227687.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence0542 80 601 gene locus_tag LOCUS_16200 80 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence0543 181 849 gene locus_tag LOCUS_16210 181 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2027 912 gene locus_tag LOCUS_16220 2027 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2788 2126 gene locus_tag LOCUS_16230 2788 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence0544 1892 2074 gene locus_tag LOCUS_16240 1892 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2788 2132 gene locus_tag LOCUS_16250 2788 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence0545 1393 812 gene locus_tag LOCUS_16260 gene udk 1393 812 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCC8 protein_id gnl|my_center|LOCUS_16260 1728 1390 gene locus_tag LOCUS_16270 1728 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 2685 1810 gene locus_tag LOCUS_16280 2685 1810 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229053.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence0546 1681 569 gene locus_tag LOCUS_16290 1681 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1816 2370 gene locus_tag LOCUS_16300 gene ptpA 1816 2370 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_16300 2617 2450 gene locus_tag LOCUS_16310 2617 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence0547 1603 2544 gene locus_tag LOCUS_16320 1603 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence0548 <1 926 gene locus_tag LOCUS_16330 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74D59:proline--tRNA ligase <2779 900 gene locus_tag LOCUS_16340 <2779 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPS8:tRNA(Met) cytidine acetyltransferase TmcA >Feature sequence0549 <1 890 gene locus_tag LOCUS_16350 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030740.1:2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase 887 1222 gene locus_tag LOCUS_16360 gene hiuH 887 1222 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XB75 protein_id gnl|my_center|LOCUS_16360 1251 2534 gene locus_tag LOCUS_16370 gene guaD 1251 2534 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207678.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence0550 <1 1495 gene locus_tag LOCUS_16380 <1 1495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729770.1:protein kinase 1502 2173 gene locus_tag LOCUS_16390 1502 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence0551 >Feature sequence0552 <1 1172 gene locus_tag LOCUS_16400 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331435.1:transposase 1837 1238 gene locus_tag LOCUS_16410 1837 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 2537 1797 gene locus_tag LOCUS_16420 2537 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence0553 950 2443 gene locus_tag LOCUS_16430 950 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence0554 1443 559 gene locus_tag LOCUS_16440 1443 559 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358617.1 protein_id gnl|my_center|LOCUS_16440 1598 2443 gene locus_tag LOCUS_16450 1598 2443 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086042.1 protein_id gnl|my_center|LOCUS_16450 2768 2616 gene locus_tag LOCUS_16460 2768 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence0555 1128 418 gene locus_tag LOCUS_16470 1128 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1910 1125 gene locus_tag LOCUS_16480 gene recO 1910 1125 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCB6 protein_id gnl|my_center|LOCUS_16480 <2764 1927 gene locus_tag LOCUS_16490 <2764 1927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7V9N7:magnesium transporter MgtE >Feature sequence0556 114 1862 gene locus_tag LOCUS_16500 114 1862 CDS product nodulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence0557 <1 1375 gene locus_tag LOCUS_16510 <1 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943442.1:histidine kinase 1840 1397 gene locus_tag LOCUS_16520 1840 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2393 1740 gene locus_tag LOCUS_16530 2393 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence0558 2019 1447 gene locus_tag LOCUS_16540 2019 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence0559 213 2735 gene locus_tag LOCUS_16550 213 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence0560 768 1706 gene locus_tag LOCUS_16560 768 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence0561 740 462 gene locus_tag LOCUS_16570 740 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1555 737 gene locus_tag LOCUS_16580 gene minD 1555 737 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B12 protein_id gnl|my_center|LOCUS_16580 <2750 1614 gene locus_tag LOCUS_16590 <2750 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228504.1:septum site-determining protein MinC >Feature sequence0562 >Feature sequence0563 1355 597 gene locus_tag LOCUS_16600 1355 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2257 1352 gene locus_tag LOCUS_16610 2257 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 2628 2254 gene locus_tag LOCUS_16620 2628 2254 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403946.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence0564 >Feature sequence0565 2736 1417 gene locus_tag LOCUS_16630 2736 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence0566 >Feature sequence0567 >Feature sequence0568 900 421 gene locus_tag LOCUS_16640 900 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1059 2561 gene locus_tag LOCUS_16650 1059 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2714 2565 gene locus_tag LOCUS_16660 2714 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence0569 987 739 gene locus_tag LOCUS_16670 987 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1147 1926 gene locus_tag LOCUS_16680 gene proC 1147 1926 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK62 protein_id gnl|my_center|LOCUS_16680 >Feature sequence0570 627 1070 gene locus_tag LOCUS_16690 627 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1073 2206 gene locus_tag LOCUS_16700 1073 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence0571 2591 957 gene locus_tag LOCUS_16710 2591 957 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS89 protein_id gnl|my_center|LOCUS_16710 >Feature sequence0572 1207 149 gene locus_tag LOCUS_16720 1207 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1703 1254 gene locus_tag LOCUS_16730 1703 1254 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225379.1 protein_id gnl|my_center|LOCUS_16730 2166 1723 gene locus_tag LOCUS_16740 2166 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence0573 2534 720 gene locus_tag LOCUS_16750 2534 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence0574 493 2070 gene locus_tag LOCUS_16760 493 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 <2733 2138 gene locus_tag LOCUS_16770 <2733 2138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804122.1:arylsulfatase A family protein >Feature sequence0575 203 709 gene locus_tag LOCUS_16780 203 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1936 770 gene locus_tag LOCUS_16790 gene plsX 1936 770 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CS5 protein_id gnl|my_center|LOCUS_16790 2059 2379 gene locus_tag LOCUS_16800 2059 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2732 2406 gene locus_tag LOCUS_16810 2732 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence0576 >Feature sequence0577 >Feature sequence0578 711 418 gene locus_tag LOCUS_16820 711 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 <2713 790 gene locus_tag LOCUS_16830 <2713 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DLG5:ATP-dependent zinc metalloprotease FtsH >Feature sequence0579 <1 615 gene locus_tag LOCUS_16840 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939596.1:UTP--glucose-1-phosphate uridylyltransferase note possible pseudo, frameshifted 1517 759 gene locus_tag LOCUS_16850 1517 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence0580 1908 250 gene locus_tag LOCUS_16860 1908 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_16860 <2709 1934 gene locus_tag LOCUS_16870 <2709 1934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679924.1:membrane protein >Feature sequence0581 725 435 gene locus_tag LOCUS_16880 725 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1410 634 gene locus_tag LOCUS_16890 1410 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1664 1407 gene locus_tag LOCUS_16900 1664 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 2444 1716 gene locus_tag LOCUS_16910 gene ate1 2444 1716 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UET6 protein_id gnl|my_center|LOCUS_16910 >Feature sequence0582 1192 11 gene locus_tag LOCUS_16920 1192 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2253 1201 gene locus_tag LOCUS_16930 2253 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence0583 305 1066 gene locus_tag LOCUS_16940 305 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 2176 1079 gene locus_tag LOCUS_16950 2176 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388632.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence0584 535 1887 gene locus_tag LOCUS_16960 535 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence0585 490 113 gene locus_tag LOCUS_16970 490 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1680 499 gene locus_tag LOCUS_16980 1680 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 2545 1667 gene locus_tag LOCUS_16990 2545 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence0586 466 122 gene locus_tag LOCUS_17000 466 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1933 491 gene locus_tag LOCUS_17010 1933 491 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGN4 protein_id gnl|my_center|LOCUS_17010 2696 2235 gene locus_tag LOCUS_17020 2696 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence0587 1674 7 gene locus_tag LOCUS_17030 1674 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence0588 >Feature sequence0589 1592 342 gene locus_tag LOCUS_17040 1592 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1699 2469 gene locus_tag LOCUS_17050 gene pdxJ 1699 2469 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5Z9 protein_id gnl|my_center|LOCUS_17050 >Feature sequence0590 986 297 gene locus_tag LOCUS_17060 986 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2153 1254 gene locus_tag LOCUS_17070 2153 1254 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence0591 <2687 1956 gene locus_tag LOCUS_17080 <2687 1956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H90:DNA replication and repair protein RecF >Feature sequence0592 658 2268 gene locus_tag LOCUS_17090 658 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence0593 879 196 gene locus_tag LOCUS_17100 879 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 2181 1141 gene locus_tag LOCUS_17110 2181 1141 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_17110 <2682 2178 gene locus_tag LOCUS_17120 <2682 2178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920232.1:methylmalonyl-CoA mutase >Feature sequence0594 1546 359 gene locus_tag LOCUS_17130 1546 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1940 1482 gene locus_tag LOCUS_17140 1940 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 2221 1928 gene locus_tag LOCUS_17150 2221 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 >Feature sequence0595 475 1524 gene locus_tag LOCUS_17160 475 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence0596 2034 742 gene locus_tag LOCUS_17170 2034 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 982 1066 gene locus_tag LOCUS_t00070 982 1066 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2250 2576 gene locus_tag LOCUS_17180 2250 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence0597 991 1305 gene locus_tag LOCUS_17190 991 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2374 1349 gene locus_tag LOCUS_17200 2374 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence0598 2196 1039 gene locus_tag LOCUS_17210 2196 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence0599 884 720 gene locus_tag LOCUS_17220 884 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2395 884 gene locus_tag LOCUS_17230 2395 884 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence0600 558 1502 gene locus_tag LOCUS_17240 558 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1492 2316 gene locus_tag LOCUS_17250 1492 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2619 2356 gene locus_tag LOCUS_17260 2619 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence0601 >Feature sequence0602 419 1042 gene locus_tag LOCUS_17270 gene fixJ 419 1042 CDS product transcriptional regulatory protein FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23221 protein_id gnl|my_center|LOCUS_17270 2455 1211 gene locus_tag LOCUS_17280 2455 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence0603 1793 891 gene locus_tag LOCUS_17290 1793 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence0604 593 1120 gene locus_tag LOCUS_17300 593 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1175 2260 gene locus_tag LOCUS_17310 1175 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence0605 >Feature sequence0606 1879 941 gene locus_tag LOCUS_17320 1879 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence0607 1029 1964 gene locus_tag LOCUS_17330 1029 1964 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119887.1 protein_id gnl|my_center|LOCUS_17330 2543 2055 gene locus_tag LOCUS_17340 2543 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence0608 1273 2601 gene locus_tag LOCUS_17350 1273 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence0609 14 538 gene locus_tag LOCUS_17360 14 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence0610 1841 48 gene locus_tag LOCUS_17370 1841 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence0611 712 1044 gene locus_tag LOCUS_17380 712 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1058 2266 gene locus_tag LOCUS_17390 1058 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence0612 1766 1119 gene locus_tag LOCUS_17400 1766 1119 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888822.1 protein_id gnl|my_center|LOCUS_17400 2334 1756 gene locus_tag LOCUS_17410 2334 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence0613 <1 1957 gene locus_tag LOCUS_17420 <1 1957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144124.1:proteinase >Feature sequence0614 1055 171 gene locus_tag LOCUS_17430 1055 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_17430 1200 1619 gene locus_tag LOCUS_17440 gene ndk 1200 1619 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QX9 protein_id gnl|my_center|LOCUS_17440 1800 2591 gene locus_tag LOCUS_17450 1800 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence0615 465 1424 gene locus_tag LOCUS_17460 465 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 557 650 gene locus_tag LOCUS_t00080 557 650 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1777 1412 gene locus_tag LOCUS_17470 1777 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence0616 291 1217 gene locus_tag LOCUS_17480 291 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17480 1310 1552 gene locus_tag LOCUS_17490 1310 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence0617 815 498 gene locus_tag LOCUS_17500 815 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 979 1992 gene locus_tag LOCUS_17510 979 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 1993 2589 gene locus_tag LOCUS_17520 1993 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence0618 42 1097 gene locus_tag LOCUS_17530 42 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 980 1969 gene locus_tag LOCUS_17540 980 1969 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229152.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence0619 >Feature sequence0620 1897 278 gene locus_tag LOCUS_17550 1897 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2608 2198 gene locus_tag LOCUS_17560 2608 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence0621 347 793 gene locus_tag LOCUS_17570 347 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 916 1524 gene locus_tag LOCUS_17580 916 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1517 2092 gene locus_tag LOCUS_17590 gene atpH 1517 2092 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY3 protein_id gnl|my_center|LOCUS_17590 >Feature sequence0622 >Feature sequence0623 <1 565 gene locus_tag LOCUS_17600 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942469.1:CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase 1912 572 gene locus_tag LOCUS_17610 1912 572 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038470.1 protein_id gnl|my_center|LOCUS_17610 <2601 1899 gene locus_tag LOCUS_17620 <2601 1899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038469.1:amidohydrolase >Feature sequence0624 2229 232 gene locus_tag LOCUS_17630 2229 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence0625 1494 943 gene locus_tag LOCUS_17640 1494 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1961 1494 gene locus_tag LOCUS_17650 1961 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2301 1954 gene locus_tag LOCUS_17660 2301 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence0626 1096 494 gene locus_tag LOCUS_17670 1096 494 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640214.1 protein_id gnl|my_center|LOCUS_17670 1220 2125 gene locus_tag LOCUS_17680 1220 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 2597 2130 gene locus_tag LOCUS_17690 2597 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence0627 2504 1908 gene locus_tag LOCUS_17700 2504 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence0628 1869 952 gene locus_tag LOCUS_17710 1869 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2293 1916 gene locus_tag LOCUS_17720 2293 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence0629 >Feature sequence0630 <1 1553 gene locus_tag LOCUS_17730 <1 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B9U6:formate--tetrahydrofolate ligase >Feature sequence0631 246 1835 gene locus_tag LOCUS_17740 246 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence0632 <2589 1942 gene locus_tag LOCUS_17750 <2589 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229196.1:NADH(P)-binding protein >Feature sequence0633 <1 532 gene locus_tag LOCUS_17760 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939632.1:Fis family transcriptional regulator 576 2234 gene locus_tag LOCUS_17770 576 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898877.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence0634 992 1726 gene locus_tag LOCUS_17780 992 1726 CDS product NADH-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_17780 2535 1735 gene locus_tag LOCUS_17790 2535 1735 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229555.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence0635 708 25 gene locus_tag LOCUS_17800 708 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 2246 789 gene locus_tag LOCUS_17810 2246 789 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938761.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence0636 29 808 gene locus_tag LOCUS_17820 29 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 901 1071 gene locus_tag LOCUS_17830 901 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2237 1185 gene locus_tag LOCUS_17840 gene holB 2237 1185 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence0637 >Feature sequence0638 1143 238 gene locus_tag LOCUS_17850 1143 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 1666 1118 gene locus_tag LOCUS_17860 1666 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 <2569 1946 gene locus_tag LOCUS_17870 <2569 1946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143952.1:thioredoxin family protein >Feature sequence0639 <1 645 gene locus_tag LOCUS_17880 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R5M8:histidine N-alpha-methyltransferase 645 2036 gene locus_tag LOCUS_17890 645 2036 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141636.1 protein_id gnl|my_center|LOCUS_17890 <2567 2002 gene locus_tag LOCUS_17900 <2567 2002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228834.1:maltose ABC transporter permease >Feature sequence0640 1091 921 gene locus_tag LOCUS_17910 1091 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 2063 1092 gene locus_tag LOCUS_17920 2063 1092 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJG0 protein_id gnl|my_center|LOCUS_17920 >Feature sequence0641 >Feature sequence0642 1150 320 gene locus_tag LOCUS_17930 1150 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence0643 882 1565 gene locus_tag LOCUS_17940 882 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1574 2179 gene locus_tag LOCUS_17950 1574 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence0644 1461 757 gene locus_tag LOCUS_17960 1461 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence0645 <1 1016 gene locus_tag LOCUS_17970 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q56232:aspartate aminotransferase >Feature sequence0646 662 1774 gene locus_tag LOCUS_17980 662 1774 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNU6 protein_id gnl|my_center|LOCUS_17980 >Feature sequence0647 <1 869 gene locus_tag LOCUS_17990 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784442.1:ABC transporter ATP-binding protein 1450 911 gene locus_tag LOCUS_18000 1450 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1542 2147 gene locus_tag LOCUS_18010 1542 2147 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706359.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence0648 159 1103 gene locus_tag LOCUS_18020 159 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 protein_id gnl|my_center|LOCUS_18020 1281 1120 gene locus_tag LOCUS_18030 1281 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 2085 1357 gene locus_tag LOCUS_18040 2085 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2120 2425 gene locus_tag LOCUS_18050 2120 2425 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945908.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence0649 532 1476 gene locus_tag LOCUS_18060 532 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225285.1 protein_id gnl|my_center|LOCUS_18060 1843 2421 gene locus_tag LOCUS_18070 1843 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence0650 651 250 gene locus_tag LOCUS_18080 651 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2342 648 gene locus_tag LOCUS_18090 2342 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence0651 241 948 gene locus_tag LOCUS_18100 241 948 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532061.1 protein_id gnl|my_center|LOCUS_18100 996 1760 gene locus_tag LOCUS_18110 996 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1829 2512 gene locus_tag LOCUS_18120 1829 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence0652 661 386 gene locus_tag LOCUS_18130 661 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1572 736 gene locus_tag LOCUS_18140 gene crt 1572 736 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939802.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence0653 3 455 gene locus_tag LOCUS_18150 3 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 480 2126 gene locus_tag LOCUS_18160 480 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence0654 465 689 gene locus_tag LOCUS_18170 465 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1094 693 gene locus_tag LOCUS_18180 1094 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 <2531 1271 gene locus_tag LOCUS_18190 <2531 1271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001280808.1:acetyl-CoA acetyltransferase >Feature sequence0655 >Feature sequence0656 1157 2305 gene locus_tag LOCUS_18200 1157 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence0657 768 1973 gene locus_tag LOCUS_18210 768 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence0658 2457 781 gene locus_tag LOCUS_18220 2457 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence0659 2181 802 gene locus_tag LOCUS_18230 gene murF 2181 802 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9Q4 protein_id gnl|my_center|LOCUS_18230 >Feature sequence0660 1324 716 gene locus_tag LOCUS_18240 1324 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1926 1321 gene locus_tag LOCUS_18250 1926 1321 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976220.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence0661 133 687 gene locus_tag LOCUS_18260 133 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1596 691 gene locus_tag LOCUS_18270 1596 691 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_18270 2510 1593 gene locus_tag LOCUS_18280 2510 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence0662 1602 835 gene locus_tag LOCUS_18290 1602 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence0663 1256 222 gene locus_tag LOCUS_18300 1256 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943375.1 protein_id gnl|my_center|LOCUS_18300 2163 1387 gene locus_tag LOCUS_18310 2163 1387 CDS product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113649.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence0664 2184 1225 gene locus_tag LOCUS_18320 2184 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence0665 495 1898 gene locus_tag LOCUS_18330 495 1898 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203595.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence0666 502 5 gene locus_tag LOCUS_18340 502 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1107 499 gene locus_tag LOCUS_18350 1107 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence0667 <1 1546 gene locus_tag LOCUS_18360 <1 1546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257750.1:succinate dehydrogenase flavoprotein subunit 1543 2295 gene locus_tag LOCUS_18370 1543 2295 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence0668 >Feature sequence0669 581 120 gene locus_tag LOCUS_18380 gene exbD3 581 120 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_18380 1243 581 gene locus_tag LOCUS_18390 gene exbB 1243 581 CDS product TolQ transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177702.1 protein_id gnl|my_center|LOCUS_18390 1538 1463 gene locus_tag LOCUS_t00090 1538 1463 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0670 153 1847 gene locus_tag LOCUS_18400 153 1847 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706882.