>Feature sequence001 1685 474 gene locus_tag LOCUS_00010 1685 474 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089133.1 protein_id gnl|my_center|LOCUS_00010 1775 2803 gene locus_tag LOCUS_00020 1775 2803 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225667.1 protein_id gnl|my_center|LOCUS_00020 4086 2854 gene locus_tag LOCUS_00030 4086 2854 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173900.1 protein_id gnl|my_center|LOCUS_00030 5271 4180 gene locus_tag LOCUS_00040 5271 4180 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090622.1 protein_id gnl|my_center|LOCUS_00040 5807 5403 gene locus_tag LOCUS_00050 5807 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702788.1 protein_id gnl|my_center|LOCUS_00050 6976 5804 gene locus_tag LOCUS_00060 6976 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815544.1 protein_id gnl|my_center|LOCUS_00060 7079 8458 gene locus_tag LOCUS_00070 gene amiD 7079 8458 CDS product putative amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQ93 protein_id gnl|my_center|LOCUS_00070 8486 8959 gene locus_tag LOCUS_00080 8486 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8977 9372 gene locus_tag LOCUS_00090 8977 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9469 10614 gene locus_tag LOCUS_00100 9469 10614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701068.1 protein_id gnl|my_center|LOCUS_00100 10664 11503 gene locus_tag LOCUS_00110 10664 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523946.1 protein_id gnl|my_center|LOCUS_00110 11500 12771 gene locus_tag LOCUS_00120 11500 12771 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887900.1 protein_id gnl|my_center|LOCUS_00120 12764 13669 gene locus_tag LOCUS_00130 12764 13669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14176 15051 gene locus_tag LOCUS_00140 14176 15051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15083 16288 gene locus_tag LOCUS_00150 15083 16288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17401 16343 gene locus_tag LOCUS_00160 gene rutA 17401 16343 CDS product pyrimidine monooxygenase RutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D5CE32 protein_id gnl|my_center|LOCUS_00160 17611 17535 gene locus_tag LOCUS_t00010 17611 17535 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17777 17853 gene locus_tag LOCUS_t00020 17777 17853 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 18069 18308 gene locus_tag LOCUS_00170 18069 18308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18373 18449 gene locus_tag LOCUS_t00030 18373 18449 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19108 18554 gene locus_tag LOCUS_00180 19108 18554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20906 19125 gene locus_tag LOCUS_00190 20906 19125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21155 21583 gene locus_tag LOCUS_00200 21155 21583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21564 23972 gene locus_tag LOCUS_00210 21564 23972 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727394.1 protein_id gnl|my_center|LOCUS_00210 25300 24026 gene locus_tag LOCUS_00220 25300 24026 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726818.1 protein_id gnl|my_center|LOCUS_00220 25687 25328 gene locus_tag LOCUS_00230 25687 25328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26236 25853 gene locus_tag LOCUS_00240 26236 25853 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089796.1 protein_id gnl|my_center|LOCUS_00240 26356 26736 gene locus_tag LOCUS_00250 26356 26736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 26892 27284 gene locus_tag LOCUS_00260 26892 27284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 28216 27335 gene locus_tag LOCUS_00270 28216 27335 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_00270 28157 28327 gene locus_tag LOCUS_00280 28157 28327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28327 30402 gene locus_tag LOCUS_00290 28327 30402 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_00290 30399 31532 gene locus_tag LOCUS_00300 30399 31532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 31529 33265 gene locus_tag LOCUS_00310 31529 33265 CDS product hydantoinase B/oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538267.1 protein_id gnl|my_center|LOCUS_00310 35073 33271 gene locus_tag LOCUS_00320 35073 33271 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895174.1 protein_id gnl|my_center|LOCUS_00320 35829 35095 gene locus_tag LOCUS_00330 35829 35095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 37078 36113 gene locus_tag LOCUS_00340 37078 36113 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHD2 protein_id gnl|my_center|LOCUS_00340 38440 37217 gene locus_tag LOCUS_00350 gene nqrF 38440 37217 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6X0 protein_id gnl|my_center|LOCUS_00350 39070 38459 gene locus_tag LOCUS_00360 gene nqrE 39070 38459 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_00360 39692 39024 gene locus_tag LOCUS_00370 gene nqrD 39692 39024 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA9 protein_id gnl|my_center|LOCUS_00370 40477 39695 gene locus_tag LOCUS_00380 gene nqrC 40477 39695 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV7 protein_id gnl|my_center|LOCUS_00380 41684 40467 gene locus_tag LOCUS_00390 gene nqrB 41684 40467 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_00390 43075 41684 gene locus_tag LOCUS_00400 gene nqrA 43075 41684 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6Y0 protein_id gnl|my_center|LOCUS_00400 44693 43572 gene locus_tag LOCUS_00410 44693 43572 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225711.1 protein_id gnl|my_center|LOCUS_00410 44818 45915 gene locus_tag LOCUS_00420 44818 45915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_00420 46711 45920 gene locus_tag LOCUS_00430 46711 45920 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 protein_id gnl|my_center|LOCUS_00430 47880 46753 gene locus_tag LOCUS_00440 47880 46753 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400502.1 protein_id gnl|my_center|LOCUS_00440 47943 48569 gene locus_tag LOCUS_00450 47943 48569 CDS product pyridoxamine 5'-phosphate oxidase-like FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528837.1 protein_id gnl|my_center|LOCUS_00450 48683 49564 gene locus_tag LOCUS_00460 48683 49564 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMH7 protein_id gnl|my_center|LOCUS_00460 49561 50361 gene locus_tag LOCUS_00470 49561 50361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545134.1 protein_id gnl|my_center|LOCUS_00470 50371 50979 gene locus_tag LOCUS_00480 50371 50979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 50921 51466 gene locus_tag LOCUS_00490 50921 51466 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929804.1 protein_id gnl|my_center|LOCUS_00490 51479 52642 gene locus_tag LOCUS_00500 51479 52642 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225183.1 protein_id gnl|my_center|LOCUS_00500 52665 53690 gene locus_tag LOCUS_00510 gene hemH 52665 53690 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCZ1 protein_id gnl|my_center|LOCUS_00510 53808 54887 gene locus_tag LOCUS_00520 53808 54887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 55783 54884 gene locus_tag LOCUS_00530 55783 54884 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067123.1 protein_id gnl|my_center|LOCUS_00530 55798 56949 gene locus_tag LOCUS_00540 gene caiA 55798 56949 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215329.1 protein_id gnl|my_center|LOCUS_00540 56970 58025 gene locus_tag LOCUS_00550 56970 58025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 58046 59125 gene locus_tag LOCUS_00560 58046 59125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 59189 59602 gene locus_tag LOCUS_00570 59189 59602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 60682 59603 gene locus_tag LOCUS_00580 60682 59603 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_00580 60852 61283 gene locus_tag LOCUS_00590 60852 61283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 62118 61291 gene locus_tag LOCUS_00600 62118 61291 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_00600 62995 62102 gene locus_tag LOCUS_00610 62995 62102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 64120 63041 gene locus_tag LOCUS_00620 64120 63041 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_00620 64738 64124 gene locus_tag LOCUS_00630 gene gst 64738 64124 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312247.1 protein_id gnl|my_center|LOCUS_00630 66063 64813 gene locus_tag LOCUS_00640 66063 64813 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338375.1 protein_id gnl|my_center|LOCUS_00640 66613 66116 gene locus_tag LOCUS_00650 66613 66116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 67455 66613 gene locus_tag LOCUS_00660 67455 66613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 67789 68583 gene locus_tag LOCUS_00670 67789 68583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 69760 68687 gene locus_tag LOCUS_00680 69760 68687 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036619.1 protein_id gnl|my_center|LOCUS_00680 70137 69874 gene locus_tag LOCUS_00690 70137 69874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 70783 71925 gene locus_tag LOCUS_00700 70783 71925 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228924.1 protein_id gnl|my_center|LOCUS_00700 72020 73132 gene locus_tag LOCUS_00710 72020 73132 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039911.1 protein_id gnl|my_center|LOCUS_00710 74341 73223 gene locus_tag LOCUS_00720 74341 73223 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 protein_id gnl|my_center|LOCUS_00720 76017 74338 gene locus_tag LOCUS_00730 76017 74338 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_00730 76202 78115 gene locus_tag LOCUS_00740 76202 78115 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057278.1 protein_id gnl|my_center|LOCUS_00740 >Feature sequence002 2074 782 gene locus_tag LOCUS_00750 2074 782 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_00750 2167 2790 gene locus_tag LOCUS_00760 2167 2790 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_00760 3585 2800 gene locus_tag LOCUS_00770 3585 2800 CDS product branched-chain amino acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 protein_id gnl|my_center|LOCUS_00770 4598 3750 gene locus_tag LOCUS_00780 4598 3750 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_00780 5738 4695 gene locus_tag LOCUS_00790 5738 4695 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143926.1 protein_id gnl|my_center|LOCUS_00790 5762 6283 gene locus_tag LOCUS_00800 5762 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 6716 6288 gene locus_tag LOCUS_00810 6716 6288 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329166.1 protein_id gnl|my_center|LOCUS_00810 6878 7858 gene locus_tag LOCUS_00820 6878 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 7855 8280 gene locus_tag LOCUS_00830 7855 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 8277 9314 gene locus_tag LOCUS_00840 8277 9314 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640185.1 protein_id gnl|my_center|LOCUS_00840 9384 9851 gene locus_tag LOCUS_00850 9384 9851 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017671.1 protein_id gnl|my_center|LOCUS_00850 11380 9896 gene locus_tag LOCUS_00860 11380 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702778.1 protein_id gnl|my_center|LOCUS_00860 11452 12414 gene locus_tag LOCUS_00870 gene ephA 11452 12414 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083933.1 protein_id gnl|my_center|LOCUS_00870 12550 13425 gene locus_tag LOCUS_00880 gene tauD 12550 13425 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530602.1 protein_id gnl|my_center|LOCUS_00880 13432 14328 gene locus_tag LOCUS_00890 13432 14328 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729776.1 protein_id gnl|my_center|LOCUS_00890 14330 15496 gene locus_tag LOCUS_00900 14330 15496 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_00900 15510 16778 gene locus_tag LOCUS_00910 15510 16778 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886788.1 protein_id gnl|my_center|LOCUS_00910 18721 16784 gene locus_tag LOCUS_00920 gene acs 18721 16784 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404558.1 protein_id gnl|my_center|LOCUS_00920 18832 19545 gene locus_tag LOCUS_00930 18832 19545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 19783 19532 gene locus_tag LOCUS_00940 19783 19532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 20750 21475 gene locus_tag LOCUS_00950 20750 21475 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141701.1 protein_id gnl|my_center|LOCUS_00950 22622 21543 gene locus_tag LOCUS_00960 22622 21543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 23444 23052 gene locus_tag LOCUS_00970 23444 23052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 24512 23526 gene locus_tag LOCUS_00980 24512 23526 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_00980 24761 25531 gene locus_tag LOCUS_00990 gene fabG 24761 25531 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_00990 25560 26360 gene locus_tag LOCUS_01000 25560 26360 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085496.1 protein_id gnl|my_center|LOCUS_01000 26509 27603 gene locus_tag LOCUS_01010 gene luxA2 26509 27603 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090024.1 protein_id gnl|my_center|LOCUS_01010 27685 28422 gene locus_tag LOCUS_01020 27685 28422 CDS product 3-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_01020 28419 30158 gene locus_tag LOCUS_01030 28419 30158 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_01030 31111 30260 gene locus_tag LOCUS_01040 31111 30260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 31729 31121 gene locus_tag LOCUS_01050 31729 31121 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708516.1 protein_id gnl|my_center|LOCUS_01050 31796 33610 gene locus_tag LOCUS_01060 31796 33610 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227739.1 protein_id gnl|my_center|LOCUS_01060 33894 33607 gene locus_tag LOCUS_01070 33894 33607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 34796 33915 gene locus_tag LOCUS_01080 34796 33915 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_01080 36552 34819 gene locus_tag LOCUS_01090 36552 34819 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_01090 36656 37669 gene locus_tag LOCUS_01100 36656 37669 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R742 protein_id gnl|my_center|LOCUS_01100 37725 38546 gene locus_tag LOCUS_01110 37725 38546 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089189.1 protein_id gnl|my_center|LOCUS_01110 38918 38736 gene locus_tag LOCUS_01120 38918 38736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 39362 39147 gene locus_tag LOCUS_01130 39362 39147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 39850 40287 gene locus_tag LOCUS_01140 39850 40287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 41391 40342 gene locus_tag LOCUS_01150 41391 40342 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_01150 41499 42521 gene locus_tag LOCUS_01160 41499 42521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 42727 42551 gene locus_tag LOCUS_01170 42727 42551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 43186 42890 gene locus_tag LOCUS_01180 43186 42890 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_01180 43500 44282 gene locus_tag LOCUS_01190 gene fabG 43500 44282 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_01190 44354 47749 gene locus_tag LOCUS_01200 44354 47749 CDS product carbamoyl-phosphate-synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921047.1 protein_id gnl|my_center|LOCUS_01200 47795 48178 gene locus_tag LOCUS_01210 47795 48178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315324.1 protein_id gnl|my_center|LOCUS_01210 >Feature sequence003 1136 507 gene locus_tag LOCUS_01220 gene gst 1136 507 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071742.1 protein_id gnl|my_center|LOCUS_01220 2021 1167 gene locus_tag LOCUS_01230 2021 1167 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_01230 2671 3477 gene locus_tag LOCUS_01240 2671 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 3489 4130 gene locus_tag LOCUS_01250 3489 4130 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113039.1 protein_id gnl|my_center|LOCUS_01250 4595 4149 gene locus_tag LOCUS_01260 4595 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 4672 5823 gene locus_tag LOCUS_01270 4672 5823 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728241.1 protein_id gnl|my_center|LOCUS_01270 7052 5895 gene locus_tag LOCUS_01280 7052 5895 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_01280 7351 7070 gene locus_tag LOCUS_01290 7351 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 7758 7447 gene locus_tag LOCUS_01300 7758 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 7987 7838 gene locus_tag LOCUS_01310 7987 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 9050 8208 gene locus_tag LOCUS_01320 gene fabG 9050 8208 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_01320 10577 9087 gene locus_tag LOCUS_01330 10577 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 11466 10588 gene locus_tag LOCUS_01340 gene mutM 11466 10588 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHE9 protein_id gnl|my_center|LOCUS_01340 11513 14671 gene locus_tag LOCUS_01350 gene ileS 11513 14671 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCU4 protein_id gnl|my_center|LOCUS_01350 15598 14738 gene locus_tag LOCUS_01360 gene tfdA 15598 14738 CDS product alpha-ketoglutarate-dependent 2,4-dichlorophenoxyacetate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084309.1 protein_id gnl|my_center|LOCUS_01360 15748 15903 gene locus_tag LOCUS_01370 15748 15903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 15900 16637 gene locus_tag LOCUS_01380 gene pqqB 15900 16637 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP45 protein_id gnl|my_center|LOCUS_01380 16634 17545 gene locus_tag LOCUS_01390 16634 17545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 17545 18645 gene locus_tag LOCUS_01400 gene pqqE 17545 18645 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4Y2 protein_id gnl|my_center|LOCUS_01400 18645 18986 gene locus_tag LOCUS_01410 18645 18986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 18983 19738 gene locus_tag LOCUS_01420 18983 19738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 20895 19789 gene locus_tag LOCUS_01430 20895 19789 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHU9 protein_id gnl|my_center|LOCUS_01430 22136 21156 gene locus_tag LOCUS_01440 22136 21156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 24153 22504 gene locus_tag LOCUS_01450 24153 22504 CDS product nodulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_01450 24729 24331 gene locus_tag LOCUS_01460 24729 24331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 24774 24959 gene locus_tag LOCUS_01470 24774 24959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 25556 26824 gene locus_tag LOCUS_01480 25556 26824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 27152 28888 gene locus_tag LOCUS_01490 27152 28888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 29447 28896 gene locus_tag LOCUS_01500 29447 28896 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMX9 protein_id gnl|my_center|LOCUS_01500 31589 30318 gene locus_tag LOCUS_01510 31589 30318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 32281 31709 gene locus_tag LOCUS_01520 32281 31709 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_01520 33123 32347 gene locus_tag LOCUS_01530 33123 32347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057528.1 protein_id gnl|my_center|LOCUS_01530 33635 33321 gene locus_tag LOCUS_01540 33635 33321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 34856 34245 gene locus_tag LOCUS_01550 34856 34245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 36072 34885 gene locus_tag LOCUS_01560 gene rumA 36072 34885 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_01560 <37284 36065 gene locus_tag LOCUS_01570 <37284 36065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085096.1:molybdopterin biosynthesis protein >Feature sequence004 <1 1122 gene locus_tag LOCUS_01580 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250683.1:dolichol-P-glucose synthetase 2628 1159 gene locus_tag LOCUS_01590 2628 1159 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_01590 3067 5250 gene locus_tag LOCUS_01600 gene pcrA 3067 5250 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746V7 protein_id gnl|my_center|LOCUS_01600 6319 5285 gene locus_tag LOCUS_01610 gene ddl 6319 5285 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG68 protein_id gnl|my_center|LOCUS_01610 6441 7235 gene locus_tag LOCUS_01620 6441 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 7786 7232 gene locus_tag LOCUS_01630 7786 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 9231 7783 gene locus_tag LOCUS_01640 9231 7783 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940347.1 protein_id gnl|my_center|LOCUS_01640 9361 9666 gene locus_tag LOCUS_01650 gene gatC 9361 9666 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CRU2 protein_id gnl|my_center|LOCUS_01650 9707 11131 gene locus_tag LOCUS_01660 gene gatA 9707 11131 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCD8 protein_id gnl|my_center|LOCUS_01660 11128 12618 gene locus_tag LOCUS_01670 gene gatB 11128 12618 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66766 protein_id gnl|my_center|LOCUS_01670 12615 14828 gene locus_tag LOCUS_01680 12615 14828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 14828 15892 gene locus_tag LOCUS_01690 gene mtnA 14828 15892 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y8 protein_id gnl|my_center|LOCUS_01690 16061 16981 gene locus_tag LOCUS_01700 gene ilvE 16061 16981 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940455.1 protein_id gnl|my_center|LOCUS_01700 17381 17064 gene locus_tag LOCUS_01710 17381 17064 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722172.1 protein_id gnl|my_center|LOCUS_01710 18649 18320 gene locus_tag LOCUS_01720 18649 18320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404775.1 protein_id gnl|my_center|LOCUS_01720 18673 19389 gene locus_tag LOCUS_01730 18673 19389 CDS product F420-dependent NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871024.1 protein_id gnl|my_center|LOCUS_01730 19407 20144 gene locus_tag LOCUS_01740 19407 20144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 20665 23436 gene locus_tag LOCUS_01750 gene nrdJ 20665 23436 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI46 protein_id gnl|my_center|LOCUS_01750 23859 23470 gene locus_tag LOCUS_01760 23859 23470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 24175 24858 gene locus_tag LOCUS_01770 gene phoB 24175 24858 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_01770 24859 26214 gene locus_tag LOCUS_01780 24859 26214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 26357 27652 gene locus_tag LOCUS_01790 26357 27652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 27775 28806 gene locus_tag LOCUS_01800 27775 28806 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_01800 28969 30273 gene locus_tag LOCUS_01810 28969 30273 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_01810 30266 31552 gene locus_tag LOCUS_01820 30266 31552 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_01820 31565 32335 gene locus_tag LOCUS_01830 gene pstB 31565 32335 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8C2 protein_id gnl|my_center|LOCUS_01830 32353 33021 gene locus_tag LOCUS_01840 gene phoU 32353 33021 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_01840 33024 33851 gene locus_tag LOCUS_01850 33024 33851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 35516 33861 gene locus_tag LOCUS_01860 35516 33861 CDS product electron-transferring-flavoprotein dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958018.1 protein_id gnl|my_center|LOCUS_01860 35782 35570 gene locus_tag LOCUS_01870 35782 35570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 >Feature sequence005 916 668 gene locus_tag LOCUS_01880 916 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 2808 1090 gene locus_tag LOCUS_01890 2808 1090 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_01890 3254 4387 gene locus_tag LOCUS_01900 3254 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 4374 7640 gene locus_tag LOCUS_01910 4374 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 7766 9577 gene locus_tag LOCUS_01920 7766 9577 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831737.1 protein_id gnl|my_center|LOCUS_01920 10024 9596 gene locus_tag LOCUS_01930 10024 9596 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482828.1 protein_id gnl|my_center|LOCUS_01930 11858 10128 gene locus_tag LOCUS_01940 gene lpdA 11858 10128 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZC3 protein_id gnl|my_center|LOCUS_01940 13153 11867 gene locus_tag LOCUS_01950 gene aceF 13153 11867 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVD7 protein_id gnl|my_center|LOCUS_01950 15821 13164 gene locus_tag LOCUS_01960 gene aceE 15821 13164 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59637 protein_id gnl|my_center|LOCUS_01960 16793 15822 gene locus_tag LOCUS_01970 gene lipA 16793 15822 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TND8 protein_id gnl|my_center|LOCUS_01970 16927 17808 gene locus_tag LOCUS_01980 16927 17808 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_01980 17826 19019 gene locus_tag LOCUS_01990 17826 19019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814068.1 protein_id gnl|my_center|LOCUS_01990 19123 19917 gene locus_tag LOCUS_02000 gene thyA 19123 19917 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRL3 protein_id gnl|my_center|LOCUS_02000 21539 19977 gene locus_tag LOCUS_02010 gene putP 21539 19977 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_02010 21707 22048 gene locus_tag LOCUS_02020 21707 22048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 24292 22064 gene locus_tag LOCUS_02030 24292 22064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 24723 24289 gene locus_tag LOCUS_02040 24723 24289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 25136 24720 gene locus_tag LOCUS_02050 25136 24720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 25975 25133 gene locus_tag LOCUS_02060 25975 25133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 27051 25972 gene locus_tag LOCUS_02070 27051 25972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 27384 27950 gene locus_tag LOCUS_02080 27384 27950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 29119 27947 gene locus_tag LOCUS_02090 29119 27947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 31600 29339 gene locus_tag LOCUS_02100 31600 29339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 <33564 31855 gene locus_tag LOCUS_02110 <33564 31855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072544.1:RND transporter >Feature sequence006 <1 602 gene locus_tag LOCUS_02120 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462638.1:membrane protein 818 1861 gene locus_tag LOCUS_02130 818 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_02130 1900 2682 gene locus_tag LOCUS_02140 gene fabG 1900 2682 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001256079.1 protein_id gnl|my_center|LOCUS_02140 3821 2745 gene locus_tag LOCUS_02150 3821 2745 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_02150 4311 3898 gene locus_tag LOCUS_02160 4311 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 4629 4327 gene locus_tag LOCUS_02170 4629 4327 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 protein_id gnl|my_center|LOCUS_02170 4739 5614 gene locus_tag LOCUS_02180 4739 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 6510 5695 gene locus_tag LOCUS_02190 6510 5695 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090625.1 protein_id gnl|my_center|LOCUS_02190 6615 7109 gene locus_tag LOCUS_02200 6615 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 7750 7112 gene locus_tag LOCUS_02210 7750 7112 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731411.1 protein_id gnl|my_center|LOCUS_02210 8975 7758 gene locus_tag LOCUS_02220 8975 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 9893 9099 gene locus_tag LOCUS_02230 9893 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 10309 9929 gene locus_tag LOCUS_02240 10309 9929 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 protein_id gnl|my_center|LOCUS_02240 11922 10366 gene locus_tag LOCUS_02250 11922 10366 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_02250 12066 12440 gene locus_tag LOCUS_02260 12066 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 12470 13357 gene locus_tag LOCUS_02270 12470 13357 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H47 protein_id gnl|my_center|LOCUS_02270 13368 14042 gene locus_tag LOCUS_02280 13368 14042 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896555.1 protein_id gnl|my_center|LOCUS_02280 14043 14330 gene locus_tag LOCUS_02290 14043 14330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813702.1 protein_id gnl|my_center|LOCUS_02290 16103 14337 gene locus_tag LOCUS_02300 gene ggt 16103 14337 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_02300 17329 16112 gene locus_tag LOCUS_02310 gene cat2 17329 16112 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931723.1 protein_id gnl|my_center|LOCUS_02310 17880 17407 gene locus_tag LOCUS_02320 17880 17407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 18961 17834 gene locus_tag LOCUS_02330 18961 17834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926482.1 protein_id gnl|my_center|LOCUS_02330 20175 18958 gene locus_tag LOCUS_02340 20175 18958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_02340 22021 20186 gene locus_tag LOCUS_02350 22021 20186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537701.1 protein_id gnl|my_center|LOCUS_02350 22301 22543 gene locus_tag LOCUS_02360 22301 22543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 22638 23843 gene locus_tag LOCUS_02370 22638 23843 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_02370 23851 24150 gene locus_tag LOCUS_02380 gene dmfA1 23851 24150 CDS product small subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811614.1 protein_id gnl|my_center|LOCUS_02380 24159 26357 gene locus_tag LOCUS_02390 24159 26357 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727394.1 protein_id gnl|my_center|LOCUS_02390 26380 27627 gene locus_tag LOCUS_02400 26380 27627 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893439.1 protein_id gnl|my_center|LOCUS_02400 29221 27671 gene locus_tag LOCUS_02410 29221 27671 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_02410 29297 30277 gene locus_tag LOCUS_02420 29297 30277 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266314.1 protein_id gnl|my_center|LOCUS_02420 30824 30354 gene locus_tag LOCUS_02430 30824 30354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 31966 30863 gene locus_tag LOCUS_02440 31966 30863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846851.1 protein_id gnl|my_center|LOCUS_02440 >Feature sequence007 1174 383 gene locus_tag LOCUS_02450 gene lepB 1174 383 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E75 protein_id gnl|my_center|LOCUS_02450 2973 1177 gene locus_tag LOCUS_02460 gene lepA 2973 1177 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60789 protein_id gnl|my_center|LOCUS_02460 3949 2963 gene locus_tag LOCUS_02470 3949 2963 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_02470 4579 4088 gene locus_tag LOCUS_02480 4579 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 6309 4576 gene locus_tag LOCUS_02490 gene argS 6309 4576 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W3 protein_id gnl|my_center|LOCUS_02490 6649 6341 gene locus_tag LOCUS_02500 6649 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 7188 6646 gene locus_tag LOCUS_02510 7188 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 7603 7223 gene locus_tag LOCUS_02520 7603 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 8637 7609 gene locus_tag LOCUS_02530 gene rpoA 8637 7609 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B3 protein_id gnl|my_center|LOCUS_02530 9043 8660 gene locus_tag LOCUS_02540 gene rpsK 9043 8660 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B1 protein_id gnl|my_center|LOCUS_02540 9431 9048 gene locus_tag LOCUS_02550 gene rpsM 9431 9048 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80377 protein_id gnl|my_center|LOCUS_02550 10132 9554 gene locus_tag LOCUS_02560 gene adk 10132 9554 