>Feature sequence001 1399 2367 gene locus_tag LOCUS_00010 1399 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2383 3594 gene locus_tag LOCUS_00020 2383 3594 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869954.1 protein_id gnl|my_center|LOCUS_00020 3684 3995 gene locus_tag LOCUS_00030 3684 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4284 4478 gene locus_tag LOCUS_00040 4284 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4539 4724 gene locus_tag LOCUS_00050 4539 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4929 5741 gene locus_tag LOCUS_00060 4929 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5745 7064 gene locus_tag LOCUS_00070 5745 7064 CDS product arsenical pump family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253041.1 protein_id gnl|my_center|LOCUS_00070 7064 8767 gene locus_tag LOCUS_00080 7064 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8782 9657 gene locus_tag LOCUS_00090 8782 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9692 10327 gene locus_tag LOCUS_00100 9692 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10403 11176 gene locus_tag LOCUS_00110 10403 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11188 11580 gene locus_tag LOCUS_00120 11188 11580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11564 12523 gene locus_tag LOCUS_00130 11564 12523 CDS product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_00130 12729 13868 gene locus_tag LOCUS_00140 12729 13868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 13926 14585 gene locus_tag LOCUS_00150 13926 14585 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140007.1 protein_id gnl|my_center|LOCUS_00150 15957 14659 gene locus_tag LOCUS_00160 15957 14659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17316 16084 gene locus_tag LOCUS_00170 17316 16084 CDS product arsenite permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020830.1 protein_id gnl|my_center|LOCUS_00170 <18719 17481 gene locus_tag LOCUS_00180 <18719 17481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530417.1:oxidoreductase FAD/NAD(P)-binding domain-containing protein >Feature sequence002 <1 1879 gene locus_tag LOCUS_00190 <1 1879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q748Y8:elongation factor G 2 1910 3100 gene locus_tag LOCUS_00200 gene tuf-2 1910 3100 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_953913.1 protein_id gnl|my_center|LOCUS_00200 3100 3408 gene locus_tag LOCUS_00210 gene rpsJ 3100 3408 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z0 protein_id gnl|my_center|LOCUS_00210 3436 4071 gene locus_tag LOCUS_00220 gene rplC 3436 4071 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHN8 protein_id gnl|my_center|LOCUS_00220 4073 4699 gene locus_tag LOCUS_00230 gene rplD 4073 4699 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFP8 protein_id gnl|my_center|LOCUS_00230 4699 4989 gene locus_tag LOCUS_00240 gene rplW 4699 4989 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5X3 protein_id gnl|my_center|LOCUS_00240 4996 5823 gene locus_tag LOCUS_00250 gene rplB 4996 5823 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH7 protein_id gnl|my_center|LOCUS_00250 5846 6130 gene locus_tag LOCUS_00260 gene rpsS 5846 6130 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CH6 protein_id gnl|my_center|LOCUS_00260 6179 6514 gene locus_tag LOCUS_00270 gene rplV 6179 6514 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS31 protein_id gnl|my_center|LOCUS_00270 6536 7198 gene locus_tag LOCUS_00280 gene rpsC 6536 7198 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z4 protein_id gnl|my_center|LOCUS_00280 7269 7676 gene locus_tag LOCUS_00290 gene rplP 7269 7676 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z5 protein_id gnl|my_center|LOCUS_00290 7694 7924 gene locus_tag LOCUS_00300 gene rpmC 7694 7924 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPQ0 protein_id gnl|my_center|LOCUS_00300 7964 8251 gene locus_tag LOCUS_00310 gene rpsQ 7964 8251 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1E2 protein_id gnl|my_center|LOCUS_00310 8248 8616 gene locus_tag LOCUS_00320 gene rplN 8248 8616 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5C7 protein_id gnl|my_center|LOCUS_00320 8622 8951 gene locus_tag LOCUS_00330 gene rplX 8622 8951 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CI78 protein_id gnl|my_center|LOCUS_00330 8976 9518 gene locus_tag LOCUS_00340 gene rplE 8976 9518 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Z9 protein_id gnl|my_center|LOCUS_00340 9809 10204 gene locus_tag LOCUS_00350 9809 10204 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459105.1 protein_id gnl|my_center|LOCUS_00350 10281 10829 gene locus_tag LOCUS_00360 gene rplF 10281 10829 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EJ3 protein_id gnl|my_center|LOCUS_00360 10840 11208 gene locus_tag LOCUS_00370 gene rplR 10840 11208 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A3 protein_id gnl|my_center|LOCUS_00370 11295 11780 gene locus_tag LOCUS_00380 gene rpsE 11295 11780 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CG3 protein_id gnl|my_center|LOCUS_00380 11799 12239 gene locus_tag LOCUS_00390 gene rplO 11799 12239 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7I7 protein_id gnl|my_center|LOCUS_00390 12240 13556 gene locus_tag LOCUS_00400 gene secY 12240 13556 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749A7 protein_id gnl|my_center|LOCUS_00400 13561 14205 gene locus_tag LOCUS_00410 gene adk 13561 14205 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHP1 protein_id gnl|my_center|LOCUS_00410 14210 14428 gene locus_tag LOCUS_00420 gene infA 14210 14428 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61688 protein_id gnl|my_center|LOCUS_00420 14611 14985 gene locus_tag LOCUS_00430 gene rpsM 14611 14985 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFS3 protein_id gnl|my_center|LOCUS_00430 15001 15387 gene locus_tag LOCUS_00440 gene rpsK 15001 15387 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPN3 protein_id gnl|my_center|LOCUS_00440 15594 16052 gene locus_tag LOCUS_00450 15594 16052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 >Feature sequence003 3937 881 gene locus_tag LOCUS_00460 3937 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 4777 3962 gene locus_tag LOCUS_00470 4777 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 7132 4793 gene locus_tag LOCUS_00480 7132 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 7406 7735 gene locus_tag LOCUS_00490 7406 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 7914 8219 gene locus_tag LOCUS_00500 7914 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 8264 8536 gene locus_tag LOCUS_00510 8264 8536 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_00510 8582 9325 gene locus_tag LOCUS_00520 8582 9325 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_00520 10537 9341 gene locus_tag LOCUS_00530 10537 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 13268 10965 gene locus_tag LOCUS_00540 gene tex 13268 10965 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_00540 13684 13361 gene locus_tag LOCUS_00550 13684 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 13839 14705 gene locus_tag LOCUS_00560 13839 14705 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857952.1 protein_id gnl|my_center|LOCUS_00560 >Feature sequence004 1450 503 gene locus_tag LOCUS_00570 1450 503 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869446.1 protein_id gnl|my_center|LOCUS_00570 1633 1974 gene locus_tag LOCUS_00580 1633 1974 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012547195.1 protein_id gnl|my_center|LOCUS_00580 2059 2331 gene locus_tag LOCUS_00590 2059 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 2465 3136 gene locus_tag LOCUS_00600 2465 3136 CDS product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830177.1 protein_id gnl|my_center|LOCUS_00600 3147 5087 gene locus_tag LOCUS_00610 gene sdhA 3147 5087 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122818.1 protein_id gnl|my_center|LOCUS_00610 5101 5844 gene locus_tag LOCUS_00620 5101 5844 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808702.1 protein_id gnl|my_center|LOCUS_00620 6037 6918 gene locus_tag LOCUS_00630 gene ispH 6037 6918 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH70 protein_id gnl|my_center|LOCUS_00630 7142 8254 gene locus_tag LOCUS_00640 7142 8254 CDS product farnesyl-diphosphate farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_00640 8260 8703 gene locus_tag LOCUS_00650 8260 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 8758 9183 gene locus_tag LOCUS_00660 8758 