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence0671 434 2164 gene locus_tag LOCUS_18410 434 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence0672 <2490 920 gene locus_tag LOCUS_18420 <2490 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877386.1:B12-binding domain-containing radical SAM protein >Feature sequence0673 1203 22 gene locus_tag LOCUS_18430 1203 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence0674 >Feature sequence0675 836 1432 gene locus_tag LOCUS_18440 836 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1429 2046 gene locus_tag LOCUS_18450 1429 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence0676 162 416 gene locus_tag LOCUS_18460 162 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 461 1564 gene locus_tag LOCUS_18470 461 1564 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815913.1 protein_id gnl|my_center|LOCUS_18470 1807 1607 gene locus_tag LOCUS_18480 1807 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2483 1860 gene locus_tag LOCUS_18490 2483 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence0677 864 142 gene locus_tag LOCUS_18500 864 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2292 934 gene locus_tag LOCUS_18510 2292 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2481 2329 gene locus_tag LOCUS_18520 2481 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence0678 449 1927 gene locus_tag LOCUS_18530 449 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence0679 1523 2473 gene locus_tag LOCUS_18540 gene pstS 1523 2473 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962532.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence0680 206 1450 gene locus_tag LOCUS_18550 206 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 <2481 1437 gene locus_tag LOCUS_18560 <2481 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9L065:glutamine--fructose-6-phosphate aminotransferase [isomerizing] >Feature sequence0681 1145 165 gene locus_tag LOCUS_18570 1145 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18570 1856 1635 gene locus_tag LOCUS_18580 1856 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2199 2035 gene locus_tag LOCUS_18590 2199 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence0682 >Feature sequence0683 234 1583 gene locus_tag LOCUS_18600 234 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence0684 1127 537 gene locus_tag LOCUS_18610 1127 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1271 2353 gene locus_tag LOCUS_18620 1271 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 >Feature sequence0685 <2464 1241 gene locus_tag LOCUS_18630 <2464 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Z6X5:NAD(P) transhydrogenase subunit alpha >Feature sequence0686 617 1825 gene locus_tag LOCUS_18640 gene add 617 1825 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403444.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence0687 1344 22 gene locus_tag LOCUS_18650 1344 22 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412946.1 protein_id gnl|my_center|LOCUS_18650 <2461 1375 gene locus_tag LOCUS_18660 <2461 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010951099.1:type III restriction endonuclease HindVIP subunit M >Feature sequence0688 999 493 gene locus_tag LOCUS_18670 999 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1805 1110 gene locus_tag LOCUS_18680 1805 1110 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200921.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence0689 1684 977 gene locus_tag LOCUS_18690 1684 977 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 protein_id gnl|my_center|LOCUS_18690 2205 1726 gene locus_tag LOCUS_18700 2205 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 >Feature sequence0690 2280 1093 gene locus_tag LOCUS_18710 2280 1093 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence0691 448 1365 gene locus_tag LOCUS_18720 gene rluD 448 1365 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U1T3 protein_id gnl|my_center|LOCUS_18720 2077 1394 gene locus_tag LOCUS_18730 2077 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082250.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence0692 1014 1751 gene locus_tag LOCUS_18740 1014 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence0693 283 134 gene locus_tag LOCUS_18750 283 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 521 366 gene locus_tag LOCUS_18760 521 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1041 886 gene locus_tag LOCUS_18770 1041 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1905 1276 gene locus_tag LOCUS_18780 1905 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence0694 2085 1039 gene locus_tag LOCUS_18790 2085 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence0695 2446 1337 gene locus_tag LOCUS_18800 2446 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence0696 <2442 287 gene locus_tag LOCUS_18810 <2442 287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein >Feature sequence0697 <2441 968 gene locus_tag LOCUS_18820 <2441 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121964.1:serine hydrolase >Feature sequence0698 821 222 gene locus_tag LOCUS_18830 821 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1166 1897 gene locus_tag LOCUS_18840 1166 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence0699 898 1620 gene locus_tag LOCUS_18850 898 1620 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063877.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence0700 <1 1562 gene locus_tag LOCUS_18860 <1 1562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226762.1:amidohydrolase 1968 1606 gene locus_tag LOCUS_18870 1968 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence0701 >Feature sequence0702 <1 902 gene locus_tag LOCUS_18880 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393418.1:DEAD/DEAH box helicase 899 1237 gene locus_tag LOCUS_18890 899 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2422 1271 gene locus_tag LOCUS_18900 2422 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence0703 <1 1209 gene locus_tag LOCUS_18910 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266161.1:membrane protein 1247 2341 gene locus_tag LOCUS_18920 gene hemH 1247 2341 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_18920 >Feature sequence0704 691 1215 gene locus_tag LOCUS_18930 gene rimP 691 1215 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_18930 >Feature sequence0705 471 19 gene locus_tag LOCUS_18940 471 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 546 1139 gene locus_tag LOCUS_18950 546 1139 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941521.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence0706 2252 1881 gene locus_tag LOCUS_18960 2252 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence0707 341 1549 gene locus_tag LOCUS_18970 341 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1564 1971 gene locus_tag LOCUS_18980 1564 1971 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence0708 375 2279 gene locus_tag LOCUS_18990 375 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence0709 247 2370 gene locus_tag LOCUS_19000 247 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence0710 2416 1346 gene locus_tag LOCUS_19010 2416 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence0711 1225 1431 gene locus_tag LOCUS_19020 1225 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2032 1751 gene locus_tag LOCUS_19030 2032 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence0712 <1 594 gene locus_tag LOCUS_19040 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962518.1:acyl-CoA dehydrogenase >Feature sequence0713 824 465 gene locus_tag LOCUS_19050 824 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_19050 1649 876 gene locus_tag LOCUS_19060 1649 876 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709386.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence0714 <1 780 gene locus_tag LOCUS_19070 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103664.1:two-component sensor histidine kinase 1877 1554 gene locus_tag LOCUS_19080 1877 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2139 2381 gene locus_tag LOCUS_19090 2139 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence0715 >Feature sequence0716 <1 2072 gene locus_tag LOCUS_19100 <1 2072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933213.1:peptidase M16 >Feature sequence0717 >Feature sequence0718 426 995 gene locus_tag LOCUS_19110 426 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2283 1003 gene locus_tag LOCUS_19120 2283 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence0719 193 744 gene locus_tag LOCUS_19130 193 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence0720 6 752 gene locus_tag LOCUS_19140 6 752 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_19140 920 1264 gene locus_tag LOCUS_19150 920 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 <2402 1268 gene locus_tag LOCUS_19160 <2402 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202237.1:peptidase M16 >Feature sequence0721 <1 993 gene locus_tag LOCUS_19170 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877386.1:B12-binding domain-containing radical SAM protein >Feature sequence0722 1723 230 gene locus_tag LOCUS_19180 1723 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence0723 803 985 gene locus_tag LOCUS_19190 803 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence0724 1092 235 gene locus_tag LOCUS_19200 1092 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1301 1609 gene locus_tag LOCUS_19210 1301 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence0725 <1 837 gene locus_tag LOCUS_19220 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DYV8:pseudouridine synthase >Feature sequence0726 1361 228 gene locus_tag LOCUS_19230 1361 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 1913 1446 gene locus_tag LOCUS_19240 1913 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence0727 138 332 gene locus_tag LOCUS_19250 138 332 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_19250 454 1041 gene locus_tag LOCUS_19260 454 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1064 1720 gene locus_tag LOCUS_19270 1064 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence0728 99 1127 gene locus_tag LOCUS_19280 99 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1820 1140 gene locus_tag LOCUS_19290 gene mutH 1820 1140 CDS product DNA mismatch repair protein MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SA6 protein_id gnl|my_center|LOCUS_19290 >Feature sequence0729 1270 458 gene locus_tag LOCUS_19300 1270 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2092 1340 gene locus_tag LOCUS_19310 gene paaG 2092 1340 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence0730 264 554 gene locus_tag LOCUS_19320 264 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 1253 561 gene locus_tag LOCUS_19330 1253 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2191 1304 gene locus_tag LOCUS_19340 2191 1304 CDS product adenine nucleotide alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence0731 1254 7 gene locus_tag LOCUS_19350 1254 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence0732 2 532 gene locus_tag LOCUS_19360 2 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 536 1534 gene locus_tag LOCUS_19370 536 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2162 1500 gene locus_tag LOCUS_19380 2162 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence0733 2117 1158 gene locus_tag LOCUS_19390 2117 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence0734 <1 854 gene locus_tag LOCUS_19400 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66682:(R)-citramalate synthase 1214 858 gene locus_tag LOCUS_19410 1214 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2047 1208 gene locus_tag LOCUS_19420 gene panC 2047 1208 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 protein_id gnl|my_center|LOCUS_19420 >Feature sequence0735 2230 1409 gene locus_tag LOCUS_19430 2230 1409 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence0736 1238 912 gene locus_tag LOCUS_19440 1238 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 1395 1877 gene locus_tag LOCUS_19450 1395 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2220 1906 gene locus_tag LOCUS_19460 2220 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence0737 172 1269 gene locus_tag LOCUS_19470 172 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1179 1724 gene locus_tag LOCUS_19480 1179 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1884 2315 gene locus_tag LOCUS_19490 gene speH 1884 2315 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZC3 protein_id gnl|my_center|LOCUS_19490 >Feature sequence0738 1703 342 gene locus_tag LOCUS_19500 gene selA 1703 342 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIF3 protein_id gnl|my_center|LOCUS_19500 >Feature sequence0739 676 1932 gene locus_tag LOCUS_19510 676 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence0740 488 99 gene locus_tag LOCUS_19520 488 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1734 1510 gene locus_tag LOCUS_19530 1734 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 1814 2008 gene locus_tag LOCUS_19540 1814 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence0741 1066 1473 gene locus_tag LOCUS_19550 1066 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1499 2320 gene locus_tag LOCUS_19560 1499 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence0742 516 2015 gene locus_tag LOCUS_19570 516 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2272 2039 gene locus_tag LOCUS_19580 2272 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence0743 >Feature sequence0744 <2368 1430 gene locus_tag LOCUS_19590 <2368 1430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DRB6:leucine--tRNA ligase >Feature sequence0745 1989 787 gene locus_tag LOCUS_19600 1989 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence0746 746 1099 gene locus_tag LOCUS_19610 746 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 1027 1779 gene locus_tag LOCUS_19620 1027 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19620 >Feature sequence0747 1498 416 gene locus_tag LOCUS_19630 1498 416 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972373.1 protein_id gnl|my_center|LOCUS_19630 2020 1619 gene locus_tag LOCUS_19640 2020 1619 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090571.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence0748 724 257 gene locus_tag LOCUS_19650 gene rlmH 724 257 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLR5 protein_id gnl|my_center|LOCUS_19650 1185 721 gene locus_tag LOCUS_19660 1185 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2012 1182 gene locus_tag LOCUS_19670 2012 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence0749 1051 1935 gene locus_tag LOCUS_19680 1051 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence0750 1684 470 gene locus_tag LOCUS_19690 1684 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090158.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence0751 <1 517 gene locus_tag LOCUS_19700 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538117.1:di-heme enzyme 556 2361 gene locus_tag LOCUS_19710 556 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence0752 >Feature sequence0753 452 1957 gene locus_tag LOCUS_19720 gene cobQ 452 1957 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDV6 protein_id gnl|my_center|LOCUS_19720 >Feature sequence0754 <1 1119 gene locus_tag LOCUS_19730 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861272.1:ABC transporter permease 2016 1144 gene locus_tag LOCUS_19740 2016 1144 CDS product UPF0160 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84391 protein_id gnl|my_center|LOCUS_19740 >Feature sequence0755 1184 6 gene locus_tag LOCUS_19750 1184 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence0756 <1 1435 gene locus_tag LOCUS_19760 <1 1435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000200580.1:hemolysin 1460 2227 gene locus_tag LOCUS_19770 gene gloB 1460 2227 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J436 protein_id gnl|my_center|LOCUS_19770 >Feature sequence0757 <1 1568 gene locus_tag LOCUS_19780 <1 1568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000486386.1:3-hydroxyacyl-CoA dehydrogenase >Feature sequence0758 >Feature sequence0759 727 2115 gene locus_tag LOCUS_19790 727 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence0760 2054 321 gene locus_tag LOCUS_19800 2054 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence0761 818 2227 gene locus_tag LOCUS_19810 818 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence0762 350 1396 gene locus_tag LOCUS_19820 350 1396 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_19820 1393 2013 gene locus_tag LOCUS_19830 gene thiE-1 1393 2013 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AA6 protein_id gnl|my_center|LOCUS_19830 >Feature sequence0763 >Feature sequence0764 551 937 gene locus_tag LOCUS_19840 551 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 983 1951 gene locus_tag LOCUS_19850 gene gmd 983 1951 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ72 protein_id gnl|my_center|LOCUS_19850 >Feature sequence0765 935 399 gene locus_tag LOCUS_19860 935 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1459 932 gene locus_tag LOCUS_19870 1459 932 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886990.1 protein_id gnl|my_center|LOCUS_19870 <2327 1463 gene locus_tag LOCUS_19880 <2327 1463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3N2:cytochrome c-type biogenesis protein CcmF >Feature sequence0766 >Feature sequence0767 >Feature sequence0768 <1 542 gene locus_tag LOCUS_19890 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y5X5:protein RecA 625 1704 gene locus_tag LOCUS_19900 gene pilT-1 625 1704 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence0769 1393 524 gene locus_tag LOCUS_19910 1393 524 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_19910 2044 1511 gene locus_tag LOCUS_19920 2044 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence0770 1539 781 gene locus_tag LOCUS_19930 1539 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence0771 >Feature sequence0772 >Feature sequence0773 2134 1046 gene locus_tag LOCUS_19940 2134 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence0774 127 1158 gene locus_tag LOCUS_19950 127 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1158 1382 gene locus_tag LOCUS_19960 1158 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 1558 1812 gene locus_tag LOCUS_19970 1558 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1813 2055 gene locus_tag LOCUS_19980 1813 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence0775 >Feature sequence0776 >Feature sequence0777 672 1454 gene locus_tag LOCUS_19990 672 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence0778 1482 1760 gene locus_tag LOCUS_20000 1482 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence0779 >Feature sequence0780 1025 18 gene locus_tag LOCUS_20010 1025 18 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_20010 <2303 1022 gene locus_tag LOCUS_20020 <2303 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P59173:putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence0781 >Feature sequence0782 126 1001 gene locus_tag LOCUS_20030 126 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 998 1483 gene locus_tag LOCUS_20040 998 1483 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126727.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence0783 >Feature sequence0784 <1 829 gene locus_tag LOCUS_20050 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142684.1:phosphoenolpyruvate synthase 1455 847 gene locus_tag LOCUS_20060 1455 847 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404017.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence0785 <2296 1279 gene locus_tag LOCUS_20070 <2296 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941496.1:RND transporter >Feature sequence0786 404 1198 gene locus_tag LOCUS_20080 404 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2201 1203 gene locus_tag LOCUS_20090 2201 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence0787 >Feature sequence0788 279 94 gene locus_tag LOCUS_20100 279 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 792 592 gene locus_tag LOCUS_20110 792 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2182 899 gene locus_tag LOCUS_20120 2182 899 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence0789 >Feature sequence0790 377 1579 gene locus_tag LOCUS_20130 377 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence0791 >Feature sequence0792 <1 544 gene locus_tag LOCUS_20140 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088378.1:glutathione S-transferase 659 859 gene locus_tag LOCUS_20150 659 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence0793 >Feature sequence0794 430 1536 gene locus_tag LOCUS_20160 430 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2274 1540 gene locus_tag LOCUS_20170 2274 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence0795 2175 685 gene locus_tag LOCUS_20180 2175 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence0796 1178 909 gene locus_tag LOCUS_20190 1178 909 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_20190 1923 1375 gene locus_tag LOCUS_20200 1923 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence0797 >Feature sequence0798 >Feature sequence0799 465 1340 gene locus_tag LOCUS_20210 465 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence0800 853 215 gene locus_tag LOCUS_20220 gene ydeI 853 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 protein_id gnl|my_center|LOCUS_20220 1201 881 gene locus_tag LOCUS_20230 1201 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2051 1275 gene locus_tag LOCUS_20240 2051 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence0801 617 1294 gene locus_tag LOCUS_20250 617 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence0802 >Feature sequence0803 >Feature sequence0804 1428 406 gene locus_tag LOCUS_20260 1428 406 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338853.1 protein_id gnl|my_center|LOCUS_20260 <2260 1425 gene locus_tag LOCUS_20270 <2260 1425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728359.1:MFS transporter >Feature sequence0805 <1 823 gene locus_tag LOCUS_20280 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404020.1:aminotransferase class V 820 1353 gene locus_tag LOCUS_20290 820 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 1384 2094 gene locus_tag LOCUS_20300 1384 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence0806 1227 1577 gene locus_tag LOCUS_20310 1227 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence0807 >Feature sequence0808 767 9 gene locus_tag LOCUS_20320 767 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1062 1856 gene locus_tag LOCUS_20330 1062 1856 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390216.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence0809 608 444 gene locus_tag LOCUS_20340 608 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2071 755 gene locus_tag LOCUS_20350 gene ampG 2071 755 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817747.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence0810 1147 290 gene locus_tag LOCUS_20360 1147 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence0811 1087 479 gene locus_tag LOCUS_20370 gene pilN 1087 479 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_20370 2157 1084 gene locus_tag LOCUS_20380 gene pilM 2157 1084 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence0812 653 1435 gene locus_tag LOCUS_20390 653 1435 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225581.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence0813 349 1335 gene locus_tag LOCUS_20400 349 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence0814 224 1594 gene locus_tag LOCUS_20410 224 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence0815 1844 1368 gene locus_tag LOCUS_20420 1844 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence0816 94 1233 gene locus_tag LOCUS_20430 94 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 1230 2165 gene locus_tag LOCUS_20440 1230 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence0817 17 883 gene locus_tag LOCUS_20450 17 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence0818 2238 916 gene locus_tag LOCUS_20460 2238 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence0819 <1 1463 gene locus_tag LOCUS_20470 <1 1463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein >Feature sequence0820 1323 664 gene locus_tag LOCUS_20480 1323 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence0821 >Feature sequence0822 537 1667 gene locus_tag LOCUS_20490 537 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 2169 1906 gene locus_tag LOCUS_20500 2169 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence0823 <1 1787 gene locus_tag LOCUS_20510 <1 1787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071198.1:peptidase S45 >Feature sequence0824 761 519 gene locus_tag LOCUS_20520 761 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 833 1972 gene locus_tag LOCUS_20530 833 1972 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984839.1 protein_id gnl|my_center|LOCUS_20530 >Feature sequence0825 >Feature sequence0826 728 1357 gene locus_tag LOCUS_20540 728 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence0827 363 1103 gene locus_tag LOCUS_20550 gene sfsA 363 1103 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61664 protein_id gnl|my_center|LOCUS_20550 >Feature sequence0828 >Feature sequence0829 <2217 840 gene locus_tag LOCUS_20560 <2217 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226443.1:polyketide synthase >Feature sequence0830 <2217 982 gene locus_tag LOCUS_20570 <2217 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001257485.1:chitinase >Feature sequence0831 205 780 gene locus_tag LOCUS_20580 205 780 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869628.1 protein_id gnl|my_center|LOCUS_20580 794 1528 gene locus_tag LOCUS_20590 794 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2019 1501 gene locus_tag LOCUS_20600 2019 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2213 2016 gene locus_tag LOCUS_20610 2213 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence0832 1730 339 gene locus_tag LOCUS_20620 1730 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence0833 >Feature sequence0834 451 364 gene locus_tag LOCUS_t00100 451 364 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0835 <2208 1246 gene locus_tag LOCUS_20630 <2208 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0Q0:2-heptyl-3-hydroxy-4(1H)-quinolone synthase >Feature sequence0836 >Feature sequence0837 >Feature sequence0838 15 848 gene locus_tag LOCUS_20640 gene ttg2A 15 848 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_20640 849 1427 gene locus_tag LOCUS_20650 849 1427 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence0839 68 799 gene locus_tag LOCUS_20660 68 799 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258572.1 protein_id gnl|my_center|LOCUS_20660 796 2100 gene locus_tag LOCUS_20670 796 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence0840 1423 1995 gene locus_tag LOCUS_20680 1423 1995 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106559.