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD15 protein_id gnl|my_center|LOCUS_02560 11439 10129 gene locus_tag LOCUS_02570 gene secY 11439 10129 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A7 protein_id gnl|my_center|LOCUS_02570 11879 11436 gene locus_tag LOCUS_02580 gene rplO 11879 11436 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1J0 protein_id gnl|my_center|LOCUS_02580 12061 11882 gene locus_tag LOCUS_02590 gene rpmD 12061 11882 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP02 protein_id gnl|my_center|LOCUS_02590 12546 12058 gene locus_tag LOCUS_02600 gene rpsE 12546 12058 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A4 protein_id gnl|my_center|LOCUS_02600 12920 12549 gene locus_tag LOCUS_02610 gene rplR 12920 12549 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A3 protein_id gnl|my_center|LOCUS_02610 13456 12920 gene locus_tag LOCUS_02620 gene rplF 13456 12920 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5W0 protein_id gnl|my_center|LOCUS_02620 13854 13459 gene locus_tag LOCUS_02630 gene rpsH 13854 13459 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CG6 protein_id gnl|my_center|LOCUS_02630 14406 13864 gene locus_tag LOCUS_02640 gene rplE 14406 13864 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z9 protein_id gnl|my_center|LOCUS_02640 14776 14408 gene locus_tag LOCUS_02650 gene rplN 14776 14408 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH0 protein_id gnl|my_center|LOCUS_02650 15046 14786 gene locus_tag LOCUS_02660 gene rpsQ 15046 14786 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z7 protein_id gnl|my_center|LOCUS_02660 15240 15043 gene locus_tag LOCUS_02670 gene rpmC 15240 15043 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FM82 protein_id gnl|my_center|LOCUS_02670 15653 15240 gene locus_tag LOCUS_02680 gene rplP 15653 15240 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z5 protein_id gnl|my_center|LOCUS_02680 16342 15659 gene locus_tag LOCUS_02690 gene rpsC 16342 15659 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z4 protein_id gnl|my_center|LOCUS_02690 16705 16358 gene locus_tag LOCUS_02700 gene rplV 16705 16358 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z3 protein_id gnl|my_center|LOCUS_02700 16980 16705 gene locus_tag LOCUS_02710 gene rpsS 16980 16705 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z2 protein_id gnl|my_center|LOCUS_02710 17810 16980 gene locus_tag LOCUS_02720 gene rplB 17810 16980 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60401 protein_id gnl|my_center|LOCUS_02720 18102 17815 gene locus_tag LOCUS_02730 gene rplW 18102 17815 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z1 protein_id gnl|my_center|LOCUS_02730 18740 18099 gene locus_tag LOCUS_02740 gene rplD 18740 18099 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH9 protein_id gnl|my_center|LOCUS_02740 19057 18740 gene locus_tag LOCUS_02750 gene rpsJ 19057 18740 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z0 protein_id gnl|my_center|LOCUS_02750 21143 19071 gene locus_tag LOCUS_02760 gene fusA2 21143 19071 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_02760 21621 21151 gene locus_tag LOCUS_02770 gene rpsG 21621 21151 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ97 protein_id gnl|my_center|LOCUS_02770 22065 21694 gene locus_tag LOCUS_02780 gene rpsL 22065 21694 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9P6 protein_id gnl|my_center|LOCUS_02780 26605 22400 gene locus_tag LOCUS_02790 gene rpoC 26605 22400 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7EPD8 protein_id gnl|my_center|LOCUS_02790 30803 26616 gene locus_tag LOCUS_02800 gene rpoB 30803 26616 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y6 protein_id gnl|my_center|LOCUS_02800 31232 30855 gene locus_tag LOCUS_02810 gene rplL 31232 30855 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J73 protein_id gnl|my_center|LOCUS_02810 >Feature sequence008 <1 820 gene locus_tag LOCUS_02820 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8RGA3:tryptophan--tRNA ligase 924 2213 gene locus_tag LOCUS_02830 924 2213 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083838.1 protein_id gnl|my_center|LOCUS_02830 3027 2221 gene locus_tag LOCUS_02840 3027 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 3760 3032 gene locus_tag LOCUS_02850 3760 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 4503 3757 gene locus_tag LOCUS_02860 4503 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 4955 6274 gene locus_tag LOCUS_02870 4955 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 8861 6258 gene locus_tag LOCUS_02880 gene clpB 8861 6258 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI87 protein_id gnl|my_center|LOCUS_02880 9023 11047 gene locus_tag LOCUS_02890 gene ligA 9023 11047 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ER9 protein_id gnl|my_center|LOCUS_02890 12576 11044 gene locus_tag LOCUS_02900 gene degP 12576 11044 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_02900 14065 12683 gene locus_tag LOCUS_02910 14065 12683 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940536.1 protein_id gnl|my_center|LOCUS_02910 14781 14113 gene locus_tag LOCUS_02920 gene thiE 14781 14113 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDL8 protein_id gnl|my_center|LOCUS_02920 15569 14793 gene locus_tag LOCUS_02930 gene thiG 15569 14793 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FL9 protein_id gnl|my_center|LOCUS_02930 15841 15587 gene locus_tag LOCUS_02940 15841 15587 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_02940 15872 17002 gene locus_tag LOCUS_02950 gene alr1 15872 17002 CDS product alanine racemase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LR2 protein_id gnl|my_center|LOCUS_02950 17215 18414 gene locus_tag LOCUS_02960 gene purD 17215 18414 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YLE7 protein_id gnl|my_center|LOCUS_02960 18467 19057 gene locus_tag LOCUS_02970 18467 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 19054 20322 gene locus_tag LOCUS_02980 19054 20322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_02980 20326 20646 gene locus_tag LOCUS_02990 20326 20646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 20780 21040 gene locus_tag LOCUS_03000 gene rpsP 20780 21040 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WU95 protein_id gnl|my_center|LOCUS_03000 21045 21278 gene locus_tag LOCUS_03010 21045 21278 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4Q4 protein_id gnl|my_center|LOCUS_03010 21386 21934 gene locus_tag LOCUS_03020 21386 21934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 21913 22626 gene locus_tag LOCUS_03030 gene trmD 21913 22626 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2G4 protein_id gnl|my_center|LOCUS_03030 22623 23135 gene locus_tag LOCUS_03040 22623 23135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 23291 24130 gene locus_tag LOCUS_03050 gene rsmI 23291 24130 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZG8 protein_id gnl|my_center|LOCUS_03050 24249 25133 gene locus_tag LOCUS_03060 24249 25133 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_03060 25189 26502 gene locus_tag LOCUS_03070 gene ugdH 25189 26502 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090851.1 protein_id gnl|my_center|LOCUS_03070 26579 27934 gene locus_tag LOCUS_03080 gene trmFO 26579 27934 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A44 protein_id gnl|my_center|LOCUS_03080 27931 28881 gene locus_tag LOCUS_03090 gene xerC 27931 28881 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KJ6 protein_id gnl|my_center|LOCUS_03090 28936 29484 gene locus_tag LOCUS_03100 gene hslV 28936 29484 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYZ1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence009 2096 852 gene locus_tag LOCUS_03110 gene pepP 2096 852 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105380.1 protein_id gnl|my_center|LOCUS_03110 3382 2228 gene locus_tag LOCUS_03120 3382 2228 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_03120 3602 5317 gene locus_tag LOCUS_03130 gene proS 3602 5317 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKW0 protein_id gnl|my_center|LOCUS_03130 5339 6229 gene locus_tag LOCUS_03140 5339 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 6417 7124 gene locus_tag LOCUS_03150 6417 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_03150 7572 7192 gene locus_tag LOCUS_03160 7572 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 7650 8183 gene locus_tag LOCUS_03170 7650 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 9120 8173 gene locus_tag LOCUS_03180 9120 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 10025 9117 gene locus_tag LOCUS_03190 10025 9117 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_03190 10114 11781 gene locus_tag LOCUS_03200 10114 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 11778 12596 gene locus_tag LOCUS_03210 11778 12596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 12605 14425 gene locus_tag LOCUS_03220 12605 14425 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227894.1 protein_id gnl|my_center|LOCUS_03220 14415 17234 gene locus_tag LOCUS_03230 14415 17234 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_03230 17558 18634 gene locus_tag LOCUS_03240 17558 18634 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_03240 18746 19144 gene locus_tag LOCUS_03250 18746 19144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 19290 19105 gene locus_tag LOCUS_03260 19290 19105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 19573 20511 gene locus_tag LOCUS_03270 19573 20511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03270 20542 20940 gene locus_tag LOCUS_03280 20542 20940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 21309 20941 gene locus_tag LOCUS_03290 21309 20941 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_03290 21782 21327 gene locus_tag LOCUS_03300 21782 21327 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946342.1 protein_id gnl|my_center|LOCUS_03300 23011 21782 gene locus_tag LOCUS_03310 23011 21782 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_03310 24204 23008 gene locus_tag LOCUS_03320 24204 23008 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 protein_id gnl|my_center|LOCUS_03320 24956 24201 gene locus_tag LOCUS_03330 24956 24201 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_03330 26410 24956 gene locus_tag LOCUS_03340 26410 24956 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_03340 26910 26431 gene locus_tag LOCUS_03350 26910 26431 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_03350 27095 27859 gene locus_tag LOCUS_03360 gene paaG 27095 27859 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224354.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence010 1111 152 gene locus_tag LOCUS_03370 gene hmd 1111 152 CDS product N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229949.1 protein_id gnl|my_center|LOCUS_03370 1215 2420 gene locus_tag LOCUS_03380 1215 2420 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_03380 2560 3780 gene locus_tag LOCUS_03390 2560 3780 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089133.1 protein_id gnl|my_center|LOCUS_03390 4439 3789 gene locus_tag LOCUS_03400 4439 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705502.1 protein_id gnl|my_center|LOCUS_03400 5309 4515 gene locus_tag LOCUS_03410 5309 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 5438 6334 gene locus_tag LOCUS_03420 5438 6334 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929646.1 protein_id gnl|my_center|LOCUS_03420 6488 7240 gene locus_tag LOCUS_03430 6488 7240 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_03430 7264 8865 gene locus_tag LOCUS_03440 7264 8865 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 protein_id gnl|my_center|LOCUS_03440 8870 10846 gene locus_tag LOCUS_03450 8870 10846 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229660.1 protein_id gnl|my_center|LOCUS_03450 10861 12006 gene locus_tag LOCUS_03460 10861 12006 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807953.1 protein_id gnl|my_center|LOCUS_03460 12122 13009 gene locus_tag LOCUS_03470 gene htpX 12122 13009 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q3 protein_id gnl|my_center|LOCUS_03470 13116 13403 gene locus_tag LOCUS_03480 13116 13403 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_03480 13437 15131 gene locus_tag LOCUS_03490 13437 15131 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_03490 15189 15683 gene locus_tag LOCUS_03500 15189 15683 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_03500 15791 16309 gene locus_tag LOCUS_03510 15791 16309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 16306 17247 gene locus_tag LOCUS_03520 16306 17247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 17244 17984 gene locus_tag LOCUS_03530 17244 17984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 18036 19424 gene locus_tag LOCUS_03540 gene rpoN 18036 19424 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BZ1 protein_id gnl|my_center|LOCUS_03540 19468 19929 gene locus_tag LOCUS_03550 19468 19929 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_03550 19945 20466 gene locus_tag LOCUS_03560 19945 20466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 20463 21332 gene locus_tag LOCUS_03570 20463 21332 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7A2 protein_id gnl|my_center|LOCUS_03570 21365 21781 gene locus_tag LOCUS_03580 21365 21781 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003505374.1 protein_id gnl|my_center|LOCUS_03580 21778 22044 gene locus_tag LOCUS_03590 21778 22044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 22146 23306 gene locus_tag LOCUS_03600 gene metK 22146 23306 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61946 protein_id gnl|my_center|LOCUS_03600 23388 23795 gene locus_tag LOCUS_03610 23388 23795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 23799 25373 gene locus_tag LOCUS_03620 gene secD 23799 25373 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X5 protein_id gnl|my_center|LOCUS_03620 25386 26399 gene locus_tag LOCUS_03630 gene secF 25386 26399 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFV4 protein_id gnl|my_center|LOCUS_03630 26908 26405 gene locus_tag LOCUS_03640 26908 26405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 >Feature sequence011 764 471 gene locus_tag LOCUS_03650 764 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206410.1 protein_id gnl|my_center|LOCUS_03650 1256 873 gene locus_tag LOCUS_03660 1256 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 1303 2538 gene locus_tag LOCUS_03670 1303 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423257.1 protein_id gnl|my_center|LOCUS_03670 3587 2535 gene locus_tag LOCUS_03680 3587 2535 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085431.1 protein_id gnl|my_center|LOCUS_03680 4026 3661 gene locus_tag LOCUS_03690 4026 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 4777 4019 gene locus_tag LOCUS_03700 4777 4019 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_03700 5408 4887 gene locus_tag LOCUS_03710 5408 4887 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z8 protein_id gnl|my_center|LOCUS_03710 5650 6102 gene locus_tag LOCUS_03720 5650 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 6180 7142 gene locus_tag LOCUS_03730 6180 7142 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_03730 7810 7151 gene locus_tag LOCUS_03740 gene nth 7810 7151 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_03740 8870 7848 gene locus_tag LOCUS_03750 gene fadB5 8870 7848 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_03750 9735 8974 gene locus_tag LOCUS_03760 9735 8974 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022442.1 protein_id gnl|my_center|LOCUS_03760 10240 9737 gene locus_tag LOCUS_03770 10240 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_03770 11498 10224 gene locus_tag LOCUS_03780 11498 10224 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_03780 12716 11556 gene locus_tag LOCUS_03790 12716 11556 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 protein_id gnl|my_center|LOCUS_03790 12878 14134 gene locus_tag LOCUS_03800 12878 14134 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338710.1 protein_id gnl|my_center|LOCUS_03800 14125 14901 gene locus_tag LOCUS_03810 14125 14901 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 protein_id gnl|my_center|LOCUS_03810 14998 16137 gene locus_tag LOCUS_03820 14998 16137 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_03820 16152 16928 gene locus_tag LOCUS_03830 16152 16928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082974.1 protein_id gnl|my_center|LOCUS_03830 17537 16932 gene locus_tag LOCUS_03840 17537 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 17899 17534 gene locus_tag LOCUS_03850 17899 17534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 18241 19329 gene locus_tag LOCUS_03860 18241 19329 CDS product 3-phosphoserine/phosphohydroxythreonine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_03860 19331 21892 gene locus_tag LOCUS_03870 19331 21892 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067921.1 protein_id gnl|my_center|LOCUS_03870 22007 23020 gene locus_tag LOCUS_03880 22007 23020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 23040 25856 gene locus_tag LOCUS_03890 gene uvrA 23040 25856 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747E2 protein_id gnl|my_center|LOCUS_03890 25873 26295 gene locus_tag LOCUS_03900 25873 26295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 26299 27267 gene locus_tag LOCUS_03910 26299 27267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence012 1457 678 gene locus_tag LOCUS_03920 1457 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 1687 1956 gene locus_tag LOCUS_03930 1687 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 1971 2375 gene locus_tag LOCUS_03940 1971 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 3591 2359 gene locus_tag LOCUS_03950 3591 2359 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521974.1 protein_id gnl|my_center|LOCUS_03950 3635 4495 gene locus_tag LOCUS_03960 3635 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 4492 5415 gene locus_tag LOCUS_03970 4492 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 5421 6632 gene locus_tag LOCUS_03980 5421 6632 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730842.1 protein_id gnl|my_center|LOCUS_03980 6715 7563 gene locus_tag LOCUS_03990 6715 7563 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090614.1 protein_id gnl|my_center|LOCUS_03990 8959 7595 gene locus_tag LOCUS_04000 gene trpB 8959 7595 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA80 protein_id gnl|my_center|LOCUS_04000 10017 8971 gene locus_tag LOCUS_04010 10017 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 11115 10117 gene locus_tag LOCUS_04020 11115 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_04020 12007 11264 gene locus_tag LOCUS_04030 gene tesB 12007 11264 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_04030 12343 12663 gene locus_tag LOCUS_04040 12343 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 13492 12740 gene locus_tag LOCUS_04050 13492 12740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 13536 14615 gene locus_tag LOCUS_04060 13536 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 14651 15799 gene locus_tag LOCUS_04070 14651 15799 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225697.1 protein_id gnl|my_center|LOCUS_04070 16863 15994 gene locus_tag LOCUS_04080 16863 15994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 17864 16998 gene locus_tag LOCUS_04090 17864 16998 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246274.1 protein_id gnl|my_center|LOCUS_04090 19335 18229 gene locus_tag LOCUS_04100 19335 18229 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089770.1 protein_id gnl|my_center|LOCUS_04100 20531 19410 gene locus_tag LOCUS_04110 20531 19410 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726983.1 protein_id gnl|my_center|LOCUS_04110 21020 20535 gene locus_tag LOCUS_04120 21020 20535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 21364 21017 gene locus_tag LOCUS_04130 21364 21017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726817.1 protein_id gnl|my_center|LOCUS_04130 22569 21364 gene locus_tag LOCUS_04140 22569 21364 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726818.1 protein_id gnl|my_center|LOCUS_04140 23212 22574 gene locus_tag LOCUS_04150 23212 22574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 23491 24360 gene locus_tag LOCUS_04160 23491 24360 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707175.1 protein_id gnl|my_center|LOCUS_04160 24357 24848 gene locus_tag LOCUS_04170 24357 24848 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707174.1 protein_id gnl|my_center|LOCUS_04170 24863 25930 gene locus_tag LOCUS_04180 24863 25930 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_04180 26007 26627 gene locus_tag LOCUS_04190 gene upp 26007 26627 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S320 protein_id gnl|my_center|LOCUS_04190 >Feature sequence013 <1 548 gene locus_tag LOCUS_04200 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P66947:putative acetolactate synthase 2086 707 gene locus_tag LOCUS_04210 2086 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 3188 2415 gene locus_tag LOCUS_04220 3188 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 protein_id gnl|my_center|LOCUS_04220 4081 3206 gene locus_tag LOCUS_04230 4081 3206 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_04230 4968 4096 gene locus_tag LOCUS_04240 4968 4096 CDS product 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_04240 5849 5067 gene locus_tag LOCUS_04250 5849 5067 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706250.1 protein_id gnl|my_center|LOCUS_04250 6380 6018 gene locus_tag LOCUS_04260 6380 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 6540 8276 gene locus_tag LOCUS_04270 gene glnS 6540 8276 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KR6 protein_id gnl|my_center|LOCUS_04270 8284 8529 gene locus_tag LOCUS_04280 8284 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 8560 10008 gene locus_tag LOCUS_04290 8560 10008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 10005 10772 gene locus_tag LOCUS_04300 10005 10772 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_04300 12400 10781 gene locus_tag LOCUS_04310 12400 10781 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_04310 13057 14013 gene locus_tag LOCUS_04320 gene rnz 13057 14013 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0Z8 protein_id gnl|my_center|LOCUS_04320 14814 14068 gene locus_tag LOCUS_04330 14814 14068 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269309.1 protein_id gnl|my_center|LOCUS_04330 16107 14830 gene locus_tag LOCUS_04340 16107 14830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 16667 16104 gene locus_tag LOCUS_04350 16667 16104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 17166 16654 gene locus_tag LOCUS_04360 17166 16654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 18530 17166 gene locus_tag LOCUS_04370 18530 17166 CDS product Fe-S-cluster-containing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_04370 21549 18535 gene locus_tag LOCUS_04380 21549 18535 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_04380 22281 21574 gene locus_tag LOCUS_04390 22281 21574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 22692 23924 gene locus_tag LOCUS_04400 gene fadA 22692 23924 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_04400 23990 24256 gene locus_tag LOCUS_04410 23990 24256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 25325 24270 gene locus_tag LOCUS_04420 25325 24270 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_04420 26225 25446 gene locus_tag LOCUS_04430 26225 25446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 26709 26272 gene locus_tag LOCUS_04440 26709 26272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence014 <1 1376 gene locus_tag LOCUS_04450 <1 1376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NP98:acetyl-coenzyme A synthetase 1443 2354 gene locus_tag LOCUS_04460 1443 2354 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_04460 2415 4148 gene locus_tag LOCUS_04470 2415 4148 CDS product sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256582.1 protein_id gnl|my_center|LOCUS_04470 4251 5447 gene locus_tag LOCUS_04480 4251 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 5516 6751 gene locus_tag LOCUS_04490 5516 6751 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876455.1 protein_id gnl|my_center|LOCUS_04490 8288 6786 gene locus_tag LOCUS_04500 gene dnaA 8288 6786 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT2 protein_id gnl|my_center|LOCUS_04500 9266 8745 gene locus_tag LOCUS_04510 9266 8745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 9338 9871 gene locus_tag LOCUS_04520 9338 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 10148 9927 gene locus_tag LOCUS_04530 10148 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 12310 10514 gene locus_tag LOCUS_04540 12310 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 12457 12918 gene locus_tag LOCUS_04550 12457 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 15023 12915 gene locus_tag LOCUS_04560 15023 12915 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030822.1 protein_id gnl|my_center|LOCUS_04560 15303 15662 gene locus_tag LOCUS_04570 15303 15662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 15852 17477 gene locus_tag LOCUS_04580 gene pckA2 15852 17477 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S008 protein_id gnl|my_center|LOCUS_04580 18538 17471 gene locus_tag LOCUS_04590 18538 17471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 18789 19055 gene locus_tag LOCUS_04600 18789 19055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 19461 19066 gene locus_tag LOCUS_04610 19461 19066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 19717 20442 gene locus_tag LOCUS_04620 gene cinA 19717 20442 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088357.1 protein_id gnl|my_center|LOCUS_04620 20451 20903 gene locus_tag LOCUS_04630 20451 20903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 21960 20917 gene locus_tag LOCUS_04640 gene aroC 21960 20917 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_04640 22160 22960 gene locus_tag LOCUS_04650 22160 22960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 23359 22976 gene locus_tag LOCUS_04660 23359 22976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 24453 23356 gene locus_tag LOCUS_04670 gene mutY 24453 23356 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_04670 25185 24460 gene locus_tag LOCUS_04680 gene sfsA 25185 24460 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61664 protein_id gnl|my_center|LOCUS_04680 >Feature sequence015 1225 2007 gene locus_tag LOCUS_04690 1225 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 2025 3299 gene locus_tag LOCUS_04700 gene hisS 2025 3299 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9Y3 protein_id gnl|my_center|LOCUS_04700 3370 5286 gene locus_tag LOCUS_04710 gene speA 3370 5286 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE10 protein_id gnl|my_center|LOCUS_04710 5290 6087 gene locus_tag LOCUS_04720 5290 6087 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_04720 8264 6102 gene locus_tag LOCUS_04730 8264 6102 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226412.1 protein_id gnl|my_center|LOCUS_04730 9486 8299 gene locus_tag LOCUS_04740 9486 8299 CDS product acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114496.1 protein_id gnl|my_center|LOCUS_04740 9646 11124 gene locus_tag LOCUS_04750 9646 11124 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031501.1 protein_id gnl|my_center|LOCUS_04750 11597 12829 gene locus_tag LOCUS_04760 gene agpS 11597 12829 CDS product alkyldihydroxyacetonephosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_04760 12908 14137 gene locus_tag LOCUS_04770 gene dapL 12908 14137 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F814 protein_id gnl|my_center|LOCUS_04770 15103 14162 gene locus_tag LOCUS_04780 15103 14162 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255971.1 protein_id gnl|my_center|LOCUS_04780 16923 15103 gene locus_tag LOCUS_04790 16923 15103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 18601 16925 gene locus_tag LOCUS_04800 18601 16925 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_04800 18712 20874 gene locus_tag LOCUS_04810 18712 20874 CDS product molybdopterin-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230850.1 protein_id gnl|my_center|LOCUS_04810 21340 20858 gene locus_tag LOCUS_04820 21340 20858 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400864.1 protein_id gnl|my_center|LOCUS_04820 22238 21384 gene locus_tag LOCUS_04830 22238 21384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 23441 22293 gene locus_tag LOCUS_04840 23441 22293 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_04840 24712 23444 gene locus_tag LOCUS_04850 24712 23444 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405234.1 protein_id gnl|my_center|LOCUS_04850 25151 24723 gene locus_tag LOCUS_04860 25151 24723 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730854.