9183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 9259 9642 gene locus_tag LOCUS_00670 9259 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 9656 9820 gene locus_tag LOCUS_00680 9656 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 9886 10401 gene locus_tag LOCUS_00690 9886 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 10501 10797 gene locus_tag LOCUS_00700 10501 10797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 11147 12397 gene locus_tag LOCUS_00710 11147 12397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 12863 12411 gene locus_tag LOCUS_00720 12863 12411 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_00720 14041 13250 gene locus_tag LOCUS_00730 14041 13250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 >Feature sequence005 154 1737 gene locus_tag LOCUS_00740 gene leuA 154 1737 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJS7 protein_id gnl|my_center|LOCUS_00740 1821 2018 gene locus_tag LOCUS_00750 1821 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 2485 4041 gene locus_tag LOCUS_00760 2485 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 5272 4058 gene locus_tag LOCUS_00770 5272 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 6345 5401 gene locus_tag LOCUS_00780 6345 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 8554 6356 gene locus_tag LOCUS_00790 8554 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 9645 8788 gene locus_tag LOCUS_00800 9645 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 9821 11824 gene locus_tag LOCUS_00810 9821 11824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 11843 13027 gene locus_tag LOCUS_00820 11843 13027 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 protein_id gnl|my_center|LOCUS_00820 14160 13261 gene locus_tag LOCUS_00830 14160 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 >Feature sequence006 1230 2117 gene locus_tag LOCUS_00840 1230 2117 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257650.1 protein_id gnl|my_center|LOCUS_00840 2375 3013 gene locus_tag LOCUS_00850 gene pglB 2375 3013 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403382.1 protein_id gnl|my_center|LOCUS_00850 3090 4097 gene locus_tag LOCUS_00860 3090 4097 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_00860 4094 5275 gene locus_tag LOCUS_00870 4094 5275 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_00870 5289 6347 gene locus_tag LOCUS_00880 5289 6347 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_00880 6347 7066 gene locus_tag LOCUS_00890 gene neuA 6347 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_00890 7091 8053 gene locus_tag LOCUS_00900 7091 8053 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257986.1 protein_id gnl|my_center|LOCUS_00900 8056 9210 gene locus_tag LOCUS_00910 8056 9210 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942618.1 protein_id gnl|my_center|LOCUS_00910 9261 11252 gene locus_tag LOCUS_00920 9261 11252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 11602 11345 gene locus_tag LOCUS_00930 11602 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 12248 12054 gene locus_tag LOCUS_00940 12248 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 12734 12279 gene locus_tag LOCUS_00950 12734 12279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403541.1 protein_id gnl|my_center|LOCUS_00950 13389 12994 gene locus_tag LOCUS_00960 13389 12994 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546014.1 protein_id gnl|my_center|LOCUS_00960 >Feature sequence007 1253 1029 gene locus_tag LOCUS_00970 1253 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 3068 1257 gene locus_tag LOCUS_00980 3068 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965497.1 protein_id gnl|my_center|LOCUS_00980 3922 3476 gene locus_tag LOCUS_00990 3922 3476 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016670.1 protein_id gnl|my_center|LOCUS_00990 4991 4305 gene locus_tag LOCUS_01000 gene apr 4991 4305 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942361.1 protein_id gnl|my_center|LOCUS_01000 5485 6861 gene locus_tag LOCUS_01010 gene degQ 5485 6861 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_01010 6954 11909 gene locus_tag LOCUS_01020 6954 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 12083 12883 gene locus_tag LOCUS_01030 12083 12883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 >Feature sequence008 <1 549 gene locus_tag LOCUS_01040 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RFJ6:7-cyano-7-deazaguanine synthase 559 792 gene locus_tag LOCUS_01050 559 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 1441 815 gene locus_tag LOCUS_01060 1441 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 2549 1464 gene locus_tag LOCUS_01070 2549 1464 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941566.1 protein_id gnl|my_center|LOCUS_01070 2937 2554 gene locus_tag LOCUS_01080 2937 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226666.1 protein_id gnl|my_center|LOCUS_01080 3344 2952 gene locus_tag LOCUS_01090 3344 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 4757 3420 gene locus_tag LOCUS_01100 4757 3420 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940275.1 protein_id gnl|my_center|LOCUS_01100 5721 4774 gene locus_tag LOCUS_01110 5721 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 7777 5738 gene locus_tag LOCUS_01120 7777 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 protein_id gnl|my_center|LOCUS_01120 10502 7794 gene locus_tag LOCUS_01130 10502 7794 CDS product ClpV1 family T6SS ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269330.1 protein_id gnl|my_center|LOCUS_01130 11684 10653 gene locus_tag LOCUS_01140 11684 10653 CDS product type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269329.1 protein_id gnl|my_center|LOCUS_01140 13465 11648 gene locus_tag LOCUS_01150 13465 11648 CDS product type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343627.1 protein_id gnl|my_center|LOCUS_01150 >Feature sequence009 <1 981 gene locus_tag LOCUS_01160 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000451037.1:transporter 3654 985 gene locus_tag LOCUS_01170 3654 985 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_01170 4139 3912 gene locus_tag LOCUS_01180 4139 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 4435 6042 gene locus_tag LOCUS_01190 4435 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 6300 6959 gene locus_tag LOCUS_01200 6300 6959 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Z9 protein_id gnl|my_center|LOCUS_01200 6952 8436 gene locus_tag LOCUS_01210 6952 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 10720 8483 gene locus_tag LOCUS_01220 10720 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 11340 10855 gene locus_tag LOCUS_01230 11340 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 <12407 11373 gene locus_tag LOCUS_01240 <12407 11373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P50848:carboxypeptidase 1 >Feature sequence010 1589 522 gene locus_tag LOCUS_01250 1589 522 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 protein_id gnl|my_center|LOCUS_01250 2764 1592 gene locus_tag LOCUS_01260 2764 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 3455 2700 gene locus_tag LOCUS_01270 3455 2700 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJH7 protein_id gnl|my_center|LOCUS_01270 4282 3515 gene locus_tag LOCUS_01280 4282 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 5590 4421 gene locus_tag LOCUS_01290 5590 4421 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 protein_id gnl|my_center|LOCUS_01290 5751 5999 gene locus_tag LOCUS_01300 5751 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 6268 8079 gene locus_tag LOCUS_01310 6268 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 9801 8377 gene locus_tag LOCUS_01320 9801 8377 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0W2 protein_id gnl|my_center|LOCUS_01320 9972 10388 gene locus_tag LOCUS_01330 9972 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708780.1 protein_id gnl|my_center|LOCUS_01330 >Feature sequence011 <1 1070 gene locus_tag LOCUS_01340 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388476.1:methyl-accepting chemotaxis protein 1181 4180 gene locus_tag LOCUS_01350 1181 4180 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122988.1 protein_id gnl|my_center|LOCUS_01350 4620 4228 gene locus_tag LOCUS_01360 4620 4228 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980198.1 protein_id gnl|my_center|LOCUS_01360 6867 4639 gene locus_tag LOCUS_01370 6867 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203361.1 protein_id gnl|my_center|LOCUS_01370 7399 6989 gene locus_tag