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence0841 >Feature sequence0842 437 1363 gene locus_tag LOCUS_20690 437 1363 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_20690 1447 2085 gene locus_tag LOCUS_20700 gene gmk 1447 2085 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ7 protein_id gnl|my_center|LOCUS_20700 >Feature sequence0843 919 449 gene locus_tag LOCUS_20710 919 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1566 916 gene locus_tag LOCUS_20720 1566 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence0844 408 809 gene locus_tag LOCUS_20730 408 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 873 1610 gene locus_tag LOCUS_20740 873 1610 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056496.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence0845 93 572 gene locus_tag LOCUS_20750 93 572 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4D4 protein_id gnl|my_center|LOCUS_20750 690 1475 gene locus_tag LOCUS_20760 690 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1493 2125 gene locus_tag LOCUS_20770 1493 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 >Feature sequence0846 >Feature sequence0847 1773 415 gene locus_tag LOCUS_20780 1773 415 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence0848 1972 1184 gene locus_tag LOCUS_20790 1972 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2163 1969 gene locus_tag LOCUS_20800 2163 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 >Feature sequence0849 324 770 gene locus_tag LOCUS_20810 gene rplO 324 770 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH7 protein_id gnl|my_center|LOCUS_20810 772 2148 gene locus_tag LOCUS_20820 gene secY 772 2148 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A7 protein_id gnl|my_center|LOCUS_20820 >Feature sequence0850 733 143 gene locus_tag LOCUS_20830 733 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2120 657 gene locus_tag LOCUS_20840 2120 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20840 >Feature sequence0851 <2181 16 gene locus_tag LOCUS_20850 <2181 16 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:signal transduction histidine kinase >Feature sequence0852 75 2123 gene locus_tag LOCUS_20860 75 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence0853 1921 1061 gene locus_tag LOCUS_20870 1921 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence0854 1479 946 gene locus_tag LOCUS_20880 1479 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence0855 709 1236 gene locus_tag LOCUS_20890 709 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 1277 1552 gene locus_tag LOCUS_20900 1277 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence0856 <1 904 gene locus_tag LOCUS_20910 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939506.1:GTP-binding protein 1997 906 gene locus_tag LOCUS_20920 gene aroC 1997 906 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence0857 1389 433 gene locus_tag LOCUS_20930 1389 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2177 1605 gene locus_tag LOCUS_20940 2177 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence0858 1180 368 gene locus_tag LOCUS_20950 1180 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence0859 943 140 gene locus_tag LOCUS_20960 943 140 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_20960 2176 1103 gene locus_tag LOCUS_20970 2176 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence0860 >Feature sequence0861 428 1363 gene locus_tag LOCUS_20980 428 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence0862 739 386 gene locus_tag LOCUS_20990 739 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 1079 1945 gene locus_tag LOCUS_21000 1079 1945 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122511.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence0863 1807 461 gene locus_tag LOCUS_21010 1807 461 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence0864 2041 656 gene locus_tag LOCUS_21020 2041 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence0865 1939 995 gene locus_tag LOCUS_21030 gene fcl 1939 995 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL64 protein_id gnl|my_center|LOCUS_21030 2163 1936 gene locus_tag LOCUS_21040 2163 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 >Feature sequence0866 1256 813 gene locus_tag LOCUS_21050 1256 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence0867 <1 530 gene locus_tag LOCUS_21060 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100953.1:cystathionine gamma-lyase 527 1156 gene locus_tag LOCUS_21070 527 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21070 1135 1635 gene locus_tag LOCUS_21080 1135 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence0868 >Feature sequence0869 360 1604 gene locus_tag LOCUS_21090 360 1604 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223974.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence0870 <1 533 gene locus_tag LOCUS_21100 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460332.1:aspartate--tRNA ligase 1356 607 gene locus_tag LOCUS_21110 1356 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence0871 44 736 gene locus_tag LOCUS_21120 44 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 736 1032 gene locus_tag LOCUS_21130 736 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1057 1791 gene locus_tag LOCUS_21140 1057 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21140 1788 2027 gene locus_tag LOCUS_21150 1788 2027 CDS product aminoacyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHM9 protein_id gnl|my_center|LOCUS_21150 >Feature sequence0872 793 1872 gene locus_tag LOCUS_21160 793 1872 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence0873 <2150 730 gene locus_tag LOCUS_21170 <2150 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2B1:biosynthetic arginine decarboxylase >Feature sequence0874 <1 908 gene locus_tag LOCUS_21180 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_009278.2:sulfate permease 938 1477 gene locus_tag LOCUS_21190 938 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 protein_id gnl|my_center|LOCUS_21190 <2149 1575 gene locus_tag LOCUS_21200 <2149 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867806.1:arginyl-tRNA synthetase >Feature sequence0875 736 2025 gene locus_tag LOCUS_21210 736 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence0876 483 1505 gene locus_tag LOCUS_21220 483 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence0877 663 7 gene locus_tag LOCUS_21230 663 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1691 660 gene locus_tag LOCUS_21240 1691 660 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence0878 73 1905 gene locus_tag LOCUS_21250 73 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence0879 >Feature sequence0880 327 1202 gene locus_tag LOCUS_21260 327 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21260 >Feature sequence0881 >Feature sequence0882 1691 1864 gene locus_tag LOCUS_21270 1691 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 >Feature sequence0883 1223 765 gene locus_tag LOCUS_21280 1223 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence0884 548 102 gene locus_tag LOCUS_21290 548 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 2124 637 gene locus_tag LOCUS_21300 2124 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence0885 >Feature sequence0886 903 262 gene locus_tag LOCUS_21310 903 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1028 1999 gene locus_tag LOCUS_21320 1028 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869902.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence0887 301 669 gene locus_tag LOCUS_21330 301 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 737 1975 gene locus_tag LOCUS_21340 737 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence0888 513 860 gene locus_tag LOCUS_21350 513 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 1647 880 gene locus_tag LOCUS_21360 1647 880 CDS product putative enoyl-coa hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704585.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence0889 1697 258 gene locus_tag LOCUS_21370 1697 258 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence0890 401 1168 gene locus_tag LOCUS_21380 401 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence0891 249 938 gene locus_tag LOCUS_21390 gene queE 249 938 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG8 protein_id gnl|my_center|LOCUS_21390 2135 942 gene locus_tag LOCUS_21400 2135 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence0892 904 197 gene locus_tag LOCUS_21410 904 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 1059 1790 gene locus_tag LOCUS_21420 1059 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21420 >Feature sequence0893 675 1283 gene locus_tag LOCUS_21430 675 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 1363 1713 gene locus_tag LOCUS_21440 1363 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence0894 >Feature sequence0895 106 1248 gene locus_tag LOCUS_21450 106 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence0896 2127 1294 gene locus_tag LOCUS_21460 2127 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence0897 >Feature sequence0898 1340 510 gene locus_tag LOCUS_21470 1340 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence0899 >Feature sequence0900 2098 824 gene locus_tag LOCUS_21480 2098 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence0901 672 1316 gene locus_tag LOCUS_21490 672 1316 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706361.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence0902 352 1245 gene locus_tag LOCUS_21500 352 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1249 1734 gene locus_tag LOCUS_21510 gene fabZ 1249 1734 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7X1 protein_id gnl|my_center|LOCUS_21510 1773 2078 gene locus_tag LOCUS_21520 1773 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence0903 1726 842 gene locus_tag LOCUS_21530 gene rsmI 1726 842 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK05 protein_id gnl|my_center|LOCUS_21530 >Feature sequence0904 1122 703 gene locus_tag LOCUS_21540 1122 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence0905 >Feature sequence0906 >Feature sequence0907 1415 456 gene locus_tag LOCUS_21550 1415 456 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence0908 171 494 gene locus_tag LOCUS_21560 171 494 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44711 protein_id gnl|my_center|LOCUS_21560 556 1149 gene locus_tag LOCUS_21570 556 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 1585 1154 gene locus_tag LOCUS_21580 1585 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 >Feature sequence0909 399 1523 gene locus_tag LOCUS_21590 399 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence0910 >Feature sequence0911 >Feature sequence0912 <1 621 gene locus_tag LOCUS_21600 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124950.1:homoserine/choline kinase >Feature sequence0913 <2105 442 gene locus_tag LOCUS_21610 <2105 442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085627.1:adenylate cyclase >Feature sequence0914 <1 1633 gene locus_tag LOCUS_21620 <1 1633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878769.1:carbamoyl phosphate synthase large subunit note possible pseudo, frameshifted >Feature sequence0915 1172 30 gene locus_tag LOCUS_21630 1172 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 2101 1160 gene locus_tag LOCUS_21640 2101 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence0916 <1 570 gene locus_tag LOCUS_21650 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707247.1:competence protein ComEA 567 788 gene locus_tag LOCUS_21660 567 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 802 1302 gene locus_tag LOCUS_21670 802 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 <2101 1319 gene locus_tag LOCUS_21680 <2101 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392225.1:aldolase >Feature sequence0917 1246 353 gene locus_tag LOCUS_21690 1246 353 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229923.1 protein_id gnl|my_center|LOCUS_21690 2097 1357 gene locus_tag LOCUS_21700 2097 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence0918 >Feature sequence0919 362 649 gene locus_tag LOCUS_21710 362 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 670 1014 gene locus_tag LOCUS_21720 670 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence0920 273 1361 gene locus_tag LOCUS_21730 273 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence0921 <1 1665 gene locus_tag LOCUS_21740 <1 1665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004079930.1:RND transporter >Feature sequence0922 503 1096 gene locus_tag LOCUS_21750 503 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 1204 1983 gene locus_tag LOCUS_21760 1204 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence0923 209 1093 gene locus_tag LOCUS_21770 209 1093 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257278.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence0924 577 1515 gene locus_tag LOCUS_21780 577 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 >Feature sequence0925 1271 339 gene locus_tag LOCUS_21790 1271 339 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246000.1 protein_id gnl|my_center|LOCUS_21790 2092 1403 gene locus_tag LOCUS_21800 2092 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence0926 >Feature sequence0927 1963 1406 gene locus_tag LOCUS_21810 1963 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence0928 >Feature sequence0929 878 1801 gene locus_tag LOCUS_21820 878 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence0930 1607 744 gene locus_tag LOCUS_21830 1607 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence0931 1803 466 gene locus_tag LOCUS_21840 1803 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence0932 >Feature sequence0933 764 1954 gene locus_tag LOCUS_21850 764 1954 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258986.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence0934 470 1840 gene locus_tag LOCUS_21860 470 1840 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence0935 473 1348 gene locus_tag LOCUS_21870 473 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 >Feature sequence0936 399 1814 gene locus_tag LOCUS_21880 399 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence0937 1837 743 gene locus_tag LOCUS_21890 1837 743 CDS product poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259104.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence0938 1991 462 gene locus_tag LOCUS_21900 1991 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence0939 <2079 1267 gene locus_tag LOCUS_21910 <2079 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q748G4:flagellin >Feature sequence0940 1794 889 gene locus_tag LOCUS_21920 gene ybhF-N 1794 889 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence0941 >Feature sequence0942 <1 596 gene locus_tag LOCUS_21930 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482649.1:outer membrane lipoprotein-sorting protein 618 1850 gene locus_tag LOCUS_21940 618 1850 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence0943 299 1552 gene locus_tag LOCUS_21950 299 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence0944 <2073 966 gene locus_tag LOCUS_21960 <2073 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:RNA-binding protein >Feature sequence0945 948 178 gene locus_tag LOCUS_21970 948 178 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_21970 1813 950 gene locus_tag LOCUS_21980 gene ispA 1813 950 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence0946 >Feature sequence0947 >Feature sequence0948 798 1484 gene locus_tag LOCUS_21990 798 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 1481 1759 gene locus_tag LOCUS_22000 1481 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence0949 <1 718 gene locus_tag LOCUS_22010 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460695.1:UDP-N-acetylenolpyruvoylglucosamine reductase 749 1780 gene locus_tag LOCUS_22020 749 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22020 >Feature sequence0950 110 1282 gene locus_tag LOCUS_22030 110 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 1413 2039 gene locus_tag LOCUS_22040 1413 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence0951 352 1170 gene locus_tag LOCUS_22050 352 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 <2062 1174 gene locus_tag LOCUS_22060 <2062 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258698.1:tRNA-guanine transglycosylase >Feature sequence0952 >Feature sequence0953 >Feature sequence0954 >Feature sequence0955 2011 392 gene locus_tag LOCUS_22070 gene atuC 2011 392 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence0956 2 277 gene locus_tag LOCUS_22080 2 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence0957 >Feature sequence0958 >Feature sequence0959 576 995 gene locus_tag LOCUS_22090 576 995 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence0960 <1 1325 gene locus_tag LOCUS_22100 <1 1325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003413541.1:peptidase S41 1330 1962 gene locus_tag LOCUS_22110 1330 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 >Feature sequence0961 >Feature sequence0962 57 959 gene locus_tag LOCUS_22120 57 959 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_22120 956 1372 gene locus_tag LOCUS_22130 956 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence0963 <1 1109 gene locus_tag LOCUS_22140 <1 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390598.1:cytosine deaminase 1173 1457 gene locus_tag LOCUS_22150 1173 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402799.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence0964 1020 1691 gene locus_tag LOCUS_22160 1020 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence0965 >Feature sequence0966 1011 487 gene locus_tag LOCUS_22170 1011 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1445 1008 gene locus_tag LOCUS_22180 1445 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 <2038 1449 gene locus_tag LOCUS_22190 <2038 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870076.1:EscN/YscN/HrcN family type III secretion system ATPase >Feature sequence0967 1539 187 gene locus_tag LOCUS_22200 1539 187 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888358.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence0968 396 1160 gene locus_tag LOCUS_22210 396 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence0969 <1 948 gene locus_tag LOCUS_22220 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F332:ferrous iron transport protein B 2032 980 gene locus_tag LOCUS_22230 2032 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence0970 >Feature sequence0971 539 1309 gene locus_tag LOCUS_22240 539 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 1641 1282 gene locus_tag LOCUS_22250 1641 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence0972 <2032 561 gene locus_tag LOCUS_22260 <2032 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877386.1:B12-binding domain-containing radical SAM protein >Feature sequence0973 244 318 gene locus_tag LOCUS_t00110 244 318 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 384 1328 gene locus_tag LOCUS_22270 gene prsA 384 1328 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE8 protein_id gnl|my_center|LOCUS_22270 >Feature sequence0974 1593 1081 gene locus_tag LOCUS_22280 1593 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence0975 948 1877 gene locus_tag LOCUS_22290 gene thiL 948 1877 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTN2 protein_id gnl|my_center|LOCUS_22290 >Feature sequence0976 2022 436 gene locus_tag LOCUS_22300 2022 436 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122718.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence0977 >Feature sequence0978 76 948 gene locus_tag LOCUS_22310 76 948 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229193.1 protein_id gnl|my_center|LOCUS_22310 958 1470 gene locus_tag LOCUS_22320 958 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence0979 >Feature sequence0980 <1 695 gene locus_tag LOCUS_22330 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973971.1:septum formation initiator >Feature sequence0981 2019 1294 gene locus_tag LOCUS_22340 2019 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence0982 1708 383 gene locus_tag LOCUS_22350 1708 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence0983 >Feature sequence0984 <1 973 gene locus_tag LOCUS_22360 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702947.1:putative polyketide synthase note possible pseudo, internal stop codon 1028 1945 gene locus_tag LOCUS_22370 1028 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22370 >Feature sequence0985 859 1173 gene locus_tag LOCUS_22380 859 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence0986 239 826 gene locus_tag LOCUS_22390 239 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence0987 870 1376 gene locus_tag LOCUS_22400 870 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence0988 943 1695 gene locus_tag LOCUS_22410 943 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence0989 >Feature sequence0990 >Feature sequence0991 38 898 gene locus_tag LOCUS_22420 38 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 895 1875 gene locus_tag LOCUS_22430 895 1875 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence0992 1539 349 gene locus_tag LOCUS_22440 1539 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1647 1723 gene locus_tag LOCUS_t00120 1647 1723 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0993 <2003 245 gene locus_tag LOCUS_22450 <2003 245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein >Feature sequence0994 1936 1466 gene locus_tag LOCUS_22460 1936 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence0995 424 1185 gene locus_tag LOCUS_22470 424 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460802.1 protein_id gnl|my_center|LOCUS_22470 1175 1720 gene locus_tag LOCUS_22480 1175 1720 CDS product flagellar protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937358.1 protein_id gnl|my_center|LOCUS_22480 >Feature sequence0996 >Feature sequence0997 1222 1803 gene locus_tag LOCUS_22490 gene plsY 1222 1803 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60926 protein_id gnl|my_center|LOCUS_22490 >Feature sequence0998 1254 595 gene locus_tag LOCUS_22500 1254 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392162.1 protein_id gnl|my_center|LOCUS_22500 1679 1419 gene locus_tag LOCUS_22510 1679 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence0999 >Feature sequence1000 82 390 gene locus_tag LOCUS_22520 82 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 1341 553 gene locus_tag LOCUS_22530 1341 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence1001 1484 765 gene locus_tag LOCUS_22540 1484 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence1002 1992 1552 gene locus_tag LOCUS_22550 1992 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence1003 1783 737 gene locus_tag LOCUS_22560 1783 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence1004 653 102 gene locus_tag LOCUS_22570 653 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 886 659 gene locus_tag LOCUS_22580 886 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 1179 904 gene locus_tag LOCUS_22590 gene rpsP 1179 904 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4M6 protein_id gnl|my_center|LOCUS_22590 >Feature sequence1005 1380 103 gene locus_tag LOCUS_22600 1380 103 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120681.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence1006 <1 559 gene locus_tag LOCUS_22610 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5I754:peptide chain release factor 3 >Feature sequence1007 158 712 gene locus_tag LOCUS_22620 158 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22620 712 1884 gene locus_tag LOCUS_22630 712 1884 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence1008 >Feature sequence1009 >Feature sequence1010 >Feature sequence1011 >Feature sequence1012 >Feature sequence1013 >Feature sequence1014 >Feature sequence1015 489 962 gene locus_tag LOCUS_22640 489 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 1943 1068 gene locus_tag LOCUS_22650 1943 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence1016 925 1080 gene locus_tag LOCUS_22660 925 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence1017 322 855 gene locus_tag LOCUS_22670 322 855 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404744.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence1018 1600 290 gene locus_tag LOCUS_22680 1600 290 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730651.1 protein_id gnl|my_center|LOCUS_22680 >Feature sequence1019 >Feature sequence1020 <1972 474 gene locus_tag LOCUS_22690 <1972 474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055904.1:penicillin-binding protein >Feature sequence1021 190 585 gene locus_tag LOCUS_22700 gene rplI1 190 585 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGH8 protein_id gnl|my_center|LOCUS_22700 600 1331 gene locus_tag LOCUS_22710 gene kdsB 600 1331 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WL5 protein_id gnl|my_center|LOCUS_22710 >Feature sequence1022 1732 314 gene locus_tag LOCUS_22720 1732 314 CDS product succinoglycan biosynthesis transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875981.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence1023 132 1037 gene locus_tag LOCUS_22730 132 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence1024 437 706 gene locus_tag LOCUS_22740 gene fliQ 437 706 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67774 protein_id gnl|my_center|LOCUS_22740 710 1483 gene locus_tag LOCUS_22750 gene fliR 710 1483 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Q3 protein_id gnl|my_center|LOCUS_22750 >Feature sequence1025 3 1151 gene locus_tag LOCUS_22760 3 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 1057 1749 gene locus_tag LOCUS_22770 1057 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence1026 494 1141 gene locus_tag LOCUS_22780 494 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence1027 21 596 gene locus_tag LOCUS_22790 21 596 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_22790 1222 791 gene locus_tag LOCUS_22800 1222 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence1028 >Feature sequence1029 >Feature sequence1030 278 12 gene locus_tag LOCUS_22810 278 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 563 345 gene locus_tag LOCUS_22820 563 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence1031 405 1001 gene locus_tag LOCUS_22830 405 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 1912 1643 gene locus_tag LOCUS_22840 1912 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 >Feature sequence1032 104 328 gene locus_tag LOCUS_22850 104 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 513 1175 gene locus_tag LOCUS_22860 513 1175 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_22860 1267 1818 gene locus_tag LOCUS_22870 1267 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence1033 284 1531 gene locus_tag LOCUS_22880 284 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 >Feature sequence1034 1890 1405 gene locus_tag LOCUS_22890 1890 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence1035 >Feature sequence1036 387 1046 gene locus_tag LOCUS_22900 gene exbB 387 1046 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_22900 1043 1486 gene locus_tag LOCUS_22910 1043 1486 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141388.