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence016 1003 1782 gene locus_tag LOCUS_04870 1003 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 3387 1810 gene locus_tag LOCUS_04880 3387 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 3965 5026 gene locus_tag LOCUS_04890 3965 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 protein_id gnl|my_center|LOCUS_04890 5067 5813 gene locus_tag LOCUS_04900 5067 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 5908 6960 gene locus_tag LOCUS_04910 5908 6960 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_04910 7769 6990 gene locus_tag LOCUS_04920 gene yabD 7769 6990 CDS product putative metal-dependent hydrolase YabD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37545 protein_id gnl|my_center|LOCUS_04920 8747 7815 gene locus_tag LOCUS_04930 gene ribA 8747 7815 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI3 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04930 8963 8814 gene locus_tag LOCUS_04940 8963 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04940 9074 9451 gene locus_tag LOCUS_04950 9074 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 9561 9486 gene locus_tag LOCUS_t00040 9561 9486 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 10168 9707 gene locus_tag LOCUS_04960 gene greA 10168 9707 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4I3 protein_id gnl|my_center|LOCUS_04960 10282 10206 gene locus_tag LOCUS_t00050 10282 10206 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11061 10384 gene locus_tag LOCUS_04970 gene rpe 11061 10384 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEV5 protein_id gnl|my_center|LOCUS_04970 12491 11058 gene locus_tag LOCUS_04980 gene rsmB 12491 11058 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z4 protein_id gnl|my_center|LOCUS_04980 13510 12515 gene locus_tag LOCUS_04990 gene fmt 13510 12515 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AA8 protein_id gnl|my_center|LOCUS_04990 14078 13557 gene locus_tag LOCUS_05000 gene def 14078 13557 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDJ4 protein_id gnl|my_center|LOCUS_05000 16547 14106 gene locus_tag LOCUS_05010 gene priA 16547 14106 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW6 protein_id gnl|my_center|LOCUS_05010 16696 17262 gene locus_tag LOCUS_05020 16696 17262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 17884 17285 gene locus_tag LOCUS_05030 gene recR 17884 17285 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI4 protein_id gnl|my_center|LOCUS_05030 18217 17888 gene locus_tag LOCUS_05040 18217 17888 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814C9 protein_id gnl|my_center|LOCUS_05040 19972 18233 gene locus_tag LOCUS_05050 gene dnaX 19972 18233 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_05050 20459 21556 gene locus_tag LOCUS_05060 20459 21556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038986.1 protein_id gnl|my_center|LOCUS_05060 21584 21675 gene locus_tag LOCUS_t00060 21584 21675 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21715 22554 gene locus_tag LOCUS_05070 21715 22554 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896244.1 protein_id gnl|my_center|LOCUS_05070 22746 22985 gene locus_tag LOCUS_05080 gene infA1 22746 22985 CDS product translation initiation factor IF-1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61686 protein_id gnl|my_center|LOCUS_05080 23069 23983 gene locus_tag LOCUS_05090 gene fmt 23069 23983 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BP0 protein_id gnl|my_center|LOCUS_05090 >Feature sequence017 1797 448 gene locus_tag LOCUS_05100 1797 448 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_05100 3464 2289 gene locus_tag LOCUS_05110 3464 2289 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_05110 3875 3498 gene locus_tag LOCUS_05120 3875 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 5262 3886 gene locus_tag LOCUS_05130 5262 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 6796 5192 gene locus_tag LOCUS_05140 6796 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 7114 7923 gene locus_tag LOCUS_05150 7114 7923 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082972.1 protein_id gnl|my_center|LOCUS_05150 8845 7934 gene locus_tag LOCUS_05160 8845 7934 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919989.1 protein_id gnl|my_center|LOCUS_05160 8933 9988 gene locus_tag LOCUS_05170 8933 9988 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_05170 11175 9985 gene locus_tag LOCUS_05180 11175 9985 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701081.1 protein_id gnl|my_center|LOCUS_05180 11314 11239 gene locus_tag LOCUS_t00070 11314 11239 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 12286 11381 gene locus_tag LOCUS_05190 12286 11381 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385088.1 protein_id gnl|my_center|LOCUS_05190 12774 12343 gene locus_tag LOCUS_05200 12774 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 14091 12784 gene locus_tag LOCUS_05210 gene purA 14091 12784 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHN3 protein_id gnl|my_center|LOCUS_05210 15677 14091 gene locus_tag LOCUS_05220 gene serA 15677 14091 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKK8 protein_id gnl|my_center|LOCUS_05220 15868 17178 gene locus_tag LOCUS_05230 gene aroA 15868 17178 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QX9 protein_id gnl|my_center|LOCUS_05230 17175 17891 gene locus_tag LOCUS_05240 17175 17891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 17987 18676 gene locus_tag LOCUS_05250 17987 18676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 18683 20158 gene locus_tag LOCUS_05260 18683 20158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_05260 20579 20145 gene locus_tag LOCUS_05270 20579 20145 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141140.1 protein_id gnl|my_center|LOCUS_05270 21240 20557 gene locus_tag LOCUS_05280 21240 20557 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_05280 23360 21405 gene locus_tag LOCUS_05290 23360 21405 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_05290 <24855 23376 gene locus_tag LOCUS_05300 <24855 23376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393465.1:5-oxoprolinase >Feature sequence018 2635 1286 gene locus_tag LOCUS_05310 2635 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931342.1 protein_id gnl|my_center|LOCUS_05310 3818 2646 gene locus_tag LOCUS_05320 3818 2646 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887258.1 protein_id gnl|my_center|LOCUS_05320 3955 5424 gene locus_tag LOCUS_05330 3955 5424 CDS product acetyl-CoA carboxylase biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623974.1 protein_id gnl|my_center|LOCUS_05330 5424 5942 gene locus_tag LOCUS_05340 5424 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 5939 7549 gene locus_tag LOCUS_05350 5939 7549 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920031.1 protein_id gnl|my_center|LOCUS_05350 7546 8427 gene locus_tag LOCUS_05360 gene pecR 7546 8427 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_05360 9275 8586 gene locus_tag LOCUS_05370 9275 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 9657 9262 gene locus_tag LOCUS_05380 9657 9262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 10502 9666 gene locus_tag LOCUS_05390 10502 9666 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_05390 10738 11544 gene locus_tag LOCUS_05400 gene paaG 10738 11544 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_05400 11582 12013 gene locus_tag LOCUS_05410 11582 12013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 13981 12119 gene locus_tag LOCUS_05420 13981 12119 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_05420 15828 14080 gene locus_tag LOCUS_05430 gene metX 15828 14080 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG04 protein_id gnl|my_center|LOCUS_05430 16005 16877 gene locus_tag LOCUS_05440 16005 16877 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 protein_id gnl|my_center|LOCUS_05440 16877 17356 gene locus_tag LOCUS_05450 16877 17356 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_05450 17356 19608 gene locus_tag LOCUS_05460 17356 19608 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 protein_id gnl|my_center|LOCUS_05460 19612 19857 gene locus_tag LOCUS_05470 19612 19857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 19953 21071 gene locus_tag LOCUS_05480 19953 21071 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086066.1 protein_id gnl|my_center|LOCUS_05480 22770 21142 gene locus_tag LOCUS_05490 22770 21142 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090102.1 protein_id gnl|my_center|LOCUS_05490 23014 23382 gene locus_tag LOCUS_05500 23014 23382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 24489 23398 gene locus_tag LOCUS_05510 24489 23398 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889453.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence019 925 347 gene locus_tag LOCUS_05520 925 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2426 1143 gene locus_tag LOCUS_05530 gene gltA 2426 1143 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F801 protein_id gnl|my_center|LOCUS_05530 3208 2870 gene locus_tag LOCUS_05540 3208 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 3842 3234 gene locus_tag LOCUS_05550 3842 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 3953 5407 gene locus_tag LOCUS_05560 3953 5407 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_05560 5404 6864 gene locus_tag LOCUS_05570 5404 6864 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 protein_id gnl|my_center|LOCUS_05570 7966 6956 gene locus_tag LOCUS_05580 7966 6956 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_05580 8567 7998 gene locus_tag LOCUS_05590 gene efp 8567 7998 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI92 protein_id gnl|my_center|LOCUS_05590 9570 8605 gene locus_tag LOCUS_05600 gene etfA 9570 8605 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101963.1 protein_id gnl|my_center|LOCUS_05600 10414 9632 gene locus_tag LOCUS_05610 10414 9632 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_05610 11220 10516 gene locus_tag LOCUS_05620 11220 10516 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727611.1 protein_id gnl|my_center|LOCUS_05620 11995 11285 gene locus_tag LOCUS_05630 11995 11285 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082950.1 protein_id gnl|my_center|LOCUS_05630 12983 13231 gene locus_tag LOCUS_05640 12983 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 13237 13689 gene locus_tag LOCUS_05650 13237 13689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 14138 13686 gene locus_tag LOCUS_05660 14138 13686 CDS product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67466 protein_id gnl|my_center|LOCUS_05660 15024 14155 gene locus_tag LOCUS_05670 15024 14155 CDS product recombinase RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027903.1 protein_id gnl|my_center|LOCUS_05670 15142 16017 gene locus_tag LOCUS_05680 15142 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 16005 16481 gene locus_tag LOCUS_05690 16005 16481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 16530 17087 gene locus_tag LOCUS_05700 16530 17087 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_05700 18091 17102 gene locus_tag LOCUS_05710 18091 17102 CDS product ArgK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390694.1 protein_id gnl|my_center|LOCUS_05710 20129 18075 gene locus_tag LOCUS_05720 20129 18075 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 protein_id gnl|my_center|LOCUS_05720 20754 21215 gene locus_tag LOCUS_05730 20754 21215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 21203 22033 gene locus_tag LOCUS_05740 21203 22033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 22126 23079 gene locus_tag LOCUS_05750 gene nadA 22126 23079 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_05750 24007 23105 gene locus_tag LOCUS_05760 gene citE 24007 23105 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_05760 >Feature sequence020 <1 1269 gene locus_tag LOCUS_05770 <1 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941668.1:acetoacetate metabolism regulatory protein AtoC 1277 1948 gene locus_tag LOCUS_05780 gene thiE 1277 1948 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD79 protein_id gnl|my_center|LOCUS_05780 1954 3174 gene locus_tag LOCUS_05790 1954 3174 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZD9 protein_id gnl|my_center|LOCUS_05790 4435 3386 gene locus_tag LOCUS_05800 4435 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026939.1 protein_id gnl|my_center|LOCUS_05800 4513 5622 gene locus_tag LOCUS_05810 4513 5622 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA4 protein_id gnl|my_center|LOCUS_05810 6437 5739 gene locus_tag LOCUS_05820 6437 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 6596 7285 gene locus_tag LOCUS_05830 gene thiD 6596 7285 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221739.1 protein_id gnl|my_center|LOCUS_05830 8753 7323 gene locus_tag LOCUS_05840 gene mpl 8753 7323 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_05840 9967 8813 gene locus_tag LOCUS_05850 9967 8813 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_05850 10956 10039 gene locus_tag LOCUS_05860 10956 10039 CDS product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640062.1 protein_id gnl|my_center|LOCUS_05860 12577 10979 gene locus_tag LOCUS_05870 gene dnaB 12577 10979 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EG4 protein_id gnl|my_center|LOCUS_05870 13095 12643 gene locus_tag LOCUS_05880 gene rplI 13095 12643 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE1 protein_id gnl|my_center|LOCUS_05880 13451 13131 gene locus_tag LOCUS_05890 gene rpsR 13451 13131 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE3 protein_id gnl|my_center|LOCUS_05890 13993 13448 gene locus_tag LOCUS_05900 13993 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 14806 14204 gene locus_tag LOCUS_05910 gene pdxT 14806 14204 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYU3 protein_id gnl|my_center|LOCUS_05910 15727 14816 gene locus_tag LOCUS_05920 gene pdxS 15727 14816 CDS product pyridoxal 5'-phosphate synthase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMJ0 protein_id gnl|my_center|LOCUS_05920 17139 15787 gene locus_tag LOCUS_05930 gene nhaA 17139 15787 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTY3 protein_id gnl|my_center|LOCUS_05930 17830 17165 gene locus_tag LOCUS_05940 gene rplY 17830 17165 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE7 protein_id gnl|my_center|LOCUS_05940 18808 17870 gene locus_tag LOCUS_05950 gene prsA 18808 17870 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE8 protein_id gnl|my_center|LOCUS_05950 18955 18881 gene locus_tag LOCUS_t00080 18955 18881 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 19941 19012 gene locus_tag LOCUS_05960 gene ispE 19941 19012 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T924 protein_id gnl|my_center|LOCUS_05960 20308 19955 gene locus_tag LOCUS_05970 20308 19955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123553.1 protein_id gnl|my_center|LOCUS_05970 20945 20301 gene locus_tag LOCUS_05980 20945 20301 CDS product CDP-diacylglycerol--inositol 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020574.1 protein_id gnl|my_center|LOCUS_05980 21255 20989 gene locus_tag LOCUS_05990 21255 20989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 21385 22221 gene locus_tag LOCUS_06000 gene bamD 21385 22221 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV3 protein_id gnl|my_center|LOCUS_06000 22335 22799 gene locus_tag LOCUS_06010 22335 22799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 <23873 22809 gene locus_tag LOCUS_06020 <23873 22809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KG23:4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) >Feature sequence021 278 1039 gene locus_tag LOCUS_06030 gene gst 278 1039 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039034.1 protein_id gnl|my_center|LOCUS_06030 1109 2329 gene locus_tag LOCUS_06040 1109 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701068.1 protein_id gnl|my_center|LOCUS_06040 2317 2520 gene locus_tag LOCUS_06050 2317 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2538 3290 gene locus_tag LOCUS_06060 2538 3290 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 protein_id gnl|my_center|LOCUS_06060 3292 3927 gene locus_tag LOCUS_06070 3292 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704659.1 protein_id gnl|my_center|LOCUS_06070 4137 5363 gene locus_tag LOCUS_06080 4137 5363 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706251.1 protein_id gnl|my_center|LOCUS_06080 5369 6169 gene locus_tag LOCUS_06090 5369 6169 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533082.1 protein_id gnl|my_center|LOCUS_06090 6190 7164 gene locus_tag LOCUS_06100 6190 7164 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582748.1 protein_id gnl|my_center|LOCUS_06100 7821 7189 gene locus_tag LOCUS_06110 7821 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099724.1 protein_id gnl|my_center|LOCUS_06110 7897 8592 gene locus_tag LOCUS_06120 7897 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 8710 8958 gene locus_tag LOCUS_06130 8710 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 9991 9077 gene locus_tag LOCUS_06140 9991 9077 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531446.1 protein_id gnl|my_center|LOCUS_06140 10870 10022 gene locus_tag LOCUS_06150 10870 10022 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039356.1 protein_id gnl|my_center|LOCUS_06150 11892 10867 gene locus_tag LOCUS_06160 11892 10867 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868029.1 protein_id gnl|my_center|LOCUS_06160 12027 12103 gene locus_tag LOCUS_t00090 12027 12103 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13354 12125 gene locus_tag LOCUS_06170 13354 12125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 13463 14533 gene locus_tag LOCUS_06180 13463 14533 CDS product FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_06180 14530 15165 gene locus_tag LOCUS_06190 14530 15165 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478031.1 protein_id gnl|my_center|LOCUS_06190 15707 15288 gene locus_tag LOCUS_06200 15707 15288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 16878 15709 gene locus_tag LOCUS_06210 16878 15709 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_06210 17121 16921 gene locus_tag LOCUS_06220 17121 16921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 17847 17362 gene locus_tag LOCUS_06230 17847 17362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 19241 18414 gene locus_tag LOCUS_06240 19241 18414 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142937.1 protein_id gnl|my_center|LOCUS_06240 19303 20673 gene locus_tag LOCUS_06250 gene pgi 19303 20673 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFP0 protein_id gnl|my_center|LOCUS_06250 21747 20695 gene locus_tag LOCUS_06260 21747 20695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence022 2773 1295 gene locus_tag LOCUS_06270 gene lysS 2773 1295 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM49 protein_id gnl|my_center|LOCUS_06270 3852 2770 gene locus_tag LOCUS_06280 gene prfB 3852 2770 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AS3 protein_id gnl|my_center|LOCUS_06280 5540 3942 gene locus_tag LOCUS_06290 gene lnt 5540 3942 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_06290 5979 5533 gene locus_tag LOCUS_06300 gene ybeY 5979 5533 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AR8 protein_id gnl|my_center|LOCUS_06300 7044 6019 gene locus_tag LOCUS_06310 7044 6019 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939167.1 protein_id gnl|my_center|LOCUS_06310 7471 7635 gene locus_tag LOCUS_06320 7471 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 8801 7821 gene locus_tag LOCUS_06330 gene holA 8801 7821 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687654.1 protein_id gnl|my_center|LOCUS_06330 9432 8854 gene locus_tag LOCUS_06340 9432 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 10221 9682 gene locus_tag LOCUS_06350 10221 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 10728 10249 gene locus_tag LOCUS_06360 gene nusB 10728 10249 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIA9 protein_id gnl|my_center|LOCUS_06360 11235 10765 gene locus_tag LOCUS_06370 gene ribH 11235 10765 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE53 protein_id gnl|my_center|LOCUS_06370 12375 11272 gene locus_tag LOCUS_06380 12375 11272 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC0 protein_id gnl|my_center|LOCUS_06380 12838 12383 gene locus_tag LOCUS_06390 gene nrdR 12838 12383 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI6 protein_id gnl|my_center|LOCUS_06390 14551 12842 gene locus_tag LOCUS_06400 14551 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 14942 14706 gene locus_tag LOCUS_06410 gene acpP 14942 14706 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67611 protein_id gnl|my_center|LOCUS_06410 15931 14984 gene locus_tag LOCUS_06420 gene fabD 15931 14984 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71019 protein_id gnl|my_center|LOCUS_06420 16871 16944 gene locus_tag LOCUS_t00100 16871 16944 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 17173 17248 gene locus_tag LOCUS_t00110 17173 17248 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17329 17916 gene locus_tag LOCUS_06430 17329 17916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 18526 17945 gene locus_tag LOCUS_06440 18526 17945 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038946.1 protein_id gnl|my_center|LOCUS_06440 19175 18612 gene locus_tag LOCUS_06450 19175 18612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 20604 19255 gene locus_tag LOCUS_06460 gene glyQS 20604 19255 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73RR5 protein_id gnl|my_center|LOCUS_06460 21442 20684 gene locus_tag LOCUS_06470 gene recO 21442 20684 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MD78 protein_id gnl|my_center|LOCUS_06470 22017 21505 gene locus_tag LOCUS_06480 22017 21505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 <23081 22198 gene locus_tag LOCUS_06490 <23081 22198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HEY0:succinate--CoA ligase [ADP-forming] subunit alpha >Feature sequence023 4966 2060 gene locus_tag LOCUS_06500 4966 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 5535 5056 gene locus_tag LOCUS_06510 5535 5056 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_06510 5621 6337 gene locus_tag LOCUS_06520 gene guaA 5621 6337 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 protein_id gnl|my_center|LOCUS_06520 7509 6352 gene locus_tag LOCUS_06530 7509 6352 CDS product amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384563.1 protein_id gnl|my_center|LOCUS_06530 7567 10233 gene locus_tag LOCUS_06540 gene valS 7567 10233 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1M5 protein_id gnl|my_center|LOCUS_06540 11314 10253 gene locus_tag LOCUS_06550 11314 10253 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQA0 protein_id gnl|my_center|LOCUS_06550 12352 11516 gene locus_tag LOCUS_06560 12352 11516 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266255.1 protein_id gnl|my_center|LOCUS_06560 13326 12361 gene locus_tag LOCUS_06570 gene fbp 13326 12361 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP35 protein_id gnl|my_center|LOCUS_06570 14725 13487 gene locus_tag LOCUS_06580 14725 13487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400620.1 protein_id gnl|my_center|LOCUS_06580 14825 16045 gene locus_tag LOCUS_06590 14825 16045 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_06590 16128 17576 gene locus_tag LOCUS_06600 gene ahcY 16128 17576 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZM1 protein_id gnl|my_center|LOCUS_06600 17595 19556 gene locus_tag LOCUS_06610 gene prc 17595 19556 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_06610 19735 19926 gene locus_tag LOCUS_06620 19735 19926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 19916 20839 gene locus_tag LOCUS_06630 19916 20839 CDS product glutaredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638714.2 protein_id gnl|my_center|LOCUS_06630 20844 21131 gene locus_tag LOCUS_06640 20844 21131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 21167 22300 gene locus_tag LOCUS_06650 21167 22300 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKF6 protein_id gnl|my_center|LOCUS_06650 <22973 22297 gene locus_tag LOCUS_06660 <22973 22297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089230.1:ABC transporter permease >Feature sequence024 <1 879 gene locus_tag LOCUS_06670 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943019.1:anthranilate synthase component I 876 1463 gene locus_tag LOCUS_06680 876 1463 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392854.1 protein_id gnl|my_center|LOCUS_06680 1460 2479 gene locus_tag LOCUS_06690 gene trpD 1460 2479 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT49 protein_id gnl|my_center|LOCUS_06690 2480 3268 gene locus_tag LOCUS_06700 gene trpC 2480 3268 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_06700 3265 3885 gene locus_tag LOCUS_06710 gene trpF 3265 3885 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DVF4 protein_id gnl|my_center|LOCUS_06710 3890 5101 gene locus_tag LOCUS_06720 gene trpB1 3890 5101 CDS product tryptophan synthase beta chain 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66923 protein_id gnl|my_center|LOCUS_06720 5098 5904 gene locus_tag LOCUS_06730 gene trpA 5098 5904 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI3 protein_id gnl|my_center|LOCUS_06730 6563 5901 gene locus_tag LOCUS_06740 gene coaE 6563 5901 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34932 protein_id gnl|my_center|LOCUS_06740 6937 8073 gene locus_tag LOCUS_06750 gene pheA 6937 8073 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_06750 8070 9167 gene locus_tag LOCUS_06760 gene hisC 8070 9167 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_06760 9164 10018 gene locus_tag LOCUS_06770 9164 10018 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_06770 10082 11797 gene locus_tag LOCUS_06780 gene rpsA 10082 11797 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_06780 11867 12181 gene locus_tag LOCUS_06790 gene ihfB 11867 12181 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP8 protein_id gnl|my_center|LOCUS_06790 12207 12584 gene locus_tag LOCUS_06800 12207 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 12587 13591 gene locus_tag LOCUS_06810 12587 13591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 13588 16224 gene locus_tag LOCUS_06820 gene mutS 13588 16224 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61667 protein_id gnl|my_center|LOCUS_06820 16257 17348 gene locus_tag LOCUS_06830 16257 17348 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545784.1 protein_id gnl|my_center|LOCUS_06830 17355 20093 gene locus_tag LOCUS_06840 gene glnD 17355 20093 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C55 protein_id gnl|my_center|LOCUS_06840 20086 21000 gene locus_tag LOCUS_06850 gene xerD 20086 21000 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FJD6 protein_id gnl|my_center|LOCUS_06850 >Feature sequence025 1757 426 gene locus_tag LOCUS_06860 gene glmU 1757 426 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U5B6 protein_id gnl|my_center|LOCUS_06860 2231 3730 gene locus_tag LOCUS_06870 gene hflX 2231 3730 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFQ8 protein_id gnl|my_center|LOCUS_06870 3727 4722 gene locus_tag LOCUS_06880 gene fabH2 3727 4722 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_06880 4842 5207 gene locus_tag LOCUS_06890 4842 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 5257 6423 gene locus_tag LOCUS_06900 5257 6423 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228201.1 protein_id gnl|my_center|LOCUS_06900 7746 6487 gene locus_tag LOCUS_06910 7746 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 8492 7785 gene locus_tag LOCUS_06920 8492 7785 CDS product 2,3-diketo-5-methylthio-1-phosphopentane phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_06920 9850 8546 gene locus_tag LOCUS_06930 gene folC 9850 8546 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_06930 10209 9883 gene locus_tag LOCUS_06940 10209 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 11014 10247 gene locus_tag LOCUS_06950 11014 10247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123408.1 protein_id gnl|my_center|LOCUS_06950 11534 12736 gene locus_tag LOCUS_06960 11534 12736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 13104 14537 gene locus_tag LOCUS_06970 13104 14537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 14550 15716 gene locus_tag LOCUS_06980 14550 15716 CDS product DNA topoisomerase VI subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869868.1 protein_id gnl|my_center|LOCUS_06980 16753 15740 gene locus_tag LOCUS_06990 16753 15740 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FH7 protein_id gnl|my_center|LOCUS_06990 17839 17264 gene locus_tag LOCUS_07000 17839 17264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 18440 17970 gene locus_tag LOCUS_07010 18440 17970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 18634 18437 gene locus_tag LOCUS_07020 18634 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 19709 18837 gene locus_tag LOCUS_07030 19709 18837 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338250.1 protein_id gnl|my_center|LOCUS_07030 20685 19774 gene locus_tag LOCUS_07040 20685 19774 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_07040 21884 20703 gene locus_tag LOCUS_07050 21884 20703 CDS product pigment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088837.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence026 3107 1962 gene locus_tag LOCUS_07060 gene mmgC 3107 1962 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973070.1 protein_id gnl|my_center|LOCUS_07060 3264 4328 gene locus_tag LOCUS_07070 3264 4328 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_07070 4410 5621 gene locus_tag LOCUS_07080 4410 5621 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_07080 6334 5618 gene locus_tag LOCUS_07090 6334 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 6450 7685 gene locus_tag LOCUS_07100 6450 7685 CDS product biphenyl 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929894.1 protein_id gnl|my_center|LOCUS_07100 7685 8164 gene locus_tag LOCUS_07110 7685 8164 CDS product ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064204.1 protein_id gnl|my_center|LOCUS_07110 8275 8871 gene locus_tag LOCUS_07120 8275 8871 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731411.1 protein_id gnl|my_center|LOCUS_07120 10194 8890 gene locus_tag LOCUS_07130 10194 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731315.1 protein_id gnl|my_center|LOCUS_07130 11291 10392 gene locus_tag LOCUS_07140 gene dapA 11291 10392 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJQ1 protein_id gnl|my_center|LOCUS_07140 12404 11301 gene locus_tag LOCUS_07150 12404 11301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820013.1 protein_id gnl|my_center|LOCUS_07150 13605 12442 gene locus_tag LOCUS_07160 13605 12442 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856473.1 protein_id gnl|my_center|LOCUS_07160 14544 13624 gene locus_tag LOCUS_07170 14544 13624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 15333 14560 gene locus_tag LOCUS_07180 15333 14560 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_07180 16523 15333 gene locus_tag LOCUS_07190 gene yjiB 16523 15333 CDS product putative cytochrome P450 YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34374 protein_id gnl|my_center|LOCUS_07190 16134 16224 gene locus_tag LOCUS_t00120 16134 16224 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17678 16602 gene locus_tag LOCUS_07200 17678 16602 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_07200 19050 17761 gene locus_tag LOCUS_07210 19050 17761 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901990.1 protein_id gnl|my_center|LOCUS_07210 19443 19066 gene locus_tag LOCUS_07220 19443 19066 CDS product limonene-1,2-epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920798.1 protein_id gnl|my_center|LOCUS_07220 20029 19460 gene locus_tag LOCUS_07230 20029 19460 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974746.1 protein_id gnl|my_center|LOCUS_07230 20777 20043 gene locus_tag LOCUS_07240 20777 20043 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_07240 <21906 20917 gene locus_tag LOCUS_07250 <21906 20917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083824.1:amidohydrolase >Feature sequence027 1269 1 gene locus_tag LOCUS_07260 1269 1 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_07260 2378 1269 gene locus_tag LOCUS_07270 2378 1269 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 protein_id gnl|my_center|LOCUS_07270 2588 3382 gene locus_tag LOCUS_07280 2588 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 3440 4060 gene locus_tag LOCUS_07290 3440 4060 CDS product RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027940.1 protein_id gnl|my_center|LOCUS_07290 5786 4896 gene locus_tag LOCUS_07300 gene surE 5786 4896 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96112 protein_id gnl|my_center|LOCUS_07300 5892 6410 gene locus_tag LOCUS_07310 gene fur 5892 6410 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_07310 8219 6411 gene locus_tag LOCUS_07320 8219 6411 CDS product putative fatty-acid-CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702084.1 protein_id gnl|my_center|LOCUS_07320 8427 9335 gene locus_tag LOCUS_07330 8427 9335 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968573.1 protein_id gnl|my_center|LOCUS_07330 9404 10414 gene locus_tag LOCUS_07340 9404 10414 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808077.1 protein_id gnl|my_center|LOCUS_07340 11146 10418 gene locus_tag LOCUS_07350 11146 10418 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_07350 12114 11161 gene locus_tag LOCUS_07360 12114 11161 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_07360 12253 12642 gene locus_tag LOCUS_07370 12253 12642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 12653 13471 gene locus_tag LOCUS_07380 12653 13471 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389028.1 protein_id gnl|my_center|LOCUS_07380 13489 13980 gene locus_tag LOCUS_07390 13489 13980 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MIH8 protein_id gnl|my_center|LOCUS_07390 14009 15364 gene locus_tag LOCUS_07400 14009 15364 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_07400 15453 15377 gene locus_tag LOCUS_t00130 15453 15377 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15592 15516 gene locus_tag LOCUS_t00140 15592 15516 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15773 16132 gene locus_tag LOCUS_07410 15773 16132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 17756 16146 gene locus_tag LOCUS_07420 gene pyrG 17756 16146 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY3 protein_id gnl|my_center|LOCUS_07420 18231 17770 gene locus_tag LOCUS_07430 18231 17770 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987100.1 protein_id gnl|my_center|LOCUS_07430 19383 18343 gene locus_tag LOCUS_07440 gene argC 19383 18343 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748X6 protein_id gnl|my_center|LOCUS_07440 19886 19485 gene locus_tag LOCUS_07450 gene rpsI 19886 19485 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728T3 protein_id gnl|my_center|LOCUS_07450 20331 19879 gene locus_tag LOCUS_07460 gene rplM 20331 19879 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY2 protein_id gnl|my_center|LOCUS_07460 21211 20441 gene locus_tag LOCUS_07470 gene truA 21211 20441 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU07 protein_id gnl|my_center|LOCUS_07470 >Feature sequence028 119 775 gene locus_tag LOCUS_07480 gene ccmC 119 775 CDS product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_07480 1222 1719 gene locus_tag LOCUS_07490 1222 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2245 1760 gene locus_tag LOCUS_07500 2245 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3247 2360 gene locus_tag LOCUS_07510 gene hisG 3247 2360 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ68 protein_id gnl|my_center|LOCUS_07510 3673 3257 gene locus_tag LOCUS_07520 3673 3257 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_07520 5608 3686 gene locus_tag LOCUS_07530 gene plsB 5608 3686 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z1T6 protein_id gnl|my_center|LOCUS_07530 7207 6365 gene locus_tag LOCUS_07540 7207 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 7430 7215 gene locus_tag LOCUS_07550 gene madF 7430 7215 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811628.1 protein_id gnl|my_center|LOCUS_07550 7543 9030 gene locus_tag LOCUS_07560 gene ffh 7543 9030 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI83 protein_id gnl|my_center|LOCUS_07560 9165 10832 gene locus_tag LOCUS_07570 9165 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 11889 10864 gene locus_tag LOCUS_07580 gene rlmN 11889 10864 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E53 protein_id gnl|my_center|LOCUS_07580 12530 11886 gene locus_tag LOCUS_07590 12530 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 13422 12592 gene locus_tag LOCUS_07600 13422 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 14578 13403 gene locus_tag LOCUS_07610 14578 13403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 14792 15586 gene locus_tag LOCUS_07620 14792 15586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 16963 15632 gene locus_tag LOCUS_07630 16963 15632 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255954.1 protein_id gnl|my_center|LOCUS_07630 17088 17276 gene locus_tag LOCUS_07640 gene tatA 17088 17276 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM8 protein_id gnl|my_center|LOCUS_07640 17514 18092 gene locus_tag LOCUS_07650 17514 18092 CDS product pesticidal protein Cry15Aa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259126.1 protein_id gnl|my_center|LOCUS_07650 18157 19173 gene locus_tag LOCUS_07660 18157 19173 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545634.1 protein_id gnl|my_center|LOCUS_07660 19460 19942 gene locus_tag LOCUS_07670 gene mraZ 19460 19942 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CSX8 protein_id gnl|my_center|LOCUS_07670 >Feature sequence029 342 1211 gene locus_tag LOCUS_07680 342 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 1233 2123 gene locus_tag LOCUS_07690 1233 2123 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223587.1 protein_id gnl|my_center|LOCUS_07690 2202 3419 gene locus_tag LOCUS_07700 2202 3419 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_07700 3438 4553 gene locus_tag LOCUS_07710 3438 4553 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400502.1 protein_id gnl|my_center|LOCUS_07710 5718 4672 gene locus_tag LOCUS_07720 5718 4672 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_07720 6938 5721 gene locus_tag LOCUS_07730 6938 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 8006 6975 gene locus_tag LOCUS_07740 8006 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 8761 8000 gene locus_tag LOCUS_07750 8761 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 8947 9726 gene locus_tag LOCUS_07760 8947 9726 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972225.1 protein_id gnl|my_center|LOCUS_07760 10201 9761 gene locus_tag LOCUS_07770 10201 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039190.1 protein_id gnl|my_center|LOCUS_07770 10285 11898 gene locus_tag LOCUS_07780 10285 11898 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640335.1 protein_id gnl|my_center|LOCUS_07780 12340 11921 gene locus_tag LOCUS_07790 gene maoC 12340 11921 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 protein_id gnl|my_center|LOCUS_07790 12860 12351 gene locus_tag LOCUS_07800 12860 12351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702790.1 protein_id gnl|my_center|LOCUS_07800 13952 12954 gene locus_tag LOCUS_07810 13952 12954 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_07810 15109 13955 gene locus_tag LOCUS_07820 15109 13955 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_07820 15196 16407 gene locus_tag LOCUS_07830 15196 16407 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403190.1 protein_id gnl|my_center|LOCUS_07830 16723 18366 gene locus_tag LOCUS_07840 16723 18366 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776685.1 protein_id gnl|my_center|LOCUS_07840 18419 19729 gene locus_tag LOCUS_07850 18419 19729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 20572 19736 gene locus_tag LOCUS_07860 20572 19736 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028354.