LOCUS_01380 7399 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 7682 7467 gene locus_tag LOCUS_01390 7682 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 8784 7717 gene locus_tag LOCUS_01400 gene hypE 8784 7717 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_01400 9872 8781 gene locus_tag LOCUS_01410 9872 8781 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_01410 10123 9869 gene locus_tag LOCUS_01420 10123 9869 CDS product hydrogenase assembly protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_01420 <11759 10125 gene locus_tag LOCUS_01430 <11759 10125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GE0:carbamoyltransferase HypF >Feature sequence012 <1 2086 gene locus_tag LOCUS_01440 <1 2086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532918.1:short-chain dehydrogenase 2160 3632 gene locus_tag LOCUS_01450 2160 3632 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ72 protein_id gnl|my_center|LOCUS_01450 3731 4036 gene locus_tag LOCUS_01460 3731 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 5163 4033 gene locus_tag LOCUS_01470 5163 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 6109 8499 gene locus_tag LOCUS_01480 6109 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 8486 10639 gene locus_tag LOCUS_01490 8486 10639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 >Feature sequence013 27 2060 gene locus_tag LOCUS_01500 27 2060 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_01500 2102 2326 gene locus_tag LOCUS_01510 2102 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 4005 2344 gene locus_tag LOCUS_01520 4005 2344 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140025.1 protein_id gnl|my_center|LOCUS_01520 5485 4013 gene locus_tag LOCUS_01530 5485 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 7079 5547 gene locus_tag LOCUS_01540 7079 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140024.1 protein_id gnl|my_center|LOCUS_01540 7280 8170 gene locus_tag LOCUS_01550 7280 8170 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927682.1 protein_id gnl|my_center|LOCUS_01550 9696 8341 gene locus_tag LOCUS_01560 9696 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 9901 10161 gene locus_tag LOCUS_01570 9901 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 10690 10178 gene locus_tag LOCUS_01580 10690 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 protein_id gnl|my_center|LOCUS_01580 >Feature sequence014 1493 12 gene locus_tag LOCUS_01590 1493 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 2521 1490 gene locus_tag LOCUS_01600 2521 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 3455 2547 gene locus_tag LOCUS_01610 3455 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 4086 3460 gene locus_tag LOCUS_01620 4086 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 4474 4064 gene locus_tag LOCUS_01630 4474 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 4973 4554 gene locus_tag LOCUS_01640 gene gspG 4973 4554 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_01640 6216 4993 gene locus_tag LOCUS_01650 6216 4993 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583240.1 protein_id gnl|my_center|LOCUS_01650 8071 6365 gene locus_tag LOCUS_01660 gene gspE 8071 6365 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 protein_id gnl|my_center|LOCUS_01660 8896 8075 gene locus_tag LOCUS_01670 8896 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 9082 9435 gene locus_tag LOCUS_01680 9082 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 10790 9441 gene locus_tag LOCUS_01690 10790 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 >Feature sequence015 704 1474 gene locus_tag LOCUS_01700 704 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 1779 5390 gene locus_tag LOCUS_01710 1779 5390 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259744.1 protein_id gnl|my_center|LOCUS_01710 5621 8056 gene locus_tag LOCUS_01720 5621 8056 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545172.1 protein_id gnl|my_center|LOCUS_01720 8227 10509 gene locus_tag LOCUS_01730 gene yaeT 8227 10509 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT3 protein_id gnl|my_center|LOCUS_01730 >Feature sequence016 636 3476 gene locus_tag LOCUS_01740 636 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 3494 4783 gene locus_tag LOCUS_01750 3494 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 4879 5811 gene locus_tag LOCUS_01760 4879 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 5815 6582 gene locus_tag LOCUS_01770 5815 6582 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_01770 7183 6596 gene locus_tag LOCUS_01780 7183 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_01780 7381 8361 gene locus_tag LOCUS_01790 7381 8361 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423295.1 protein_id gnl|my_center|LOCUS_01790 >Feature sequence017 275 610 gene locus_tag LOCUS_01800 275 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 653 952 gene locus_tag LOCUS_01810 653 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 1067 1543 gene locus_tag LOCUS_01820 1067 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106151.1 protein_id gnl|my_center|LOCUS_01820 1588 1839 gene locus_tag LOCUS_01830 1588 1839 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_01830 1860 2081 gene locus_tag LOCUS_01840 1860 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 2128 2736 gene locus_tag LOCUS_01850 2128 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 2778 4595 gene locus_tag LOCUS_01860 2778 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 4745 5230 gene locus_tag LOCUS_01870 4745 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 6902 5343 gene locus_tag LOCUS_01880 gene speE2 6902 5343 CDS product polyamine aminopropyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67365 protein_id gnl|my_center|LOCUS_01880 7794 6949 gene locus_tag LOCUS_01890 7794 6949 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425211.1 protein_id gnl|my_center|LOCUS_01890 8552 7839 gene locus_tag LOCUS_01900 8552 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 10063 10740 gene locus_tag LOCUS_01910 10063 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 >Feature sequence018 <1 2235 gene locus_tag LOCUS_01920 <1 2235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105802.1:RND transporter 2266 3054 gene locus_tag LOCUS_01930 2266 3054 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_01930 3265 3939 gene locus_tag LOCUS_01940 3265 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 4020 4340 gene locus_tag LOCUS_01950 gene yqjZ 4020 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54563 protein_id gnl|my_center|LOCUS_01950 4445 6754 gene locus_tag LOCUS_01960 4445 6754 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_01960 6747 7964 gene locus_tag LOCUS_01970 6747 7964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_01970 8262 9593 gene locus_tag LOCUS_01980 8262 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 9650 10375 gene locus_tag LOCUS_01990 gene cmoA 9650 10375 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PAS7 protein_id gnl|my_center|LOCUS_01990 >Feature sequence019 2556 1246 gene locus_tag LOCUS_02000 gene trmFO 2556 1246 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A44 protein_id gnl|my_center|LOCUS_02000 4915 2642 gene locus_tag LOCUS_02010 gene topA 4915 2642 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGH1 protein_id gnl|my_center|LOCUS_02010 6039 4939 gene locus_tag LOCUS_02020 6039 4939 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_02020 7044 6217 gene locus_tag LOCUS_02030 7044 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 8569 7685 gene locus_tag LOCUS_02040 8569 7685 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257004.1 protein_id gnl|my_center|LOCUS_02040 8696 8959 gene locus_tag LOCUS_02050 8696 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 10266 8965 gene locus_tag LOCUS_02060 10266 8965 CDS product gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_02060 >Feature sequence020 1133 210 gene locus_tag LOCUS_02070 1133 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 1995 1123 gene locus_tag LOCUS_02080 1995 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 2957 1992 gene locus_tag LOCUS_02090 2957 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 4450 3095 gene locus_tag LOCUS_02100 4450 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 6585 4426 gene locus_tag LOCUS_02110 6585 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 7453 6575 gene locus_tag LOCUS_02120 7453 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143034.1 protein_id