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence1037 >Feature sequence1038 1759 746 gene locus_tag LOCUS_22920 1759 746 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence1039 1368 37 gene locus_tag LOCUS_22930 1368 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 1917 1453 gene locus_tag LOCUS_22940 1917 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence1040 >Feature sequence1041 >Feature sequence1042 680 1021 gene locus_tag LOCUS_22950 680 1021 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387838.1 protein_id gnl|my_center|LOCUS_22950 1577 1035 gene locus_tag LOCUS_22960 1577 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence1043 1190 1552 gene locus_tag LOCUS_22970 1190 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence1044 1418 390 gene locus_tag LOCUS_22980 1418 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence1045 <1939 1359 gene locus_tag LOCUS_22990 <1939 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256517.1:cytochrome c >Feature sequence1046 967 527 gene locus_tag LOCUS_23000 967 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence1047 >Feature sequence1048 318 641 gene locus_tag LOCUS_23010 318 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 710 1240 gene locus_tag LOCUS_23020 710 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 <1932 1277 gene locus_tag LOCUS_23030 <1932 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000394583.1:endoflagellar motor protein >Feature sequence1049 >Feature sequence1050 1812 526 gene locus_tag LOCUS_23040 1812 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122840.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence1051 >Feature sequence1052 1924 860 gene locus_tag LOCUS_23050 1924 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence1053 <1924 854 gene locus_tag LOCUS_23060 <1924 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028428.1:AMP-dependent synthetase >Feature sequence1054 <1 1074 gene locus_tag LOCUS_23070 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886697.1:rRNA (guanine-N2)-methyltransferase 1120 1383 gene locus_tag LOCUS_23080 1120 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence1055 1017 226 gene locus_tag LOCUS_23090 1017 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 1923 1123 gene locus_tag LOCUS_23100 1923 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence1056 1431 433 gene locus_tag LOCUS_23110 1431 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence1057 870 148 gene locus_tag LOCUS_23120 870 148 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_23120 <1923 885 gene locus_tag LOCUS_23130 <1923 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338906.1:ATP-dependent DNA helicase RecQ >Feature sequence1058 188 844 gene locus_tag LOCUS_23140 188 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 977 1810 gene locus_tag LOCUS_23150 gene cphB 977 1810 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016692.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence1059 41 511 gene locus_tag LOCUS_23160 41 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 1867 551 gene locus_tag LOCUS_23170 gene apeB 1867 551 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XA76 protein_id gnl|my_center|LOCUS_23170 >Feature sequence1060 1130 582 gene locus_tag LOCUS_23180 1130 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 1683 1123 gene locus_tag LOCUS_23190 1683 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence1061 270 1217 gene locus_tag LOCUS_23200 270 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096603.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence1062 930 616 gene locus_tag LOCUS_23210 930 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 1534 1127 gene locus_tag LOCUS_23220 1534 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919719.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence1063 >Feature sequence1064 >Feature sequence1065 <1 747 gene locus_tag LOCUS_23230 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74AT3:outer membrane protein assembly factor BamA 827 1363 gene locus_tag LOCUS_23240 gene ompH 827 1363 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816966.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence1066 1 234 gene locus_tag LOCUS_23250 1 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 662 1279 gene locus_tag LOCUS_23260 662 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23260 >Feature sequence1067 <1 1419 gene locus_tag LOCUS_23270 <1 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387739.1:ABC transporter ATP-binding protein >Feature sequence1068 >Feature sequence1069 247 1200 gene locus_tag LOCUS_23280 247 1200 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086017.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence1070 <1 620 gene locus_tag LOCUS_23290 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883237.1:peptide ABC transporter substrate-binding protein >Feature sequence1071 333 97 gene locus_tag LOCUS_23300 333 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 566 1669 gene locus_tag LOCUS_23310 566 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 1916 1686 gene locus_tag LOCUS_23320 1916 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence1072 144 1229 gene locus_tag LOCUS_23330 144 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence1073 648 64 gene locus_tag LOCUS_23340 648 64 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_23340 846 1850 gene locus_tag LOCUS_23350 846 1850 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259367.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence1074 >Feature sequence1075 362 1705 gene locus_tag LOCUS_23360 362 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23360 >Feature sequence1076 <1912 881 gene locus_tag LOCUS_23370 <1912 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680943.1:Trk system potassium transporter TrkH >Feature sequence1077 85 588 gene locus_tag LOCUS_23380 85 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 656 1012 gene locus_tag LOCUS_23390 656 1012 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 protein_id gnl|my_center|LOCUS_23390 1454 1029 gene locus_tag LOCUS_23400 1454 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence1078 2 1396 gene locus_tag LOCUS_23410 2 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence1079 >Feature sequence1080 1831 1232 gene locus_tag LOCUS_23420 1831 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence1081 1556 693 gene locus_tag LOCUS_23430 1556 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence1082 1296 301 gene locus_tag LOCUS_23440 1296 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence1083 897 1874 gene locus_tag LOCUS_23450 897 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 >Feature sequence1084 1644 349 gene locus_tag LOCUS_23460 1644 349 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_23460 1906 1742 gene locus_tag LOCUS_23470 1906 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence1085 >Feature sequence1086 842 1804 gene locus_tag LOCUS_23480 842 1804 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010218977.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence1087 361 975 gene locus_tag LOCUS_23490 361 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 1230 1015 gene locus_tag LOCUS_23500 1230 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence1088 1897 1010 gene locus_tag LOCUS_23510 1897 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence1089 578 36 gene locus_tag LOCUS_23520 578 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 658 903 gene locus_tag LOCUS_23530 658 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 1898 909 gene locus_tag LOCUS_23540 1898 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence1090 <1 773 gene locus_tag LOCUS_23550 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186941.1:phenylacetic acid degradation protein PaaN 1516 965 gene locus_tag LOCUS_23560 1516 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence1091 >Feature sequence1092 >Feature sequence1093 1678 5 gene locus_tag LOCUS_23570 1678 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence1094 >Feature sequence1095 320 1438 gene locus_tag LOCUS_23580 320 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence1096 1892 993 gene locus_tag LOCUS_23590 1892 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 >Feature sequence1097 >Feature sequence1098 652 1455 gene locus_tag LOCUS_23600 652 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence1099 1612 116 gene locus_tag LOCUS_23610 1612 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence1100 >Feature sequence1101 268 849 gene locus_tag LOCUS_23620 268 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 870 1211 gene locus_tag LOCUS_23630 870 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence1102 >Feature sequence1103 1794 1447 gene locus_tag LOCUS_23640 1794 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence1104 232 894 gene locus_tag LOCUS_23650 232 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 901 1776 gene locus_tag LOCUS_23660 901 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23660 >Feature sequence1105 >Feature sequence1106 >Feature sequence1107 <1880 764 gene locus_tag LOCUS_23670 <1880 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947846.1:transporter >Feature sequence1108 625 164 gene locus_tag LOCUS_23680 625 164 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583173.1 protein_id gnl|my_center|LOCUS_23680 826 1341 gene locus_tag LOCUS_23690 gene ppiB 826 1341 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F376 protein_id gnl|my_center|LOCUS_23690 >Feature sequence1109 >Feature sequence1110 >Feature sequence1111 1874 804 gene locus_tag LOCUS_23700 1874 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence1112 >Feature sequence1113 1133 306 gene locus_tag LOCUS_23710 1133 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 <1875 1182 gene locus_tag LOCUS_23720 <1875 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXD3:pseudouridine synthase >Feature sequence1114 >Feature sequence1115 8 811 gene locus_tag LOCUS_23730 8 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 808 1569 gene locus_tag LOCUS_23740 808 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23740 >Feature sequence1116 1871 903 gene locus_tag LOCUS_23750 1871 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence1117 1595 45 gene locus_tag LOCUS_23760 1595 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence1118 >Feature sequence1119 1091 159 gene locus_tag LOCUS_23770 1091 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence1120 14 982 gene locus_tag LOCUS_23780 14 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence1121 818 192 gene locus_tag LOCUS_23790 818 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence1122 957 1511 gene locus_tag LOCUS_23800 gene rsmG 957 1511 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CN3 protein_id gnl|my_center|LOCUS_23800 >Feature sequence1123 >Feature sequence1124 338 1060 gene locus_tag LOCUS_23810 338 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 <1861 1081 gene locus_tag LOCUS_23820 <1861 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O51557:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence1125 666 971 gene locus_tag LOCUS_23830 666 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence1126 321 1289 gene locus_tag LOCUS_23840 321 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence1127 3 842 gene locus_tag LOCUS_23850 3 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence1128 1225 836 gene locus_tag LOCUS_23860 1225 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence1129 <1857 996 gene locus_tag LOCUS_23870 <1857 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I310:putative signaling protein >Feature sequence1130 1311 661 gene locus_tag LOCUS_23880 1311 661 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence1131 838 521 gene locus_tag LOCUS_23890 838 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1854 958 gene locus_tag LOCUS_23900 1854 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence1132 <1 525 gene locus_tag LOCUS_23910 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391428.1:polyisoprenoid-binding protein 618 1850 gene locus_tag LOCUS_23920 618 1850 CDS product nucleoside:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence1133 >Feature sequence1134 2 604 gene locus_tag LOCUS_23930 2 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 >Feature sequence1135 >Feature sequence1136 >Feature sequence1137 1508 423 gene locus_tag LOCUS_23940 1508 423 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884030.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence1138 <1 743 gene locus_tag LOCUS_23950 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940792.1:transglycosylase 872 1300 gene locus_tag LOCUS_23960 872 1300 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977376.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence1139 159 626 gene locus_tag LOCUS_23970 159 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence1140 >Feature sequence1141 110 925 gene locus_tag LOCUS_23980 110 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence1142 >Feature sequence1143 1252 839 gene locus_tag LOCUS_23990 1252 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence1144 3 200 gene locus_tag LOCUS_24000 3 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence1145 985 284 gene locus_tag LOCUS_24010 985 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence1146 171 1163 gene locus_tag LOCUS_24020 gene holA 171 1163 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362655.1 protein_id gnl|my_center|LOCUS_24020 1520 1245 gene locus_tag LOCUS_24030 gene rpsT 1520 1245 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AZ3 protein_id gnl|my_center|LOCUS_24030 >Feature sequence1147 26 1072 gene locus_tag LOCUS_24040 26 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 1072 1554 gene locus_tag LOCUS_24050 1072 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence1148 1424 540 gene locus_tag LOCUS_24060 1424 540 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120182.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence1149 263 883 gene locus_tag LOCUS_24070 263 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 880 1254 gene locus_tag LOCUS_24080 880 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 1254 1631 gene locus_tag LOCUS_24090 1254 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence1150 882 133 gene locus_tag LOCUS_24100 882 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1037 1351 gene locus_tag LOCUS_24110 1037 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence1151 >Feature sequence1152 1662 919 gene locus_tag LOCUS_24120 1662 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence1153 >Feature sequence1154 1688 525 gene locus_tag LOCUS_24130 1688 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence1155 203 1330 gene locus_tag LOCUS_24140 203 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 1657 1385 gene locus_tag LOCUS_24150 1657 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence1156 >Feature sequence1157 1750 1307 gene locus_tag LOCUS_24160 1750 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence1158 >Feature sequence1159 <1 619 gene locus_tag LOCUS_24170 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UP89:triosephosphate isomerase 670 1173 gene locus_tag LOCUS_24180 670 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 1690 1223 gene locus_tag LOCUS_24190 gene fur 1690 1223 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence1160 505 113 gene locus_tag LOCUS_24200 505 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 1334 693 gene locus_tag LOCUS_24210 1334 693 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389529.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence1161 >Feature sequence1162 318 1790 gene locus_tag LOCUS_24220 318 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence1163 499 663 gene locus_tag LOCUS_24230 499 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 1745 891 gene locus_tag LOCUS_24240 1745 891 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence1164 >Feature sequence1165 <1826 479 gene locus_tag LOCUS_24250 <1826 479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120741.1:phosphomannomutase >Feature sequence1166 >Feature sequence1167 495 1184 gene locus_tag LOCUS_24260 gene flgH 495 1184 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EQ4 protein_id gnl|my_center|LOCUS_24260 >Feature sequence1168 208 1158 gene locus_tag LOCUS_24270 208 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence1169 >Feature sequence1170 746 1060 gene locus_tag LOCUS_24280 746 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence1171 14 895 gene locus_tag LOCUS_24290 14 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence1172 >Feature sequence1173 1786 1109 gene locus_tag LOCUS_24300 1786 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 >Feature sequence1174 54 482 gene locus_tag LOCUS_24310 54 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 479 1282 gene locus_tag LOCUS_24320 gene tatC 479 1282 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D88 protein_id gnl|my_center|LOCUS_24320 >Feature sequence1175 352 38 gene locus_tag LOCUS_24330 352 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 1473 448 gene locus_tag LOCUS_24340 gene fadB5 1473 448 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_24340 >Feature sequence1176 >Feature sequence1177 1003 1593 gene locus_tag LOCUS_24350 1003 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence1178 329 1144 gene locus_tag LOCUS_24360 329 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence1179 >Feature sequence1180 931 1806 gene locus_tag LOCUS_24370 931 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence1181 >Feature sequence1182 3 185 gene locus_tag LOCUS_24380 3 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence1183 <1 588 gene locus_tag LOCUS_24390 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222349.1:1-aminocyclopropane-1-carboxylate deaminase 591 1550 gene locus_tag LOCUS_24400 591 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence1184 824 87 gene locus_tag LOCUS_24410 824 87 CDS product putative polyprenol phosphate mannosyl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702942.1 protein_id gnl|my_center|LOCUS_24410 1589 834 gene locus_tag LOCUS_24420 1589 834 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676157.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence1185 1629 448 gene locus_tag LOCUS_24430 1629 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence1186 >Feature sequence1187 <1 980 gene locus_tag LOCUS_24440 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527993.1:ABC transporter substrate-binding protein >Feature sequence1188 891 190 gene locus_tag LOCUS_24450 891 190 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071887.1 protein_id gnl|my_center|LOCUS_24450 1279 923 gene locus_tag LOCUS_24460 1279 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24460 >Feature sequence1189 1 708 gene locus_tag LOCUS_24470 1 708 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195950.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence1190 <1806 492 gene locus_tag LOCUS_24480 <1806 492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920205.1:nitrate reductase >Feature sequence1191 909 385 gene locus_tag LOCUS_24490 gene hprT 909 385 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37472 protein_id gnl|my_center|LOCUS_24490 >Feature sequence1192 1321 215 gene locus_tag LOCUS_24500 1321 215 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence1193 1585 248 gene locus_tag LOCUS_24510 gene murD 1585 248 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK81 protein_id gnl|my_center|LOCUS_24510 >Feature sequence1194 >Feature sequence1195 >Feature sequence1196 <1 656 gene locus_tag LOCUS_24520 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730147.1:2-hydroxy-6-ketonona-2,4-dienedioic acid hydrolase >Feature sequence1197 >Feature sequence1198 935 246 gene locus_tag LOCUS_24530 935 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence1199 >Feature sequence1200 53 1663 gene locus_tag LOCUS_24540 gene groL 53 1663 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C7 protein_id gnl|my_center|LOCUS_24540 >Feature sequence1201 465 1292 gene locus_tag LOCUS_24550 465 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence1202 <1796 1289 gene locus_tag LOCUS_24560 <1796 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087365.1:delta 9 acyl-lipid fatty acid desaturase >Feature sequence1203 >Feature sequence1204 1280 486 gene locus_tag LOCUS_24570 1280 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389315.1 protein_id gnl|my_center|LOCUS_24570 >Feature sequence1205 1311 583 gene locus_tag LOCUS_24580 1311 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence1206 517 1302 gene locus_tag LOCUS_24590 517 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence1207 44 448 gene locus_tag LOCUS_24600 44 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 451 1659 gene locus_tag LOCUS_24610 451 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence1208 1409 75 gene locus_tag LOCUS_24620 1409 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 1652 1488 gene locus_tag LOCUS_24630 1652 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence1209 1671 400 gene locus_tag LOCUS_24640 1671 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence1210 1349 1774 gene locus_tag LOCUS_24650 1349 1774 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence1211 111 893 gene locus_tag LOCUS_24660 111 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence1212 1088 75 gene locus_tag LOCUS_24670 1088 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1087 1275 gene locus_tag LOCUS_24680 1087 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 1316 1507 gene locus_tag LOCUS_24690 1316 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence1213 >Feature sequence1214 1205 363 gene locus_tag LOCUS_24700 1205 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence1215 965 1768 gene locus_tag LOCUS_24710 965 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 >Feature sequence1216 >Feature sequence1217 <1 649 gene locus_tag LOCUS_24720 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72C40:basal-body rod modification protein FlgD 662 1138 gene locus_tag LOCUS_24730 662 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence1218 >Feature sequence1219 850 65 gene locus_tag LOCUS_24740 850 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence1220 >Feature sequence1221 >Feature sequence1222 >Feature sequence1223 >Feature sequence1224 <1 903 gene locus_tag LOCUS_24750 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933643.1:glycosyl hydrolase >Feature sequence1225 409 1260 gene locus_tag LOCUS_24760 409 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence1226 <1766 1085 gene locus_tag LOCUS_24770 <1766 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882748.1:lipid A biosynthesis lauroyl acyltransferase >Feature sequence1227 254 811 gene locus_tag LOCUS_24780 254 811 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807810.1 protein_id gnl|my_center|LOCUS_24780 1762 860 gene locus_tag LOCUS_24790 1762 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence1228 1468 983 gene locus_tag LOCUS_24800 1468 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence1229 65 1306 gene locus_tag LOCUS_24810 65 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence1230 >Feature sequence1231 308 147 gene locus_tag LOCUS_24820 308 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence1232 163 250 gene locus_tag LOCUS_t00130 163 250 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1233 >Feature sequence1234 >Feature sequence1235 <1 1226 gene locus_tag LOCUS_24830 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S0V0:GMP synthase [glutamine-hydrolyzing] >Feature sequence1236 464 1366 gene locus_tag LOCUS_24840 464 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence1237 <1758 414 gene locus_tag LOCUS_24850 <1758 414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187957.1:peptidase C69 >Feature sequence1238 >Feature sequence1239 >Feature sequence1240 35 721 gene locus_tag LOCUS_24860 35 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 799 1272 gene locus_tag LOCUS_24870 799 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence1241 >Feature sequence1242 9 1067 gene locus_tag LOCUS_24880 9 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence1243 >Feature sequence1244 >Feature sequence1245 1104 247 gene locus_tag LOCUS_24890 1104 247 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887993.