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence030 2990 1308 gene locus_tag LOCUS_07870 2990 1308 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_07870 4202 3009 gene locus_tag LOCUS_07880 gene frc 4202 3009 CDS product formyl-CoA:oxalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D7S7 protein_id gnl|my_center|LOCUS_07880 4730 4362 gene locus_tag LOCUS_07890 4730 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 4813 5718 gene locus_tag LOCUS_07900 4813 5718 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_07900 6962 5715 gene locus_tag LOCUS_07910 6962 5715 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727996.1 protein_id gnl|my_center|LOCUS_07910 8113 6962 gene locus_tag LOCUS_07920 gene acd 8113 6962 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_07920 8335 8260 gene locus_tag LOCUS_t00150 8335 8260 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10804 8348 gene locus_tag LOCUS_07930 gene lon-2 10804 8348 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C84 protein_id gnl|my_center|LOCUS_07930 12077 10830 gene locus_tag LOCUS_07940 gene clpX 12077 10830 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C83 protein_id gnl|my_center|LOCUS_07940 12748 12122 gene locus_tag LOCUS_07950 gene clpP1 12748 12122 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U1 protein_id gnl|my_center|LOCUS_07950 14231 12921 gene locus_tag LOCUS_07960 gene tig 14231 12921 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CNY4 protein_id gnl|my_center|LOCUS_07960 14463 14377 gene locus_tag LOCUS_t00160 14463 14377 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15734 14541 gene locus_tag LOCUS_07970 15734 14541 CDS product pigment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088837.1 protein_id gnl|my_center|LOCUS_07970 15870 15795 gene locus_tag LOCUS_t00170 15870 15795 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 19542 15937 gene locus_tag LOCUS_07980 gene oplaH 19542 15937 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 protein_id gnl|my_center|LOCUS_07980 20483 19527 gene locus_tag LOCUS_07990 20483 19527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence031 2724 1948 gene locus_tag LOCUS_08000 2724 1948 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088800.1 protein_id gnl|my_center|LOCUS_08000 2953 3984 gene locus_tag LOCUS_08010 2953 3984 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729474.1 protein_id gnl|my_center|LOCUS_08010 4011 5081 gene locus_tag LOCUS_08020 4011 5081 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729074.1 protein_id gnl|my_center|LOCUS_08020 5203 6312 gene locus_tag LOCUS_08030 5203 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_08030 6378 6626 gene locus_tag LOCUS_08040 6378 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 6738 7025 gene locus_tag LOCUS_08050 6738 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 7039 7467 gene locus_tag LOCUS_08060 7039 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 7464 7952 gene locus_tag LOCUS_08070 7464 7952 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532155.1 protein_id gnl|my_center|LOCUS_08070 7978 8613 gene locus_tag LOCUS_08080 gene psrA 7978 8613 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072458.1 protein_id gnl|my_center|LOCUS_08080 8610 9845 gene locus_tag LOCUS_08090 8610 9845 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_08090 9842 13030 gene locus_tag LOCUS_08100 9842 13030 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_08100 13395 14678 gene locus_tag LOCUS_08110 13395 14678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 14734 15132 gene locus_tag LOCUS_08120 14734 15132 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227887.1 protein_id gnl|my_center|LOCUS_08120 16288 15167 gene locus_tag LOCUS_08130 16288 15167 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728241.1 protein_id gnl|my_center|LOCUS_08130 16389 16805 gene locus_tag LOCUS_08140 16389 16805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 16833 17039 gene locus_tag LOCUS_08150 16833 17039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 17061 17417 gene locus_tag LOCUS_08160 17061 17417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 17533 17934 gene locus_tag LOCUS_08170 17533 17934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 18240 19136 gene locus_tag LOCUS_08180 18240 19136 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402219.1 protein_id gnl|my_center|LOCUS_08180 19324 19485 gene locus_tag LOCUS_08190 19324 19485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence032 3560 1020 gene locus_tag LOCUS_08200 3560 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 4179 3652 gene locus_tag LOCUS_08210 4179 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 4904 4176 gene locus_tag LOCUS_08220 4904 4176 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707992.1 protein_id gnl|my_center|LOCUS_08220 5506 5114 gene locus_tag LOCUS_08230 5506 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 6698 6892 gene locus_tag LOCUS_08240 6698 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 7929 6847 gene locus_tag LOCUS_08250 7929 6847 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_08250 8149 8799 gene locus_tag LOCUS_08260 8149 8799 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 protein_id gnl|my_center|LOCUS_08260 9376 8828 gene locus_tag LOCUS_08270 9376 8828 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J441 protein_id gnl|my_center|LOCUS_08270 9854 9366 gene locus_tag LOCUS_08280 gene greB 9854 9366 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DW4 protein_id gnl|my_center|LOCUS_08280 10029 12863 gene locus_tag LOCUS_08290 10029 12863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 12860 13408 gene locus_tag LOCUS_08300 12860 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 13422 14879 gene locus_tag LOCUS_08310 13422 14879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 14904 15413 gene locus_tag LOCUS_08320 gene nodN 14904 15413 CDS product nodulation protein NodN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086736.1 protein_id gnl|my_center|LOCUS_08320 16122 15436 gene locus_tag LOCUS_08330 16122 15436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 16223 16148 gene locus_tag LOCUS_t00180 16223 16148 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16746 16276 gene locus_tag LOCUS_08340 gene aroQ 16746 16276 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD27 protein_id gnl|my_center|LOCUS_08340 17922 16831 gene locus_tag LOCUS_08350 gene aroB 17922 16831 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BL6 protein_id gnl|my_center|LOCUS_08350 18410 17919 gene locus_tag LOCUS_08360 gene aroK 18410 17919 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCL0 protein_id gnl|my_center|LOCUS_08360 <19230 18592 gene locus_tag LOCUS_08370 <19230 18592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJM1:riboflavin biosynthesis protein >Feature sequence033 2021 1029 gene locus_tag LOCUS_08380 2021 1029 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2X7 protein_id gnl|my_center|LOCUS_08380 2485 2018 gene locus_tag LOCUS_08390 gene dut 2485 2018 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66592 protein_id gnl|my_center|LOCUS_08390 4681 2495 gene locus_tag LOCUS_08400 gene pnp 4681 2495 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS9 protein_id gnl|my_center|LOCUS_08400 5197 4910 gene locus_tag LOCUS_08410 gene rpsO 5197 4910 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJM0 protein_id gnl|my_center|LOCUS_08410 6294 5365 gene locus_tag LOCUS_08420 gene truB 6294 5365 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60344 protein_id gnl|my_center|LOCUS_08420 6637 6287 gene locus_tag LOCUS_08430 gene rbfA 6637 6287 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_08430 7031 6639 gene locus_tag LOCUS_08440 7031 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 9529 7031 gene locus_tag LOCUS_08450 gene infB 9529 7031 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT3 protein_id gnl|my_center|LOCUS_08450 10854 9544 gene locus_tag LOCUS_08460 gene nusA 10854 9544 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT5 protein_id gnl|my_center|LOCUS_08460 11357 10854 gene locus_tag LOCUS_08470 gene rimP 11357 10854 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y4 protein_id gnl|my_center|LOCUS_08470 12510 11566 gene locus_tag LOCUS_08480 gene pyrD 12510 11566 CDS product dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB9 protein_id gnl|my_center|LOCUS_08480 13328 12510 gene locus_tag LOCUS_08490 gene pyrK 13328 12510 CDS product dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB8 protein_id gnl|my_center|LOCUS_08490 13790 13341 gene locus_tag LOCUS_08500 13790 13341 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W95 protein_id gnl|my_center|LOCUS_08500 15135 13780 gene locus_tag LOCUS_08510 15135 13780 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941477.1 protein_id gnl|my_center|LOCUS_08510 17401 15137 gene locus_tag LOCUS_08520 17401 15137 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_08520 18609 17689 gene locus_tag LOCUS_08530 gene lpxC 18609 17689 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSB1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence034 <1 1280 gene locus_tag LOCUS_08540 <1 1280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775783.1:UTP--glucose-1-phosphate uridylyltransferase 2184 1336 gene locus_tag LOCUS_08550 2184 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_08550 2240 3514 gene locus_tag LOCUS_08560 gene lysA 2240 3514 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPF4 protein_id gnl|my_center|LOCUS_08560 3511 4476 gene locus_tag LOCUS_08570 gene purC 3511 4476 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2E5 protein_id gnl|my_center|LOCUS_08570 4522 5796 gene locus_tag LOCUS_08580 4522 5796 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_08580 5793 6407 gene locus_tag LOCUS_08590 5793 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 6577 6882 gene locus_tag LOCUS_08600 gene rpsN 6577 6882 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU4 protein_id gnl|my_center|LOCUS_08600 6889 7137 gene locus_tag LOCUS_08610 gene rpmE2 6889 7137 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DTN5 protein_id gnl|my_center|LOCUS_08610 7140 7427 gene locus_tag LOCUS_08620 gene rpmB 7140 7427 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCK6 protein_id gnl|my_center|LOCUS_08620 7489 8394 gene locus_tag LOCUS_08630 7489 8394 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_08630 10048 8414 gene locus_tag LOCUS_08640 gene caiA 10048 8414 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_08640 11042 10266 gene locus_tag LOCUS_08650 gene suhB 11042 10266 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222889.1 protein_id gnl|my_center|LOCUS_08650 11289 12260 gene locus_tag LOCUS_08660 11289 12260 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616036.1 protein_id gnl|my_center|LOCUS_08660 12312 13079 gene locus_tag LOCUS_08670 12312 13079 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_08670 13903 13076 gene locus_tag LOCUS_08680 13903 13076 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_08680 14029 16869 gene locus_tag LOCUS_08690 gene uvrA 14029 16869 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7B1 protein_id gnl|my_center|LOCUS_08690 16866 17567 gene locus_tag LOCUS_08700 16866 17567 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103676.1 protein_id gnl|my_center|LOCUS_08700 18748 17564 gene locus_tag LOCUS_08710 18748 17564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence035 676 2583 gene locus_tag LOCUS_08720 gene dnaK 676 2583 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_08720 2765 5179 gene locus_tag LOCUS_08730 gene lon-3 2765 5179 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747S2 protein_id gnl|my_center|LOCUS_08730 5273 6592 gene locus_tag LOCUS_08740 5273 6592 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_08740 6647 7906 gene locus_tag LOCUS_08750 6647 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 7934 8431 gene locus_tag LOCUS_08760 gene hsaB 7934 8431 CDS product flavin-dependent monooxygenase, reductase subunit HsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WND9 protein_id gnl|my_center|LOCUS_08760 8499 9053 gene locus_tag LOCUS_08770 8499 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 10019 9069 gene locus_tag LOCUS_08780 10019 9069 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730384.1 protein_id gnl|my_center|LOCUS_08780 11401 10145 gene locus_tag LOCUS_08790 gene fabF-1 11401 10145 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q820V4 protein_id gnl|my_center|LOCUS_08790 12427 11510 gene locus_tag LOCUS_08800 12427 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200946.1 protein_id gnl|my_center|LOCUS_08800 12485 12398 gene locus_tag LOCUS_t00190 12485 12398 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12928 12533 gene locus_tag LOCUS_08810 12928 12533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 13731 12985 gene locus_tag LOCUS_08820 gene tpiA 13731 12985 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU0 protein_id gnl|my_center|LOCUS_08820 14950 13766 gene locus_tag LOCUS_08830 gene pgk 14950 13766 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU1 protein_id gnl|my_center|LOCUS_08830 15949 14951 gene locus_tag LOCUS_08840 gene gapA 15949 14951 CDS product glyceraldehyde-3-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P09124 protein_id gnl|my_center|LOCUS_08840 >Feature sequence036 492 1352 gene locus_tag LOCUS_08850 gene dapF 492 1352 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL43 protein_id gnl|my_center|LOCUS_08850 1378 2250 gene locus_tag LOCUS_08860 gene dapA 1378 2250 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AX2 protein_id gnl|my_center|LOCUS_08860 2247 3038 gene locus_tag LOCUS_08870 gene dapB 2247 3038 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GT5 protein_id gnl|my_center|LOCUS_08870 4492 3143 gene locus_tag LOCUS_08880 4492 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 5508 4828 gene locus_tag LOCUS_08890 5508 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941153.1 protein_id gnl|my_center|LOCUS_08890 6452 5505 gene locus_tag LOCUS_08900 6452 5505 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_08900 7458 6457 gene locus_tag LOCUS_08910 7458 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 7628 8683 gene locus_tag LOCUS_08920 7628 8683 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967605.1 protein_id gnl|my_center|LOCUS_08920 8783 8708 gene locus_tag LOCUS_t00200 8783 8708 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9484 8894 gene locus_tag LOCUS_08930 9484 8894 CDS product carbohydrate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862016.1 protein_id gnl|my_center|LOCUS_08930 10592 9486 gene locus_tag LOCUS_08940 10592 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 11563 10814 gene locus_tag LOCUS_08950 11563 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 12855 11560 gene locus_tag LOCUS_08960 gene eno 12855 11560 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AR6 protein_id gnl|my_center|LOCUS_08960 14032 12992 gene locus_tag LOCUS_08970 gene ispB 14032 12992 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_08970 15390 14092 gene locus_tag LOCUS_08980 gene radA 15390 14092 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GG1 protein_id gnl|my_center|LOCUS_08980 15629 16702 gene locus_tag LOCUS_08990 gene bioB 15629 16702 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F498 protein_id gnl|my_center|LOCUS_08990 17253 16852 gene locus_tag LOCUS_09000 gene atpC 17253 16852 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E05 protein_id gnl|my_center|LOCUS_09000 <18479 17263 gene locus_tag LOCUS_09010 <18479 17263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GY0:ATP synthase subunit beta >Feature sequence037 824 1822 gene locus_tag LOCUS_09020 824 1822 CDS product tyrosine protein kinase:aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085728.1 protein_id gnl|my_center|LOCUS_09020 1806 2177 gene locus_tag LOCUS_09030 1806 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3183 2179 gene locus_tag LOCUS_09040 3183 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 3984 3196 gene locus_tag LOCUS_09050 3984 3196 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_09050 4848 3988 gene locus_tag LOCUS_09060 4848 3988 CDS product FAA-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529347.1 protein_id gnl|my_center|LOCUS_09060 7028 4860 gene locus_tag LOCUS_09070 7028 4860 CDS product acetone carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650637.1 protein_id gnl|my_center|LOCUS_09070 7654 7073 gene locus_tag LOCUS_09080 7654 7073 CDS product acetone carboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969351.1 protein_id gnl|my_center|LOCUS_09080 9901 7655 gene locus_tag LOCUS_09090 9901 7655 CDS product acetone carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285084.1 protein_id gnl|my_center|LOCUS_09090 10350 10003 gene locus_tag LOCUS_09100 10350 10003 CDS product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708537.1 protein_id gnl|my_center|LOCUS_09100 10427 11077 gene locus_tag LOCUS_09110 gene gph 10427 11077 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XT39 protein_id gnl|my_center|LOCUS_09110 11193 11543 gene locus_tag LOCUS_09120 11193 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 12826 11600 gene locus_tag LOCUS_09130 12826 11600 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089133.1 protein_id gnl|my_center|LOCUS_09130 13563 12904 gene locus_tag LOCUS_09140 13563 12904 CDS product nitrile hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531053.1 protein_id gnl|my_center|LOCUS_09140 14162 13560 gene locus_tag LOCUS_09150 gene nthA 14162 13560 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533852.1 protein_id gnl|my_center|LOCUS_09150 14270 15784 gene locus_tag LOCUS_09160 14270 15784 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083030.1 protein_id gnl|my_center|LOCUS_09160 16830 15799 gene locus_tag LOCUS_09170 16830 15799 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_09170 17330 16902 gene locus_tag LOCUS_09180 17330 16902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence038 351 2576 gene locus_tag LOCUS_09190 351 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 2945 5170 gene locus_tag LOCUS_09200 2945 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 5427 5203 gene locus_tag LOCUS_09210 5427 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 6450 5692 gene locus_tag LOCUS_09220 6450 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 6866 7570 gene locus_tag LOCUS_09230 6866 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 7604 8617 gene locus_tag LOCUS_09240 7604 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 8682 9506 gene locus_tag LOCUS_09250 8682 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 9652 11493 gene locus_tag LOCUS_09260 9652 11493 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007748760.1 protein_id gnl|my_center|LOCUS_09260 12445 11561 gene locus_tag LOCUS_09270 12445 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 13489 12626 gene locus_tag LOCUS_09280 13489 12626 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090614.1 protein_id gnl|my_center|LOCUS_09280 14288 13584 gene locus_tag LOCUS_09290 14288 13584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 14616 15557 gene locus_tag LOCUS_09300 14616 15557 CDS product putative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704295.1 protein_id gnl|my_center|LOCUS_09300 17139 15580 gene locus_tag LOCUS_09310 17139 15580 CDS product 2-keto-gluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090223.1 protein_id gnl|my_center|LOCUS_09310 17681 17166 gene locus_tag LOCUS_09320 17681 17166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531852.1 protein_id gnl|my_center|LOCUS_09320 18029 17760 gene locus_tag LOCUS_09330 18029 17760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence039 1485 268 gene locus_tag LOCUS_09340 1485 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2564 1482 gene locus_tag LOCUS_09350 2564 1482 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_09350 3844 2561 gene locus_tag LOCUS_09360 gene gabT 3844 2561 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_09360 3952 4410 gene locus_tag LOCUS_09370 gene folK 3952 4410 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943608.1 protein_id gnl|my_center|LOCUS_09370 4398 4685 gene locus_tag LOCUS_09380 4398 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868800.1 protein_id gnl|my_center|LOCUS_09380 4768 5547 gene locus_tag LOCUS_09390 4768 5547 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_09390 5570 6109 gene locus_tag LOCUS_09400 5570 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 6134 7162 gene locus_tag LOCUS_09410 6134 7162 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_09410 8117 7164 gene locus_tag LOCUS_09420 8117 7164 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_09420 8429 8626 gene locus_tag LOCUS_09430 8429 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 9696 8671 gene locus_tag LOCUS_09440 9696 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 9889 10506 gene locus_tag LOCUS_09450 9889 10506 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_09450 10641 11627 gene locus_tag LOCUS_09460 10641 11627 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942085.1 protein_id gnl|my_center|LOCUS_09460 12410 11628 gene locus_tag LOCUS_09470 12410 11628 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_09470 12592 15348 gene locus_tag LOCUS_09480 gene acn 12592 15348 CDS product aconitate hydratase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTN7 protein_id gnl|my_center|LOCUS_09480 15394 16380 gene locus_tag LOCUS_09490 15394 16380 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_09490 16314 17330 gene locus_tag LOCUS_09500 16314 17330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 17365 17892 gene locus_tag LOCUS_09510 17365 17892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence040 811 380 gene locus_tag LOCUS_09520 811 380 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479368.1 protein_id gnl|my_center|LOCUS_09520 2263 932 gene locus_tag LOCUS_09530 2263 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3674 2397 gene locus_tag LOCUS_09540 gene luxA2 3674 2397 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090024.1 protein_id gnl|my_center|LOCUS_09540 3786 4211 gene locus_tag LOCUS_09550 3786 4211 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_09550 4274 5539 gene locus_tag LOCUS_09560 4274 5539 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_09560 5536 6117 gene locus_tag LOCUS_09570 5536 6117 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980453.1 protein_id gnl|my_center|LOCUS_09570 7202 6126 gene locus_tag LOCUS_09580 7202 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 7361 8419 gene locus_tag LOCUS_09590 7361 8419 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527983.1 protein_id gnl|my_center|LOCUS_09590 9852 8458 gene locus_tag LOCUS_09600 gene amiD 9852 8458 CDS product putative amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63497 protein_id gnl|my_center|LOCUS_09600 10617 9931 gene locus_tag LOCUS_09610 gene pgsA 10617 9931 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939132.1 protein_id gnl|my_center|LOCUS_09610 10927 12528 gene locus_tag LOCUS_09620 gene nadB 10927 12528 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C48 protein_id gnl|my_center|LOCUS_09620 14082 12577 gene locus_tag LOCUS_09630 gene purF 14082 12577 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN7 protein_id gnl|my_center|LOCUS_09630 16333 14093 gene locus_tag LOCUS_09640 gene purL 16333 14093 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI3 protein_id gnl|my_center|LOCUS_09640 16887 16330 gene locus_tag LOCUS_09650 gene purQ 16887 16330 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL01 protein_id gnl|my_center|LOCUS_09650 17286 17041 gene locus_tag LOCUS_09660 gene purS 17286 17041 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3Y6 protein_id gnl|my_center|LOCUS_09660 >Feature sequence041 839 2569 gene locus_tag LOCUS_09670 839 2569 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_09670 3598 2579 gene locus_tag LOCUS_09680 3598 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 4385 5152 gene locus_tag LOCUS_09690 4385 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 5149 6405 gene locus_tag LOCUS_09700 gene dadA 5149 6405 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89T28 protein_id gnl|my_center|LOCUS_09700 6599 6414 gene locus_tag LOCUS_09710 6599 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 6686 7912 gene locus_tag LOCUS_09720 6686 7912 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726824.1 protein_id gnl|my_center|LOCUS_09720 7909 8256 gene locus_tag LOCUS_09730 7909 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 9365 8265 gene locus_tag LOCUS_09740 9365 8265 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_09740 9950 9393 gene locus_tag LOCUS_09750 9950 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 10796 9960 gene locus_tag LOCUS_09760 10796 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 11643 10804 gene locus_tag LOCUS_09770 gene yvrE 11643 10804 CDS product putative sugar lactone lactonase YvrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34940 protein_id gnl|my_center|LOCUS_09770 12061 11654 gene locus_tag LOCUS_09780 12061 11654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 13600 12116 gene locus_tag LOCUS_09790 13600 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702778.1 protein_id gnl|my_center|LOCUS_09790 13722 14528 gene locus_tag LOCUS_09800 13722 14528 CDS product putative enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704891.1 protein_id gnl|my_center|LOCUS_09800 14541 15983 gene locus_tag LOCUS_09810 14541 15983 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528760.1 protein_id gnl|my_center|LOCUS_09810 16432 15980 gene locus_tag LOCUS_09820 16432 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence042 2082 502 gene locus_tag LOCUS_09830 2082 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2174 3151 gene locus_tag LOCUS_09840 gene hemB 2174 3151 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_09840 3158 3664 gene locus_tag LOCUS_09850 3158 3664 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122012.1 protein_id gnl|my_center|LOCUS_09850 3673 5337 gene locus_tag LOCUS_09860 gene gpmI 3673 5337 CDS product putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59173 protein_id gnl|my_center|LOCUS_09860 5433 6779 gene locus_tag LOCUS_09870 5433 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 6844 7851 gene locus_tag LOCUS_09880 6844 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 9027 7933 gene locus_tag LOCUS_09890 9027 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 12670 9143 gene locus_tag LOCUS_09900 12670 9143 CDS product pyruvate ferredoxin/flavodoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705082.1 protein_id gnl|my_center|LOCUS_09900 14411 12714 gene locus_tag LOCUS_09910 14411 12714 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528676.1 protein_id gnl|my_center|LOCUS_09910 14510 15118 gene locus_tag LOCUS_09920 14510 15118 CDS product SH3 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073548.1 protein_id gnl|my_center|LOCUS_09920 16519 15146 gene locus_tag LOCUS_09930 16519 15146 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015878.1 protein_id gnl|my_center|LOCUS_09930 17388 16525 gene locus_tag LOCUS_09940 gene dhaA 17388 16525 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XB14 protein_id gnl|my_center|LOCUS_09940 >Feature sequence043 <1 635 gene locus_tag LOCUS_09950 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969638.1:BMP family ABC transporter substrate-binding protein 639 2159 gene locus_tag LOCUS_09960 639 2159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381361.1 protein_id gnl|my_center|LOCUS_09960 2159 3196 gene locus_tag LOCUS_09970 2159 3196 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969639.1 protein_id gnl|my_center|LOCUS_09970 3210 4106 gene locus_tag LOCUS_09980 3210 4106 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536791.1 protein_id gnl|my_center|LOCUS_09980 4142 4645 gene locus_tag LOCUS_09990 4142 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 4699 5775 gene locus_tag LOCUS_10000 4699 5775 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085431.1 protein_id gnl|my_center|LOCUS_10000 7829 5772 gene locus_tag LOCUS_10010 7829 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 8097 8834 gene locus_tag LOCUS_10020 gene rph 8097 8834 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28619 protein_id gnl|my_center|LOCUS_10020 8831 9442 gene locus_tag LOCUS_10030 8831 9442 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHP2 protein_id gnl|my_center|LOCUS_10030 10885 9470 gene locus_tag LOCUS_10040 10885 9470 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403891.1 protein_id gnl|my_center|LOCUS_10040 11121 11744 gene locus_tag LOCUS_10050 11121 11744 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888032.1 protein_id gnl|my_center|LOCUS_10050 13432 11768 gene locus_tag LOCUS_10060 gene cstA 13432 11768 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67304 protein_id gnl|my_center|LOCUS_10060 15086 13452 gene locus_tag LOCUS_10070 15086 13452 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142253.1 protein_id gnl|my_center|LOCUS_10070 15279 16271 gene locus_tag LOCUS_10080 15279 16271 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403889.1 protein_id gnl|my_center|LOCUS_10080 16268 17374 gene locus_tag LOCUS_10090 16268 17374 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403887.