gnl|my_center|LOCUS_02120 8161 7457 gene locus_tag LOCUS_02130 8161 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 9666 8278 gene locus_tag LOCUS_02140 9666 8278 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122697.1 protein_id gnl|my_center|LOCUS_02140 10294 9749 gene locus_tag LOCUS_02150 10294 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 >Feature sequence021 210 1214 gene locus_tag LOCUS_02160 gene rbsK 210 1214 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683574.1 protein_id gnl|my_center|LOCUS_02160 2636 1233 gene locus_tag LOCUS_02170 gene mltF 2636 1233 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX03 protein_id gnl|my_center|LOCUS_02170 3951 2902 gene locus_tag LOCUS_02180 3951 2902 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228858.1 protein_id gnl|my_center|LOCUS_02180 4430 3978 gene locus_tag LOCUS_02190 4430 3978 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_02190 5726 4470 gene locus_tag LOCUS_02200 gene sufS 5726 4470 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_02200 7038 5719 gene locus_tag LOCUS_02210 gene sufD 7038 5719 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_02210 7797 7048 gene locus_tag LOCUS_02220 7797 7048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_02220 9379 7916 gene locus_tag LOCUS_02230 gene ycf24 9379 7916 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_02230 10162 9407 gene locus_tag LOCUS_02240 10162 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883496.1 protein_id gnl|my_center|LOCUS_02240 >Feature sequence022 658 1401 gene locus_tag LOCUS_02250 gene spsF 658 1401 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965489.1 protein_id gnl|my_center|LOCUS_02250 1438 2511 gene locus_tag LOCUS_02260 gene neuB 1438 2511 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942614.1 protein_id gnl|my_center|LOCUS_02260 3488 2556 gene locus_tag LOCUS_02270 3488 2556 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724106.1 protein_id gnl|my_center|LOCUS_02270 3744 5372 gene locus_tag LOCUS_02280 3744 5372 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249504.1 protein_id gnl|my_center|LOCUS_02280 5383 5928 gene locus_tag LOCUS_02290 5383 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 7203 7646 gene locus_tag LOCUS_02300 7203 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 8688 7663 gene locus_tag LOCUS_02310 8688 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 9772 8747 gene locus_tag LOCUS_02320 9772 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620274.1 protein_id gnl|my_center|LOCUS_02320 >Feature sequence023 <1 1267 gene locus_tag LOCUS_02330 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to I7F9Q4:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 1286 2371 gene locus_tag LOCUS_02340 gene mraY 1286 2371 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728U5 protein_id gnl|my_center|LOCUS_02340 2375 3712 gene locus_tag LOCUS_02350 gene murD 2375 3712 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D4 protein_id gnl|my_center|LOCUS_02350 3748 4872 gene locus_tag LOCUS_02360 gene ftsW 3748 4872 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D5 protein_id gnl|my_center|LOCUS_02360 4879 5994 gene locus_tag LOCUS_02370 gene murG 4879 5994 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748D6 protein_id gnl|my_center|LOCUS_02370 6018 7415 gene locus_tag LOCUS_02380 gene murC 6018 7415 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61679 protein_id gnl|my_center|LOCUS_02380 7424 8476 gene locus_tag LOCUS_02390 gene murB2 7424 8476 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HBI9 protein_id gnl|my_center|LOCUS_02390 8622 8807 gene locus_tag LOCUS_02400 8622 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 8788 9720 gene locus_tag LOCUS_02410 gene ddl 8788 9720 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFT1 protein_id gnl|my_center|LOCUS_02410 >Feature sequence024 155 859 gene locus_tag LOCUS_02420 155 859 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_02420 875 1270 gene locus_tag LOCUS_02430 875 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 1280 1687 gene locus_tag LOCUS_02440 1280 1687 CDS product biopolymer transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_604208.2 protein_id gnl|my_center|LOCUS_02440 1765 2103 gene locus_tag LOCUS_02450 1765 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 2108 2926 gene locus_tag LOCUS_02460 2108 2926 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066558.1 protein_id gnl|my_center|LOCUS_02460 2985 3713 gene locus_tag LOCUS_02470 2985 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 3970 6258 gene locus_tag LOCUS_02480 3970 6258 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_02480 6508 8370 gene locus_tag LOCUS_02490 6508 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 >Feature sequence025 597 2372 gene locus_tag LOCUS_02500 597 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 3169 2621 gene locus_tag LOCUS_02510 3169 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 3328 4320 gene locus_tag LOCUS_02520 3328 4320 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_02520 5181 4333 gene locus_tag LOCUS_02530 5181 4333 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766711.1 protein_id gnl|my_center|LOCUS_02530 5912 5292 gene locus_tag LOCUS_02540 gene hisH 5912 5292 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHA2 protein_id gnl|my_center|LOCUS_02540 6500 5913 gene locus_tag LOCUS_02550 gene hisB 6500 5913 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60885 protein_id gnl|my_center|LOCUS_02550 8487 6493 gene locus_tag LOCUS_02560 gene dxs1 8487 6493 CDS product 1-deoxy-D-xylulose-5-phosphate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FC3 protein_id gnl|my_center|LOCUS_02560 9389 8499 gene locus_tag LOCUS_02570 9389 8499 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence026 122 4330 gene locus_tag LOCUS_02580 gene rpoB 122 4330 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFV8 protein_id gnl|my_center|LOCUS_02580 4395 8492 gene locus_tag LOCUS_02590 gene rpoC 4395 8492 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7EPD8 protein_id gnl|my_center|LOCUS_02590 8661 9035 gene locus_tag LOCUS_02600 gene rpsL 8661 9035 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFP2 protein_id gnl|my_center|LOCUS_02600 9051 9521 gene locus_tag LOCUS_02610 gene rpsG 9051 9521 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J80 protein_id gnl|my_center|LOCUS_02610 >Feature sequence027 127 1263 gene locus_tag LOCUS_02620 127 1263 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257269.1 protein_id gnl|my_center|LOCUS_02620 1725 1264 gene locus_tag LOCUS_02630 gene fliW 1725 1264 CDS product flagellar assembly factor FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKH2 protein_id gnl|my_center|LOCUS_02630 1995 1750 gene locus_tag LOCUS_02640 gene csrA 1995 1750 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY93 protein_id gnl|my_center|LOCUS_02640 2181 2255 gene locus_tag LOCUS_t00010 2181 2255 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3287 2286 gene locus_tag LOCUS_02650 3287 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 5477 4668 gene locus_tag LOCUS_02660 gene fabI 5477 4668 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG49 protein_id gnl|my_center|LOCUS_02660 5958 5521 gene locus_tag LOCUS_02670 gene fabZ 5958 5521 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ9 protein_id gnl|my_center|LOCUS_02670 6092 7060 gene locus_tag LOCUS_02680 6092 7060 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086540.1 protein_id gnl|my_center|LOCUS_02680 7407 7057 gene locus_tag LOCUS_02690 7407 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 8488 7523 gene locus_tag LOCUS_02700 8488 7523 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118175.1 protein_id gnl|my_center|LOCUS_02700 8831 9571 gene locus_tag LOCUS_02710 gene gpmA 8831 9571 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFC8 protein_id gnl|my_center|LOCUS_02710 >Feature sequence028 104 1429 gene locus_tag LOCUS_02720 gene nhaD 104 1429 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_02720 2285 1494 gene locus_tag LOCUS_02730 2285 1494 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_02730 2394 3605 gene locus_tag LOCUS_02740 gene argD 2394 3605 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG65 protein_id gnl|my_center|LOCUS_02740 3634 4530 gene locus_tag LOCUS_02750 gene argF 3634 4530 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG66 protein_id gnl|my_center|LOCUS_02750 4585 5667 gene locus_tag LOCUS_02760 gene tgt 4585 5667 