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence1246 <1 713 gene locus_tag LOCUS_24900 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222805.1:alpha-hydroxy-acid oxidizing enzyme >Feature sequence1247 538 1359 gene locus_tag LOCUS_24910 538 1359 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731349.1 protein_id gnl|my_center|LOCUS_24910 1607 1356 gene locus_tag LOCUS_24920 1607 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence1248 <1750 1192 gene locus_tag LOCUS_24930 <1750 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946539.1:acyl-CoA dehydrogenase >Feature sequence1249 1159 173 gene locus_tag LOCUS_24940 1159 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 1748 1221 gene locus_tag LOCUS_24950 1748 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence1250 <1 948 gene locus_tag LOCUS_24960 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726830.1:glycerol acyltransferase 1363 959 gene locus_tag LOCUS_24970 1363 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 1746 1438 gene locus_tag LOCUS_24980 1746 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence1251 980 1210 gene locus_tag LOCUS_24990 980 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 1167 1679 gene locus_tag LOCUS_25000 1167 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence1252 >Feature sequence1253 >Feature sequence1254 1013 378 gene locus_tag LOCUS_25010 1013 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 1200 1619 gene locus_tag LOCUS_25020 1200 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence1255 867 1505 gene locus_tag LOCUS_25030 867 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence1256 1305 1601 gene locus_tag LOCUS_25040 1305 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence1257 63 686 gene locus_tag LOCUS_25050 63 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence1258 >Feature sequence1259 1413 421 gene locus_tag LOCUS_25060 gene moaA 1413 421 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJ31 protein_id gnl|my_center|LOCUS_25060 >Feature sequence1260 <1 704 gene locus_tag LOCUS_25070 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74ER6:peptidyl-prolyl cis-trans isomerase 1739 786 gene locus_tag LOCUS_25080 1739 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence1261 924 10 gene locus_tag LOCUS_25090 924 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence1262 334 65 gene locus_tag LOCUS_25100 334 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 562 909 gene locus_tag LOCUS_25110 562 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence1263 >Feature sequence1264 850 74 gene locus_tag LOCUS_25120 850 74 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_25120 1326 871 gene locus_tag LOCUS_25130 1326 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 1733 1575 gene locus_tag LOCUS_25140 1733 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence1265 206 1657 gene locus_tag LOCUS_25150 gene mpl 206 1657 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence1266 1700 684 gene locus_tag LOCUS_25160 1700 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 >Feature sequence1267 >Feature sequence1268 <1 1617 gene locus_tag LOCUS_25170 <1 1617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459887.1:ATP-dependent helicase >Feature sequence1269 >Feature sequence1270 >Feature sequence1271 >Feature sequence1272 788 600 gene locus_tag LOCUS_25180 788 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence1273 809 267 gene locus_tag LOCUS_25190 809 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 <1724 875 gene locus_tag LOCUS_25200 <1724 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531366.1:penicillin-binding protein >Feature sequence1274 1613 390 gene locus_tag LOCUS_25210 1613 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence1275 381 1361 gene locus_tag LOCUS_25220 gene acoB 381 1361 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_25220 >Feature sequence1276 <1 1270 gene locus_tag LOCUS_25230 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762594.1:modulator protein >Feature sequence1277 3 524 gene locus_tag LOCUS_25240 3 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 >Feature sequence1278 1508 429 gene locus_tag LOCUS_25250 1508 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence1279 1193 285 gene locus_tag LOCUS_25260 1193 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 >Feature sequence1280 700 38 gene locus_tag LOCUS_25270 gene gpmA 700 38 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206916.1 protein_id gnl|my_center|LOCUS_25270 869 1363 gene locus_tag LOCUS_25280 869 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence1281 >Feature sequence1282 >Feature sequence1283 >Feature sequence1284 <1 1441 gene locus_tag LOCUS_25290 <1 1441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530640.1:glycosyl transferase family 1 >Feature sequence1285 1579 194 gene locus_tag LOCUS_25300 1579 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence1286 1508 72 gene locus_tag LOCUS_25310 1508 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25310 >Feature sequence1287 1439 894 gene locus_tag LOCUS_25320 gene mobA 1439 894 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R169 protein_id gnl|my_center|LOCUS_25320 >Feature sequence1288 <1715 895 gene locus_tag LOCUS_25330 <1715 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UM96:chaperone protein DnaJ >Feature sequence1289 791 1591 gene locus_tag LOCUS_25340 791 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 >Feature sequence1290 1592 876 gene locus_tag LOCUS_25350 1592 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence1291 <1714 922 gene locus_tag LOCUS_25360 <1714 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8RGV7:GTPase Der >Feature sequence1292 1694 1128 gene locus_tag LOCUS_25370 1694 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence1293 <1 854 gene locus_tag LOCUS_25380 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RU46:trigger factor >Feature sequence1294 <1 1092 gene locus_tag LOCUS_25390 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223904.1:NADPH:quinone reductase >Feature sequence1295 >Feature sequence1296 >Feature sequence1297 <1 700 gene locus_tag LOCUS_25400 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888825.1:alpha-glucan phosphorylase >Feature sequence1298 >Feature sequence1299 >Feature sequence1300 >Feature sequence1301 2 598 gene locus_tag LOCUS_25410 2 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence1302 1393 344 gene locus_tag LOCUS_25420 1393 344 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_25420 >Feature sequence1303 >Feature sequence1304 >Feature sequence1305 1273 386 gene locus_tag LOCUS_25430 1273 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence1306 1035 589 gene locus_tag LOCUS_25440 1035 589 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767887.1 protein_id gnl|my_center|LOCUS_25440 1394 1218 gene locus_tag LOCUS_25450 1394 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 >Feature sequence1307 1359 673 gene locus_tag LOCUS_25460 1359 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 1702 1376 gene locus_tag LOCUS_25470 1702 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence1308 879 463 gene locus_tag LOCUS_25480 879 463 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_25480 1460 876 gene locus_tag LOCUS_25490 1460 876 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022658.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence1309 1348 425 gene locus_tag LOCUS_25500 1348 425 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIK9 protein_id gnl|my_center|LOCUS_25500 >Feature sequence1310 671 1300 gene locus_tag LOCUS_25510 671 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence1311 >Feature sequence1312 1326 292 gene locus_tag LOCUS_25520 1326 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence1313 >Feature sequence1314 >Feature sequence1315 >Feature sequence1316 106 351 gene locus_tag LOCUS_25530 gene acp 106 351 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4N3 protein_id gnl|my_center|LOCUS_25530 452 1642 gene locus_tag LOCUS_25540 gene fabF 452 1642 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67612 protein_id gnl|my_center|LOCUS_25540 >Feature sequence1317 >Feature sequence1318 532 442 gene locus_tag LOCUS_t00140 532 442 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1319 824 1609 gene locus_tag LOCUS_25550 824 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence1320 113 1015 gene locus_tag LOCUS_25560 113 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence1321 >Feature sequence1322 >Feature sequence1323 <1 555 gene locus_tag LOCUS_25570 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389890.1:histidine kinase 687 1313 gene locus_tag LOCUS_25580 687 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence1324 >Feature sequence1325 237 1640 gene locus_tag LOCUS_25590 237 1640 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence1326 276 935 gene locus_tag LOCUS_25600 276 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 <1688 962 gene locus_tag LOCUS_25610 <1688 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986940.1:B12-binding domain-containing radical SAM protein >Feature sequence1327 >Feature sequence1328 >Feature sequence1329 >Feature sequence1330 1092 1643 gene locus_tag LOCUS_25620 1092 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence1331 <1 928 gene locus_tag LOCUS_25630 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940770.1:ABC transporter ATP-binding protein note possible pseudo, frameshifted 831 1448 gene locus_tag LOCUS_25640 831 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25640 >Feature sequence1332 <1 687 gene locus_tag LOCUS_25650 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123698.1:adenosine kinase 674 1483 gene locus_tag LOCUS_25660 674 1483 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence1333 >Feature sequence1334 >Feature sequence1335 <1680 730 gene locus_tag LOCUS_25670 <1680 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RHE5:cyclic dehypoxanthine futalosine synthase >Feature sequence1336 >Feature sequence1337 <1 1000 gene locus_tag LOCUS_25680 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898564.1:signal peptide peptidase SppA >Feature sequence1338 661 161 gene locus_tag LOCUS_25690 661 161 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224025.1 protein_id gnl|my_center|LOCUS_25690 771 1499 gene locus_tag LOCUS_25700 771 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 >Feature sequence1339 >Feature sequence1340 1546 641 gene locus_tag LOCUS_25710 1546 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence1341 >Feature sequence1342 1310 348 gene locus_tag LOCUS_25720 1310 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence1343 >Feature sequence1344 >Feature sequence1345 953 300 gene locus_tag LOCUS_25730 953 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25730 1277 1047 gene locus_tag LOCUS_25740 1277 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 1639 1274 gene locus_tag LOCUS_25750 1639 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 >Feature sequence1346 >Feature sequence1347 <1 719 gene locus_tag LOCUS_25760 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942482.1:ATP-dependent helicase HrpB 1280 723 gene locus_tag LOCUS_25770 1280 723 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124477.1 protein_id gnl|my_center|LOCUS_25770 >Feature sequence1348 >Feature sequence1349 669 1235 gene locus_tag LOCUS_25780 669 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence1350 865 44 gene locus_tag LOCUS_25790 gene folP 865 44 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S174 protein_id gnl|my_center|LOCUS_25790 <1666 862 gene locus_tag LOCUS_25800 <1666 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C66:ATP-dependent zinc metalloprotease FtsH >Feature sequence1351 1202 618 gene locus_tag LOCUS_25810 1202 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence1352 >Feature sequence1353 >Feature sequence1354 642 415 gene locus_tag LOCUS_25820 642 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 1097 534 gene locus_tag LOCUS_25830 1097 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25830 <1663 1103 gene locus_tag LOCUS_25840 <1663 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EGG8:zinc metalloprotease >Feature sequence1355 <1 556 gene locus_tag LOCUS_25850 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194643.1:asparagine synthetase B 544 1461 gene locus_tag LOCUS_25860 544 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence1356 1661 1419 gene locus_tag LOCUS_25870 1661 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence1357 1220 96 gene locus_tag LOCUS_25880 1220 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence1358 <1 555 gene locus_tag LOCUS_25890 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921559.1:transporter 1569 565 gene locus_tag LOCUS_25900 1569 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence1359 359 1549 gene locus_tag LOCUS_25910 359 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence1360 2 1600 gene locus_tag LOCUS_25920 2 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence1361 >Feature sequence1362 <1 540 gene locus_tag LOCUS_25930 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKU1:gamma-glutamyl phosphate reductase >Feature sequence1363 >Feature sequence1364 >Feature sequence1365 1208 414 gene locus_tag LOCUS_25940 1208 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 >Feature sequence1366 66 1277 gene locus_tag LOCUS_25950 66 1277 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944009.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence1367 216 1196 gene locus_tag LOCUS_25960 216 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 >Feature sequence1368 <1 1189 gene locus_tag LOCUS_25970 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765451.1:alginate O-acetyltransferase >Feature sequence1369 693 175 gene locus_tag LOCUS_25980 693 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence1370 <1645 17 gene locus_tag LOCUS_25990 <1645 17 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNW6:sulfate adenylyltransferase subunit 1 >Feature sequence1371 >Feature sequence1372 >Feature sequence1373 626 1228 gene locus_tag LOCUS_26000 626 1228 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072497.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence1374 >Feature sequence1375 >Feature sequence1376 976 50 gene locus_tag LOCUS_26010 976 50 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143535.1 protein_id gnl|my_center|LOCUS_26010 1094 1555 gene locus_tag LOCUS_26020 1094 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 >Feature sequence1377 >Feature sequence1378 >Feature sequence1379 >Feature sequence1380 <1639 609 gene locus_tag LOCUS_26030 <1639 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YHG6:aminotransferase >Feature sequence1381 <1638 333 gene locus_tag LOCUS_26040 <1638 333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084518.1:transposase >Feature sequence1382 593 87 gene locus_tag LOCUS_26050 593 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence1383 >Feature sequence1384 1187 534 gene locus_tag LOCUS_26060 1187 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence1385 602 267 gene locus_tag LOCUS_26070 602 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 1159 599 gene locus_tag LOCUS_26080 1159 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence1386 >Feature sequence1387 >Feature sequence1388 590 1108 gene locus_tag LOCUS_26090 590 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence1389 <1631 708 gene locus_tag LOCUS_26100 <1631 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461847.1:oxidoreductase >Feature sequence1390 <1 848 gene locus_tag LOCUS_26110 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P37710:autolysin >Feature sequence1391 <1630 32 gene locus_tag LOCUS_26120 <1630 32 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257959.1:lipid A ABC transporter permease/ATP-binding protein >Feature sequence1392 67 819 gene locus_tag LOCUS_26130 67 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence1393 >Feature sequence1394 >Feature sequence1395 1332 376 gene locus_tag LOCUS_26140 1332 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 1396 1581 gene locus_tag LOCUS_26150 1396 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 >Feature sequence1396 979 224 gene locus_tag LOCUS_26160 979 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence1397 598 1251 gene locus_tag LOCUS_26170 598 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence1398 1011 733 gene locus_tag LOCUS_26180 1011 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 >Feature sequence1399 >Feature sequence1400 257 802 gene locus_tag LOCUS_26190 257 802 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence1401 856 1554 gene locus_tag LOCUS_26200 856 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 >Feature sequence1402 818 138 gene locus_tag LOCUS_26210 818 138 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0T7 protein_id gnl|my_center|LOCUS_26210 <1622 821 gene locus_tag LOCUS_26220 <1622 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74G05:ribosomal protein L11 methyltransferase >Feature sequence1403 486 1358 gene locus_tag LOCUS_26230 486 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence1404 >Feature sequence1405 270 1181 gene locus_tag LOCUS_26240 270 1181 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJH7 protein_id gnl|my_center|LOCUS_26240 1619 1188 gene locus_tag LOCUS_26250 1619 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence1406 459 830 gene locus_tag LOCUS_26260 459 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 1125 880 gene locus_tag LOCUS_26270 1125 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 1619 1122 gene locus_tag LOCUS_26280 1619 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 >Feature sequence1407 710 306 gene locus_tag LOCUS_26290 710 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 >Feature sequence1408 >Feature sequence1409 133 1290 gene locus_tag LOCUS_26300 133 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence1410 <1615 79 gene locus_tag LOCUS_26310 <1615 79 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P8W5:tetraacyldisaccharide 4'-kinase >Feature sequence1411 1001 264 gene locus_tag LOCUS_26320 1001 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 >Feature sequence1412 >Feature sequence1413 >Feature sequence1414 164 922 gene locus_tag LOCUS_26330 164 922 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence1415 >Feature sequence1416 1560 235 gene locus_tag LOCUS_26340 1560 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence1417 >Feature sequence1418 >Feature sequence1419 <1610 441 gene locus_tag LOCUS_26350 <1610 441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708991.1:oxidoreductase >Feature sequence1420 364 1050 gene locus_tag LOCUS_26360 364 1050 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence1421 737 1003 gene locus_tag LOCUS_26370 737 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 <1607 963 gene locus_tag LOCUS_26380 <1607 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403341.1:peptidase S8 >Feature sequence1422 437 1237 gene locus_tag LOCUS_26390 437 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 1607 1371 gene locus_tag LOCUS_26400 1607 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 >Feature sequence1423 1200 694 gene locus_tag LOCUS_26410 1200 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence1424 689 336 gene locus_tag LOCUS_26420 689 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 <1606 686 gene locus_tag LOCUS_26430 <1606 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72BE3:glutamyl-Q tRNA(Asp) synthetase >Feature sequence1425 844 92 gene locus_tag LOCUS_26440 gene sdhB 844 92 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933915.1 protein_id gnl|my_center|LOCUS_26440 <1606 841 gene locus_tag LOCUS_26450 <1606 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257750.1:succinate dehydrogenase flavoprotein subunit >Feature sequence1426 1194 1508 gene locus_tag LOCUS_26460 gene hupA 1194 1508 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL0 protein_id gnl|my_center|LOCUS_26460 >Feature sequence1427 1548 814 gene locus_tag LOCUS_26470 1548 814 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence1428 >Feature sequence1429 508 1029 gene locus_tag LOCUS_26480 508 1029 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence1430 >Feature sequence1431 <1599 801 gene locus_tag LOCUS_26490 <1599 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460911.1:endopeptidase La >Feature sequence1432 700 308 gene locus_tag LOCUS_26500 700 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728758.1 protein_id gnl|my_center|LOCUS_26500 <1599 836 gene locus_tag LOCUS_26510 <1599 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529052.1:LysR family transcriptional regulator >Feature sequence1433 165 590 gene locus_tag LOCUS_26520 165 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881169.1 protein_id gnl|my_center|LOCUS_26520 >Feature sequence1434 >Feature sequence1435 442 750 gene locus_tag LOCUS_26530 442 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence1436 1383 349 gene locus_tag LOCUS_26540 1383 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 >Feature sequence1437 >Feature sequence1438 1330 563 gene locus_tag LOCUS_26550 1330 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence1439 1177 434 gene locus_tag LOCUS_26560 1177 434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815775.1 protein_id gnl|my_center|LOCUS_26560 1593 1174 gene locus_tag LOCUS_26570 1593 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence1440 625 1488 gene locus_tag LOCUS_26580 625 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence1441 966 340 gene locus_tag LOCUS_26590 966 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 1591 968 gene locus_tag LOCUS_26600 1591 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence1442 578 1321 gene locus_tag LOCUS_26610 578 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence1443 >Feature sequence1444 >Feature sequence1445 >Feature sequence1446 710 21 gene locus_tag LOCUS_26620 710 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26620 >Feature sequence1447 1238 591 gene locus_tag LOCUS_26630 1238 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence1448 >Feature sequence1449 >Feature sequence1450 >Feature sequence1451 >Feature sequence1452 >Feature sequence1453 >Feature sequence1454 >Feature sequence1455 <1 1234 gene locus_tag LOCUS_26640 <1 1234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920434.1:peptidase M16 >Feature sequence1456 >Feature sequence1457 427 71 gene locus_tag LOCUS_26650 427 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1583 519 gene locus_tag LOCUS_26660 1583 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 >Feature sequence1458 >Feature sequence1459 1 552 gene locus_tag LOCUS_26670 1 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1475 555 gene locus_tag LOCUS_26680 1475 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 >Feature sequence1460 >Feature sequence1461 1420 95 gene locus_tag LOCUS_26690 1420 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence1462 >Feature sequence1463 8 1018 gene locus_tag LOCUS_26700 8 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence1464 >Feature sequence1465 179 1351 gene locus_tag LOCUS_26710 179 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence1466 >Feature sequence1467 1578 1483 gene locus_tag LOCUS_t00150 1578 1483 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1468 167 1093 gene locus_tag LOCUS_26720 167 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26720 >Feature sequence1469 1405 80 gene locus_tag LOCUS_26730 1405 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence1470 200 367 gene locus_tag LOCUS_26740 200 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence1471 1335 436 gene locus_tag LOCUS_26750 1335 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence1472 870 139 gene locus_tag LOCUS_26760 870 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 1574 867 gene locus_tag LOCUS_26770 1574 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 >Feature sequence1473 >Feature sequence1474 1138 92 gene locus_tag LOCUS_26780 gene yiaO 1138 92 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776911.1 protein_id gnl|my_center|LOCUS_26780 1540 1154 gene locus_tag LOCUS_26790 1540 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence1475 <1 574 gene locus_tag LOCUS_26800 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941610.1:inositol monophosphatase >Feature sequence1476 >Feature sequence1477 >Feature sequence1478 1452 418 gene locus_tag LOCUS_26810 gene ybhS 1452 418 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence1479 >Feature sequence1480 >Feature sequence1481 >Feature sequence1482 <1 1107 gene locus_tag LOCUS_26820 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141076.1:folylpolyglutamate synthase >Feature sequence1483 >Feature sequence1484 >Feature sequence1485 >Feature sequence1486 >Feature sequence1487 227 1210 gene locus_tag LOCUS_26830 227 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence1488 >Feature sequence1489 >Feature sequence1490 125 982 gene locus_tag LOCUS_26840 125 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 <1567 987 gene locus_tag LOCUS_26850 <1567 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72CB9:dTDP-glucose 4,6-dehydratase >Feature sequence1491 103 525 gene locus_tag LOCUS_26860 103 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence1492 >Feature sequence1493 >Feature sequence1494 440 1465 gene locus_tag LOCUS_26870 440 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence1495 >Feature sequence1496 953 258 gene locus_tag LOCUS_26880 953 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence1497 1559 36 gene locus_tag LOCUS_26890 1559 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 >Feature sequence1498 211 576 gene locus_tag LOCUS_26900 211 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence1499 648 103 gene locus_tag LOCUS_26910 648 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26910 988 539 gene locus_tag LOCUS_26920 988 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 <1557 985 gene locus_tag LOCUS_26930 <1557 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035494.1:cyclic nucleotide-binding protein >Feature sequence1500 >Feature sequence1501 >Feature sequence1502 >Feature sequence1503 850 92 gene locus_tag LOCUS_26940 850 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 1235 1483 gene locus_tag LOCUS_26950 1235 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 >Feature sequence1504 >Feature sequence1505 >Feature sequence1506 <1551 659 gene locus_tag LOCUS_26960 <1551 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703431.1:Xaa-Pro aminopeptidase >Feature sequence1507 >Feature sequence1508 16 1110 gene locus_tag LOCUS_26970 16 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence1509 836 210 gene locus_tag LOCUS_26980 gene cysC 836 210 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN99 protein_id gnl|my_center|LOCUS_26980 >Feature sequence1510 818 180 gene locus_tag LOCUS_26990 818 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 <1547 703 gene locus_tag LOCUS_27000 <1547 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257229.1:sulfatase >Feature sequence1511 665 288 gene locus_tag LOCUS_27010 665 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259291.1 protein_id gnl|my_center|LOCUS_27010 1290 808 gene locus_tag LOCUS_27020 1290 808 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880208.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence1512 >Feature sequence1513 620 1069 gene locus_tag LOCUS_27030 620 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence1514 1341 1036 gene locus_tag LOCUS_27040 1341 1036 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FU4 protein_id gnl|my_center|LOCUS_27040 >Feature sequence1515 669 1424 gene locus_tag LOCUS_27050 669 1424 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894369.