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence044 321 899 gene locus_tag LOCUS_10100 321 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1387 3207 gene locus_tag LOCUS_10110 gene arc 1387 3207 CDS product proteasome-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ58 protein_id gnl|my_center|LOCUS_10110 3233 4717 gene locus_tag LOCUS_10120 3233 4717 CDS product proteasome accessory factor PafA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_10120 4754 5026 gene locus_tag LOCUS_10130 4754 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 5056 5883 gene locus_tag LOCUS_10140 gene prcB 5056 5883 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKQ5 protein_id gnl|my_center|LOCUS_10140 5913 6611 gene locus_tag LOCUS_10150 gene prcA 5913 6611 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKQ6 protein_id gnl|my_center|LOCUS_10150 6624 8030 gene locus_tag LOCUS_10160 gene pafA 6624 8030 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ61 protein_id gnl|my_center|LOCUS_10160 9278 8262 gene locus_tag LOCUS_10170 gene yceG 9278 8262 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_10170 9729 9304 gene locus_tag LOCUS_10180 9729 9304 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLJ1 protein_id gnl|my_center|LOCUS_10180 9952 10527 gene locus_tag LOCUS_10190 gene pgpA 9952 10527 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74WT5 protein_id gnl|my_center|LOCUS_10190 10524 11819 gene locus_tag LOCUS_10200 10524 11819 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_10200 11926 13029 gene locus_tag LOCUS_10210 gene recA 11926 13029 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62215 protein_id gnl|my_center|LOCUS_10210 13087 15726 gene locus_tag LOCUS_10220 gene alaS 13087 15726 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61701 protein_id gnl|my_center|LOCUS_10220 >Feature sequence045 1860 943 gene locus_tag LOCUS_10230 1860 943 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2V8 protein_id gnl|my_center|LOCUS_10230 2645 1881 gene locus_tag LOCUS_10240 2645 1881 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528547.1 protein_id gnl|my_center|LOCUS_10240 3814 2663 gene locus_tag LOCUS_10250 gene acdA 3814 2663 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770780.1 protein_id gnl|my_center|LOCUS_10250 4265 3828 gene locus_tag LOCUS_10260 4265 3828 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 protein_id gnl|my_center|LOCUS_10260 4479 4793 gene locus_tag LOCUS_10270 4479 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 4795 5244 gene locus_tag LOCUS_10280 4795 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 5323 5874 gene locus_tag LOCUS_10290 5323 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 6792 5896 gene locus_tag LOCUS_10300 6792 5896 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892776.1 protein_id gnl|my_center|LOCUS_10300 7421 6852 gene locus_tag LOCUS_10310 7421 6852 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_10310 8784 7459 gene locus_tag LOCUS_10320 gene murA 8784 7459 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDW1 protein_id gnl|my_center|LOCUS_10320 10143 8923 gene locus_tag LOCUS_10330 10143 8923 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405015.1 protein_id gnl|my_center|LOCUS_10330 10907 10296 gene locus_tag LOCUS_10340 gene ppiA 10907 10296 CDS product peptidyl-prolyl cis-trans isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59641 protein_id gnl|my_center|LOCUS_10340 11056 11973 gene locus_tag LOCUS_10350 11056 11973 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390262.1 protein_id gnl|my_center|LOCUS_10350 12063 13448 gene locus_tag LOCUS_10360 gene asnS 12063 13448 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG51 protein_id gnl|my_center|LOCUS_10360 13515 14570 gene locus_tag LOCUS_10370 gene citE 13515 14570 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222030.1 protein_id gnl|my_center|LOCUS_10370 14582 15235 gene locus_tag LOCUS_10380 14582 15235 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704421.1 protein_id gnl|my_center|LOCUS_10380 15239 15505 gene locus_tag LOCUS_10390 15239 15505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 15899 15489 gene locus_tag LOCUS_10400 15899 15489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 <16776 15896 gene locus_tag LOCUS_10410 <16776 15896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67716:aspartate-semialdehyde dehydrogenase >Feature sequence046 1220 438 gene locus_tag LOCUS_10420 1220 438 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_10420 1414 2205 gene locus_tag LOCUS_10430 gene kdsB 1414 2205 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY2 protein_id gnl|my_center|LOCUS_10430 2375 2154 gene locus_tag LOCUS_10440 2375 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 5044 2372 gene locus_tag LOCUS_10450 gene polA 5044 2372 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34996 protein_id gnl|my_center|LOCUS_10450 6159 5203 gene locus_tag LOCUS_10460 6159 5203 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9T3 protein_id gnl|my_center|LOCUS_10460 7201 6218 gene locus_tag LOCUS_10470 gene truD 7201 6218 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI49 protein_id gnl|my_center|LOCUS_10470 8026 7208 gene locus_tag LOCUS_10480 8026 7208 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813213.1 protein_id gnl|my_center|LOCUS_10480 9070 8030 gene locus_tag LOCUS_10490 gene lpxD 9070 8030 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT5 protein_id gnl|my_center|LOCUS_10490 9891 9070 gene locus_tag LOCUS_10500 9891 9070 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227875.1 protein_id gnl|my_center|LOCUS_10500 11474 9939 gene locus_tag LOCUS_10510 11474 9939 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L239 protein_id gnl|my_center|LOCUS_10510 11991 11560 gene locus_tag LOCUS_10520 11991 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 12166 13167 gene locus_tag LOCUS_10530 12166 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 14685 13180 gene locus_tag LOCUS_10540 14685 13180 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_10540 15515 14685 gene locus_tag LOCUS_10550 gene hemC 15515 14685 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8T5 protein_id gnl|my_center|LOCUS_10550 <16284 15605 gene locus_tag LOCUS_10560 <16284 15605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747I2:glutamyl-tRNA reductase >Feature sequence047 1230 547 gene locus_tag LOCUS_10570 1230 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 2117 1227 gene locus_tag LOCUS_10580 2117 1227 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_10580 2992 2114 gene locus_tag LOCUS_10590 gene folP 2992 2114 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIW4 protein_id gnl|my_center|LOCUS_10590 4908 2992 gene locus_tag LOCUS_10600 gene ftsH-2 4908 2992 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C66 protein_id gnl|my_center|LOCUS_10600 6104 5070 gene locus_tag LOCUS_10610 6104 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 7441 6254 gene locus_tag LOCUS_10620 7441 6254 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064431.1 protein_id gnl|my_center|LOCUS_10620 8398 7526 gene locus_tag LOCUS_10630 8398 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 8619 9458 gene locus_tag LOCUS_10640 8619 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 9524 10528 gene locus_tag LOCUS_10650 9524 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 10638 11306 gene locus_tag LOCUS_10660 10638 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 11337 11413 gene locus_tag LOCUS_t00210 11337 11413 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11511 11978 gene locus_tag LOCUS_10670 11511 11978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 12747 11986 gene locus_tag LOCUS_10680 gene queE 12747 11986 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKG4 protein_id gnl|my_center|LOCUS_10680 15460 12755 gene locus_tag LOCUS_10690 15460 12755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 16111 15611 gene locus_tag LOCUS_10700 16111 15611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence048 1842 1060 gene locus_tag LOCUS_10710 1842 1060 CDS product glycine/betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772946.1 protein_id gnl|my_center|LOCUS_10710 1999 2661 gene locus_tag LOCUS_10720 1999 2661 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083783.1 protein_id gnl|my_center|LOCUS_10720 2719 3480 gene locus_tag LOCUS_10730 2719 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3477 4325 gene locus_tag LOCUS_10740 3477 4325 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_10740 5571 4327 gene locus_tag LOCUS_10750 5571 4327 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_10750 6882 5668 gene locus_tag LOCUS_10760 6882 5668 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088203.1 protein_id gnl|my_center|LOCUS_10760 8403 6934 gene locus_tag LOCUS_10770 8403 6934 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402854.1 protein_id gnl|my_center|LOCUS_10770 8573 9586 gene locus_tag LOCUS_10780 8573 9586 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122352.1 protein_id gnl|my_center|LOCUS_10780 10571 9642 gene locus_tag LOCUS_10790 10571 9642 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_10790 10777 11169 gene locus_tag LOCUS_10800 10777 11169 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968175.1 protein_id gnl|my_center|LOCUS_10800 11885 11238 gene locus_tag LOCUS_10810 11885 11238 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896555.1 protein_id gnl|my_center|LOCUS_10810 12786 11908 gene locus_tag LOCUS_10820 gene lipg 12786 11908 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890781.1 protein_id gnl|my_center|LOCUS_10820 13757 12789 gene locus_tag LOCUS_10830 gene hmd 13757 12789 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225293.1 protein_id gnl|my_center|LOCUS_10830 14723 13791 gene locus_tag LOCUS_10840 gene moaA 14723 13791 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39757 protein_id gnl|my_center|LOCUS_10840 15163 14813 gene locus_tag LOCUS_10850 15163 14813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence049 1593 355 gene locus_tag LOCUS_10860 gene ftsA 1593 355 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E0 protein_id gnl|my_center|LOCUS_10860 2432 1665 gene locus_tag LOCUS_10870 2432 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 3394 2429 gene locus_tag LOCUS_10880 3394 2429 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_10880 4731 3397 gene locus_tag LOCUS_10890 gene murC 4731 3397 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFT3 protein_id gnl|my_center|LOCUS_10890 5930 4812 gene locus_tag LOCUS_10900 gene murG 5930 4812 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW01 protein_id gnl|my_center|LOCUS_10900 7093 5927 gene locus_tag LOCUS_10910 gene ftsW 7093 5927 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545997.1 protein_id gnl|my_center|LOCUS_10910 8400 7093 gene locus_tag LOCUS_10920 gene murD 8400 7093 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D4 protein_id gnl|my_center|LOCUS_10920 9488 8415 gene locus_tag LOCUS_10930 gene mraY 9488 8415 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D3 protein_id gnl|my_center|LOCUS_10930 10971 9556 gene locus_tag LOCUS_10940 gene murF 10971 9556 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7F9Q4 protein_id gnl|my_center|LOCUS_10940 12501 10972 gene locus_tag LOCUS_10950 gene murE 12501 10972 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03523 protein_id gnl|my_center|LOCUS_10950 14351 12501 gene locus_tag LOCUS_10960 gene ftsI 14351 12501 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_10960 14728 14351 gene locus_tag LOCUS_10970 14728 14351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence050 1106 648 gene locus_tag LOCUS_10980 1106 648 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 protein_id gnl|my_center|LOCUS_10980 1830 1099 gene locus_tag LOCUS_10990 1830 1099 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_10990 2825 1827 gene locus_tag LOCUS_11000 2825 1827 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772652.1 protein_id gnl|my_center|LOCUS_11000 3784 2822 gene locus_tag LOCUS_11010 3784 2822 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_11010 4936 4151 gene locus_tag LOCUS_11020 4936 4151 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198379.1 protein_id gnl|my_center|LOCUS_11020 7748 4926 gene locus_tag LOCUS_11030 7748 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 9438 7792 gene locus_tag LOCUS_11040 gene ilvB 9438 7792 CDS product acetolactate synthase I/II/III large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226410.1 protein_id gnl|my_center|LOCUS_11040 10129 9611 gene locus_tag LOCUS_11050 10129 9611 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_11050 11083 10301 gene locus_tag LOCUS_11060 11083 10301 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_11060 11754 11068 gene locus_tag LOCUS_11070 11754 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 11808 13295 gene locus_tag LOCUS_11080 11808 13295 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762723.1 protein_id gnl|my_center|LOCUS_11080 14087 13269 gene locus_tag LOCUS_11090 14087 13269 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083661.1 protein_id gnl|my_center|LOCUS_11090 <14957 14298 gene locus_tag LOCUS_11100 <14957 14298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898564.1:signal peptide peptidase SppA >Feature sequence051 1262 309 gene locus_tag LOCUS_11110 1262 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2035 1271 gene locus_tag LOCUS_11120 2035 1271 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_11120 3396 2044 gene locus_tag LOCUS_11130 3396 2044 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_11130 4700 3441 gene locus_tag LOCUS_11140 gene coaBC 4700 3441 CDS product peptidase ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_11140 5301 4807 gene locus_tag LOCUS_11150 gene coaD 5301 4807 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401377.1 protein_id gnl|my_center|LOCUS_11150 5901 5320 gene locus_tag LOCUS_11160 5901 5320 CDS product methyltransferase small inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_11160 6048 6287 gene locus_tag LOCUS_11170 6048 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 7693 6290 gene locus_tag LOCUS_11180 gene dacC 7693 6290 CDS product D-alanyl-D-alanine carboxypeptidase DacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39844 protein_id gnl|my_center|LOCUS_11180 7846 9159 gene locus_tag LOCUS_11190 7846 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 9156 10160 gene locus_tag LOCUS_11200 9156 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 10166 11158 gene locus_tag LOCUS_11210 10166 11158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 11151 11888 gene locus_tag LOCUS_11220 11151 11888 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_11220 13040 11871 gene locus_tag LOCUS_11230 gene anmK 13040 11871 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EX9 protein_id gnl|my_center|LOCUS_11230 13188 13445 gene locus_tag LOCUS_11240 13188 13445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence052 267 2297 gene locus_tag LOCUS_11250 gene hppA 267 2297 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747H5 protein_id gnl|my_center|LOCUS_11250 2465 2788 gene locus_tag LOCUS_11260 2465 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11260 2785 3102 gene locus_tag LOCUS_11270 2785 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11270 3102 4421 gene locus_tag LOCUS_11280 3102 4421 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIE4 protein_id gnl|my_center|LOCUS_11280 4424 5782 gene locus_tag LOCUS_11290 4424 5782 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257816.1 protein_id gnl|my_center|LOCUS_11290 5795 6388 gene locus_tag LOCUS_11300 gene ribE 5795 6388 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_687762.2 protein_id gnl|my_center|LOCUS_11300 6807 7202 gene locus_tag LOCUS_11310 6807 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 7921 7271 gene locus_tag LOCUS_11320 7921 7271 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_11320 9150 8080 gene locus_tag LOCUS_11330 9150 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 9327 10169 gene locus_tag LOCUS_11340 gene fabG 9327 10169 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324898.1 protein_id gnl|my_center|LOCUS_11340 10333 11382 gene locus_tag LOCUS_11350 10333 11382 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729074.1 protein_id gnl|my_center|LOCUS_11350 12822 11392 gene locus_tag LOCUS_11360 12822 11392 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJA6 protein_id gnl|my_center|LOCUS_11360 13149 12985 gene locus_tag LOCUS_11370 13149 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 13243 13476 gene locus_tag LOCUS_11380 13243 13476 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DU1 protein_id gnl|my_center|LOCUS_11380 14251 14444 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aagaaggcgacacgcaagaaggc >Feature sequence053 392 1477 gene locus_tag LOCUS_11390 392 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 2827 1814 gene locus_tag LOCUS_11400 2827 1814 CDS product putative aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704365.1 protein_id gnl|my_center|LOCUS_11400 3207 2824 gene locus_tag LOCUS_11410 3207 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 3383 4183 gene locus_tag LOCUS_11420 3383 4183 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807958.1 protein_id gnl|my_center|LOCUS_11420 5635 4205 gene locus_tag LOCUS_11430 gene pyk 5635 4205 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180P2 protein_id gnl|my_center|LOCUS_11430 6113 5769 gene locus_tag LOCUS_11440 6113 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895682.1 protein_id gnl|my_center|LOCUS_11440 6600 6193 gene locus_tag LOCUS_11450 6600 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930086.1 protein_id gnl|my_center|LOCUS_11450 7766 6597 gene locus_tag LOCUS_11460 7766 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813480.1 protein_id gnl|my_center|LOCUS_11460 8580 7780 gene locus_tag LOCUS_11470 8580 7780 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_11470 8993 8604 gene locus_tag LOCUS_11480 8993 8604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 9519 9013 gene locus_tag LOCUS_11490 9519 9013 CDS product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090633.1 protein_id gnl|my_center|LOCUS_11490 10584 9577 gene locus_tag LOCUS_11500 10584 9577 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_11500 11123 10632 gene locus_tag LOCUS_11510 gene cdhB 11123 10632 CDS product carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114441.1 protein_id gnl|my_center|LOCUS_11510 12352 11120 gene locus_tag LOCUS_11520 12352 11120 CDS product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701953.1 protein_id gnl|my_center|LOCUS_11520 12517 14313 gene locus_tag LOCUS_11530 12517 14313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence054 1311 1724 gene locus_tag LOCUS_11540 1311 1724 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203152.1 protein_id gnl|my_center|LOCUS_11540 1721 2653 gene locus_tag LOCUS_11550 1721 2653 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897127.1 protein_id gnl|my_center|LOCUS_11550 2656 4875 gene locus_tag LOCUS_11560 2656 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 4938 5798 gene locus_tag LOCUS_11570 gene paaH 4938 5798 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230733.1 protein_id gnl|my_center|LOCUS_11570 5812 7074 gene locus_tag LOCUS_11580 gene serS 5812 7074 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KB2 protein_id gnl|my_center|LOCUS_11580 7067 8998 gene locus_tag LOCUS_11590 gene selB 7067 8998 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_11590 9065 10069 gene locus_tag LOCUS_11600 gene gpsA 9065 10069 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61740 protein_id gnl|my_center|LOCUS_11600 10178 10438 gene locus_tag LOCUS_11610 10178 10438 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252982.1 protein_id gnl|my_center|LOCUS_11610 10482 12371 gene locus_tag LOCUS_11620 10482 12371 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089263.1 protein_id gnl|my_center|LOCUS_11620 12421 13215 gene locus_tag LOCUS_11630 12421 13215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 13740 13237 gene locus_tag LOCUS_11640 13740 13237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence055 293 2653 gene locus_tag LOCUS_11650 293 2653 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_11650 3457 2627 gene locus_tag LOCUS_11660 gene lipL 3457 2627 CDS product octanoyl-[GcvH]:protein N-octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39648 protein_id gnl|my_center|LOCUS_11660 4663 3485 gene locus_tag LOCUS_11670 4663 3485 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_11670 4775 5110 gene locus_tag LOCUS_11680 4775 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 5218 6474 gene locus_tag LOCUS_11690 gene hcaE 5218 6474 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808134.1 protein_id gnl|my_center|LOCUS_11690 6471 6965 gene locus_tag LOCUS_11700 6471 6965 CDS product hypothetical biphenyl dioxygenase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705092.1 protein_id gnl|my_center|LOCUS_11700 6978 7781 gene locus_tag LOCUS_11710 6978 7781 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_11710 7778 8806 gene locus_tag LOCUS_11720 7778 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 8803 9783 gene locus_tag LOCUS_11730 8803 9783 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947905.1 protein_id gnl|my_center|LOCUS_11730 10953 9802 gene locus_tag LOCUS_11740 10953 9802 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_11740 12158 10950 gene locus_tag LOCUS_11750 12158 10950 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_11750 12255 12464 gene locus_tag LOCUS_11760 12255 12464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 12464 13387 gene locus_tag LOCUS_11770 12464 13387 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730159.1 protein_id gnl|my_center|LOCUS_11770 13441 14010 gene locus_tag LOCUS_11780 13441 14010 CDS product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730127.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence056 146 1726 gene locus_tag LOCUS_11790 146 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030958.1 protein_id gnl|my_center|LOCUS_11790 2979 1732 gene locus_tag LOCUS_11800 2979 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_11800 3383 3673 gene locus_tag LOCUS_11810 gene tatB 3383 3673 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H70 protein_id gnl|my_center|LOCUS_11810 3762 4499 gene locus_tag LOCUS_11820 gene tatC 3762 4499 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D88 protein_id gnl|my_center|LOCUS_11820 5070 4561 gene locus_tag LOCUS_11830 5070 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 6593 5067 gene locus_tag LOCUS_11840 6593 5067 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_11840 8152 6602 gene locus_tag LOCUS_11850 8152 6602 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_11850 9534 8395 gene locus_tag LOCUS_11860 gene caiA 9534 8395 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215329.1 protein_id gnl|my_center|LOCUS_11860 10570 9767 gene locus_tag LOCUS_11870 10570 9767 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_11870 11292 10645 gene locus_tag LOCUS_11880 gene tal 11292 10645 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66520 protein_id gnl|my_center|LOCUS_11880 11942 11442 gene locus_tag LOCUS_11890 gene lspA 11942 11442 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Y0 protein_id gnl|my_center|LOCUS_11890 12536 11982 gene locus_tag LOCUS_11900 12536 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 <13950 12526 gene locus_tag LOCUS_11910 <13950 12526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZY72:penicillin-binding protein 1B >Feature sequence057 2531 1296 gene locus_tag LOCUS_11920 gene dinB 2531 1296 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USY7 protein_id gnl|my_center|LOCUS_11920 2585 4405 gene locus_tag LOCUS_11930 gene pepF 2585 4405 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_11930 4405 4860 gene locus_tag LOCUS_11940 4405 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 4967 8113 gene locus_tag LOCUS_11950 gene dnaE2 4967 8113 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTG0 protein_id gnl|my_center|LOCUS_11950 9204 8119 gene locus_tag LOCUS_11960 9204 8119 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088315.1 protein_id gnl|my_center|LOCUS_11960 9439 10617 gene locus_tag LOCUS_11970 9439 10617 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_11970 12629 10614 gene locus_tag LOCUS_11980 gene tkt 12629 10614 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746U5 protein_id gnl|my_center|LOCUS_11980 12924 12848 gene locus_tag LOCUS_t00220 12924 12848 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13640 12972 gene locus_tag LOCUS_11990 13640 12972 CDS product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057873.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence058 <1 783 gene locus_tag LOCUS_12000 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67572:tetraacyldisaccharide 4'-kinase 2706 1567 gene locus_tag LOCUS_12010 gene lptF 2706 1567 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_12010 3366 3845 gene locus_tag LOCUS_12020 3366 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 4081 4929 gene locus_tag LOCUS_12030 4081 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4926 6041 gene locus_tag LOCUS_12040 4926 6041 CDS product nucleoside-diphosphate-sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_12040 6041 7072 gene locus_tag LOCUS_12050 gene rfaE 6041 7072 CDS product RfaE bifunctional protein, domain I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_12050 7069 7953 gene locus_tag LOCUS_12060 7069 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_12060 7950 8252 gene locus_tag LOCUS_12070 7950 8252 CDS product UPF0296 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X216 protein_id gnl|my_center|LOCUS_12070 8255 8863 gene locus_tag LOCUS_12080 gene gmk 8255 8863 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F775 protein_id gnl|my_center|LOCUS_12080 8942 11110 gene locus_tag LOCUS_12090 gene relA 8942 11110 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_12090 11107 11883 gene locus_tag LOCUS_12100 11107 11883 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_12100 11918 13051 gene locus_tag LOCUS_12110 11918 13051 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 protein_id gnl|my_center|LOCUS_12110 <13674 13048 gene locus_tag LOCUS_12120 <13674 13048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709957.1:ABC transporter ATP-binding protein >Feature sequence059 1415 1741 gene locus_tag LOCUS_12130 1415 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2599 1781 gene locus_tag LOCUS_12140 2599 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 2797 4401 gene locus_tag LOCUS_12150 gene leuA 2797 4401 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169689.1 protein_id gnl|my_center|LOCUS_12150 4414 5397 gene locus_tag LOCUS_12160 4414 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 5378 7654 gene locus_tag LOCUS_12170 5378 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 8777 7659 gene locus_tag LOCUS_12180 8777 7659 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81GB2 protein_id gnl|my_center|LOCUS_12180 10168 8924 gene locus_tag LOCUS_12190 10168 8924 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257030.1 protein_id gnl|my_center|LOCUS_12190 11601 10165 gene locus_tag LOCUS_12200 11601 10165 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257998.1 protein_id gnl|my_center|LOCUS_12200 12688 11615 gene locus_tag LOCUS_12210 12688 11615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence060 984 199 gene locus_tag LOCUS_12220 984 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1034 1738 gene locus_tag LOCUS_12230 1034 1738 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063978.1 protein_id gnl|my_center|LOCUS_12230 2736 2002 gene locus_tag LOCUS_12240 2736 2002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_12240 3424 2729 gene locus_tag LOCUS_12250 3424 2729 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970365.1 protein_id gnl|my_center|LOCUS_12250 3783 3424 gene locus_tag LOCUS_12260 3783 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3933 4667 gene locus_tag LOCUS_12270 3933 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 4677 6317 gene locus_tag LOCUS_12280 4677 6317 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729261.1 protein_id gnl|my_center|LOCUS_12280 6330 7151 gene locus_tag LOCUS_12290 gene crt 6330 7151 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52046 protein_id gnl|my_center|LOCUS_12290 7167 8141 gene locus_tag LOCUS_12300 7167 8141 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545846.1 protein_id gnl|my_center|LOCUS_12300 9614 8196 gene locus_tag LOCUS_12310 9614 8196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 9895 10971 gene locus_tag LOCUS_12320 9895 10971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 11634 11023 gene locus_tag LOCUS_12330 gene leuD 11634 11023 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_12330 13038 11635 gene locus_tag LOCUS_12340 gene leuC 13038 11635 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKF0 protein_id gnl|my_center|LOCUS_12340 >Feature sequence061 154 654 gene locus_tag LOCUS_12350 154 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 716 2473 gene locus_tag LOCUS_12360 716 2473 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895174.1 protein_id gnl|my_center|LOCUS_12360 2477 3268 gene locus_tag LOCUS_12370 2477 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 4395 3265 gene locus_tag LOCUS_12380 4395 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 5265 4492 gene locus_tag LOCUS_12390 5265 4492 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730152.1 protein_id gnl|my_center|LOCUS_12390 6334 5303 gene locus_tag LOCUS_12400 6334 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 7219 6359 gene locus_tag LOCUS_12410 7219 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 8065 7220 gene locus_tag LOCUS_12420 8065 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 8651 8160 gene locus_tag LOCUS_12430 8651 8160 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_12430 8812 10092 gene locus_tag LOCUS_12440 gene rimO 8812 10092 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747R0 