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183P1 protein_id gnl|my_center|LOCUS_02760 6525 5680 gene locus_tag LOCUS_02770 6525 5680 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882838.1 protein_id gnl|my_center|LOCUS_02770 6635 7084 gene locus_tag LOCUS_02780 6635 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 7779 7081 gene locus_tag LOCUS_02790 gene sfsA 7779 7081 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MP8 protein_id gnl|my_center|LOCUS_02790 9182 7827 gene locus_tag LOCUS_02800 gene nuoM-1 9182 7827 CDS product NADH:ubiquinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_02800 9214 9372 gene locus_tag LOCUS_02810 9214 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 >Feature sequence029 773 699 gene locus_tag LOCUS_t00020 773 699 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1243 1043 gene locus_tag LOCUS_02820 1243 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 1629 2867 gene locus_tag LOCUS_02830 1629 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 3109 6288 gene locus_tag LOCUS_02840 3109 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 6292 8352 gene locus_tag LOCUS_02850 6292 8352 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681441.1 protein_id gnl|my_center|LOCUS_02850 8409 9302 gene locus_tag LOCUS_02860 8409 9302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 >Feature sequence030 <1 1305 gene locus_tag LOCUS_02870 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941017.1:NADH-quinone oxidoreductase subunit L 1431 3020 gene locus_tag LOCUS_02880 1431 3020 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_02880 3057 4496 gene locus_tag LOCUS_02890 gene nuoN-1 3057 4496 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_02890 4549 4857 gene locus_tag LOCUS_02900 4549 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 4942 5712 gene locus_tag LOCUS_02910 4942 5712 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897326.1 protein_id gnl|my_center|LOCUS_02910 6248 5847 gene locus_tag LOCUS_02920 6248 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 7160 6513 gene locus_tag LOCUS_02930 gene rpe 7160 6513 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z3 protein_id gnl|my_center|LOCUS_02930 >Feature sequence031 191 595 gene locus_tag LOCUS_02940 191 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 882 2291 gene locus_tag LOCUS_02950 882 2291 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_02950 2261 3190 gene locus_tag LOCUS_02960 gene arnC 2261 3190 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY64 protein_id gnl|my_center|LOCUS_02960 3190 4035 gene locus_tag LOCUS_02970 3190 4035 CDS product radical SAM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253598.1 protein_id gnl|my_center|LOCUS_02970 4073 4885 gene locus_tag LOCUS_02980 4073 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 7480 4916 gene locus_tag LOCUS_02990 7480 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 9114 7537 gene locus_tag LOCUS_03000 9114 7537 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256915.1 protein_id gnl|my_center|LOCUS_03000 >Feature sequence032 95 2410 gene locus_tag LOCUS_03010 95 2410 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H4 protein_id gnl|my_center|LOCUS_03010 2432 4321 gene locus_tag LOCUS_03020 gene gyrB 2432 4321 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU72 protein_id gnl|my_center|LOCUS_03020 4487 5212 gene locus_tag LOCUS_03030 4487 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 5801 5280 gene locus_tag LOCUS_03040 5801 5280 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854561.1 protein_id gnl|my_center|LOCUS_03040 6214 5891 gene locus_tag LOCUS_03050 6214 5891 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG33 protein_id gnl|my_center|LOCUS_03050 6581 6345 gene locus_tag LOCUS_03060 6581 6345 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144400.1 protein_id gnl|my_center|LOCUS_03060 6882 7220 gene locus_tag LOCUS_03070 6882 7220 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_03070 7255 8967 gene locus_tag LOCUS_03080 7255 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence033 2322 1804 gene locus_tag LOCUS_03090 2322 1804 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256496.1 protein_id gnl|my_center|LOCUS_03090 3051 2341 gene locus_tag LOCUS_03100 3051 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_03100 3411 4556 gene locus_tag LOCUS_03110 3411 4556 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_03110 4832 5833 gene locus_tag LOCUS_03120 4832 5833 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_03120 5887 6369 gene locus_tag LOCUS_03130 5887 6369 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_03130 6375 7379 gene locus_tag LOCUS_03140 6375 7379 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257504.1 protein_id gnl|my_center|LOCUS_03140 7367 8644 gene locus_tag LOCUS_03150 7367 8644 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257505.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence034 809 4033 gene locus_tag LOCUS_03160 gene carB 809 4033 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP0 protein_id gnl|my_center|LOCUS_03160 4944 4060 gene locus_tag LOCUS_03170 4944 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 5086 5838 gene locus_tag LOCUS_03180 5086 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020696.1 protein_id gnl|my_center|LOCUS_03180 5905 6537 gene locus_tag LOCUS_03190 gene nth 5905 6537 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLJ8 protein_id gnl|my_center|LOCUS_03190 6534 7295 gene locus_tag LOCUS_03200 6534 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 >Feature sequence035 290 3937 gene locus_tag LOCUS_03210 gene nrdJ 290 3937 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3P1 protein_id gnl|my_center|LOCUS_03210 4186 4806 gene locus_tag LOCUS_03220 4186 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 5045 6037 gene locus_tag LOCUS_03230 5045 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 6074 6715 gene locus_tag LOCUS_03240 6074 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 6712 7518 gene locus_tag LOCUS_03250 6712 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 7559 7954 gene locus_tag LOCUS_03260 7559 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 8208 8699 gene locus_tag LOCUS_03270 8208 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 >Feature sequence036 350 36 gene locus_tag LOCUS_03280 350 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 2612 444 gene locus_tag LOCUS_03290 2612 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 2829 4799 gene locus_tag LOCUS_03300 2829 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 4814 6118 gene locus_tag LOCUS_03310 4814 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 6122 6775 gene locus_tag LOCUS_03320 6122 6775 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_03320 8262 6781 gene locus_tag LOCUS_03330 8262 6781 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943658.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence037 1199 636 gene locus_tag LOCUS_03340 1199 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1365 2141 gene locus_tag LOCUS_03350 1365 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005679031.1 protein_id gnl|my_center|LOCUS_03350 2287 3936 gene locus_tag LOCUS_03360 2287 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_03360 4200 5807 gene locus_tag LOCUS_03370 4200 5807 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_03370 6027 6596 gene locus_tag LOCUS_03380 6027 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 6874 8019 gene locus_tag LOCUS_03390 6874 8019 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889545.