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence1516 >Feature sequence1517 224 721 gene locus_tag LOCUS_27060 224 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence1518 >Feature sequence1519 >Feature sequence1520 >Feature sequence1521 <1541 234 gene locus_tag LOCUS_27070 <1541 234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973184.1:zinc protease >Feature sequence1522 128 655 gene locus_tag LOCUS_27080 128 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 729 1499 gene locus_tag LOCUS_27090 729 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence1523 815 3 gene locus_tag LOCUS_27100 815 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 1539 1264 gene locus_tag LOCUS_27110 1539 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence1524 516 1418 gene locus_tag LOCUS_27120 516 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence1525 <1 964 gene locus_tag LOCUS_27130 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PBB3:tryptophan 2,3-dioxygenase-like protein >Feature sequence1526 1281 640 gene locus_tag LOCUS_27140 1281 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 1533 1348 gene locus_tag LOCUS_27150 1533 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence1527 >Feature sequence1528 >Feature sequence1529 <1 718 gene locus_tag LOCUS_27160 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404965.1:sodium-independent anion transporter >Feature sequence1530 >Feature sequence1531 >Feature sequence1532 661 167 gene locus_tag LOCUS_27170 661 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 1167 658 gene locus_tag LOCUS_27180 1167 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence1533 >Feature sequence1534 >Feature sequence1535 193 678 gene locus_tag LOCUS_27190 193 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence1536 148 543 gene locus_tag LOCUS_27200 148 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27200 456 1241 gene locus_tag LOCUS_27210 456 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27210 >Feature sequence1537 77 1456 gene locus_tag LOCUS_27220 77 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence1538 282 1385 gene locus_tag LOCUS_27230 282 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 >Feature sequence1539 527 9 gene locus_tag LOCUS_27240 527 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 608 1006 gene locus_tag LOCUS_27250 608 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 1060 1419 gene locus_tag LOCUS_27260 1060 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 >Feature sequence1540 >Feature sequence1541 1237 779 gene locus_tag LOCUS_27270 1237 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence1542 >Feature sequence1543 571 1518 gene locus_tag LOCUS_27280 gene ctaB 571 1518 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIL7 protein_id gnl|my_center|LOCUS_27280 >Feature sequence1544 84 977 gene locus_tag LOCUS_27290 84 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27290 >Feature sequence1545 600 758 gene locus_tag LOCUS_27300 600 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence1546 >Feature sequence1547 674 1225 gene locus_tag LOCUS_27310 674 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence1548 85 528 gene locus_tag LOCUS_27320 85 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 1200 517 gene locus_tag LOCUS_27330 1200 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence1549 >Feature sequence1550 363 1160 gene locus_tag LOCUS_27340 363 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 >Feature sequence1551 >Feature sequence1552 1390 590 gene locus_tag LOCUS_27350 1390 590 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_27350 >Feature sequence1553 >Feature sequence1554 1490 492 gene locus_tag LOCUS_27360 1490 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence1555 1049 366 gene locus_tag LOCUS_27370 1049 366 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EP2 protein_id gnl|my_center|LOCUS_27370 >Feature sequence1556 >Feature sequence1557 >Feature sequence1558 <1512 529 gene locus_tag LOCUS_27380 <1512 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DZ0:queuine tRNA-ribosyltransferase >Feature sequence1559 >Feature sequence1560 <1 1136 gene locus_tag LOCUS_27390 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RUU1:imidazolonepropionase >Feature sequence1561 314 865 gene locus_tag LOCUS_27400 gene kptA 314 865 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I778 protein_id gnl|my_center|LOCUS_27400 >Feature sequence1562 1277 750 gene locus_tag LOCUS_27410 1277 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 >Feature sequence1563 >Feature sequence1564 676 1128 gene locus_tag LOCUS_27420 676 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 >Feature sequence1565 >Feature sequence1566 843 415 gene locus_tag LOCUS_27430 843 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence1567 <1506 218 gene locus_tag LOCUS_27440 <1506 218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747R0:ribosomal protein S12 methylthiotransferase RimO >Feature sequence1568 1211 834 gene locus_tag LOCUS_27450 1211 834 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707050.1 protein_id gnl|my_center|LOCUS_27450 >Feature sequence1569 <1 510 gene locus_tag LOCUS_27460 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DNR9:protein phosphatase PhpP 1455 568 gene locus_tag LOCUS_27470 1455 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence1570 >Feature sequence1571 >Feature sequence1572 1090 425 gene locus_tag LOCUS_27480 1090 425 CDS product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 protein_id gnl|my_center|LOCUS_27480 >Feature sequence1573 >Feature sequence1574 >Feature sequence1575 >Feature sequence1576 284 649 gene locus_tag LOCUS_27490 284 649 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975764.1 protein_id gnl|my_center|LOCUS_27490 686 1498 gene locus_tag LOCUS_27500 686 1498 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_27500 >Feature sequence1577 694 1254 gene locus_tag LOCUS_27510 694 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 >Feature sequence1578 523 1107 gene locus_tag LOCUS_27520 523 1107 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS19 protein_id gnl|my_center|LOCUS_27520 >Feature sequence1579 631 1371 gene locus_tag LOCUS_27530 631 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255354.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence1580 118 552 gene locus_tag LOCUS_27540 118 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence1581 <1 1021 gene locus_tag LOCUS_27550 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942910.1:ABC transporter permease >Feature sequence1582 <1 1167 gene locus_tag LOCUS_27560 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027988.1:ABC transporter ATP-binding protein 1452 1171 gene locus_tag LOCUS_27570 1452 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence1583 91 1371 gene locus_tag LOCUS_27580 91 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 >Feature sequence1584 <1497 563 gene locus_tag LOCUS_27590 <1497 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031746.1:esterase >Feature sequence1585 <1497 420 gene locus_tag LOCUS_27600 <1497 420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207270.1:xanthine dehydrogenase molybdopterin binding subunit >Feature sequence1586 371 1222 gene locus_tag LOCUS_27610 371 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 >Feature sequence1587 <1497 656 gene locus_tag LOCUS_27620 <1497 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889131.1:ferric enterobactin esterase >Feature sequence1588 1419 7 gene locus_tag LOCUS_27630 1419 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 >Feature sequence1589 883 65 gene locus_tag LOCUS_27640 883 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 >Feature sequence1590 >Feature sequence1591 379 1317 gene locus_tag LOCUS_27650 379 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence1592 <1 1027 gene locus_tag LOCUS_27660 <1 1027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031140.1:acetyl-CoA acetyltransferase >Feature sequence1593 >Feature sequence1594 <1 1255 gene locus_tag LOCUS_27670 <1 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_011298.2:Snf2 family protein >Feature sequence1595 >Feature sequence1596 1219 866 gene locus_tag LOCUS_27680 1219 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence1597 <1489 93 gene locus_tag LOCUS_27690 <1489 93 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S2H4:DNA topoisomerase (ATP-hydrolyzing) >Feature sequence1598 247 1077 gene locus_tag LOCUS_27700 gene mtnP 247 1077 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E52 protein_id gnl|my_center|LOCUS_27700 >Feature sequence1599 98 808 gene locus_tag LOCUS_27710 98 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 820 1431 gene locus_tag LOCUS_27720 820 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 >Feature sequence1600 >Feature sequence1601 <1 624 gene locus_tag LOCUS_27730 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969436.1:membrane protein >Feature sequence1602 <1488 871 gene locus_tag LOCUS_27740 <1488 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000820031.1:copper oxidase >Feature sequence1603 >Feature sequence1604 >Feature sequence1605 200 1117 gene locus_tag LOCUS_27750 200 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence1606 >Feature sequence1607 >Feature sequence1608 >Feature sequence1609 >Feature sequence1610 <1484 241 gene locus_tag LOCUS_27760 <1484 241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031412.1:NADPH-dependent 2,4-dienoyl-CoA reductase >Feature sequence1611 >Feature sequence1612 3 956 gene locus_tag LOCUS_27770 3 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 >Feature sequence1613 >Feature sequence1614 >Feature sequence1615 448 1317 gene locus_tag LOCUS_27780 448 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence1616 <1 1057 gene locus_tag LOCUS_27790 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001068542.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence1617 >Feature sequence1618 >Feature sequence1619 58 516 gene locus_tag LOCUS_27800 58 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 >Feature sequence1620 117 761 gene locus_tag LOCUS_27810 117 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 1478 960 gene locus_tag LOCUS_27820 1478 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence1621 >Feature sequence1622 453 196 gene locus_tag LOCUS_27830 453 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 856 491 gene locus_tag LOCUS_27840 856 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 >Feature sequence1623 <1477 148 gene locus_tag LOCUS_27850 <1477 148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:RNA-binding protein >Feature sequence1624 <1 645 gene locus_tag LOCUS_27860 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336857.1:glutathione-dependent reductase >Feature sequence1625 1291 1031 gene locus_tag LOCUS_27870 1291 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence1626 <1 1307 gene locus_tag LOCUS_27880 <1 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZU46:peptidyl-prolyl cis-trans isomerase >Feature sequence1627 67 768 gene locus_tag LOCUS_27890 67 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 928 854 gene locus_tag LOCUS_t00160 928 854 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1009 937 gene locus_tag LOCUS_t00170 1009 937 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1628 <1 1375 gene locus_tag LOCUS_27900 <1 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478447.1:ABC transporter ATP-binding protein >Feature sequence1629 >Feature sequence1630 873 121 gene locus_tag LOCUS_27910 873 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence1631 <1 630 gene locus_tag LOCUS_27920 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531306.1:protein translocase subunit SecDF 708 1037 gene locus_tag LOCUS_27930 708 1037 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940232.1 protein_id gnl|my_center|LOCUS_27930 >Feature sequence1632 >Feature sequence1633 >Feature sequence1634 1468 137 gene locus_tag LOCUS_27940 1468 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence1635 696 250 gene locus_tag LOCUS_27950 696 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 918 1442 gene locus_tag LOCUS_27960 gene tadA 918 1442 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q035W4 protein_id gnl|my_center|LOCUS_27960 >Feature sequence1636 228 1253 gene locus_tag LOCUS_27970 228 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 >Feature sequence1637 394 813 gene locus_tag LOCUS_27980 394 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence1638 843 346 gene locus_tag LOCUS_27990 843 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 <1467 954 gene locus_tag LOCUS_28000 <1467 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941701.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence1639 >Feature sequence1640 >Feature sequence1641 >Feature sequence1642 >Feature sequence1643 1462 1157 gene locus_tag LOCUS_28010 1462 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 >Feature sequence1644 >Feature sequence1645 >Feature sequence1646 >Feature sequence1647 <1459 720 gene locus_tag LOCUS_28020 <1459 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403082.1:TIGR00266 family protein >Feature sequence1648 587 135 gene locus_tag LOCUS_28030 587 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence1649 <1459 721 gene locus_tag LOCUS_28040 <1459 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256961.1:beta-glucosidase >Feature sequence1650 >Feature sequence1651 <1 741 gene locus_tag LOCUS_28050 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003687361.1:c-type cytochrome biogenesis protein CcsB >Feature sequence1652 >Feature sequence1653 119 1051 gene locus_tag LOCUS_28060 119 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 >Feature sequence1654 >Feature sequence1655 1287 988 gene locus_tag LOCUS_28070 1287 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence1656 >Feature sequence1657 >Feature sequence1658 317 841 gene locus_tag LOCUS_28080 317 841 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939520.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence1659 <1450 303 gene locus_tag LOCUS_28090 <1450 303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PDC6:glycogen operon protein GlgX homolog >Feature sequence1660 >Feature sequence1661 <1449 758 gene locus_tag LOCUS_28100 <1449 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003897325.1:DUF4956 domain-containing protein >Feature sequence1662 245 769 gene locus_tag LOCUS_28110 245 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence1663 1148 642 gene locus_tag LOCUS_28120 1148 642 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888078.1 protein_id gnl|my_center|LOCUS_28120 >Feature sequence1664 >Feature sequence1665 <1 666 gene locus_tag LOCUS_28130 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CZ6:5'-nucleotidase SurE 1330 641 gene locus_tag LOCUS_28140 1330 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057912.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence1666 >Feature sequence1667 <1 601 gene locus_tag LOCUS_28150 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203507.1:peptidoglycan-binding protein >Feature sequence1668 >Feature sequence1669 219 851 gene locus_tag LOCUS_28160 219 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 <1442 900 gene locus_tag LOCUS_28170 <1442 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023004213.1:GGDEF domain-containing protein >Feature sequence1670 540 710 gene locus_tag LOCUS_28180 540 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence1671 739 296 gene locus_tag LOCUS_28190 gene dtd 739 296 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHV8 protein_id gnl|my_center|LOCUS_28190 <1442 764 gene locus_tag LOCUS_28200 <1442 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256651.1:rhomboid family intramembrane serine protease >Feature sequence1672 <1441 845 gene locus_tag LOCUS_28210 <1441 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:membrane protein >Feature sequence1673 >Feature sequence1674 >Feature sequence1675 >Feature sequence1676 <1 1154 gene locus_tag LOCUS_28220 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259368.1:peptide synthase >Feature sequence1677 >Feature sequence1678 30 569 gene locus_tag LOCUS_28230 30 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 942 583 gene locus_tag LOCUS_28240 942 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence1679 432 863 gene locus_tag LOCUS_28250 432 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 <1435 878 gene locus_tag LOCUS_28260 <1435 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259176.1:adenosine deaminase >Feature sequence1680 361 873 gene locus_tag LOCUS_28270 361 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence1681 >Feature sequence1682 442 1317 gene locus_tag LOCUS_28280 442 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence1683 >Feature sequence1684 >Feature sequence1685 >Feature sequence1686 920 6 gene locus_tag LOCUS_28290 gene pdxA1 920 6 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58715 protein_id gnl|my_center|LOCUS_28290 >Feature sequence1687 <1429 146 gene locus_tag LOCUS_28300 <1429 146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H59:chaperone protein DnaK >Feature sequence1688 >Feature sequence1689 <1 1417 gene locus_tag LOCUS_28310 <1 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940636.1:acetoacetate metabolism regulatory protein AtoC >Feature sequence1690 <1428 587 gene locus_tag LOCUS_28320 <1428 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q749B3:DNA-directed RNA polymerase subunit alpha >Feature sequence1691 >Feature sequence1692 >Feature sequence1693 307 1350 gene locus_tag LOCUS_28330 gene proB 307 1350 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPI6 protein_id gnl|my_center|LOCUS_28330 >Feature sequence1694 >Feature sequence1695 1423 554 gene locus_tag LOCUS_28340 1423 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 >Feature sequence1696 557 922 gene locus_tag LOCUS_28350 557 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence1697 426 16 gene locus_tag LOCUS_28360 426 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 1189 635 gene locus_tag LOCUS_28370 1189 635 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence1698 <1 761 gene locus_tag LOCUS_28380 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903126.1:DNA modification methylase 764 1378 gene locus_tag LOCUS_28390 764 1378 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTF0 protein_id gnl|my_center|LOCUS_28390 >Feature sequence1699 >Feature sequence1700 325 1233 gene locus_tag LOCUS_28400 325 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 >Feature sequence1701 >Feature sequence1702 >Feature sequence1703 >Feature sequence1704 <1 736 gene locus_tag LOCUS_28410 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938202.1:HD family phosphohydrolase 1394 759 gene locus_tag LOCUS_28420 1394 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 >Feature sequence1705 3 377 gene locus_tag LOCUS_28430 3 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence1706 1259 864 gene locus_tag LOCUS_28440 1259 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 protein_id gnl|my_center|LOCUS_28440 >Feature sequence1707 >Feature sequence1708 >Feature sequence1709 1315 311 gene locus_tag LOCUS_28450 1315 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence1710 >Feature sequence1711 >Feature sequence1712 1011 844 gene locus_tag LOCUS_28460 1011 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence1713 >Feature sequence1714 >Feature sequence1715 >Feature sequence1716 229 513 gene locus_tag LOCUS_28470 gene hup 229 513 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_28470 822 1286 gene locus_tag LOCUS_28480 822 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence1717 1 303 gene locus_tag LOCUS_28490 1 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 961 350 gene locus_tag LOCUS_28500 961 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 1269 973 gene locus_tag LOCUS_28510 1269 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence1718 100 621 gene locus_tag LOCUS_28520 100 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 <1413 635 gene locus_tag LOCUS_28530 <1413 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001250026.1:metallophosphatase >Feature sequence1719 548 949 gene locus_tag LOCUS_28540 548 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence1720 1287 286 gene locus_tag LOCUS_28550 1287 286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence1721 >Feature sequence1722 >Feature sequence1723 >Feature sequence1724 961 158 gene locus_tag LOCUS_28560 961 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 >Feature sequence1725 <1 659 gene locus_tag LOCUS_28570 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968176.1:dehydrogenase 1108 851 gene locus_tag LOCUS_28580 1108 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 >Feature sequence1726 663 211 gene locus_tag LOCUS_28590 663 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence1727 >Feature sequence1728 661 1362 gene locus_tag LOCUS_28600 gene fnr 661 1362 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880279.1 protein_id gnl|my_center|LOCUS_28600 >Feature sequence1729 >Feature sequence1730 1362 397 gene locus_tag LOCUS_28610 1362 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 >Feature sequence1731 >Feature sequence1732 891 262 gene locus_tag LOCUS_28620 891 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28620 975 1358 gene locus_tag LOCUS_28630 975 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence1733 57 263 gene locus_tag LOCUS_28640 57 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence1734 >Feature sequence1735 >Feature sequence1736 489 974 gene locus_tag LOCUS_28650 489 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 1400 978 gene locus_tag LOCUS_28660 1400 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence1737 1369 1103 gene locus_tag LOCUS_28670 1369 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 >Feature sequence1738 <1 1320 gene locus_tag LOCUS_28680 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143951.1:thiol:disulfide interchange protein >Feature sequence1739 336 19 gene locus_tag LOCUS_28690 336 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 566 333 gene locus_tag LOCUS_28700 566 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 1366 563 gene locus_tag LOCUS_28710 1366 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence1740 >Feature sequence1741 3 230 gene locus_tag LOCUS_28720 3 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 758 402 gene locus_tag LOCUS_28730 758 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 >Feature sequence1742 258 1103 gene locus_tag LOCUS_28740 258 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 >Feature sequence1743 983 144 gene locus_tag LOCUS_28750 983 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 >Feature sequence1744 759 463 gene locus_tag LOCUS_28760 759 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 1251 886 gene locus_tag LOCUS_28770 1251 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence1745 44 307 gene locus_tag LOCUS_28780 44 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 863 276 gene locus_tag LOCUS_28790 863 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence1746 1392 223 gene locus_tag LOCUS_28800 1392 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence1747 <1 1003 gene locus_tag LOCUS_28810 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NP12:glycine dehydrogenase (decarboxylating) 1392 1045 gene locus_tag LOCUS_28820 1392 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence1748 754 1200 gene locus_tag LOCUS_28830 754 1200 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_28830 >Feature sequence1749 1184 387 gene locus_tag LOCUS_28840 gene caiD 1184 387 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001943.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence1750 >Feature sequence1751 <1 501 gene locus_tag LOCUS_28850 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYI5:DNA mismatch repair protein MutS >Feature sequence1752 <1 826 gene locus_tag LOCUS_28860 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KUX4:sulfite reductase [NADPH] flavoprotein alpha-component >Feature sequence1753 <1 1282 gene locus_tag LOCUS_28870 <1 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861071.1:spore coat protein >Feature sequence1754 13 651 gene locus_tag LOCUS_28880 13 651 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 protein_id gnl|my_center|LOCUS_28880 <1389 706 gene locus_tag LOCUS_28890 <1389 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PCQ7:phosphoribosylformylglycinamidine synthase >Feature sequence1755 >Feature sequence1756 >Feature sequence1757 138 1127 gene locus_tag LOCUS_28900 138 1127 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_28900 >Feature sequence1758 419 81 gene locus_tag LOCUS_28910 419 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence1759 <1386 174 gene locus_tag LOCUS_28920 <1386 174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YHN2:polyribonucleotide nucleotidyltransferase >Feature sequence1760 <1 595 gene locus_tag LOCUS_28930 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222657.1:alpha/beta hydrolase >Feature sequence1761 >Feature sequence1762 >Feature sequence1763 3 242 gene locus_tag LOCUS_28940 3 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence1764 134 742 gene locus_tag LOCUS_28950 134 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28950 >Feature sequence1765 >Feature sequence1766 2 472 gene locus_tag LOCUS_28960 2 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 >Feature sequence1767 <1379 524 gene locus_tag LOCUS_28970 <1379 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035764.