protein_id gnl|my_center|LOCUS_12440 10592 10152 gene locus_tag LOCUS_12450 10592 10152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 11392 10745 gene locus_tag LOCUS_12460 gene rplC 11392 10745 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH66 protein_id gnl|my_center|LOCUS_12460 >Feature sequence062 1700 3052 gene locus_tag LOCUS_12470 gene miaB 1700 3052 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B44 protein_id gnl|my_center|LOCUS_12470 3234 4697 gene locus_tag LOCUS_12480 gene guaB 3234 4697 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B47 protein_id gnl|my_center|LOCUS_12480 4749 6320 gene locus_tag LOCUS_12490 gene guaA 4749 6320 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHY9 protein_id gnl|my_center|LOCUS_12490 6328 6843 gene locus_tag LOCUS_12500 6328 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 6994 10389 gene locus_tag LOCUS_12510 gene dnaE 6994 10389 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB6 protein_id gnl|my_center|LOCUS_12510 10386 11129 gene locus_tag LOCUS_12520 10386 11129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 11177 11252 gene locus_tag LOCUS_t00230 11177 11252 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence063 1881 2531 gene locus_tag LOCUS_12530 1881 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3140 2568 gene locus_tag LOCUS_12540 3140 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 3981 3130 gene locus_tag LOCUS_12550 3981 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420817.1 protein_id gnl|my_center|LOCUS_12550 5268 4036 gene locus_tag LOCUS_12560 5268 4036 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_12560 5538 6401 gene locus_tag LOCUS_12570 5538 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 6637 6404 gene locus_tag LOCUS_12580 6637 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 7064 6699 gene locus_tag LOCUS_12590 gene frdD 7064 6699 CDS product fumarate reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIQ0 protein_id gnl|my_center|LOCUS_12590 8333 7587 gene locus_tag LOCUS_12600 8333 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 10051 8333 gene locus_tag LOCUS_12610 gene frdA 10051 8333 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN91 protein_id gnl|my_center|LOCUS_12610 11161 10238 gene locus_tag LOCUS_12620 11161 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 12186 11320 gene locus_tag LOCUS_12630 12186 11320 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence064 <1 632 gene locus_tag LOCUS_12640 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071990.1:MexH family multidrug efflux RND transporter periplasmic adaptor subunit 673 3720 gene locus_tag LOCUS_12650 673 3720 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814731.1 protein_id gnl|my_center|LOCUS_12650 3767 4549 gene locus_tag LOCUS_12660 gene uppP4 3767 4549 CDS product undecaprenyl-diphosphatase 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI21 protein_id gnl|my_center|LOCUS_12660 6055 4559 gene locus_tag LOCUS_12670 gene rpoD 6055 4559 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B8 protein_id gnl|my_center|LOCUS_12670 8242 6479 gene locus_tag LOCUS_12680 8242 6479 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403360.1 protein_id gnl|my_center|LOCUS_12680 8455 9477 gene locus_tag LOCUS_12690 8455 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 10042 11040 gene locus_tag LOCUS_12700 10042 11040 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_12700 11136 11573 gene locus_tag LOCUS_12710 gene ndk 11136 11573 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_12710 13059 11656 gene locus_tag LOCUS_12720 gene ftsZ 13059 11656 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4W6 protein_id gnl|my_center|LOCUS_12720 >Feature sequence065 2988 520 gene locus_tag LOCUS_12730 gene gyrA 2988 520 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H88 protein_id gnl|my_center|LOCUS_12730 5472 3043 gene locus_tag LOCUS_12740 gene gyrB 5472 3043 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H89 protein_id gnl|my_center|LOCUS_12740 6857 5730 gene locus_tag LOCUS_12750 gene dnaN 6857 5730 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H91 protein_id gnl|my_center|LOCUS_12750 7307 7639 gene locus_tag LOCUS_12760 gene rnpA 7307 7639 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25814 protein_id gnl|my_center|LOCUS_12760 7890 9557 gene locus_tag LOCUS_12770 gene yidC 7890 9557 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D53 protein_id gnl|my_center|LOCUS_12770 9574 10386 gene locus_tag LOCUS_12780 9574 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 10442 11089 gene locus_tag LOCUS_12790 gene rsmG 10442 11089 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CMN7 protein_id gnl|my_center|LOCUS_12790 11164 12057 gene locus_tag LOCUS_12800 11164 12057 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence066 647 1156 gene locus_tag LOCUS_12810 647 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1279 1767 gene locus_tag LOCUS_12820 gene msrA 1279 1767 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_12820 1900 2529 gene locus_tag LOCUS_12830 1900 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088432.1 protein_id gnl|my_center|LOCUS_12830 2519 3133 gene locus_tag LOCUS_12840 2519 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088431.1 protein_id gnl|my_center|LOCUS_12840 3130 3699 gene locus_tag LOCUS_12850 3130 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 5047 3770 gene locus_tag LOCUS_12860 5047 3770 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225119.1 protein_id gnl|my_center|LOCUS_12860 5857 5060 gene locus_tag LOCUS_12870 5857 5060 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084218.1 protein_id gnl|my_center|LOCUS_12870 6287 6697 gene locus_tag LOCUS_12880 6287 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 7786 6767 gene locus_tag LOCUS_12890 gene ywcH 7786 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39606 protein_id gnl|my_center|LOCUS_12890 8733 7876 gene locus_tag LOCUS_12900 gene tfdA 8733 7876 CDS product alpha-ketoglutarate-dependent 2,4-dichlorophenoxyacetate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084309.1 protein_id gnl|my_center|LOCUS_12900 8846 9637 gene locus_tag LOCUS_12910 8846 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 9659 10021 gene locus_tag LOCUS_12920 9659 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 10842 10030 gene locus_tag LOCUS_12930 10842 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence067 <1 723 gene locus_tag LOCUS_12940 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401012.1:3-alpha-hydroxysteroid dehydrogenase 822 1067 gene locus_tag LOCUS_12950 822 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1086 1406 gene locus_tag LOCUS_12960 1086 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1466 2383 gene locus_tag LOCUS_12970 1466 2383 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391941.1 protein_id gnl|my_center|LOCUS_12970 3326 2412 gene locus_tag LOCUS_12980 3326 2412 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_12980 3408 4259 gene locus_tag LOCUS_12990 3408 4259 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226695.1 protein_id gnl|my_center|LOCUS_12990 4786 4256 gene locus_tag LOCUS_13000 4786 4256 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089163.1 protein_id gnl|my_center|LOCUS_13000 4857 5312 gene locus_tag LOCUS_13010 4857 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 5920 5384 gene locus_tag LOCUS_13020 5920 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 6429 6022 gene locus_tag LOCUS_13030 6429 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 7809 6595 gene locus_tag LOCUS_13040 7809 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 8620 7868 gene locus_tag LOCUS_13050 8620 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 9514 8723 gene locus_tag LOCUS_13060 9514 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 9731 10276 gene locus_tag LOCUS_13070 9731 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531852.1 protein_id gnl|my_center|LOCUS_13070 10286 11851 gene locus_tag LOCUS_13080 10286 11851 CDS product 2-keto-gluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090223.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence068 <1 1155 gene locus_tag LOCUS_13090 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020683.1:pyridoxal phosphate-dependent aminotransferase 1152 1760 gene locus_tag LOCUS_13100 gene engB 1152 1760 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180E5 protein_id gnl|my_center|LOCUS_13100 2512 1757 gene locus_tag LOCUS_13110 2512 1757 CDS product F420-0--gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_13110 3156 2509 gene locus_tag LOCUS_13120 3156 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 4135 3185 gene locus_tag LOCUS_13130 4135 3185 CDS product LPPG--FO 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_13130 4681 4142 gene locus_tag LOCUS_13140 4681 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 5613 4870 gene locus_tag LOCUS_13150 5613 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 5871 7229 gene locus_tag LOCUS_13160 gene ctpA-2 5871 7229 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_13160 7276 8517 gene locus_tag LOCUS_13170 gene xseA 7276 8517 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C85 protein_id gnl|my_center|LOCUS_13170 8555 8848 gene locus_tag LOCUS_13180 gene xseB 8555 8848 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNR4 protein_id gnl|my_center|LOCUS_13180 8954 9802 gene locus_tag LOCUS_13190 8954 9802 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_13190 9825 11726 gene locus_tag LOCUS_13200 gene dxs1 9825 11726 CDS product 1-deoxy-D-xylulose-5-phosphate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FC3 protein_id gnl|my_center|LOCUS_13200 11752 12489 gene locus_tag LOCUS_13210 11752 12489 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence069 2 250 gene locus_tag LOCUS_13220 2 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 264 1613 gene locus_tag LOCUS_13230 gene hslU 264 1613 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72C17 protein_id gnl|my_center|LOCUS_13230 1643 2497 gene locus_tag LOCUS_13240 gene argB 1643 2497 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL8 protein_id gnl|my_center|LOCUS_13240 2501 3418 gene locus_tag LOCUS_13250 gene arcB 2501 3418 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB17 protein_id gnl|my_center|LOCUS_13250 3504 4460 gene locus_tag LOCUS_13260 gene aes 3504 4460 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_13260 5529 4462 gene locus_tag LOCUS_13270 5529 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 6242 5574 gene locus_tag LOCUS_13280 6242 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 7056 6304 gene locus_tag LOCUS_13290 gene fabG 7056 6304 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546317.1 protein_id gnl|my_center|LOCUS_13290 7202 8515 gene locus_tag LOCUS_13300 gene abc1 7202 8515 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339198.1 protein_id gnl|my_center|LOCUS_13300 8664 9785 gene locus_tag LOCUS_13310 8664 9785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089165.1 protein_id gnl|my_center|LOCUS_13310 9928 11781 gene locus_tag LOCUS_13320 9928 11781 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_13320 <12403 11783 gene locus_tag LOCUS_13330 <12403 11783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481838.1:isocitrate dehydrogenase, NADP-dependent >Feature sequence070 1161 181 gene locus_tag LOCUS_13340 1161 181 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_13340 3296 1158 gene locus_tag LOCUS_13350 3296 1158 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_13350 6747 3328 gene locus_tag LOCUS_13360 gene icmF 6747 3328 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F222 protein_id gnl|my_center|LOCUS_13360 7835 6954 gene locus_tag LOCUS_13370 gene era 7835 6954 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818G1 protein_id gnl|my_center|LOCUS_13370 8515 7832 gene locus_tag LOCUS_13380 8515 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 9570 8512 gene locus_tag LOCUS_13390 gene mnmA 9570 8512 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A22 protein_id gnl|my_center|LOCUS_13390 10715 9567 gene locus_tag LOCUS_13400 10715 9567 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_13400 12030 10789 gene locus_tag LOCUS_13410 12030 10789 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C75 protein_id gnl|my_center|LOCUS_13410 >Feature sequence071 2574 2092 gene locus_tag LOCUS_13420 2574 2092 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_13420 3380 2571 gene locus_tag LOCUS_13430 3380 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3438 3812 gene locus_tag LOCUS_13440 3438 3812 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525071.1 protein_id gnl|my_center|LOCUS_13440 4155 3865 gene locus_tag LOCUS_13450 4155 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762682.1 protein_id gnl|my_center|LOCUS_13450 5362 4265 gene locus_tag LOCUS_13460 5362 4265 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730665.1 protein_id gnl|my_center|LOCUS_13460 5550 7265 gene locus_tag LOCUS_13470 5550 7265 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_13470 7262 8113 gene locus_tag LOCUS_13480 gene ssuD 7262 8113 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225079.1 protein_id gnl|my_center|LOCUS_13480 8688 8137 gene locus_tag LOCUS_13490 8688 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268111.1 protein_id gnl|my_center|LOCUS_13490 8815 10095 gene locus_tag LOCUS_13500 gene gudP 8815 10095 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088610.1 protein_id gnl|my_center|LOCUS_13500 10266 10715 gene locus_tag LOCUS_13510 10266 10715 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence072 5461 3602 gene locus_tag LOCUS_13520 5461 3602 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_13520 7253 5454 gene locus_tag LOCUS_13530 7253 5454 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_13530 8007 7294 gene locus_tag LOCUS_13540 8007 7294 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_13540 8116 9180 gene locus_tag LOCUS_13550 gene purM 8116 9180 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB6 protein_id gnl|my_center|LOCUS_13550 9235 10617 gene locus_tag LOCUS_13560 9235 10617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence073 36 920 gene locus_tag LOCUS_13570 36 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 987 2708 gene locus_tag LOCUS_13580 987 2708 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_13580 2761 3654 gene locus_tag LOCUS_13590 2761 3654 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_13590 3988 3656 gene locus_tag LOCUS_13600 3988 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 5191 3992 gene locus_tag LOCUS_13610 5191 3992 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896238.1 protein_id gnl|my_center|LOCUS_13610 6958 5282 gene locus_tag LOCUS_13620 6958 5282 CDS product steroid monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228901.1 protein_id gnl|my_center|LOCUS_13620 8160 7090 gene locus_tag LOCUS_13630 8160 7090 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729074.1 protein_id gnl|my_center|LOCUS_13630 8601 8525 gene locus_tag LOCUS_t00240 8601 8525 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8752 9999 gene locus_tag LOCUS_13640 8752 9999 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084676.1 protein_id gnl|my_center|LOCUS_13640 10733 9993 gene locus_tag LOCUS_13650 10733 9993 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_13650 <11992 10726 gene locus_tag LOCUS_13660 <11992 10726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195457.1:3-phenylpropionate dioxygenase >Feature sequence074 993 343 gene locus_tag LOCUS_13670 993 343 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531972.1 protein_id gnl|my_center|LOCUS_13670 1078 1734 gene locus_tag LOCUS_13680 1078 1734 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186572.1 protein_id gnl|my_center|LOCUS_13680 1734 2393 gene locus_tag LOCUS_13690 1734 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3453 2410 gene locus_tag LOCUS_13700 3453 2410 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 protein_id gnl|my_center|LOCUS_13700 4329 3544 gene locus_tag LOCUS_13710 4329 3544 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090089.1 protein_id gnl|my_center|LOCUS_13710 4831 4316 gene locus_tag LOCUS_13720 4831 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 6712 5084 gene locus_tag LOCUS_13730 6712 5084 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089722.1 protein_id gnl|my_center|LOCUS_13730 7467 6766 gene locus_tag LOCUS_13740 7467 6766 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727608.1 protein_id gnl|my_center|LOCUS_13740 8955 7486 gene locus_tag LOCUS_13750 8955 7486 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730494.1 protein_id gnl|my_center|LOCUS_13750 9012 9743 gene locus_tag LOCUS_13760 9012 9743 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941604.1 protein_id gnl|my_center|LOCUS_13760 10587 9727 gene locus_tag LOCUS_13770 10587 9727 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence075 759 157 gene locus_tag LOCUS_13780 gene rpsD 759 157 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXP5 protein_id gnl|my_center|LOCUS_13780 870 1469 gene locus_tag LOCUS_13790 gene pyrE 870 1469 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYX5 protein_id gnl|my_center|LOCUS_13790 1563 1805 gene locus_tag LOCUS_13800 1563 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1968 2759 gene locus_tag LOCUS_13810 1968 2759 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255957.1 protein_id gnl|my_center|LOCUS_13810 3627 2749 gene locus_tag LOCUS_13820 3627 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4444 3635 gene locus_tag LOCUS_13830 4444 3635 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249636.1 protein_id gnl|my_center|LOCUS_13830 6131 5208 gene locus_tag LOCUS_13840 6131 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727361.1 protein_id gnl|my_center|LOCUS_13840 6604 6128 gene locus_tag LOCUS_13850 6604 6128 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460247.1 protein_id gnl|my_center|LOCUS_13850 6716 7366 gene locus_tag LOCUS_13860 6716 7366 CDS product alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022560.1 protein_id gnl|my_center|LOCUS_13860 9882 7438 gene locus_tag LOCUS_13870 gene mrcA 9882 7438 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_13870 10111 11055 gene locus_tag LOCUS_13880 gene gshB 10111 11055 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5H2 protein_id gnl|my_center|LOCUS_13880 11058 11216 gene locus_tag LOCUS_13890 11058 11216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence076 513 28 gene locus_tag LOCUS_13900 513 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 984 559 gene locus_tag LOCUS_13910 984 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1143 1436 gene locus_tag LOCUS_13920 1143 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1448 2029 gene locus_tag LOCUS_13930 1448 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_13930 2504 2097 gene locus_tag LOCUS_13940 2504 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13940 2714 2553 gene locus_tag LOCUS_13950 2714 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13950 3288 2992 gene locus_tag LOCUS_13960 3288 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 3525 4154 gene locus_tag LOCUS_13970 3525 4154 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969753.1 protein_id gnl|my_center|LOCUS_13970 4760 4326 gene locus_tag LOCUS_13980 4760 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529227.1 protein_id gnl|my_center|LOCUS_13980 4862 5287 gene locus_tag LOCUS_13990 4862 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 5328 6539 gene locus_tag LOCUS_14000 5328 6539 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089997.1 protein_id gnl|my_center|LOCUS_14000 6616 6969 gene locus_tag LOCUS_14010 6616 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 7132 8427 gene locus_tag LOCUS_14020 7132 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 8789 8424 gene locus_tag LOCUS_14030 8789 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 9002 9382 gene locus_tag LOCUS_14040 9002 9382 CDS product endoribonuclease L-PSP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174212.1 protein_id gnl|my_center|LOCUS_14040 9426 10193 gene locus_tag LOCUS_14050 9426 10193 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084226.1 protein_id gnl|my_center|LOCUS_14050 11475 10378 gene locus_tag LOCUS_14060 11475 10378 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence077 <1 510 gene locus_tag LOCUS_14070 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707486.1:beta-aryl ether-cleaving enzyme 1484 519 gene locus_tag LOCUS_14080 1484 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 2760 1540 gene locus_tag LOCUS_14090 2760 1540 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_14090 3145 4101 gene locus_tag LOCUS_14100 3145 4101 CDS product luciferase-like hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701714.1 protein_id gnl|my_center|LOCUS_14100 4245 5096 gene locus_tag LOCUS_14110 4245 5096 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416061.1 protein_id gnl|my_center|LOCUS_14110 6598 5141 gene locus_tag LOCUS_14120 6598 5141 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_14120 6672 7754 gene locus_tag LOCUS_14130 6672 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 7791 8315 gene locus_tag LOCUS_14140 7791 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 9430 8612 gene locus_tag LOCUS_14150 9430 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 9916 9491 gene locus_tag LOCUS_14160 9916 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 10094 11212 gene locus_tag LOCUS_14170 10094 11212 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967713.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence078 336 1136 gene locus_tag LOCUS_14180 336 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2186 1152 gene locus_tag LOCUS_14190 2186 1152 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_14190 2295 3521 gene locus_tag LOCUS_14200 2295 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3521 3871 gene locus_tag LOCUS_14210 3521 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 5253 3868 gene locus_tag LOCUS_14220 gene rarA 5253 3868 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_14220 5278 6168 gene locus_tag LOCUS_14230 gene nadK 5278 6168 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH6 protein_id gnl|my_center|LOCUS_14230 6165 7865 gene locus_tag LOCUS_14240 6165 7865 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E250 protein_id gnl|my_center|LOCUS_14240 7991 10726 gene locus_tag LOCUS_14250 gene secA 7991 10726 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKT5 protein_id gnl|my_center|LOCUS_14250 >Feature sequence079 246 1628 gene locus_tag LOCUS_14260 246 1628 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067193.1 protein_id gnl|my_center|LOCUS_14260 2524 1640 gene locus_tag LOCUS_14270 2524 1640 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391941.1 protein_id gnl|my_center|LOCUS_14270 2635 3972 gene locus_tag LOCUS_14280 2635 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 5149 3992 gene locus_tag LOCUS_14290 5149 3992 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086088.1 protein_id gnl|my_center|LOCUS_14290 5945 5184 gene locus_tag LOCUS_14300 5945 5184 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_14300 8244 5929 gene locus_tag LOCUS_14310 8244 5929 CDS product putative biotin sulfoxide reductase BisC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703773.1 protein_id gnl|my_center|LOCUS_14310 9799 8294 gene locus_tag LOCUS_14320 9799 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 10003 10650 gene locus_tag LOCUS_14330 10003 10650 CDS product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085212.1 protein_id gnl|my_center|LOCUS_14330 10744 11295 gene locus_tag LOCUS_14340 10744 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702776.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence080 1 210 gene locus_tag LOCUS_14350 1 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3005 645 gene locus_tag LOCUS_14360 gene lon 3005 645 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKD3 protein_id gnl|my_center|LOCUS_14360 3211 3125 gene locus_tag LOCUS_t00250 3211 3125 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3326 3820 gene locus_tag LOCUS_14370 gene iscR-2 3326 3820 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943207.1 protein_id gnl|my_center|LOCUS_14370 4736 4098 gene locus_tag LOCUS_14380 gene ctaE 4736 4098 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24012 protein_id gnl|my_center|LOCUS_14380 5073 4720 gene locus_tag LOCUS_14390 5073 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 5654 5085 gene locus_tag LOCUS_14400 gene coxC 5654 5085 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940895.1 protein_id gnl|my_center|LOCUS_14400 7372 5675 gene locus_tag LOCUS_14410 gene ctaD 7372 5675 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_14410 8084 7377 gene locus_tag LOCUS_14420 gene coxM 8084 7377 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969990.1 protein_id gnl|my_center|LOCUS_14420 8890 8237 gene locus_tag LOCUS_14430 8890 8237 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538458.1 protein_id gnl|my_center|LOCUS_14430 10235 9210 gene locus_tag LOCUS_14440 10235 9210 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_14440 10435 10974 gene locus_tag LOCUS_14450 10435 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence081 613 1155 gene locus_tag LOCUS_14460 613 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1526 1356 gene locus_tag LOCUS_14470 1526 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1527 1907 gene locus_tag LOCUS_14480 gene gloA 1527 1907 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124389.1 protein_id gnl|my_center|LOCUS_14480 2950 2315 gene locus_tag LOCUS_14490 gene purN 2950 2315 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S223 protein_id gnl|my_center|LOCUS_14490 3067 4005 gene locus_tag LOCUS_14500 3067 4005 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 protein_id gnl|my_center|LOCUS_14500 3986 5131 gene locus_tag LOCUS_14510 3986 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112621.1 protein_id gnl|my_center|LOCUS_14510 5567 5178 gene locus_tag LOCUS_14520 5567 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 6471 5560 gene locus_tag LOCUS_14530 6471 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 7954 7454 gene locus_tag LOCUS_14540 7954 7454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 8581 7955 gene locus_tag LOCUS_14550 gene thrH 8581 7955 CDS product phosphoserine phosphatase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y2 protein_id gnl|my_center|LOCUS_14550 10134 8593 gene locus_tag LOCUS_14560 10134 8593 CDS product acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083800.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence082 206 1327 gene locus_tag LOCUS_14570 206 1327 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_14570 2118 1381 gene locus_tag LOCUS_14580 2118 1381 CDS product 2-haloalkanoic acid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978408.1 protein_id gnl|my_center|LOCUS_14580 2364 2849 gene locus_tag LOCUS_14590 2364 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 4493 2850 gene locus_tag LOCUS_14600 4493 2850 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_14600 5072 4596 gene locus_tag LOCUS_14610 gene maoC 5072 4596 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151673.1 protein_id gnl|my_center|LOCUS_14610 7189 5075 gene locus_tag LOCUS_14620 7189 5075 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 protein_id gnl|my_center|LOCUS_14620 7253 8092 gene locus_tag LOCUS_14630 7253 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 9540 8089 gene locus_tag LOCUS_14640 9540 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496884.1 protein_id gnl|my_center|LOCUS_14640 9698 10555 gene locus_tag LOCUS_14650 gene apaH 9698 10555 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIP1 protein_id gnl|my_center|LOCUS_14650 10642 10917 gene locus_tag LOCUS_14660 10642 10917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence083 1569 1823 gene locus_tag LOCUS_14670 1569 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3190 1832 gene locus_tag LOCUS_14680 3190 1832 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728613.1 protein_id gnl|my_center|LOCUS_14680 3295 4065 gene locus_tag LOCUS_14690 3295 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 4279 5679 gene locus_tag LOCUS_14700 4279 5679 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252933.1 protein_id gnl|my_center|LOCUS_14700 5691 6929 gene locus_tag LOCUS_14710 5691 6929 CDS product 2-polyprenyl-6-methoxyphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974144.1 protein_id gnl|my_center|LOCUS_14710 6926 7966 gene locus_tag LOCUS_14720 6926 7966 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225667.1 protein_id gnl|my_center|LOCUS_14720 9157 7973 gene locus_tag LOCUS_14730 9157 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 10427 9180 gene locus_tag LOCUS_14740 10427 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence084 666 741 gene locus_tag LOCUS_t00260 666 741 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 900 2066 gene locus_tag LOCUS_14750 900 2066 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_14750 2079 2921 gene locus_tag LOCUS_14760 2079 2921 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083715.1 protein_id gnl|my_center|LOCUS_14760 2942 4687 gene locus_tag LOCUS_14770 2942 4687 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_14770 5858 4701 gene locus_tag LOCUS_14780 5858 4701 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727100.1 protein_id gnl|my_center|LOCUS_14780 5943 6953 gene locus_tag LOCUS_14790 5943 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064160.1 protein_id gnl|my_center|LOCUS_14790 7828 7004 gene locus_tag LOCUS_14800 7828 7004 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_14800 8939 7815 gene locus_tag LOCUS_14810 8939 7815 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400502.