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence038 <1 1361 gene locus_tag LOCUS_03400 <1 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545239.1:carbon starvation protein A 3058 1358 gene locus_tag LOCUS_03410 3058 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 4046 3144 gene locus_tag LOCUS_03420 4046 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 4368 6032 gene locus_tag LOCUS_03430 gene pckA 4368 6032 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLL5 protein_id gnl|my_center|LOCUS_03430 6131 7102 gene locus_tag LOCUS_03440 gene pdxA 6131 7102 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKJ4 protein_id gnl|my_center|LOCUS_03440 7102 7896 gene locus_tag LOCUS_03450 gene rsmA 7102 7896 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EX0 protein_id gnl|my_center|LOCUS_03450 >Feature sequence039 676 188 gene locus_tag LOCUS_03460 gene nuoI 676 188 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFB9 protein_id gnl|my_center|LOCUS_03460 1706 693 gene locus_tag LOCUS_03470 gene nuoH2 1706 693 CDS product NADH-quinone oxidoreductase subunit H 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746T2 protein_id gnl|my_center|LOCUS_03470 4219 1745 gene locus_tag LOCUS_03480 4219 1745 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFB7 protein_id gnl|my_center|LOCUS_03480 5479 4226 gene locus_tag LOCUS_03490 gene nuoF 5479 4226 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_03490 5965 5489 gene locus_tag LOCUS_03500 5965 5489 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_03500 7164 5965 gene locus_tag LOCUS_03510 gene nuoD2 7164 5965 CDS product NADH-quinone oxidoreductase subunit D 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFB4 protein_id gnl|my_center|LOCUS_03510 7722 7174 gene locus_tag LOCUS_03520 gene nuoC 7722 7174 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFB3 protein_id gnl|my_center|LOCUS_03520 8303 7719 gene locus_tag LOCUS_03530 gene nqo6 8303 7719 CDS product NADH-quinone oxidoreductase subunit 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56218 protein_id gnl|my_center|LOCUS_03530 8647 8294 gene locus_tag LOCUS_03540 gene nuoA1 8647 8294 CDS product NADH-quinone oxidoreductase subunit A 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA8 protein_id gnl|my_center|LOCUS_03540 >Feature sequence040 132 1121 gene locus_tag LOCUS_03550 132 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_03550 1427 1717 gene locus_tag LOCUS_03560 1427 1717 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090833.1 protein_id gnl|my_center|LOCUS_03560 5119 1841 gene locus_tag LOCUS_03570 5119 1841 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266501.1 protein_id gnl|my_center|LOCUS_03570 5454 7292 gene locus_tag LOCUS_03580 5454 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 7889 7623 gene locus_tag LOCUS_03590 7889 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 >Feature sequence041 3337 2594 gene locus_tag LOCUS_03600 3337 2594 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544975.1 protein_id gnl|my_center|LOCUS_03600 3606 5255 gene locus_tag LOCUS_03610 3606 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_03610 5279 6259 gene locus_tag LOCUS_03620 5279 6259 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5D8 protein_id gnl|my_center|LOCUS_03620 6303 6707 gene locus_tag LOCUS_03630 6303 6707 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869706.1 protein_id gnl|my_center|LOCUS_03630 6830 7081 gene locus_tag LOCUS_03640 6830 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 7644 7126 gene locus_tag LOCUS_03650 7644 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 8121 7651 gene locus_tag LOCUS_03660 8121 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence042 214 429 gene locus_tag LOCUS_03670 214 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1374 1048 gene locus_tag LOCUS_03680 1374 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880524.1 protein_id gnl|my_center|LOCUS_03680 4652 1404 gene locus_tag LOCUS_03690 4652 1404 CDS product UPF0753 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67026 protein_id gnl|my_center|LOCUS_03690 5927 4698 gene locus_tag LOCUS_03700 5927 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 7651 5948 gene locus_tag LOCUS_03710 7651 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 >Feature sequence043 1649 1915 gene locus_tag LOCUS_03720 1649 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 2740 1925 gene locus_tag LOCUS_03730 2740 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 3340 2996 gene locus_tag LOCUS_03740 3340 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 3845 3357 gene locus_tag LOCUS_03750 3845 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 4284 4093 gene locus_tag LOCUS_03760 4284 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 5067 5579 gene locus_tag LOCUS_03770 5067 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 5657 5920 gene locus_tag LOCUS_03780 5657 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 6260 6946 gene locus_tag LOCUS_03790 6260 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 7855 6974 gene locus_tag LOCUS_03800 7855 6974 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437125.1 protein_id gnl|my_center|LOCUS_03800 8081 8359 gene locus_tag LOCUS_03810 8081 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 8443 8586 gene locus_tag LOCUS_03820 8443 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 >Feature sequence044 1371 886 gene locus_tag LOCUS_03830 1371 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 2221 3003 gene locus_tag LOCUS_03840 2221 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 3008 7159 gene locus_tag LOCUS_03850 3008 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 7220 8347 gene locus_tag LOCUS_03860 7220 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115340.1 protein_id gnl|my_center|LOCUS_03860 >Feature sequence045 3072 2725 gene locus_tag LOCUS_03870 3072 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 3329 3069 gene locus_tag LOCUS_03880 3329 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 3645 3869 gene locus_tag LOCUS_03890 3645 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 3866 4261 gene locus_tag LOCUS_03900 3866 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 4485 5147 gene locus_tag LOCUS_03910 4485 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 protein_id gnl|my_center|LOCUS_03910 6179 5175 gene locus_tag LOCUS_03920 gene yjgB 6179 5175 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 protein_id gnl|my_center|LOCUS_03920 6230 6520 gene locus_tag LOCUS_03930 6230 6520 CDS product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_03930 6530 6826 gene locus_tag LOCUS_03940 6530 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 7719 7141 gene locus_tag LOCUS_03950 7719 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 8329 7766 gene locus_tag LOCUS_03960 8329 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence046 792 358 gene locus_tag LOCUS_03970 792 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 2131 812 gene locus_tag LOCUS_03980 gene fliI 2131 812 CDS product flagellum-specific ATP synthase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941081.1 protein_id gnl|my_center|LOCUS_03980 2945 2121 gene locus_tag LOCUS_03990 2945 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 3945 2938 gene locus_tag LOCUS_04000 gene fliG 3945 2938 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545416.1 protein_id gnl|my_center|LOCUS_04000 5566 3968 gene locus_tag LOCUS_04010 gene fliF 5566 3968 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G39 protein_id gnl|my_center|LOCUS_04010 6039 5602 gene locus_tag LOCUS_04020 gene flgC 6039 5602 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G41 protein_id gnl|my_center|LOCUS_04020 7650 6265 gene locus_tag LOCUS_04030 7650 6265 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_04030 <8543 7647 gene locus_tag LOCUS_04040 <8543 7647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545659.1:sensor histidine kinase >Feature sequence047 4455 3361 gene locus_tag LOCUS_04050 4455 3361 CDS product phosphoribosylaminoimidazole synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876828.1 protein_id gnl|my_center|LOCUS_04050 5985 4480 gene locus_tag LOCUS_04060 5985 4480 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870173.1 protein_id gnl|my_center|LOCUS_04060 6327 7016 gene locus_tag LOCUS_04070 6327 7016 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310196.1 protein_id gnl|my_center|LOCUS_04070 7063 8151 gene locus_tag LOCUS_04080 7063 8151 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE7 protein_id gnl|my_center|LOCUS_04080 >Feature sequence048 <1 1171 gene locus_tag LOCUS_04090 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977179.1:proteasome accessory factor PafA2 1168 1338 gene locus_tag LOCUS_04100 1168 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 1335 2147 gene locus_tag LOCUS_04110 gene prcB 1335 2147 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKQ5 protein_id gnl|my_center|LOCUS_04110 2140 2883 gene locus_tag LOCUS_04120 2140 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 2880 4343 gene locus_tag LOCUS_04130 gene pafA 2880 4343 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NQE1 protein_id gnl|my_center|LOCUS_04130 4556 5011 gene locus_tag LOCUS_04140 4556 5011 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTM1 protein_id gnl|my_center|LOCUS_04140 5109 6125 gene locus_tag LOCUS_04150 gene nadA 5109 6125 