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence1768 >Feature sequence1769 321 1010 gene locus_tag LOCUS_28980 321 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 >Feature sequence1770 >Feature sequence1771 >Feature sequence1772 282 860 gene locus_tag LOCUS_28990 gene acrR3 282 860 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880133.1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence1773 <1 515 gene locus_tag LOCUS_29000 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003417929.1:3-hydroxyacyl-thioester dehydratase HtdY >Feature sequence1774 115 537 gene locus_tag LOCUS_29010 115 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 1064 585 gene locus_tag LOCUS_29020 1064 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 1284 1057 gene locus_tag LOCUS_29030 1284 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 >Feature sequence1775 >Feature sequence1776 <1 564 gene locus_tag LOCUS_29040 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224905.1:carbon-monoxide dehydrogenase medium subunit 592 1371 gene locus_tag LOCUS_29050 592 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence1777 371 1288 gene locus_tag LOCUS_29060 371 1288 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence1778 <1372 528 gene locus_tag LOCUS_29070 <1372 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192085.1:exported fimbriae assembly protein >Feature sequence1779 >Feature sequence1780 >Feature sequence1781 503 15 gene locus_tag LOCUS_29080 503 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 >Feature sequence1782 334 1308 gene locus_tag LOCUS_29090 334 1308 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_29090 >Feature sequence1783 720 103 gene locus_tag LOCUS_29100 720 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 1131 727 gene locus_tag LOCUS_29110 1131 727 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTX9 protein_id gnl|my_center|LOCUS_29110 >Feature sequence1784 >Feature sequence1785 >Feature sequence1786 247 780 gene locus_tag LOCUS_29120 247 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 >Feature sequence1787 >Feature sequence1788 >Feature sequence1789 >Feature sequence1790 <1 592 gene locus_tag LOCUS_29130 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKF1:glutathione synthetase 589 1038 gene locus_tag LOCUS_29140 589 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 >Feature sequence1791 >Feature sequence1792 >Feature sequence1793 >Feature sequence1794 >Feature sequence1795 >Feature sequence1796 >Feature sequence1797 >Feature sequence1798 1041 370 gene locus_tag LOCUS_29150 1041 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence1799 1 444 gene locus_tag LOCUS_29160 1 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 781 488 gene locus_tag LOCUS_29170 781 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence1800 614 462 gene locus_tag LOCUS_29180 614 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 >Feature sequence1801 >Feature sequence1802 >Feature sequence1803 >Feature sequence1804 >Feature sequence1805 >Feature sequence1806 940 722 gene locus_tag LOCUS_29190 gene infA 940 722 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20458 protein_id gnl|my_center|LOCUS_29190 >Feature sequence1807 401 790 gene locus_tag LOCUS_29200 401 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 787 1137 gene locus_tag LOCUS_29210 787 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence1808 <1353 788 gene locus_tag LOCUS_29220 <1353 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035898.1:membrane protein >Feature sequence1809 >Feature sequence1810 396 1229 gene locus_tag LOCUS_29230 396 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_29230 >Feature sequence1811 475 972 gene locus_tag LOCUS_29240 475 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 >Feature sequence1812 831 1049 gene locus_tag LOCUS_29250 831 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 1068 1289 gene locus_tag LOCUS_29260 1068 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 >Feature sequence1813 >Feature sequence1814 >Feature sequence1815 >Feature sequence1816 84 1349 gene locus_tag LOCUS_29270 84 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 >Feature sequence1817 <1 732 gene locus_tag LOCUS_29280 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727744.1:GntR family transcriptional regulator >Feature sequence1818 >Feature sequence1819 >Feature sequence1820 >Feature sequence1821 2 166 gene locus_tag LOCUS_29290 2 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 >Feature sequence1822 <1345 33 gene locus_tag LOCUS_29300 <1345 33 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763369.1:aminopeptidase >Feature sequence1823 658 188 gene locus_tag LOCUS_29310 658 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence1824 1061 435 gene locus_tag LOCUS_29320 1061 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 1341 1054 gene locus_tag LOCUS_29330 1341 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 >Feature sequence1825 >Feature sequence1826 <1 1041 gene locus_tag LOCUS_29340 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141553.1:peptidase S8 note possible pseudo, frameshifted >Feature sequence1827 >Feature sequence1828 >Feature sequence1829 >Feature sequence1830 >Feature sequence1831 >Feature sequence1832 <1339 409 gene locus_tag LOCUS_29350 <1339 409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YLD2:threonine--tRNA ligase >Feature sequence1833 >Feature sequence1834 >Feature sequence1835 188 670 gene locus_tag LOCUS_29360 188 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 >Feature sequence1836 >Feature sequence1837 1334 453 gene locus_tag LOCUS_29370 1334 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 >Feature sequence1838 >Feature sequence1839 >Feature sequence1840 >Feature sequence1841 <1334 469 gene locus_tag LOCUS_29380 <1334 469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206435.1:acetyl-CoA acetyltransferase >Feature sequence1842 229 726 gene locus_tag LOCUS_29390 229 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence1843 >Feature sequence1844 761 252 gene locus_tag LOCUS_29400 gene yjeE 761 252 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942445.1 protein_id gnl|my_center|LOCUS_29400 >Feature sequence1845 >Feature sequence1846 272 197 gene locus_tag LOCUS_t00180 272 197 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 351 278 gene locus_tag LOCUS_t00190 351 278 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 453 371 gene locus_tag LOCUS_t00200 453 371 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 596 523 gene locus_tag LOCUS_t00210 596 523 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1847 <1 713 gene locus_tag LOCUS_29410 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268796.1:ATPase >Feature sequence1848 >Feature sequence1849 <1329 41 gene locus_tag LOCUS_29420 <1329 41 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q93PE0:UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase >Feature sequence1850 453 1073 gene locus_tag LOCUS_29430 453 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence1851 >Feature sequence1852 >Feature sequence1853 881 252 gene locus_tag LOCUS_29440 881 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence1854 <1325 225 gene locus_tag LOCUS_29450 <1325 225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230333.1:benzoyl-CoA oxygenase subunit B >Feature sequence1855 42 1103 gene locus_tag LOCUS_29460 42 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence1856 >Feature sequence1857 57 284 gene locus_tag LOCUS_29470 57 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence1858 >Feature sequence1859 <1 546 gene locus_tag LOCUS_29480 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HTB6:GDP-6-deoxy-D-mannose reductase 1174 464 gene locus_tag LOCUS_29490 1174 464 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391460.1 protein_id gnl|my_center|LOCUS_29490 >Feature sequence1860 34 1287 gene locus_tag LOCUS_29500 gene nqrB 34 1287 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_29500 >Feature sequence1861 42 788 gene locus_tag LOCUS_29510 gene pyrH 42 788 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJP1 protein_id gnl|my_center|LOCUS_29510 >Feature sequence1862 454 987 gene locus_tag LOCUS_29520 454 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence1863 1 543 gene locus_tag LOCUS_29530 1 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 <1321 575 gene locus_tag LOCUS_29540 <1321 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140097.1:Xaa-Pro aminopeptidase >Feature sequence1864 189 788 gene locus_tag LOCUS_29550 189 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 1314 766 gene locus_tag LOCUS_29560 1314 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence1865 1160 840 gene locus_tag LOCUS_29570 1160 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence1866 >Feature sequence1867 >Feature sequence1868 2 235 gene locus_tag LOCUS_29580 2 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 <1315 243 gene locus_tag LOCUS_29590 <1315 243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205261.1:outer membrane protein >Feature sequence1869 <1 577 gene locus_tag LOCUS_29600 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941095.1:flagellar biosynthesis protein FlhB >Feature sequence1870 <1 555 gene locus_tag LOCUS_29610 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876951.1:peptidyl-prolyl cis-trans isomerase <1314 580 gene locus_tag LOCUS_29620 <1314 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462207.1:glycosyl transferase >Feature sequence1871 <1314 56 gene locus_tag LOCUS_29630 <1314 56 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887817.1:histidine kinase >Feature sequence1872 >Feature sequence1873 223 867 gene locus_tag LOCUS_29640 gene lspA 223 867 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Y0 protein_id gnl|my_center|LOCUS_29640 >Feature sequence1874 >Feature sequence1875 <1313 813 gene locus_tag LOCUS_29650 <1313 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023791.1:nitrogenase reductase >Feature sequence1876 460 1008 gene locus_tag LOCUS_29660 460 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 >Feature sequence1877 >Feature sequence1878 >Feature sequence1879 969 238 gene locus_tag LOCUS_29670 969 238 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530403.1 protein_id gnl|my_center|LOCUS_29670 >Feature sequence1880 <1310 594 gene locus_tag LOCUS_29680 <1310 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142640.1:phosphoribosylanthranilate isomerase >Feature sequence1881 >Feature sequence1882 <1 602 gene locus_tag LOCUS_29690 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FQ42:DNA ligase 599 889 gene locus_tag LOCUS_29700 599 889 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_29700 >Feature sequence1883 >Feature sequence1884 >Feature sequence1885 516 250 gene locus_tag LOCUS_29710 516 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 1074 529 gene locus_tag LOCUS_29720 1074 529 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031817.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence1886 185 1030 gene locus_tag LOCUS_29730 185 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 protein_id gnl|my_center|LOCUS_29730 >Feature sequence1887 <1307 532 gene locus_tag LOCUS_29740 <1307 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TLD6:peptide chain release factor 2 >Feature sequence1888 <1 725 gene locus_tag LOCUS_29750 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000853744.1:type II secretion system protein GspE >Feature sequence1889 <1 779 gene locus_tag LOCUS_29760 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74G30:flagellar hook protein FlgE >Feature sequence1890 >Feature sequence1891 >Feature sequence1892 202 786 gene locus_tag LOCUS_29770 202 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 >Feature sequence1893 >Feature sequence1894 <1303 557 gene locus_tag LOCUS_29780 <1303 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KMI6:chaperone protein DnaK >Feature sequence1895 584 1114 gene locus_tag LOCUS_29790 584 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence1896 1300 497 gene locus_tag LOCUS_29800 1300 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 >Feature sequence1897 >Feature sequence1898 1163 486 gene locus_tag LOCUS_29810 1163 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 >Feature sequence1899 >Feature sequence1900 >Feature sequence1901 <1 905 gene locus_tag LOCUS_29820 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762594.1:modulator protein >Feature sequence1902 >Feature sequence1903 425 1111 gene locus_tag LOCUS_29830 425 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 >Feature sequence1904 >Feature sequence1905 >Feature sequence1906 <1 513 gene locus_tag LOCUS_29840 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224099.1:Zn-dependent protease >Feature sequence1907 1294 1127 gene locus_tag LOCUS_29850 1294 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 >Feature sequence1908 454 98 gene locus_tag LOCUS_29860 454 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 >Feature sequence1909 >Feature sequence1910 1242 544 gene locus_tag LOCUS_29870 1242 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 >Feature sequence1911 158 874 gene locus_tag LOCUS_29880 158 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 892 1050 gene locus_tag LOCUS_29890 892 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 >Feature sequence1912 54 1175 gene locus_tag LOCUS_29900 54 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 >Feature sequence1913 440 1240 gene locus_tag LOCUS_29910 440 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 >Feature sequence1914 1065 13 gene locus_tag LOCUS_29920 1065 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 >Feature sequence1915 251 934 gene locus_tag LOCUS_29930 251 934 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_29930 >Feature sequence1916 >Feature sequence1917 >Feature sequence1918 719 339 gene locus_tag LOCUS_29940 719 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence1919 <1 661 gene locus_tag LOCUS_29950 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524131.1:cation transporter >Feature sequence1920 >Feature sequence1921 <1291 9 gene locus_tag LOCUS_29960 <1291 9 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403686.1:multidrug resistance protein >Feature sequence1922 >Feature sequence1923 <1 1211 gene locus_tag LOCUS_29970 <1 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701308.1:putative non-hemolytic phospholipase C >Feature sequence1924 142 1233 gene locus_tag LOCUS_29980 142 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29980 >Feature sequence1925 145 1137 gene locus_tag LOCUS_29990 145 1137 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310475.1 protein_id gnl|my_center|LOCUS_29990 >Feature sequence1926 7 213 gene locus_tag LOCUS_30000 7 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 549 797 gene locus_tag LOCUS_30010 gene rpmE2 549 797 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q034T0 protein_id gnl|my_center|LOCUS_30010 >Feature sequence1927 <1 591 gene locus_tag LOCUS_30020 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to I7EPD8:DNA-directed RNA polymerase subunit beta' 708 1091 gene locus_tag LOCUS_30030 gene rpsL 708 1091 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CI5 protein_id gnl|my_center|LOCUS_30030 >Feature sequence1928 <1286 362 gene locus_tag LOCUS_30040 <1286 362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7TTZ1:3-oxoacyl-[acyl-carrier-protein] synthase 2 >Feature sequence1929 824 60 gene locus_tag LOCUS_30050 824 60 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence1930 <1285 472 gene locus_tag LOCUS_30060 <1285 472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143702.1:glucosyltransferase >Feature sequence1931 3 1205 gene locus_tag LOCUS_30070 3 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 >Feature sequence1932 >Feature sequence1933 >Feature sequence1934 400 35 gene locus_tag LOCUS_30080 400 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 >Feature sequence1935 79 723 gene locus_tag LOCUS_30090 gene fabG 79 723 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383937.1 protein_id gnl|my_center|LOCUS_30090 >Feature sequence1936 238 148 gene locus_tag LOCUS_t00220 238 148 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1937 47 817 gene locus_tag LOCUS_30100 47 817 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_30100 >Feature sequence1938 >Feature sequence1939 <1 664 gene locus_tag LOCUS_30110 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXS2:molybdenum cofactor biosynthesis protein B >Feature sequence1940 <1 538 gene locus_tag LOCUS_30120 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057023.1:oligopeptidase A 535 798 gene locus_tag LOCUS_30130 535 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence1941 >Feature sequence1942 <1 904 gene locus_tag LOCUS_30140 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BH7:DNA repair protein RecN >Feature sequence1943 214 1116 gene locus_tag LOCUS_30150 214 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 >Feature sequence1944 >Feature sequence1945 >Feature sequence1946 >Feature sequence1947 >Feature sequence1948 >Feature sequence1949 1272 766 gene locus_tag LOCUS_30160 1272 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence1950 >Feature sequence1951 >Feature sequence1952 >Feature sequence1953 >Feature sequence1954 >Feature sequence1955 914 549 gene locus_tag LOCUS_30170 914 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 >Feature sequence1956 <1 977 gene locus_tag LOCUS_30180 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391431.1:sulfotransferase >Feature sequence1957 >Feature sequence1958 1263 331 gene locus_tag LOCUS_30190 1263 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 >Feature sequence1959 744 325 gene locus_tag LOCUS_30200 744 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 >Feature sequence1960 >Feature sequence1961 >Feature sequence1962 92 895 gene locus_tag LOCUS_30210 92 895 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_30210 >Feature sequence1963 >Feature sequence1964 879 337 gene locus_tag LOCUS_30220 879 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 >Feature sequence1965 >Feature sequence1966 102 1034 gene locus_tag LOCUS_30230 102 1034 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_30230 >Feature sequence1967 >Feature sequence1968 204 788 gene locus_tag LOCUS_30240 204 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 >Feature sequence1969 373 600 gene locus_tag LOCUS_30250 373 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence1970 1040 645 gene locus_tag LOCUS_30260 1040 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 >Feature sequence1971 347 943 gene locus_tag LOCUS_30270 347 943 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943304.1 protein_id gnl|my_center|LOCUS_30270 >Feature sequence1972 >Feature sequence1973 748 59 gene locus_tag LOCUS_30280 748 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence1974 >Feature sequence1975 >Feature sequence1976 >Feature sequence1977 >Feature sequence1978 >Feature sequence1979 162 527 gene locus_tag LOCUS_30290 162 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 >Feature sequence1980 378 974 gene locus_tag LOCUS_30300 378 974 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206326.1 protein_id gnl|my_center|LOCUS_30300 >Feature sequence1981 976 221 gene locus_tag LOCUS_30310 976 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 >Feature sequence1982 >Feature sequence1983 682 62 gene locus_tag LOCUS_30320 682 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 >Feature sequence1984 >Feature sequence1985 >Feature sequence1986 >Feature sequence1987 >Feature sequence1988 >Feature sequence1989 >Feature sequence1990 <1254 42 gene locus_tag LOCUS_30330 <1254 42 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036281.1:sugar hydrolase >Feature sequence1991 1092 307 gene locus_tag LOCUS_30340 1092 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 >Feature sequence1992 <1251 670 gene locus_tag LOCUS_30350 <1251 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976163.1:restriction endonuclease subunit M >Feature sequence1993 105 944 gene locus_tag LOCUS_30360 105 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 1250 1011 gene locus_tag LOCUS_30370 1250 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 >Feature sequence1994 >Feature sequence1995 <1 1163 gene locus_tag LOCUS_30380 <1 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787020.1:TonB-dependent receptor >Feature sequence1996 >Feature sequence1997 >Feature sequence1998 >Feature sequence1999 <1 596 gene locus_tag LOCUS_30390 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022154.1:dolichyl-phosphate mannose synthase >Feature sequence2000 <1 635 gene locus_tag LOCUS_30400 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9CB78:aspartate-semialdehyde dehydrogenase >Feature sequence2001 >Feature sequence2002 >Feature sequence2003 >Feature sequence2004 >Feature sequence2005 >Feature sequence2006 >Feature sequence2007 64 405 gene locus_tag LOCUS_30410 64 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 >Feature sequence2008 254 919 gene locus_tag LOCUS_30420 254 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 >Feature sequence2009 >Feature sequence2010 <1 652 gene locus_tag LOCUS_30430 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090620.1:amidase >Feature sequence2011 <1236 143 gene locus_tag LOCUS_30440 <1236 143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545206.1:apolipoprotein N-acyltransferase >Feature sequence2012 >Feature sequence2013 <1235 242 gene locus_tag LOCUS_30450 <1235 242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114358.1:phosphopantothenoylcysteine decarboxylase >Feature sequence2014 >Feature sequence2015 >Feature sequence2016 >Feature sequence2017 >Feature sequence2018 372 590 gene locus_tag LOCUS_30460 372 590 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_30460 971 618 gene locus_tag LOCUS_30470 971 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 >Feature sequence2019 >Feature sequence2020 <1233 402 gene locus_tag LOCUS_30480 <1233 402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to G5EBD4:chromosome partition protein Smc >Feature sequence2021 >Feature sequence2022 <1 652 gene locus_tag LOCUS_30490 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RK07:riboflavin biosynthesis protein RibD >Feature sequence2023 >Feature sequence2024 >Feature sequence2025 >Feature sequence2026 129 866 gene locus_tag LOCUS_30500 129 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence2027 >Feature sequence2028 >Feature sequence2029 >Feature sequence2030 188 685 gene locus_tag LOCUS_30510 188 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence2031 362 823 gene locus_tag LOCUS_30520 362 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 >Feature sequence2032 >Feature sequence2033 283 1017 gene locus_tag LOCUS_30530 283 1017 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_30530 >Feature sequence2034 >Feature sequence2035 >Feature sequence2036 31 825 gene locus_tag LOCUS_30540 31 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence2037 >Feature sequence2038 1068 229 gene locus_tag LOCUS_30550 1068 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 1223 1065 gene locus_tag LOCUS_30560 1223 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 >Feature sequence2039 1082 336 gene locus_tag LOCUS_30570 1082 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 >Feature sequence2040 1 465 gene locus_tag LOCUS_30580 1 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 >Feature sequence2041 <1 1166 gene locus_tag LOCUS_30590 <1 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003689532.1:AmpG family muropeptide MFS transporter >Feature sequence2042 >Feature sequence2043 1097 108 gene locus_tag LOCUS_30600 1097 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 >Feature sequence2044 146 823 gene locus_tag LOCUS_30610 146 823 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706985.1 protein_id gnl|my_center|LOCUS_30610 >Feature sequence2045 >Feature sequence2046 >Feature sequence2047 >Feature sequence2048 >Feature sequence2049 >Feature sequence2050 <1 767 gene locus_tag LOCUS_30620 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249822.1:ornithine carbamoyltransferase >Feature sequence2051 <1 535 gene locus_tag LOCUS_30630 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037668.1:oxidoreductase >Feature sequence2052 256 429 gene locus_tag LOCUS_30640 256 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 >Feature sequence2053 >Feature sequence2054 <1216 201 gene locus_tag LOCUS_30650 <1216 201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804193.1:ATPase >Feature sequence2055 345 1055 gene locus_tag LOCUS_30660 345 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 >Feature sequence2056 735 22 gene locus_tag LOCUS_30670 735 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 >Feature sequence2057 >Feature sequence2058 >Feature sequence2059 >Feature sequence2060 >Feature sequence2061 144 569 gene locus_tag LOCUS_30680 144 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence2062 >Feature sequence2063 313 975 gene locus_tag LOCUS_30690 gene bioD 313 975 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Y24 protein_id gnl|my_center|LOCUS_30690 1211 945 gene locus_tag LOCUS_30700 1211 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 >Feature sequence2064 2 253 gene locus_tag LOCUS_30710 2 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 >Feature sequence2065 >Feature sequence2066 <1 943 gene locus_tag LOCUS_30720 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFI0:adenylate kinase >Feature sequence2067 >Feature sequence2068 >Feature sequence2069 >Feature sequence2070 >Feature sequence2071 >Feature sequence2072 >Feature sequence2073 508 1137 gene locus_tag LOCUS_30730 508 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence2074 >Feature sequence2075 >Feature sequence2076 <1 892 gene locus_tag LOCUS_30740 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P07373:stage V sporulation protein E >Feature sequence2077 <1 851 gene locus_tag LOCUS_30750 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087365.1:delta 9 acyl-lipid fatty acid desaturase >Feature sequence2078 <1202 410 gene locus_tag LOCUS_30760 <1202 410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258554.1:spermidine synthase >Feature sequence2079 >Feature sequence2080 <1201 225 gene locus_tag LOCUS_30770 <1201 225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89WA1:apolipoprotein N-acyltransferase >Feature sequence2081 926 306 gene locus_tag LOCUS_30780 926 306 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027706.1 protein_id gnl|my_center|LOCUS_30780 >Feature sequence2082 >Feature sequence2083 >Feature sequence2084 4 852 gene locus_tag LOCUS_30790 4 852 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392508.1 protein_id gnl|my_center|LOCUS_30790 >Feature sequence2085 >Feature sequence2086 920 255 gene locus_tag LOCUS_30800 920 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 >Feature sequence2087 >Feature sequence2088 <1 1160 gene locus_tag LOCUS_30810 <1 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029620.1:AMP-dependent synthetase >Feature sequence2089 1177 8 gene locus_tag LOCUS_30820 1177 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 >Feature sequence2090 247 747 gene locus_tag LOCUS_30830 247 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence2091 <1 956 gene locus_tag LOCUS_30840 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5F9P9:elongation factor 4 >Feature sequence2092 <1196 89 gene locus_tag LOCUS_30850 <1196 89 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392429.1:serine/threonine protein kinase >Feature sequence2093 >Feature sequence2094 >Feature sequence2095 488 42 gene locus_tag LOCUS_30860 488 42 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FAI7 protein_id gnl|my_center|LOCUS_30860 1066 485 gene locus_tag LOCUS_30870 1066 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 >Feature sequence2096 790 74 gene locus_tag LOCUS_30880 790 74 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_30880 >Feature sequence2097 >Feature sequence2098 >Feature sequence2099 570 139 gene locus_tag LOCUS_30890 570 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 >Feature sequence2100 >Feature sequence2101 2 415 gene locus_tag LOCUS_30900 2 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 <1191 601 gene locus_tag LOCUS_30910 <1191 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000626897.