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence085 2617 329 gene locus_tag LOCUS_14820 2617 329 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_14820 3455 2844 gene locus_tag LOCUS_14830 3455 2844 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Z9 protein_id gnl|my_center|LOCUS_14830 3728 4159 gene locus_tag LOCUS_14840 3728 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 4340 5545 gene locus_tag LOCUS_14850 4340 5545 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533081.1 protein_id gnl|my_center|LOCUS_14850 6350 5595 gene locus_tag LOCUS_14860 6350 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 7069 6347 gene locus_tag LOCUS_14870 7069 6347 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_14870 7591 7079 gene locus_tag LOCUS_14880 gene moaC 7591 7079 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG82 protein_id gnl|my_center|LOCUS_14880 8290 7643 gene locus_tag LOCUS_14890 8290 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 8521 9210 gene locus_tag LOCUS_14900 gene lgt 8521 9210 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182Z4 protein_id gnl|my_center|LOCUS_14900 9278 10534 gene locus_tag LOCUS_14910 9278 10534 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence086 828 211 gene locus_tag LOCUS_14920 gene leuD 828 211 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8T3 protein_id gnl|my_center|LOCUS_14920 2289 838 gene locus_tag LOCUS_14930 gene leuC1 2289 838 CDS product 3-isopropylmalate dehydratase large subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X98 protein_id gnl|my_center|LOCUS_14930 3164 2253 gene locus_tag LOCUS_14940 gene bcpA 3164 2253 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808124.1 protein_id gnl|my_center|LOCUS_14940 3298 3675 gene locus_tag LOCUS_14950 3298 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 3700 4098 gene locus_tag LOCUS_14960 gene msrB 3700 4098 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q1 protein_id gnl|my_center|LOCUS_14960 4304 4113 gene locus_tag LOCUS_14970 4304 4113 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730111.1 protein_id gnl|my_center|LOCUS_14970 5234 4329 gene locus_tag LOCUS_14980 5234 4329 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462061.1 protein_id gnl|my_center|LOCUS_14980 5403 5828 gene locus_tag LOCUS_14990 5403 5828 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083398.1 protein_id gnl|my_center|LOCUS_14990 5912 6583 gene locus_tag LOCUS_15000 5912 6583 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907717.1 protein_id gnl|my_center|LOCUS_15000 7063 6572 gene locus_tag LOCUS_15010 gene rnhA 7063 6572 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8G2 protein_id gnl|my_center|LOCUS_15010 8163 7063 gene locus_tag LOCUS_15020 gene ychF 8163 7063 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC2 protein_id gnl|my_center|LOCUS_15020 9351 8224 gene locus_tag LOCUS_15030 gene tgt-1 9351 8224 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DZ0 protein_id gnl|my_center|LOCUS_15030 9403 10326 gene locus_tag LOCUS_15040 gene pyrF 9403 10326 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 protein_id gnl|my_center|LOCUS_15040 >Feature sequence087 286 1317 gene locus_tag LOCUS_15050 gene adhB 286 1317 CDS product butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645822.1 protein_id gnl|my_center|LOCUS_15050 2550 1324 gene locus_tag LOCUS_15060 2550 1324 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895828.1 protein_id gnl|my_center|LOCUS_15060 3453 2578 gene locus_tag LOCUS_15070 3453 2578 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971164.1 protein_id gnl|my_center|LOCUS_15070 4843 3491 gene locus_tag LOCUS_15080 4843 3491 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090251.1 protein_id gnl|my_center|LOCUS_15080 6291 4840 gene locus_tag LOCUS_15090 gene tldD 6291 4840 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037736.1 protein_id gnl|my_center|LOCUS_15090 6840 6307 gene locus_tag LOCUS_15100 6840 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 <10420 7025 gene locus_tag LOCUS_15110 <10420 7025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227000.1:5-methyltetrahydrofolate--homocysteine methyltransferase >Feature sequence088 244 319 gene locus_tag LOCUS_t00270 244 319 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 726 433 gene locus_tag LOCUS_15120 726 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 931 1173 gene locus_tag LOCUS_15130 931 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2354 1170 gene locus_tag LOCUS_15140 2354 1170 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_15140 3201 4310 gene locus_tag LOCUS_15150 3201 4310 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640506.1 protein_id gnl|my_center|LOCUS_15150 4327 5574 gene locus_tag LOCUS_15160 4327 5574 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920336.1 protein_id gnl|my_center|LOCUS_15160 5830 7002 gene locus_tag LOCUS_15170 5830 7002 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_15170 7003 7449 gene locus_tag LOCUS_15180 7003 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 8619 7456 gene locus_tag LOCUS_15190 8619 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114811.1 protein_id gnl|my_center|LOCUS_15190 8664 8984 gene locus_tag LOCUS_15200 8664 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence089 1715 21 gene locus_tag LOCUS_15210 1715 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1792 2097 gene locus_tag LOCUS_15220 1792 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 2562 3572 gene locus_tag LOCUS_15230 gene glnII 2562 3572 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_15230 4080 3607 gene locus_tag LOCUS_15240 4080 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 4315 4923 gene locus_tag LOCUS_15250 4315 4923 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_15250 4933 6123 gene locus_tag LOCUS_15260 4933 6123 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_15260 6219 7271 gene locus_tag LOCUS_15270 6219 7271 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_15270 7448 7372 gene locus_tag LOCUS_t00280 7448 7372 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8175 7531 gene locus_tag LOCUS_15280 8175 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 8237 8992 gene locus_tag LOCUS_15290 8237 8992 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_15290 9826 9050 gene locus_tag LOCUS_15300 9826 9050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence090 769 395 gene locus_tag LOCUS_15310 769 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15310 1339 788 gene locus_tag LOCUS_15320 1339 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15320 1400 2470 gene locus_tag LOCUS_15330 1400 2470 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_15330 2820 3071 gene locus_tag LOCUS_15340 2820 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4270 3068 gene locus_tag LOCUS_15350 4270 3068 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2D4 protein_id gnl|my_center|LOCUS_15350 4348 6213 gene locus_tag LOCUS_15360 gene ilvB 4348 6213 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_15360 6200 6727 gene locus_tag LOCUS_15370 6200 6727 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_15370 8015 6720 gene locus_tag LOCUS_15380 gene garP 8015 6720 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599656.1 protein_id gnl|my_center|LOCUS_15380 9667 8054 gene locus_tag LOCUS_15390 gene ilvD 9667 8054 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ69 protein_id gnl|my_center|LOCUS_15390 >Feature sequence091 1188 415 gene locus_tag LOCUS_15400 1188 415 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE92 protein_id gnl|my_center|LOCUS_15400 2165 1185 gene locus_tag LOCUS_15410 2165 1185 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876717.1 protein_id gnl|my_center|LOCUS_15410 2218 3156 gene locus_tag LOCUS_15420 gene ctaA 2218 3156 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087694.1 protein_id gnl|my_center|LOCUS_15420 3160 3645 gene locus_tag LOCUS_15430 3160 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 4554 3649 gene locus_tag LOCUS_15440 4554 3649 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726664.1 protein_id gnl|my_center|LOCUS_15440 4763 5485 gene locus_tag LOCUS_15450 4763 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 5772 5482 gene locus_tag LOCUS_15460 5772 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 5915 6436 gene locus_tag LOCUS_15470 5915 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 7335 6457 gene locus_tag LOCUS_15480 7335 6457 CDS product 2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810064.1 protein_id gnl|my_center|LOCUS_15480 8064 7360 gene locus_tag LOCUS_15490 gene menG 8064 7360 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4C2 protein_id gnl|my_center|LOCUS_15490 <9549 8123 gene locus_tag LOCUS_15500 <9549 8123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q73NV3:elongation factor G 2 >Feature sequence092 333 5945 gene locus_tag LOCUS_15510 333 5945 CDS product fused acetyl/propionyl-CoA carboxylase subuit alpha/methylmalonyl-CoA decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226015.1 protein_id gnl|my_center|LOCUS_15510 5942 6757 gene locus_tag LOCUS_15520 gene map 5942 6757 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX4 protein_id gnl|my_center|LOCUS_15520 7947 6754 gene locus_tag LOCUS_15530 7947 6754 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876950.1 protein_id gnl|my_center|LOCUS_15530 8004 8369 gene locus_tag LOCUS_15540 8004 8369 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC17 protein_id gnl|my_center|LOCUS_15540 9048 8353 gene locus_tag LOCUS_15550 gene menH 9048 8353 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23974 protein_id gnl|my_center|LOCUS_15550 >Feature sequence093 732 202 gene locus_tag LOCUS_15560 732 202 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920315.1 protein_id gnl|my_center|LOCUS_15560 930 2075 gene locus_tag LOCUS_15570 930 2075 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063639.1 protein_id gnl|my_center|LOCUS_15570 2072 3109 gene locus_tag LOCUS_15580 2072 3109 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082970.1 protein_id gnl|my_center|LOCUS_15580 3929 3120 gene locus_tag LOCUS_15590 gene yngF 3929 3120 CDS product putative enoyl-CoA hydratase/isomerase YngF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34893 protein_id gnl|my_center|LOCUS_15590 4760 3990 gene locus_tag LOCUS_15600 4760 3990 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_15600 5114 5737 gene locus_tag LOCUS_15610 5114 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 6665 5745 gene locus_tag LOCUS_15620 6665 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 6800 7324 gene locus_tag LOCUS_15630 6800 7324 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_15630 7373 7448 gene locus_tag LOCUS_t00290 7373 7448 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7693 8910 gene locus_tag LOCUS_15640 7693 8910 CDS product cytochrome P450 hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_15640 9065 9313 gene locus_tag LOCUS_15650 9065 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence094 289 1404 gene locus_tag LOCUS_15660 gene gcvT 289 1404 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818M3 protein_id gnl|my_center|LOCUS_15660 1401 1805 gene locus_tag LOCUS_15670 gene gcvH 1401 1805 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_15670 1815 3155 gene locus_tag LOCUS_15680 1815 3155 CDS product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_15680 3145 4671 gene locus_tag LOCUS_15690 3145 4671 CDS product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_15690 5543 4668 gene locus_tag LOCUS_15700 5543 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5686 6690 gene locus_tag LOCUS_15710 5686 6690 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919302.1 protein_id gnl|my_center|LOCUS_15710 6707 7864 gene locus_tag LOCUS_15720 gene metB 6707 7864 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56069 protein_id gnl|my_center|LOCUS_15720 7980 8864 gene locus_tag LOCUS_15730 7980 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence095 186 644 gene locus_tag LOCUS_15740 186 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2675 693 gene locus_tag LOCUS_15750 2675 693 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 protein_id gnl|my_center|LOCUS_15750 2883 4157 gene locus_tag LOCUS_15760 2883 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 4327 5193 gene locus_tag LOCUS_15770 gene queA 4327 5193 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ44 protein_id gnl|my_center|LOCUS_15770 5190 6323 gene locus_tag LOCUS_15780 gene tgt 5190 6323 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32053 protein_id gnl|my_center|LOCUS_15780 6395 7267 gene locus_tag LOCUS_15790 6395 7267 CDS product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088038.1 protein_id gnl|my_center|LOCUS_15790 8613 7264 gene locus_tag LOCUS_15800 8613 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence096 <1 519 gene locus_tag LOCUS_15810 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RVB9:bifunctional protein PyrR 516 1442 gene locus_tag LOCUS_15820 gene pyrB 516 1442 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2K5 protein_id gnl|my_center|LOCUS_15820 1442 2752 gene locus_tag LOCUS_15830 gene pyrC 1442 2752 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK42 protein_id gnl|my_center|LOCUS_15830 2736 3947 gene locus_tag LOCUS_15840 gene carA 2736 3947 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP3 protein_id gnl|my_center|LOCUS_15840 3934 7152 gene locus_tag LOCUS_15850 gene carB 3934 7152 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP0 protein_id gnl|my_center|LOCUS_15850 >Feature sequence097 1356 478 gene locus_tag LOCUS_15860 gene hslO 1356 478 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E253 protein_id gnl|my_center|LOCUS_15860 1399 2337 gene locus_tag LOCUS_15870 gene gluQ 1399 2337 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_15870 2965 2372 gene locus_tag LOCUS_15880 2965 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 4030 3005 gene locus_tag LOCUS_15890 4030 3005 CDS product conjugal transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680885.1 protein_id gnl|my_center|LOCUS_15890 4300 5046 gene locus_tag LOCUS_15900 4300 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 5607 6443 gene locus_tag LOCUS_15910 5607 6443 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728665.1 protein_id gnl|my_center|LOCUS_15910 7116 6529 gene locus_tag LOCUS_15920 7116 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 7445 7107 gene locus_tag LOCUS_15930 7445 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 8218 7556 gene locus_tag LOCUS_15940 8218 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence098 <1 646 gene locus_tag LOCUS_15950 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070965.1:alcohol dehydrogenase 1715 669 gene locus_tag LOCUS_15960 1715 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2955 1786 gene locus_tag LOCUS_15970 2955 1786 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926041.1 protein_id gnl|my_center|LOCUS_15970 3177 4064 gene locus_tag LOCUS_15980 3177 4064 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_15980 4101 4544 gene locus_tag LOCUS_15990 4101 4544 CDS product putative F420H(2)-dependent quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64876 protein_id gnl|my_center|LOCUS_15990 4624 5649 gene locus_tag LOCUS_16000 4624 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 5690 6463 gene locus_tag LOCUS_16010 5690 6463 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_16010 7249 6476 gene locus_tag LOCUS_16020 gene fadB 7249 6476 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085730.1 protein_id gnl|my_center|LOCUS_16020 7625 9016 gene locus_tag LOCUS_16030 7625 9016 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence099 4629 76 gene locus_tag LOCUS_16040 gene gltA 4629 76 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_16040 5609 4896 gene locus_tag LOCUS_16050 5609 4896 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070923.1 protein_id gnl|my_center|LOCUS_16050 7084 5594 gene locus_tag LOCUS_16060 gene glpK 7084 5594 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726H4 protein_id gnl|my_center|LOCUS_16060 8113 7085 gene locus_tag LOCUS_16070 gene ftsY 8113 7085 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E32 protein_id gnl|my_center|LOCUS_16070 >Feature sequence100 1114 2151 gene locus_tag LOCUS_16080 1114 2151 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 protein_id gnl|my_center|LOCUS_16080 2484 2287 gene locus_tag LOCUS_16090 2484 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 2660 3643 gene locus_tag LOCUS_16100 2660 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 5832 3910 gene locus_tag LOCUS_16110 5832 3910 CDS product putative monooxygenase y4iD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55487 protein_id gnl|my_center|LOCUS_16110 6173 6589 gene locus_tag LOCUS_16120 6173 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 6636 6818 gene locus_tag LOCUS_16130 6636 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence101 1055 1510 gene locus_tag LOCUS_16140 1055 1510 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807963.1 protein_id gnl|my_center|LOCUS_16140 1512 2396 gene locus_tag LOCUS_16150 1512 2396 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_16150 3115 2411 gene locus_tag LOCUS_16160 gene surE 3115 2411 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_16160 3197 3961 gene locus_tag LOCUS_16170 3197 3961 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_16170 3963 4727 gene locus_tag LOCUS_16180 3963 4727 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_16180 4737 5498 gene locus_tag LOCUS_16190 4737 5498 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_16190 5511 6716 gene locus_tag LOCUS_16200 5511 6716 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390303.1 protein_id gnl|my_center|LOCUS_16200 7509 6763 gene locus_tag LOCUS_16210 7509 6763 CDS product igiC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895987.1 protein_id gnl|my_center|LOCUS_16210 <8494 7506 gene locus_tag LOCUS_16220 <8494 7506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186665.1:FAD-dependent oxidoreductase >Feature sequence102 330 1445 gene locus_tag LOCUS_16230 gene dnaJ 330 1445 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H58 protein_id gnl|my_center|LOCUS_16230 1521 3611 gene locus_tag LOCUS_16240 1521 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 3690 4637 gene locus_tag LOCUS_16250 gene thiL 3690 4637 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747S1 protein_id gnl|my_center|LOCUS_16250 4814 5026 gene locus_tag LOCUS_16260 4814 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 5122 5724 gene locus_tag LOCUS_16270 gene lexA 5122 5724 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I23 protein_id gnl|my_center|LOCUS_16270 5787 6362 gene locus_tag LOCUS_16280 gene folE 5787 6362 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEA8 protein_id gnl|my_center|LOCUS_16280 >Feature sequence103 1981 827 gene locus_tag LOCUS_16290 gene hemN 1981 827 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_16290 2066 4657 gene locus_tag LOCUS_16300 2066 4657 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_16300 6420 4663 gene locus_tag LOCUS_16310 6420 4663 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888193.1 protein_id gnl|my_center|LOCUS_16310 6517 6592 gene locus_tag LOCUS_t00300 6517 6592 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6742 7356 gene locus_tag LOCUS_16320 6742 7356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 <8458 7399 gene locus_tag LOCUS_16330 <8458 7399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919618.1:TonB-dependent receptor >Feature sequence104 1 249 gene locus_tag LOCUS_16340 1 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 393 3131 gene locus_tag LOCUS_16350 gene uvrA 393 3131 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4F6 protein_id gnl|my_center|LOCUS_16350 3241 4032 gene locus_tag LOCUS_16360 3241 4032 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706250.1 protein_id gnl|my_center|LOCUS_16360 4059 5381 gene locus_tag LOCUS_16370 4059 5381 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706251.1 protein_id gnl|my_center|LOCUS_16370 5453 5896 gene locus_tag LOCUS_16380 5453 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 6094 6489 gene locus_tag LOCUS_16390 6094 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 6529 7383 gene locus_tag LOCUS_16400 6529 7383 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_16400 7569 7471 gene locus_tag LOCUS_t00310 7569 7471 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence105 693 142 gene locus_tag LOCUS_16410 693 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1842 727 gene locus_tag LOCUS_16420 1842 727 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730592.1 protein_id gnl|my_center|LOCUS_16420 3540 1849 gene locus_tag LOCUS_16430 3540 1849 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_16430 3635 4846 gene locus_tag LOCUS_16440 3635 4846 CDS product succinyl-CoA--D-citramalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGE3 protein_id gnl|my_center|LOCUS_16440 7136 4854 gene locus_tag LOCUS_16450 7136 4854 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_16450 <8275 7133 gene locus_tag LOCUS_16460 <8275 7133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538204.1:methylhydantoinase >Feature sequence106 <1 620 gene locus_tag LOCUS_16470 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088459.1:dimethylhistidine N-methyltransferase 627 1070 gene locus_tag LOCUS_16480 627 1070 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462001.1 protein_id gnl|my_center|LOCUS_16480 2744 1089 gene locus_tag LOCUS_16490 2744 1089 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728663.1 protein_id gnl|my_center|LOCUS_16490 4712 2805 gene locus_tag LOCUS_16500 4712 2805 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_16500 4789 6375 gene locus_tag LOCUS_16510 4789 6375 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_16510 <8212 6410 gene locus_tag LOCUS_16520 <8212 6410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083575.1:double-strand break repair helicase AddA >Feature sequence107 102 26 gene locus_tag LOCUS_t00320 102 26 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 247 162 gene locus_tag LOCUS_t00330 247 162 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 515 252 gene locus_tag LOCUS_16530 515 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 646 571 gene locus_tag LOCUS_t00340 646 571 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1439 696 gene locus_tag LOCUS_16540 gene trmH 1439 696 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855745.1 protein_id gnl|my_center|LOCUS_16540 1508 1879 gene locus_tag LOCUS_16550 1508 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1993 1909 gene locus_tag LOCUS_t00350 1993 1909 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2080 3402 gene locus_tag LOCUS_16560 gene pyrC 2080 3402 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ62 protein_id gnl|my_center|LOCUS_16560 3974 3477 gene locus_tag LOCUS_16570 3974 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 5327 3975 gene locus_tag LOCUS_16580 5327 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_16580 6034 5324 gene locus_tag LOCUS_16590 6034 5324 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_16590 6969 6031 gene locus_tag LOCUS_16600 6969 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 7866 6994 gene locus_tag LOCUS_16610 7866 6994 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087810.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence108 2720 402 gene locus_tag LOCUS_16620 gene ptsP 2720 402 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941826.1 protein_id gnl|my_center|LOCUS_16620 3030 3515 gene locus_tag LOCUS_16630 3030 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 5005 3734 gene locus_tag LOCUS_16640 5005 3734 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_16640 6336 5104 gene locus_tag LOCUS_16650 gene moeA 6336 5104 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_16650 6642 7718 gene locus_tag LOCUS_16660 gene gnfL 6642 7718 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence109 <1 1470 gene locus_tag LOCUS_16670 <1 1470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F6S7:2-oxoglutarate dehydrogenase E1 component 1528 2223 gene locus_tag LOCUS_16680 1528 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 4854 2257 gene locus_tag LOCUS_16690 4854 2257 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140731.1 protein_id gnl|my_center|LOCUS_16690 4995 6302 gene locus_tag LOCUS_16700 4995 6302 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125603.1 protein_id gnl|my_center|LOCUS_16700 6857 7516 gene locus_tag LOCUS_16710 6857 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 7817 7530 gene locus_tag LOCUS_16720 7817 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence110 307 1578 gene locus_tag LOCUS_16730 307 1578 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 protein_id gnl|my_center|LOCUS_16730 1582 2550 gene locus_tag LOCUS_16740 1582 2550 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_16740 3010 2561 gene locus_tag LOCUS_16750 3010 2561 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_16750 3714 3013 gene locus_tag LOCUS_16760 gene gst7 3714 3013 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969007.1 protein_id gnl|my_center|LOCUS_16760 3863 4399 gene locus_tag LOCUS_16770 3863 4399 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_16770 5432 4386 gene locus_tag LOCUS_16780 5432 4386 CDS product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 protein_id gnl|my_center|LOCUS_16780 5633 5812 gene locus_tag LOCUS_16790 5633 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 5809 6954 gene locus_tag LOCUS_16800 5809 6954 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DR9 protein_id gnl|my_center|LOCUS_16800 >Feature sequence111 1404 367 gene locus_tag LOCUS_16810 gene rodA 1404 367 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_16810 3349 1463 gene locus_tag LOCUS_16820 gene mrdA 3349 1463 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_16820 3895 3362 gene locus_tag LOCUS_16830 3895 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 4824 3928 gene locus_tag LOCUS_16840 gene mreC 4824 3928 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BG0 protein_id gnl|my_center|LOCUS_16840 5887 4847 gene locus_tag LOCUS_16850 gene mreB-1 5887 4847 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_16850 6193 7704 gene locus_tag LOCUS_16860 6193 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence112 870 3893 gene locus_tag LOCUS_16870 870 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 3954 6587 gene locus_tag LOCUS_16880 3954 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 7319 6591 gene locus_tag LOCUS_16890 7319 6591 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC66 protein_id gnl|my_center|LOCUS_16890 >Feature sequence113 22 543 gene locus_tag LOCUS_16900 22 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 2510 657 gene locus_tag LOCUS_16910 gene uvrC 2510 657 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747I7 protein_id gnl|my_center|LOCUS_16910 4573 2519 gene locus_tag LOCUS_16920 gene uvrB 4573 2519 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747K3 protein_id gnl|my_center|LOCUS_16920 6002 4590 gene locus_tag LOCUS_16930 gene cysS 6002 4590 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E391 protein_id gnl|my_center|LOCUS_16930 6481 5999 gene locus_tag LOCUS_16940 gene ispF 6481 5999 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747A0 protein_id gnl|my_center|LOCUS_16940 7218 6478 gene locus_tag LOCUS_16950 gene ispD 7218 6478 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E113 protein_id gnl|my_center|LOCUS_16950 >Feature sequence114 1239 73 gene locus_tag LOCUS_16960 gene sucC 1239 73 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80886 protein_id gnl|my_center|LOCUS_16960 2215 1271 gene locus_tag LOCUS_16970 gene mdh 2215 1271 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D53 protein_id gnl|my_center|LOCUS_16970 2672 2412 gene locus_tag LOCUS_16980 2672 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 4534 2723 gene locus_tag LOCUS_16990 gene aspS 4534 2723 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32038 protein_id gnl|my_center|LOCUS_16990 4985 6604 gene locus_tag LOCUS_17000 gene acsA 4985 6604 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817748.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence115 614 2902 gene locus_tag LOCUS_17010 614 2902 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTX2 protein_id gnl|my_center|LOCUS_17010 4758 3088 gene locus_tag LOCUS_17020 gene groL 4758 3088 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C7 protein_id gnl|my_center|LOCUS_17020 5057 4770 gene locus_tag LOCUS_17030 gene groS 5057 4770 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C8 protein_id gnl|my_center|LOCUS_17030 5386 6318 gene locus_tag LOCUS_17040 gene hemF 5386 6318 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P36553 protein_id gnl|my_center|LOCUS_17040 <7118 6344 gene locus_tag LOCUS_17050 <7118 6344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YFL7:transport permease protein >Feature sequence116 <1 728 gene locus_tag LOCUS_17060 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549123.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB 848 1870 gene locus_tag LOCUS_17070 gene ilvC 848 1870 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJT0 protein_id gnl|my_center|LOCUS_17070 1873 2562 gene locus_tag LOCUS_17080 1873 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 2555 3361 gene locus_tag LOCUS_17090 gene pssA-1 2555 3361 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770492.1 protein_id gnl|my_center|LOCUS_17090 3394 4941 gene locus_tag LOCUS_17100 gene leuA 3394 4941 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJS7 protein_id gnl|my_center|LOCUS_17100 4972 6048 gene locus_tag LOCUS_17110 gene leuB 4972 6048 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFH4 protein_id gnl|my_center|LOCUS_17110 6201 7004 gene locus_tag LOCUS_17120 6201 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence117 1115 339 gene locus_tag LOCUS_17130 gene lpxA-1 1115 339 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT6 protein_id gnl|my_center|LOCUS_17130 1646 1122 gene locus_tag LOCUS_17140 1646 1122 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545058.1 protein_id gnl|my_center|LOCUS_17140 4912 1733 gene locus_tag LOCUS_17150 gene yaeT 4912 1733 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT3 protein_id gnl|my_center|LOCUS_17150 5936 5244 gene locus_tag LOCUS_17160 gene lolD 5936 5244 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT2 protein_id gnl|my_center|LOCUS_17160 <7056 5933 gene locus_tag LOCUS_17170 <7056 5933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942910.1:ABC transporter permease >Feature sequence118 787 413 gene locus_tag LOCUS_17180 787 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1266 784 gene locus_tag LOCUS_17190 1266 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1462 3528 gene locus_tag LOCUS_17200 1462 3528 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083165.1 protein_id gnl|my_center|LOCUS_17200 4108 3518 gene locus_tag LOCUS_17210 4108 3518 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230483.1 protein_id gnl|my_center|LOCUS_17210 5051 4143 gene locus_tag LOCUS_17220 5051 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 5121 6203 gene locus_tag LOCUS_17230 5121 6203 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089770.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence119 43 873 gene locus_tag LOCUS_17240 43 873 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_17240 1374 925 gene locus_tag LOCUS_17250 1374 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1475 1930 gene locus_tag LOCUS_17260 1475 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2694 1960 gene locus_tag LOCUS_17270 2694 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 3497 2712 gene locus_tag LOCUS_17280 3497 2712 CDS product 3-oxoadipate--succinyl-CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406327.1 protein_id gnl|my_center|LOCUS_17280 4367 3501 gene locus_tag LOCUS_17290 4367 3501 CDS product 3-oxoadipate--succinyl-CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976287.1 protein_id gnl|my_center|LOCUS_17290 5832 4429 gene locus_tag LOCUS_17300 gene dapE 5832 4429 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 protein_id gnl|my_center|LOCUS_17300 5911 6639 gene locus_tag LOCUS_17310 5911 6639 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926447.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence120 831 1673 gene locus_tag LOCUS_17320 gene scpA 831 1673 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C43 protein_id gnl|my_center|LOCUS_17320 1707 2312 gene locus_tag LOCUS_17330 gene scpB 1707 2312 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C44 protein_id gnl|my_center|LOCUS_17330 2363 3085 gene locus_tag LOCUS_17340 gene rluB 2363 3085 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HL82 protein_id gnl|my_center|LOCUS_17340 3960 3091 gene locus_tag LOCUS_17350 3960 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 4733 4948 gene locus_tag LOCUS_17360 4733 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4945 6399 gene locus_tag LOCUS_17370 4945 6399 CDS product pantothenate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877748.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence121 <1 774 gene locus_tag LOCUS_17380 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228970.1:amidohydrolase 717 905 gene locus_tag LOCUS_17390 717 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2061 991 gene locus_tag LOCUS_17400 2061 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2911 2150 gene locus_tag LOCUS_17410 2911 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 3648 3220 gene locus_tag LOCUS_17420 3648 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 3730 4068 gene locus_tag LOCUS_17430 3730 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 4068 5663 gene locus_tag LOCUS_17440 4068 5663 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709081.1 protein_id gnl|my_center|LOCUS_17440 5641 6708 gene locus_tag LOCUS_17450 gene adh1 5641 6708 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880876.