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8D9 protein_id gnl|my_center|LOCUS_04150 6345 7427 gene locus_tag LOCUS_04160 6345 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 7440 7835 gene locus_tag LOCUS_04170 7440 7835 CDS product chromosome condensation protein CcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023830.1 protein_id gnl|my_center|LOCUS_04170 7916 7992 gene locus_tag LOCUS_t00030 7916 7992 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence049 47 1789 gene locus_tag LOCUS_04180 47 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 2258 2542 gene locus_tag LOCUS_04190 2258 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3305 2610 gene locus_tag LOCUS_04200 3305 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 3930 3529 gene locus_tag LOCUS_04210 3930 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 4675 5010 gene locus_tag LOCUS_04220 4675 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 5240 6118 gene locus_tag LOCUS_04230 5240 6118 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546161.1 protein_id gnl|my_center|LOCUS_04230 6181 7968 gene locus_tag LOCUS_04240 6181 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 >Feature sequence050 2480 159 gene locus_tag LOCUS_04250 2480 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 2969 2499 gene locus_tag LOCUS_04260 2969 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 3373 3119 gene locus_tag LOCUS_04270 3373 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 4068 3370 gene locus_tag LOCUS_04280 4068 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 5079 4159 gene locus_tag LOCUS_04290 5079 4159 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260358.1 protein_id gnl|my_center|LOCUS_04290 6610 5051 gene locus_tag LOCUS_04300 6610 5051 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972453.1 protein_id gnl|my_center|LOCUS_04300 7305 6829 gene locus_tag LOCUS_04310 7305 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 7865 7584 gene locus_tag LOCUS_04320 7865 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 8077 7865 gene locus_tag LOCUS_04330 8077 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 >Feature sequence051 254 394 gene locus_tag LOCUS_04340 254 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 1205 3433 gene locus_tag LOCUS_04350 gene lldD 1205 3433 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058907.1 protein_id gnl|my_center|LOCUS_04350 3437 4234 gene locus_tag LOCUS_04360 3437 4234 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001977544.1 protein_id gnl|my_center|LOCUS_04360 4423 5688 gene locus_tag LOCUS_04370 gene sucC1 4423 5688 CDS product succinyl-CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880832.1 protein_id gnl|my_center|LOCUS_04370 >Feature sequence052 <1 785 gene locus_tag LOCUS_04380 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263130.1:hybrid sensor histidine kinase/response regulator 930 1994 gene locus_tag LOCUS_04390 930 1994 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_04390 2033 2437 gene locus_tag LOCUS_04400 2033 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204941.1 protein_id gnl|my_center|LOCUS_04400 3359 2445 gene locus_tag LOCUS_04410 gene oppB 3359 2445 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210654.1 protein_id gnl|my_center|LOCUS_04410 3880 3533 gene locus_tag LOCUS_04420 3880 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 4935 3943 gene locus_tag LOCUS_04430 4935 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 5238 7064 gene locus_tag LOCUS_04440 5238 7064 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence053 15 698 gene locus_tag LOCUS_04450 15 698 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263640.1 protein_id gnl|my_center|LOCUS_04450 784 1248 gene locus_tag LOCUS_04460 784 1248 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271013.1 protein_id gnl|my_center|LOCUS_04460 1276 1827 gene locus_tag LOCUS_04470 gene rpoE3 1276 1827 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263639.1 protein_id gnl|my_center|LOCUS_04470 3001 2636 gene locus_tag LOCUS_04480 3001 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4158 3076 gene locus_tag LOCUS_04490 4158 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 4725 4249 gene locus_tag LOCUS_04500 4725 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 5605 4820 gene locus_tag LOCUS_04510 5605 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941264.1 protein_id gnl|my_center|LOCUS_04510 6416 5994 gene locus_tag LOCUS_04520 6416 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 7066 6566 gene locus_tag LOCUS_04530 7066 6566 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_04530 7898 7155 gene locus_tag LOCUS_04540 7898 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123114.1 protein_id gnl|my_center|LOCUS_04540 >Feature sequence054 1323 121 gene locus_tag LOCUS_04550 1323 121 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765689.1 protein_id gnl|my_center|LOCUS_04550 1889 1437 gene locus_tag LOCUS_04560 1889 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 2223 4163 gene locus_tag LOCUS_04570 2223 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 5529 4246 gene locus_tag LOCUS_04580 gene rarA 5529 4246 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_04580 6636 5530 gene locus_tag LOCUS_04590 6636 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence055 470 1006 gene locus_tag LOCUS_04600 470 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 1185 1358 gene locus_tag LOCUS_04610 1185 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2258 4600 gene locus_tag LOCUS_04620 2258 4600 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188913.1 protein_id gnl|my_center|LOCUS_04620 4828 5352 gene locus_tag LOCUS_04630 4828 5352 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 protein_id gnl|my_center|LOCUS_04630 5405 6403 gene locus_tag LOCUS_04640 5405 6403 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 protein_id gnl|my_center|LOCUS_04640 >Feature sequence056 370 1713 gene locus_tag LOCUS_04650 370 1713 CDS product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_04650 2526 2086 gene locus_tag LOCUS_04660 2526 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140230.1 protein_id gnl|my_center|LOCUS_04660 3403 2585 gene locus_tag LOCUS_04670 3403 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_04670 3563 4087 gene locus_tag LOCUS_04680 3563 4087 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328411.1 protein_id gnl|my_center|LOCUS_04680 5194 4316 gene locus_tag LOCUS_04690 5194 4316 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143692.1 protein_id gnl|my_center|LOCUS_04690 6330 5290 gene locus_tag LOCUS_04700 gene mtnA 6330 5290 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y8 protein_id gnl|my_center|LOCUS_04700 6782 6465 gene locus_tag LOCUS_04710 6782 6465 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU5 protein_id gnl|my_center|LOCUS_04710 7281 6745 gene locus_tag LOCUS_04720 7281 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 7587 7288 gene locus_tag LOCUS_04730 7587 7288 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence057 7516 6836 gene locus_tag LOCUS_04740 7516 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence058 361 74 gene locus_tag LOCUS_04750 361 74 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_04750 448 1167 gene locus_tag LOCUS_04760 448 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 2488 1193 gene locus_tag LOCUS_04770 2488 1193 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_04770 3798 2488 gene locus_tag LOCUS_04780 3798 2488 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_04780 4901 3888 gene locus_tag LOCUS_04790 gene thiL 4901 3888 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747S1 protein_id gnl|my_center|LOCUS_04790 5279 5049 gene locus_tag LOCUS_04800 5279 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 6880 5390 gene locus_tag LOCUS_04810 6880 5390 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJZ4 protein_id gnl|my_center|LOCUS_04810 7291 6899 gene locus_tag LOCUS_04820 7291 6899 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_04820 >Feature sequence059 982 7092 gene locus_tag LOCUS_04830 982 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence060 1193 2296 gene locus_tag LOCUS_04840 1193 2296 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_04840 2513 2791 gene locus_tag LOCUS_04850 2513 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 2886 3200 gene locus_tag LOCUS_04860 2886 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 3332 4177 gene locus_tag