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN >Feature sequence2102 296 1165 gene locus_tag LOCUS_30920 296 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 >Feature sequence2103 >Feature sequence2104 >Feature sequence2105 >Feature sequence2106 86 778 gene locus_tag LOCUS_30930 86 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 >Feature sequence2107 163 627 gene locus_tag LOCUS_30940 163 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence2108 >Feature sequence2109 <1 839 gene locus_tag LOCUS_30950 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q748B2:release factor glutamine methyltransferase >Feature sequence2110 203 370 gene locus_tag LOCUS_30960 203 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 >Feature sequence2111 >Feature sequence2112 >Feature sequence2113 >Feature sequence2114 >Feature sequence2115 >Feature sequence2116 3 170 gene locus_tag LOCUS_30970 3 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 167 1096 gene locus_tag LOCUS_30980 167 1096 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942090.1 protein_id gnl|my_center|LOCUS_30980 >Feature sequence2117 >Feature sequence2118 >Feature sequence2119 86 766 gene locus_tag LOCUS_30990 86 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 >Feature sequence2120 >Feature sequence2121 >Feature sequence2122 >Feature sequence2123 >Feature sequence2124 >Feature sequence2125 >Feature sequence2126 >Feature sequence2127 2 1081 gene locus_tag LOCUS_31000 2 1081 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_31000 >Feature sequence2128 >Feature sequence2129 >Feature sequence2130 >Feature sequence2131 472 909 gene locus_tag LOCUS_31010 472 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 >Feature sequence2132 >Feature sequence2133 1018 155 gene locus_tag LOCUS_31020 1018 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 >Feature sequence2134 >Feature sequence2135 642 1031 gene locus_tag LOCUS_31030 642 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence2136 1083 679 gene locus_tag LOCUS_31040 gene ptpS 1083 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 protein_id gnl|my_center|LOCUS_31040 >Feature sequence2137 >Feature sequence2138 >Feature sequence2139 164 1093 gene locus_tag LOCUS_31050 164 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 >Feature sequence2140 131 418 gene locus_tag LOCUS_31060 131 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 1138 491 gene locus_tag LOCUS_31070 1138 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 >Feature sequence2141 >Feature sequence2142 681 778 gene locus_tag LOCUS_t00230 681 778 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2143 >Feature sequence2144 <1 1075 gene locus_tag LOCUS_31080 <1 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808616.1:nicotinate phosphoribosyltransferase >Feature sequence2145 >Feature sequence2146 >Feature sequence2147 >Feature sequence2148 <1163 312 gene locus_tag LOCUS_31090 <1163 312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein >Feature sequence2149 784 458 gene locus_tag LOCUS_31100 784 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 >Feature sequence2150 449 1123 gene locus_tag LOCUS_31110 449 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 >Feature sequence2151 572 171 gene locus_tag LOCUS_31120 572 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 956 807 gene locus_tag LOCUS_31130 956 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 >Feature sequence2152 <1 879 gene locus_tag LOCUS_31140 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224909.1:methylmalonate-semialdehyde dehydrogenase (acylating) >Feature sequence2153 >Feature sequence2154 >Feature sequence2155 >Feature sequence2156 >Feature sequence2157 <1157 248 gene locus_tag LOCUS_31150 <1157 248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701652.1:putative 3-hydroxyacyl-CoA dehydrogenase >Feature sequence2158 >Feature sequence2159 >Feature sequence2160 1022 393 gene locus_tag LOCUS_31160 1022 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 >Feature sequence2161 984 85 gene locus_tag LOCUS_31170 984 85 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026257.1 protein_id gnl|my_center|LOCUS_31170 >Feature sequence2162 750 19 gene locus_tag LOCUS_31180 750 19 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_31180 >Feature sequence2163 >Feature sequence2164 >Feature sequence2165 >Feature sequence2166 <1 602 gene locus_tag LOCUS_31190 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C83:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence2167 >Feature sequence2168 <1150 148 gene locus_tag LOCUS_31200 <1150 148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877387.1:radical SAM/SPASM domain-containing protein >Feature sequence2169 324 1118 gene locus_tag LOCUS_31210 324 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 >Feature sequence2170 >Feature sequence2171 47 247 gene locus_tag LOCUS_31220 47 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 244 1068 gene locus_tag LOCUS_31230 244 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 >Feature sequence2172 >Feature sequence2173 >Feature sequence2174 177 851 gene locus_tag LOCUS_31240 177 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 >Feature sequence2175 >Feature sequence2176 >Feature sequence2177 >Feature sequence2178 >Feature sequence2179 491 1102 gene locus_tag LOCUS_31250 491 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 >Feature sequence2180 >Feature sequence2181 806 210 gene locus_tag LOCUS_31260 806 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 >Feature sequence2182 <1 665 gene locus_tag LOCUS_31270 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228515.1:phenylacetic acid degradation protein >Feature sequence2183 >Feature sequence2184 >Feature sequence2185 <1 596 gene locus_tag LOCUS_31280 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522785.1:phosphate starvation protein PhoH >Feature sequence2186 943 8 gene locus_tag LOCUS_31290 943 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 >Feature sequence2187 >Feature sequence2188 >Feature sequence2189 >Feature sequence2190 >Feature sequence2191 >Feature sequence2192 >Feature sequence2193 >Feature sequence2194 >Feature sequence2195 1130 723 gene locus_tag LOCUS_31300 1130 723 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338748.1 protein_id gnl|my_center|LOCUS_31300 >Feature sequence2196 >Feature sequence2197 >Feature sequence2198 >Feature sequence2199 >Feature sequence2200 <1137 34 gene locus_tag LOCUS_31310 <1137 34 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258472.1:cytochrome P450 >Feature sequence2201 >Feature sequence2202 <1135 580 gene locus_tag LOCUS_31320 <1135 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HEY8:30S ribosomal protein S2 >Feature sequence2203 912 828 gene locus_tag LOCUS_t00240 912 828 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2204 <1135 617 gene locus_tag LOCUS_31330 <1135 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DK5:glucose-6-phosphate isomerase >Feature sequence2205 847 185 gene locus_tag LOCUS_31340 847 185 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_31340 >Feature sequence2206 >Feature sequence2207 >Feature sequence2208 >Feature sequence2209 >Feature sequence2210 <1 590 gene locus_tag LOCUS_31350 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9S2C0:serine/threonine-protein kinase PksC >Feature sequence2211 >Feature sequence2212 425 772 gene locus_tag LOCUS_31360 425 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 762 1127 gene locus_tag LOCUS_31370 762 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence2213 456 49 gene locus_tag LOCUS_31380 456 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 966 490 gene locus_tag LOCUS_31390 966 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 >Feature sequence2214 3 989 gene locus_tag LOCUS_31400 3 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence2215 >Feature sequence2216 >Feature sequence2217 >Feature sequence2218 >Feature sequence2219 >Feature sequence2220 >Feature sequence2221 576 166 gene locus_tag LOCUS_31410 576 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267025.1 protein_id gnl|my_center|LOCUS_31410 949 590 gene locus_tag LOCUS_31420 949 590 CDS product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 protein_id gnl|my_center|LOCUS_31420 1118 966 gene locus_tag LOCUS_31430 1118 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 >Feature sequence2222 >Feature sequence2223 >Feature sequence2224 >Feature sequence2225 >Feature sequence2226 829 503 gene locus_tag LOCUS_31440 829 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 >Feature sequence2227 >Feature sequence2228 <1 631 gene locus_tag LOCUS_31450 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027782.1:acyl-CoA dehydrogenase >Feature sequence2229 >Feature sequence2230 >Feature sequence2231 >Feature sequence2232 >Feature sequence2233 >Feature sequence2234 >Feature sequence2235 >Feature sequence2236 <1113 242 gene locus_tag LOCUS_31460 <1113 242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479204.1:His-Xaa-Ser system radical SAM maturase HxsB >Feature sequence2237 <1113 582 gene locus_tag LOCUS_31470 <1113 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJV4:tRNA (guanine-N(1)-)-methyltransferase >Feature sequence2238 >Feature sequence2239 >Feature sequence2240 >Feature sequence2241 986 492 gene locus_tag LOCUS_31480 986 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 >Feature sequence2242 <1 1057 gene locus_tag LOCUS_31490 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946127.1:glutamate--cysteine ligase >Feature sequence2243 >Feature sequence2244 287 1057 gene locus_tag LOCUS_31500 287 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 >Feature sequence2245 1047 601 gene locus_tag LOCUS_31510 1047 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 >Feature sequence2246 1069 233 gene locus_tag LOCUS_31520 1069 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31520 >Feature sequence2247 538 38 gene locus_tag LOCUS_31530 538 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 756 601 gene locus_tag LOCUS_31540 756 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 696 884 gene locus_tag LOCUS_31550 696 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 >Feature sequence2248 1097 12 gene locus_tag LOCUS_31560 1097 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 >Feature sequence2249 >Feature sequence2250 438 950 gene locus_tag LOCUS_31570 438 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 >Feature sequence2251 613 86 gene locus_tag LOCUS_31580 613 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 863 1051 gene locus_tag LOCUS_31590 863 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence2252 >Feature sequence2253 >Feature sequence2254 >Feature sequence2255 >Feature sequence2256 >Feature sequence2257 <1099 591 gene locus_tag LOCUS_31600 <1099 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q817R6:valine--tRNA ligase >Feature sequence2258 100 315 gene locus_tag LOCUS_31610 100 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 >Feature sequence2259 >Feature sequence2260 >Feature sequence2261 >Feature sequence2262 >Feature sequence2263 >Feature sequence2264 >Feature sequence2265 630 238 gene locus_tag LOCUS_31620 630 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 >Feature sequence2266 297 602 gene locus_tag LOCUS_31630 297 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 >Feature sequence2267 115 354 gene locus_tag LOCUS_31640 115 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence2268 >Feature sequence2269 <1 539 gene locus_tag LOCUS_31650 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104467.1:nuclease 571 801 gene locus_tag LOCUS_31660 571 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence2270 >Feature sequence2271 >Feature sequence2272 >Feature sequence2273 914 225 gene locus_tag LOCUS_31670 914 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 >Feature sequence2274 >Feature sequence2275 917 246 gene locus_tag LOCUS_31680 917 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 >Feature sequence2276 >Feature sequence2277 248 745 gene locus_tag LOCUS_31690 248 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31690 >Feature sequence2278 >Feature sequence2279 456 46 gene locus_tag LOCUS_31700 456 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 >Feature sequence2280 432 184 gene locus_tag LOCUS_31710 432 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 <1087 365 gene locus_tag LOCUS_31720 <1087 365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011181813.1:alanyl-tRNA editing protein >Feature sequence2281 289 1050 gene locus_tag LOCUS_31730 289 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 >Feature sequence2282 >Feature sequence2283 >Feature sequence2284 >Feature sequence2285 >Feature sequence2286 >Feature sequence2287 >Feature sequence2288 >Feature sequence2289 <1 745 gene locus_tag LOCUS_31740 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000269085.1:thiol:disulfide interchange protein tlpA >Feature sequence2290 1065 214 gene locus_tag LOCUS_31750 1065 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 >Feature sequence2291 1081 836 gene locus_tag LOCUS_31760 1081 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 >Feature sequence2292 335 36 gene locus_tag LOCUS_31770 335 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 >Feature sequence2293 1 183 gene locus_tag LOCUS_31780 1 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 >Feature sequence2294 404 479 gene locus_tag LOCUS_t00250 404 479 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2295 180 935 gene locus_tag LOCUS_31790 180 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 >Feature sequence2296 >Feature sequence2297 483 166 gene locus_tag LOCUS_31800 483 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 1079 408 gene locus_tag LOCUS_31810 1079 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 >Feature sequence2298 >Feature sequence2299 >Feature sequence2300 >Feature sequence2301 <1078 193 gene locus_tag LOCUS_31820 <1078 193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C768:inosine-5'-monophosphate dehydrogenase >Feature sequence2302 >Feature sequence2303 <1 881 gene locus_tag LOCUS_31830 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932252.1:FAD-linked oxidase >Feature sequence2304 <1 805 gene locus_tag LOCUS_31840 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933114.1:serine protease >Feature sequence2305 >Feature sequence2306 1075 347 gene locus_tag LOCUS_31850 1075 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 >Feature sequence2307 >Feature sequence2308 13 834 gene locus_tag LOCUS_31860 13 834 CDS product putative oxidoreductase EphD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700844.1 protein_id gnl|my_center|LOCUS_31860 >Feature sequence2309 >Feature sequence2310 >Feature sequence2311 >Feature sequence2312 >Feature sequence2313 >Feature sequence2314 2 484 gene locus_tag LOCUS_31870 2 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 >Feature sequence2315 <1 963 gene locus_tag LOCUS_31880 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIS7:putative K(+)-stimulated pyrophosphate-energized sodium pump note possible pseudo, frameshifted >Feature sequence2316 >Feature sequence2317 >Feature sequence2318 388 897 gene locus_tag LOCUS_31890 388 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 >Feature sequence2319 1 414 gene locus_tag LOCUS_31900 1 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 >Feature sequence2320 <1 642 gene locus_tag LOCUS_31910 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530316.1:N-formylglutamate amidohydrolase >Feature sequence2321 >Feature sequence2322 >Feature sequence2323 >Feature sequence2324 >Feature sequence2325 686 102 gene locus_tag LOCUS_31920 686 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400645.1 protein_id gnl|my_center|LOCUS_31920 927 706 gene locus_tag LOCUS_31930 927 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 >Feature sequence2326 191 475 gene locus_tag LOCUS_31940 191 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 459 833 gene locus_tag LOCUS_31950 459 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 >Feature sequence2327 >Feature sequence2328 235 702 gene locus_tag LOCUS_31960 gene gspG 235 702 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_31960 >Feature sequence2329 <1 893 gene locus_tag LOCUS_31970 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KU60:lysine--tRNA ligase >Feature sequence2330 >Feature sequence2331 >Feature sequence2332 >Feature sequence2333 >Feature sequence2334 <1 958 gene locus_tag LOCUS_31980 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479240.1:potassium transporter >Feature sequence2335 >Feature sequence2336 310 600 gene locus_tag LOCUS_31990 310 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 >Feature sequence2337 >Feature sequence2338 >Feature sequence2339 >Feature sequence2340 2 553 gene locus_tag LOCUS_32000 2 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence2341 >Feature sequence2342 428 610 gene locus_tag LOCUS_32010 428 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 >Feature sequence2343 >Feature sequence2344 >Feature sequence2345 >Feature sequence2346 >Feature sequence2347 >Feature sequence2348 >Feature sequence2349 >Feature sequence2350 >Feature sequence2351 >Feature sequence2352 >Feature sequence2353 1051 725 gene locus_tag LOCUS_32020 1051 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 >Feature sequence2354 798 304 gene locus_tag LOCUS_32030 798 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 >Feature sequence2355 >Feature sequence2356 >Feature sequence2357 >Feature sequence2358 >Feature sequence2359 >Feature sequence2360 1047 25 gene locus_tag LOCUS_32040 1047 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 >Feature sequence2361 >Feature sequence2362 <1051 383 gene locus_tag LOCUS_32050 <1051 383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJ26:3-phosphoshikimate 1-carboxyvinyltransferase >Feature sequence2363 >Feature sequence2364 <1 960 gene locus_tag LOCUS_32060 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118764.1:serine/threonine protein kinase >Feature sequence2365 >Feature sequence2366 713 339 gene locus_tag LOCUS_32070 713 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 >Feature sequence2367 >Feature sequence2368 >Feature sequence2369 >Feature sequence2370 <1 897 gene locus_tag LOCUS_32080 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943668.1:flagellar hook-associated protein 3 >Feature sequence2371 >Feature sequence2372 >Feature sequence2373 16 660 gene locus_tag LOCUS_32090 16 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 >Feature sequence2374 <1 746 gene locus_tag LOCUS_32100 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036198.1:MBL fold metallo-hydrolase >Feature sequence2375 >Feature sequence2376 >Feature sequence2377 >Feature sequence2378 >Feature sequence2379 >Feature sequence2380 >Feature sequence2381 <1 775 gene locus_tag LOCUS_32110 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259464.1:long-chain-fatty-acid--CoA ligase >Feature sequence2382 >Feature sequence2383 <1 592 gene locus_tag LOCUS_32120 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72FW4:protein TonB >Feature sequence2384 >Feature sequence2385 <1 577 gene locus_tag LOCUS_32130 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861071.1:spore coat protein >Feature sequence2386 971 675 gene locus_tag LOCUS_32140 971 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 >Feature sequence2387 >Feature sequence2388 200 868 gene locus_tag LOCUS_32150 gene fadR 200 868 CDS product fatty acid metabolism regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94548 protein_id gnl|my_center|LOCUS_32150 >Feature sequence2389 >Feature sequence2390 <1034 278 gene locus_tag LOCUS_32160 <1034 278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932235.1:N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA >Feature sequence2391 <1 974 gene locus_tag LOCUS_32170 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776859.1:arylsulfatase A family protein >Feature sequence2392 >Feature sequence2393 >Feature sequence2394 >Feature sequence2395 <1 907 gene locus_tag LOCUS_32180 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072577.1:isocitrate dehydrogenase, NADP-dependent >Feature sequence2396 295 26 gene locus_tag LOCUS_32190 295 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 443 991 gene locus_tag LOCUS_32200 443 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 >Feature sequence2397 3 854 gene locus_tag LOCUS_32210 3 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 >Feature sequence2398 <1 1012 gene locus_tag LOCUS_32220 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943972.1:transglutaminase >Feature sequence2399 <1 873 gene locus_tag LOCUS_32230 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9F2Q3:enolase 1 >Feature sequence2400 >Feature sequence2401 >Feature sequence2402 >Feature sequence2403 >Feature sequence2404 >Feature sequence2405 <1026 305 gene locus_tag LOCUS_32240 <1026 305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941031.1:ATP-dependent DNA helicase DinG >Feature sequence2406 204 497 gene locus_tag LOCUS_32250 204 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 >Feature sequence2407 >Feature sequence2408 >Feature sequence2409 >Feature sequence2410 >Feature sequence2411 318 64 gene locus_tag LOCUS_32260 318 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 <1023 402 gene locus_tag LOCUS_32270 <1023 402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q746Y8:methylthioribose-1-phosphate isomerase >Feature sequence2412 <1023 290 gene locus_tag LOCUS_32280 <1023 290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524310.1:quinol oxidase subunit >Feature sequence2413 <1 987 gene locus_tag LOCUS_32290 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZN36:bifunctional purine biosynthesis protein PurH >Feature sequence2414 <1022 429 gene locus_tag LOCUS_32300 <1022 429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521274.1:fatty acid degradation protein >Feature sequence2415 >Feature sequence2416 >Feature sequence2417 >Feature sequence2418 <1021 312 gene locus_tag LOCUS_32310 <1021 312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001254056.1:chloramphenicol acetyltransferase >Feature sequence2419 >Feature sequence2420 >Feature sequence2421 <1 511 gene locus_tag LOCUS_32320 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5I4W6:cell division protein FtsZ >Feature sequence2422 1017 418 gene locus_tag LOCUS_32330 1017 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 >Feature sequence2423 >Feature sequence2424 >Feature sequence2425 >Feature sequence2426 >Feature sequence2427 417 229 gene locus_tag LOCUS_32340 417 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 650 414 gene locus_tag LOCUS_32350 650 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 >Feature sequence2428 >Feature sequence2429 <1015 162 gene locus_tag LOCUS_32360 <1015 162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067187.1:alkaline phosphatase >Feature sequence2430 >Feature sequence2431 >Feature sequence2432 <1014 470 gene locus_tag LOCUS_32370 <1014 470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530998.1:glucose dehydrogenase >Feature sequence2433 >Feature sequence2434 <1 586 gene locus_tag LOCUS_32380 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9WYK8:phosphate propanoyltransferase >Feature sequence2435 >Feature sequence2436 >Feature sequence2437 >Feature sequence2438 >Feature sequence2439 >Feature sequence2440 804 268 gene locus_tag LOCUS_32390 804 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 >Feature sequence2441 791 249 gene locus_tag LOCUS_32400 791 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 >Feature sequence2442 >Feature sequence2443 >Feature sequence2444 657 133 gene locus_tag LOCUS_32410 657 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 >Feature sequence2445 <1 975 gene locus_tag LOCUS_32420 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067100.1:outer membrane protein assembly factor >Feature sequence2446 <1008 4 gene locus_tag LOCUS_32430 <1008 4 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404078.1:3'(2'),5'-bisphosphate nucleotidase >Feature sequence2447 >Feature sequence2448 >Feature sequence2449 241 639 gene locus_tag LOCUS_32440 241 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 >Feature sequence2450 >Feature sequence2451 993 415 gene locus_tag LOCUS_32450 993 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 >Feature sequence2452 <1006 356 gene locus_tag LOCUS_32460 <1006 356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729793.1:organophopsphate acid anhydrase >Feature sequence2453 365 745 gene locus_tag LOCUS_32470 365 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 >Feature sequence2454 >Feature sequence2455 <1 913 gene locus_tag LOCUS_32480 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PAP5:replicative DNA helicase >Feature sequence2456 >Feature sequence2457 >Feature sequence2458 >Feature sequence2459 >Feature sequence2460 >Feature sequence2461 >Feature sequence2462 >Feature sequence2463 >Feature sequence2464 1001 609 gene locus_tag LOCUS_32490 1001 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 >Feature sequence2465 1001 420 gene locus_tag LOCUS_32500 1001 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence2466 >Feature sequence2467 99 968 gene locus_tag LOCUS_32510 gene ugpQ 99 968 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196745.1 protein_id gnl|my_center|LOCUS_32510