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence122 58 798 gene locus_tag LOCUS_17460 58 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 795 1226 gene locus_tag LOCUS_17470 795 1226 CDS product glyoxalase/bleomycin resistance protein/dioxygenase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204789.1 protein_id gnl|my_center|LOCUS_17470 2229 1255 gene locus_tag LOCUS_17480 gene qor 2229 1255 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224686.1 protein_id gnl|my_center|LOCUS_17480 2315 2746 gene locus_tag LOCUS_17490 2315 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 2778 3557 gene locus_tag LOCUS_17500 2778 3557 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705635.1 protein_id gnl|my_center|LOCUS_17500 3565 4515 gene locus_tag LOCUS_17510 3565 4515 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266814.1 protein_id gnl|my_center|LOCUS_17510 4512 5237 gene locus_tag LOCUS_17520 4512 5237 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089892.1 protein_id gnl|my_center|LOCUS_17520 5328 6005 gene locus_tag LOCUS_17530 5328 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence123 <1 2255 gene locus_tag LOCUS_17540 <1 2255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H75:transcription-repair-coupling factor 2685 2287 gene locus_tag LOCUS_17550 2685 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2972 2697 gene locus_tag LOCUS_17560 2972 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 4058 3576 gene locus_tag LOCUS_17570 4058 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526466.1 protein_id gnl|my_center|LOCUS_17570 5484 4027 gene locus_tag LOCUS_17580 5484 4027 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090620.1 protein_id gnl|my_center|LOCUS_17580 5678 6289 gene locus_tag LOCUS_17590 5678 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence124 168 968 gene locus_tag LOCUS_17600 168 968 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_17600 1013 1363 gene locus_tag LOCUS_17610 1013 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1391 2608 gene locus_tag LOCUS_17620 1391 2608 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726818.1 protein_id gnl|my_center|LOCUS_17620 3977 2637 gene locus_tag LOCUS_17630 3977 2637 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706251.1 protein_id gnl|my_center|LOCUS_17630 5199 4063 gene locus_tag LOCUS_17640 5199 4063 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895366.1 protein_id gnl|my_center|LOCUS_17640 6037 5243 gene locus_tag LOCUS_17650 6037 5243 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089969.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence125 1644 442 gene locus_tag LOCUS_17660 1644 442 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973048.1 protein_id gnl|my_center|LOCUS_17660 3398 1644 gene locus_tag LOCUS_17670 3398 1644 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_17670 5435 3399 gene locus_tag LOCUS_17680 5435 3399 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence126 414 1376 gene locus_tag LOCUS_17690 gene miaA 414 1376 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP1 protein_id gnl|my_center|LOCUS_17690 1409 2749 gene locus_tag LOCUS_17700 gene der 1409 2749 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX4 protein_id gnl|my_center|LOCUS_17700 2810 3553 gene locus_tag LOCUS_17710 2810 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 3579 3791 gene locus_tag LOCUS_17720 3579 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 4558 4193 gene locus_tag LOCUS_17730 4558 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 4822 5673 gene locus_tag LOCUS_17740 4822 5673 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence127 157 936 gene locus_tag LOCUS_17750 gene fabG-2 157 936 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_17750 1016 1585 gene locus_tag LOCUS_17760 1016 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 2350 1604 gene locus_tag LOCUS_17770 gene scdh1 2350 1604 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083282.1 protein_id gnl|my_center|LOCUS_17770 3739 2375 gene locus_tag LOCUS_17780 3739 2375 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886801.1 protein_id gnl|my_center|LOCUS_17780 5831 3756 gene locus_tag LOCUS_17790 5831 3756 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence128 <1 2087 gene locus_tag LOCUS_17800 <1 2087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P17922:phenylalanine--tRNA ligase beta subunit 2106 2408 gene locus_tag LOCUS_17810 gene ihfA-1 2106 2408 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ8 protein_id gnl|my_center|LOCUS_17810 2523 2984 gene locus_tag LOCUS_17820 2523 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3116 3192 gene locus_tag LOCUS_t00360 3116 3192 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3250 4029 gene locus_tag LOCUS_17830 3250 4029 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186027.1 protein_id gnl|my_center|LOCUS_17830 4146 4460 gene locus_tag LOCUS_17840 4146 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 4500 4997 gene locus_tag LOCUS_17850 4500 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence129 594 1889 gene locus_tag LOCUS_17860 594 1889 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_17860 1919 2359 gene locus_tag LOCUS_17870 1919 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2442 2531 gene locus_tag LOCUS_t00370 2442 2531 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2593 2684 gene locus_tag LOCUS_t00380 2593 2684 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2815 2891 gene locus_tag LOCUS_t00390 2815 2891 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3846 2962 gene locus_tag LOCUS_17880 3846 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943863.1 protein_id gnl|my_center|LOCUS_17880 5375 4005 gene locus_tag LOCUS_17890 5375 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 5476 5907 gene locus_tag LOCUS_17900 5476 5907 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461775.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence130 1176 283 gene locus_tag LOCUS_17910 1176 283 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730867.1 protein_id gnl|my_center|LOCUS_17910 1304 1789 gene locus_tag LOCUS_17920 1304 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 3012 1810 gene locus_tag LOCUS_17930 3012 1810 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973048.1 protein_id gnl|my_center|LOCUS_17930 4183 3020 gene locus_tag LOCUS_17940 4183 3020 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706251.1 protein_id gnl|my_center|LOCUS_17940 4980 4210 gene locus_tag LOCUS_17950 4980 4210 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706250.1 protein_id gnl|my_center|LOCUS_17950 5979 5065 gene locus_tag LOCUS_17960 5979 5065 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence131 1259 390 gene locus_tag LOCUS_17970 1259 390 CDS product ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_17970 2817 1273 gene locus_tag LOCUS_17980 gene atpA 2817 1273 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY2 protein_id gnl|my_center|LOCUS_17980 3411 2869 gene locus_tag LOCUS_17990 gene atpH 3411 2869 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88UU0 protein_id gnl|my_center|LOCUS_17990 3901 3473 gene locus_tag LOCUS_18000 3901 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 4434 4033 gene locus_tag LOCUS_18010 4434 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 5174 4836 gene locus_tag LOCUS_18020 5174 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 <5787 5180 gene locus_tag LOCUS_18030 <5787 5180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546849.1:chromosome partitioning protein ParB >Feature sequence132 89 1783 gene locus_tag LOCUS_18040 89 1783 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_18040 1927 3081 gene locus_tag LOCUS_18050 gene argG 1927 3081 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKX5 protein_id gnl|my_center|LOCUS_18050 3174 4541 gene locus_tag LOCUS_18060 3174 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence133 1015 1884 gene locus_tag LOCUS_18070 1015 1884 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_18070 2702 1911 gene locus_tag LOCUS_18080 2702 1911 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_18080 3728 2745 gene locus_tag LOCUS_18090 3728 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4200 3952 gene locus_tag LOCUS_18100 4200 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence134 461 222 gene locus_tag LOCUS_18110 461 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1346 477 gene locus_tag LOCUS_18120 1346 477 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_18120 1428 2207 gene locus_tag LOCUS_18130 gene paaG 1428 2207 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_18130 2220 3014 gene locus_tag LOCUS_18140 2220 3014 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498262.1 protein_id gnl|my_center|LOCUS_18140 3023 3421 gene locus_tag LOCUS_18150 3023 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 3468 3851 gene locus_tag LOCUS_18160 3468 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 4650 3892 gene locus_tag LOCUS_18170 gene znuB 4650 3892 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_18170 <5334 4676 gene locus_tag LOCUS_18180 <5334 4676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070905.1:zinc ABC transporter substrate-binding protein >Feature sequence135 2431 575 gene locus_tag LOCUS_18190 2431 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_18190 3058 2444 gene locus_tag LOCUS_18200 gene cysC 3058 2444 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CR04 protein_id gnl|my_center|LOCUS_18200 4317 3157 gene locus_tag LOCUS_18210 gene iscS 4317 3157 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_18210 4725 4393 gene locus_tag LOCUS_18220 4725 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence136 2307 952 gene locus_tag LOCUS_18230 2307 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_18230 2911 4167 gene locus_tag LOCUS_18240 gene amtB 2911 4167 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTR7 protein_id gnl|my_center|LOCUS_18240 4180 4518 gene locus_tag LOCUS_18250 gene glnB 4180 4518 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225869.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence137 268 1011 gene locus_tag LOCUS_18260 268 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1154 2758 gene locus_tag LOCUS_18270 1154 2758 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_18270 3926 2796 gene locus_tag LOCUS_18280 3926 2796 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_18280 4012 4950 gene locus_tag LOCUS_18290 4012 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence138 512 222 gene locus_tag LOCUS_18300 512 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 751 1821 gene locus_tag LOCUS_18310 751 1821 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730665.1 protein_id gnl|my_center|LOCUS_18310 3442 1835 gene locus_tag LOCUS_18320 3442 1835 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_18320 3598 4632 gene locus_tag LOCUS_18330 3598 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence139 1542 238 gene locus_tag LOCUS_18340 gene apeB 1542 238 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ3 protein_id gnl|my_center|LOCUS_18340 2346 1585 gene locus_tag LOCUS_18350 gene paaC 2346 1585 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085677.1 protein_id gnl|my_center|LOCUS_18350 2679 2350 gene locus_tag LOCUS_18360 gene paaB 2679 2350 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984048.1 protein_id gnl|my_center|LOCUS_18360 3593 2640 gene locus_tag LOCUS_18370 gene paaA 3593 2640 CDS product phenylacetate-CoA oxygenase subunit PaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085675.1 protein_id gnl|my_center|LOCUS_18370 4368 3727 gene locus_tag LOCUS_18380 gene msrA 4368 3727 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_18380 >Feature sequence140 1080 223 gene locus_tag LOCUS_18390 1080 223 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931162.1 protein_id gnl|my_center|LOCUS_18390 1141 2268 gene locus_tag LOCUS_18400 1141 2268 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228913.1 protein_id gnl|my_center|LOCUS_18400 2279 3013 gene locus_tag LOCUS_18410 2279 3013 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202330.1 protein_id gnl|my_center|LOCUS_18410 4041 3010 gene locus_tag LOCUS_18420 gene adhP 4041 3010 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_18420 4221 4694 gene locus_tag LOCUS_18430 4221 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence141 1443 370 gene locus_tag LOCUS_18440 1443 370 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030812.1 protein_id gnl|my_center|LOCUS_18440 1546 2019 gene locus_tag LOCUS_18450 1546 2019 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975277.1 protein_id gnl|my_center|LOCUS_18450 2009 4126 gene locus_tag LOCUS_18460 2009 4126 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975278.1 protein_id gnl|my_center|LOCUS_18460 <4833 4132 gene locus_tag LOCUS_18470 <4833 4132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705095.1:putative large terminal subunit of phenylpropionate dioxygenase >Feature sequence142 217 1050 gene locus_tag LOCUS_18480 217 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880814.1 protein_id gnl|my_center|LOCUS_18480 1086 1988 gene locus_tag LOCUS_18490 gene gnnA 1086 1988 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_18490 2051 3214 gene locus_tag LOCUS_18500 gene lpxB 2051 3214 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT9 protein_id gnl|my_center|LOCUS_18500 3297 4448 gene locus_tag LOCUS_18510 gene kdtA 3297 4448 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891562.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence143 <1 918 gene locus_tag LOCUS_18520 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403969.1:protoporphyrinogen oxidase 1713 3119 gene locus_tag LOCUS_18530 gene lpd 1713 3119 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F290 protein_id gnl|my_center|LOCUS_18530 3143 4396 gene locus_tag LOCUS_18540 3143 4396 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCB7 protein_id gnl|my_center|LOCUS_18540 >Feature sequence144 668 2923 gene locus_tag LOCUS_18550 668 2923 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258126.1 protein_id gnl|my_center|LOCUS_18550 3709 2933 gene locus_tag LOCUS_18560 gene garL 3709 2933 CDS product 5-keto-4-deoxy-D-glucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FK52 protein_id gnl|my_center|LOCUS_18560 4478 3726 gene locus_tag LOCUS_18570 gene gdh 4478 3726 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288522.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence145 550 122 gene locus_tag LOCUS_18580 550 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1705 653 gene locus_tag LOCUS_18590 1705 653 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252963.1 protein_id gnl|my_center|LOCUS_18590 2829 1708 gene locus_tag LOCUS_18600 2829 1708 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_18600 2792 2935 gene locus_tag LOCUS_18610 2792 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2942 3724 gene locus_tag LOCUS_18620 2942 3724 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967182.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence146 1 402 gene locus_tag LOCUS_18630 1 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 447 1193 gene locus_tag LOCUS_18640 447 1193 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015093.1 protein_id gnl|my_center|LOCUS_18640 1552 1361 gene locus_tag LOCUS_18650 1552 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1948 1580 gene locus_tag LOCUS_18660 1948 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 1989 2783 gene locus_tag LOCUS_18670 1989 2783 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730661.1 protein_id gnl|my_center|LOCUS_18670 2786 3157 gene locus_tag LOCUS_18680 2786 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 3203 4354 gene locus_tag LOCUS_18690 3203 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence147 701 216 gene locus_tag LOCUS_18700 701 216 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902425.1 protein_id gnl|my_center|LOCUS_18700 1924 710 gene locus_tag LOCUS_18710 gene bcd2 1924 710 CDS product butyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_18710 2459 1965 gene locus_tag LOCUS_18720 2459 1965 CDS product molybdenum cofactor biosynthesis protein MoeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 protein_id gnl|my_center|LOCUS_18720 2647 2735 gene locus_tag LOCUS_t00400 2647 2735 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2838 3992 gene locus_tag LOCUS_18730 2838 3992 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_18730 4005 4352 gene locus_tag LOCUS_18740 4005 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence148 1847 657 gene locus_tag LOCUS_18750 1847 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 3078 2689 gene locus_tag LOCUS_18760 3078 2689 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895688.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence149 624 82 gene locus_tag LOCUS_18770 gene rplJ 624 82 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U849 protein_id gnl|my_center|LOCUS_18770 1335 634 gene locus_tag LOCUS_18780 gene rplA 1335 634 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y3 protein_id gnl|my_center|LOCUS_18780 1765 1337 gene locus_tag LOCUS_18790 gene rplK 1765 1337 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66054 protein_id gnl|my_center|LOCUS_18790 2349 1801 gene locus_tag LOCUS_18800 gene nusG 2349 1801 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y1 protein_id gnl|my_center|LOCUS_18800 2547 2359 gene locus_tag LOCUS_18810 gene secE 2547 2359 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y0 protein_id gnl|my_center|LOCUS_18810 2688 2612 gene locus_tag LOCUS_t00410 2688 2612 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4009 2819 gene locus_tag LOCUS_18820 gene tuf-1 4009 2819 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_953902.1 protein_id gnl|my_center|LOCUS_18820 4277 4202 gene locus_tag LOCUS_t00420 4277 4202 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence150 2109 1303 gene locus_tag LOCUS_18830 2109 1303 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_18830 2813 2106 gene locus_tag LOCUS_18840 gene yggS 2813 2106 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_18840 3420 2800 gene locus_tag LOCUS_18850 3420 2800 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA14 protein_id gnl|my_center|LOCUS_18850 <4143 3499 gene locus_tag LOCUS_18860 <4143 3499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SJP8:4-hydroxyphenylacetate 3-monooxygenase oxygenase component >Feature sequence151 <1 900 gene locus_tag LOCUS_18870 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNA0:glutamate-1-semialdehyde 2,1-aminomutase 1021 1320 gene locus_tag LOCUS_18880 1021 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 1317 1787 gene locus_tag LOCUS_18890 1317 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 1784 2503 gene locus_tag LOCUS_18900 gene atpB 1784 2503 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GB2 protein_id gnl|my_center|LOCUS_18900 2553 2885 gene locus_tag LOCUS_18910 2553 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2989 3609 gene locus_tag LOCUS_18920 2989 3609 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877575.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence152 185 1903 gene locus_tag LOCUS_18930 185 1903 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_18930 1994 3271 gene locus_tag LOCUS_18940 1994 3271 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878430.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence153 853 311 gene locus_tag LOCUS_18950 853 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 1376 2110 gene locus_tag LOCUS_18960 1376 2110 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731052.1 protein_id gnl|my_center|LOCUS_18960 2668 2183 gene locus_tag LOCUS_18970 2668 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2743 3279 gene locus_tag LOCUS_18980 gene yddQ 2743 3279 CDS product putative isochorismatase family protein YddQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96654 protein_id gnl|my_center|LOCUS_18980 3315 3896 gene locus_tag LOCUS_18990 3315 3896 CDS product putative biphenyl-2,3-diol 1,2-dioxygenase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705084.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence154 133 891 gene locus_tag LOCUS_19000 gene paaG 133 891 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228150.1 protein_id gnl|my_center|LOCUS_19000 907 1962 gene locus_tag LOCUS_19010 907 1962 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_19010 2875 2018 gene locus_tag LOCUS_19020 2875 2018 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_19020 2989 3381 gene locus_tag LOCUS_19030 2989 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267535.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence155 738 64 gene locus_tag LOCUS_19040 738 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 773 848 gene locus_tag LOCUS_t00430 773 848 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2011 890 gene locus_tag LOCUS_19050 2011 890 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104430.1 protein_id gnl|my_center|LOCUS_19050 2164 3819 gene locus_tag LOCUS_19060 2164 3819 CDS product 2,4-dichlorophenol 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227785.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence156 1835 468 gene locus_tag LOCUS_19070 1835 468 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_19070 1985 2602 gene locus_tag LOCUS_19080 1985 2602 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933053.1 protein_id gnl|my_center|LOCUS_19080 3519 2674 gene locus_tag LOCUS_19090 3519 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19090 3908 3531 gene locus_tag LOCUS_19100 3908 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence157 645 319 gene locus_tag LOCUS_19110 gene trx 645 319 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72B01 protein_id gnl|my_center|LOCUS_19110 738 1340 gene locus_tag LOCUS_19120 gene gmhA 738 1340 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67054 protein_id gnl|my_center|LOCUS_19120 1372 1920 gene locus_tag LOCUS_19130 1372 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 1913 2701 gene locus_tag LOCUS_19140 1913 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence158 1342 386 gene locus_tag LOCUS_19150 1342 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 <3851 1496 gene locus_tag LOCUS_19160 <3851 1496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525850.1:DNA topoisomerase III >Feature sequence159 <1 731 gene locus_tag LOCUS_19170 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227362.1:epoxide hydrolase 2623 752 gene locus_tag LOCUS_19180 2623 752 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258126.1 protein_id gnl|my_center|LOCUS_19180 <3751 2623 gene locus_tag LOCUS_19190 <3751 2623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258127.1:5-oxoprolinase >Feature sequence160 108 1226 gene locus_tag LOCUS_19200 108 1226 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_19200 2067 1252 gene locus_tag LOCUS_19210 gene menB 2067 1252 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23966 protein_id gnl|my_center|LOCUS_19210 2722 2216 gene locus_tag LOCUS_19220 2722 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_19220 3299 2868 gene locus_tag LOCUS_19230 3299 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence161 1276 986 gene locus_tag LOCUS_19240 1276 986 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_19240 2419 1280 gene locus_tag LOCUS_19250 2419 1280 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921137.1 protein_id gnl|my_center|LOCUS_19250 3469 2588 gene locus_tag LOCUS_19260 3469 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence162 <1 903 gene locus_tag LOCUS_19270 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083841.1:acyl-CoA dehydrogenase 916 2058 gene locus_tag LOCUS_19280 916 2058 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 protein_id gnl|my_center|LOCUS_19280 2153 3097 gene locus_tag LOCUS_19290 gene hemE 2153 3097 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746R5 protein_id gnl|my_center|LOCUS_19290 >Feature sequence163 244 696 gene locus_tag LOCUS_19300 244 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 741 2711 gene locus_tag LOCUS_19310 741 2711 CDS product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence164 18 1241 gene locus_tag LOCUS_19320 18 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 1968 1264 gene locus_tag LOCUS_19330 1968 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2969 2007 gene locus_tag LOCUS_19340 2969 2007 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence165 118 1068 gene locus_tag LOCUS_19350 118 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1308 2477 gene locus_tag LOCUS_19360 1308 2477 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926041.1 protein_id gnl|my_center|LOCUS_19360 2964 2710 gene locus_tag LOCUS_19370 2964 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence166 1167 754 gene locus_tag LOCUS_19380 1167 754 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IL8 protein_id gnl|my_center|LOCUS_19380 2198 1164 gene locus_tag LOCUS_19390 2198 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2323 3087 gene locus_tag LOCUS_19400 2323 3087 CDS product putative enoyl-CoA dehydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702794.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence167 1976 309 gene locus_tag LOCUS_19410 1976 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 3191 1977 gene locus_tag LOCUS_19420 gene dxr 3191 1977 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG43 protein_id gnl|my_center|LOCUS_19420 >Feature sequence168 1 753 gene locus_tag LOCUS_19430 1 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 750 1778 gene locus_tag LOCUS_19440 gene gmd 750 1778 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97H33 protein_id gnl|my_center|LOCUS_19440 1768 2940 gene locus_tag LOCUS_19450 1768 2940 CDS product hexosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021210.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence169 <1 1741 gene locus_tag LOCUS_19460 <1 1741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804353.1:potassium transporter 1754 2506 gene locus_tag LOCUS_19470 1754 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence170 194 1288 gene locus_tag LOCUS_19480 194 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2275 1298 gene locus_tag LOCUS_19490 2275 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 3150 2284 gene locus_tag LOCUS_19500 3150 2284 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187690.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence171 1898 1419 gene locus_tag LOCUS_19510 1898 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1980 2963 gene locus_tag LOCUS_19520 gene galE 1980 2963 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475725.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence172 1267 701 gene locus_tag LOCUS_19530 gene frr 1267 701 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61304 protein_id gnl|my_center|LOCUS_19530 1991 1281 gene locus_tag LOCUS_19540 gene pyrH 1991 1281 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW2 protein_id gnl|my_center|LOCUS_19540 2863 1988 gene locus_tag LOCUS_19550 gene tsf 2863 1988 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEY9 protein_id gnl|my_center|LOCUS_19550 >Feature sequence173 22 555 gene locus_tag LOCUS_19560 22 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 567 1892 gene locus_tag LOCUS_19570 567 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence174 334 1587 gene locus_tag LOCUS_19580 gene ribA 334 1587 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI3 protein_id gnl|my_center|LOCUS_19580 1593 2576 gene locus_tag LOCUS_19590 1593 2576 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258665.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence175 <1 700 gene locus_tag LOCUS_19600 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920753.1:nicotinate-nucleotide diphosphorylase (carboxylating) 690 1490 gene locus_tag LOCUS_19610 gene coaX 690 1490 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BU2 protein_id gnl|my_center|LOCUS_19610 2634 1522 gene locus_tag LOCUS_19620 2634 1522 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLS7 protein_id gnl|my_center|LOCUS_19620 >Feature sequence176 1446 58 gene locus_tag LOCUS_19630 gene argH 1446 58 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence177 1133 528 gene locus_tag LOCUS_19640 1133 528 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088352.1 protein_id gnl|my_center|LOCUS_19640 1506 1165 gene locus_tag LOCUS_19650 1506 1165 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU09 protein_id gnl|my_center|LOCUS_19650 <2819 1530 gene locus_tag LOCUS_19660 <2819 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HHS9:DNA helicase >Feature sequence178 <1 887 gene locus_tag LOCUS_19670 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770365.1:beta-ketoacyl-ACP synthase 998 1246 gene locus_tag LOCUS_19680 gene acpP 998 1246 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FA8 protein_id gnl|my_center|LOCUS_19680 1509 2006 gene locus_tag LOCUS_19690 1509 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 1999 2643 gene locus_tag LOCUS_19700 1999 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence179 1888 884 gene locus_tag LOCUS_19710 1888 884 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_19710 2666 1896 gene locus_tag LOCUS_19720 2666 1896 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence180 66 962 gene locus_tag LOCUS_19730 66 962 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E95 protein_id gnl|my_center|LOCUS_19730 1920 967 gene locus_tag LOCUS_19740 1920 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence181 107 1138 gene locus_tag LOCUS_19750 107 1138 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527983.1 protein_id gnl|my_center|LOCUS_19750 1188 2111 gene locus_tag LOCUS_19760 gene mvaB 1188 2111 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037002.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence182 <1 654 gene locus_tag LOCUS_19770 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RZI1:octanoyltransferase 658 1128 gene locus_tag LOCUS_19780 658 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1478 1125 gene locus_tag LOCUS_19790 gene crcB 1478 1125 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY60 protein_id gnl|my_center|LOCUS_19790 1577 1650 gene locus_tag LOCUS_t00440 1577 1650 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1828 2196 gene locus_tag LOCUS_19800 1828 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence183 <1 1283 gene locus_tag LOCUS_19810 <1 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098652.1:3-phenylpropionate dioxygenase 1310 2176 gene locus_tag LOCUS_19820 1310 2176 CDS product 2-hydroxy-6-ketonona-2,4-dienedioic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730147.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence184 1209 313 gene locus_tag LOCUS_19830 1209 313 CDS product iron-dependent extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224395.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence185 1051 329 gene locus_tag LOCUS_19840 1051 329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence186 318 1652 gene locus_tag LOCUS_19850 318 1652 CDS product tricarballylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813511.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence187 788 2032 gene locus_tag LOCUS_19860 788 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113399.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence188 >Feature sequence189 351 779 gene locus_tag LOCUS_19870 351 779 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_19870 792 1769 gene locus_tag LOCUS_19880 792 1769 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392393.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence190 1179 271 gene locus_tag LOCUS_19890 1179 271 CDS product malyl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731422.1 protein_id gnl|my_center|LOCUS_19890 <1998 1187 gene locus_tag LOCUS_19900 <1998 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063669.1:CoA transferase >Feature sequence191 <1 729 gene locus_tag LOCUS_19910 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728415.1:3-oxoacyl-ACP reductase 745 1599 gene locus_tag LOCUS_19920 745 1599 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266331.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence192 <1907 1321 gene locus_tag LOCUS_19930 <1907 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SJ18:arginine biosynthesis bifunctional protein ArgJ >Feature sequence193