LOCUS_04870 3332 4177 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_04870 4186 4458 gene locus_tag LOCUS_04880 4186 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 4421 5023 gene locus_tag LOCUS_04890 4421 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 5272 6207 gene locus_tag LOCUS_04900 gene desC 5272 6207 CDS product delta 9 acyl-lipid fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_04900 6213 7457 gene locus_tag LOCUS_04910 6213 7457 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence061 4665 2887 gene locus_tag LOCUS_04920 4665 2887 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950790.1 protein_id gnl|my_center|LOCUS_04920 5460 4906 gene locus_tag LOCUS_04930 gene cobO 5460 4906 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192682.1 protein_id gnl|my_center|LOCUS_04930 6143 5472 gene locus_tag LOCUS_04940 6143 5472 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903145.1 protein_id gnl|my_center|LOCUS_04940 6753 6151 gene locus_tag LOCUS_04950 6753 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 >Feature sequence062 <1 2569 gene locus_tag LOCUS_04960 <1 2569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958090.1:ATP-dependent helicase 2572 5922 gene locus_tag LOCUS_04970 2572 5922 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_04970 6262 6810 gene locus_tag LOCUS_04980 6262 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence063 71 1054 gene locus_tag LOCUS_04990 71 1054 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_04990 1054 2148 gene locus_tag LOCUS_05000 1054 2148 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_05000 2250 3011 gene locus_tag LOCUS_05010 2250 3011 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229160.1 protein_id gnl|my_center|LOCUS_05010 3071 4384 gene locus_tag LOCUS_05020 3071 4384 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 protein_id gnl|my_center|LOCUS_05020 4436 5956 gene locus_tag LOCUS_05030 4436 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 >Feature sequence064 2670 628 gene locus_tag LOCUS_05040 2670 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_05040 2681 2869 gene locus_tag LOCUS_05050 2681 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 4424 3987 gene locus_tag LOCUS_05060 4424 3987 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964989.1 protein_id gnl|my_center|LOCUS_05060 4675 5310 gene locus_tag LOCUS_05070 4675 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 5353 5610 gene locus_tag LOCUS_05080 5353 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 5632 6987 gene locus_tag LOCUS_05090 5632 6987 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140537.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence065 2072 255 gene locus_tag LOCUS_05100 gene nolO 2072 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887298.1 protein_id gnl|my_center|LOCUS_05100 2547 2089 gene locus_tag LOCUS_05110 2547 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 3465 2734 gene locus_tag LOCUS_05120 gene pyrF 3465 2734 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181J5 protein_id gnl|my_center|LOCUS_05120 3674 4396 gene locus_tag LOCUS_05130 3674 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 protein_id gnl|my_center|LOCUS_05130 5337 4393 gene locus_tag LOCUS_05140 5337 4393 CDS product carbamoyl phosphate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392274.1 protein_id gnl|my_center|LOCUS_05140 5884 5423 gene locus_tag LOCUS_05150 5884 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 6323 5976 gene locus_tag LOCUS_05160 6323 5976 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831965.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence066 697 2025 gene locus_tag LOCUS_05170 gene wzt 697 2025 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096884.1 protein_id gnl|my_center|LOCUS_05170 2046 3188 gene locus_tag LOCUS_05180 2046 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3403 4260 gene locus_tag LOCUS_05190 3403 4260 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031203.1 protein_id gnl|my_center|LOCUS_05190 4292 5113 gene locus_tag LOCUS_05200 gene pstC 4292 5113 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_05200 5110 5958 gene locus_tag LOCUS_05210 5110 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05210 5955 6716 gene locus_tag LOCUS_05220 gene pstB1 5955 6716 CDS product phosphate import ATP-binding protein PstB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S48 protein_id gnl|my_center|LOCUS_05220 >Feature sequence067 3429 1999 gene locus_tag LOCUS_05230 3429 1999 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_05230 3590 4555 gene locus_tag LOCUS_05240 3590 4555 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_05240 4670 6187 gene locus_tag LOCUS_05250 gene pepA 4670 6187 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GB4 protein_id gnl|my_center|LOCUS_05250 6315 6794 gene locus_tag LOCUS_05260 6315 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 >Feature sequence068 377 2026 gene locus_tag LOCUS_05270 377 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2144 4645 gene locus_tag LOCUS_05280 gene infB 2144 4645 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT3 protein_id gnl|my_center|LOCUS_05280 4661 4978 gene locus_tag LOCUS_05290 4661 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 4981 5334 gene locus_tag LOCUS_05300 gene rbfA 4981 5334 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPG2 protein_id gnl|my_center|LOCUS_05300 5315 6253 gene locus_tag LOCUS_05310 gene truB 5315 6253 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI4 protein_id gnl|my_center|LOCUS_05310 6310 6579 gene locus_tag LOCUS_05320 gene rpsO 6310 6579 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT0 protein_id gnl|my_center|LOCUS_05320 >Feature sequence069 1778 141 gene locus_tag LOCUS_05330 1778 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895680.1 protein_id gnl|my_center|LOCUS_05330 2508 3608 gene locus_tag LOCUS_05340 2508 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 3986 3678 gene locus_tag LOCUS_05350 3986 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_214416.2 protein_id gnl|my_center|LOCUS_05350 4122 5207 gene locus_tag LOCUS_05360 4122 5207 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546845.1 protein_id gnl|my_center|LOCUS_05360 5204 6088 gene locus_tag LOCUS_05370 5204 6088 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_05370 6095 6760 gene locus_tag LOCUS_05380 gene cmk 6095 6760 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187C4 protein_id gnl|my_center|LOCUS_05380 >Feature sequence070 1069 1824 gene locus_tag LOCUS_05390 1069 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 3875 1842 gene locus_tag LOCUS_05400 3875 1842 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016621.1 protein_id gnl|my_center|LOCUS_05400 5295 4078 gene locus_tag LOCUS_05410 5295 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 5438 5821 gene locus_tag LOCUS_05420 5438 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence071 1944 841 gene locus_tag LOCUS_05430 gene spsC 1944 841 CDS product spore coat polysaccharide biosynthesis protein SpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39623 protein_id gnl|my_center|LOCUS_05430 2861 2163 gene locus_tag LOCUS_05440 2861 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 protein_id gnl|my_center|LOCUS_05440 2946 3569 gene locus_tag LOCUS_05450 2946 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546497.1 protein_id gnl|my_center|LOCUS_05450 3581 4243 gene locus_tag LOCUS_05460 3581 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_05460 4953 6599 gene locus_tag LOCUS_05470 4953 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence072 67 324 gene locus_tag LOCUS_05480 67 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 663 830 gene locus_tag LOCUS_05490 663 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 964 2352 gene locus_tag LOCUS_05500 964 2352 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_05500 2632 3627 gene locus_tag LOCUS_05510 2632 3627 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647271.1 protein_id gnl|my_center|LOCUS_05510 4600 3974 gene locus_tag LOCUS_05520 4600 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 5243 5773 gene locus_tag LOCUS_05530 5243 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 6862 6098 gene locus_tag LOCUS_05540 6862 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence073 <1 513 gene locus_tag LOCUS_05550 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460838.1:glycine--tRNA ligase subunit alpha 1483 1917 gene locus_tag LOCUS_05560 1483 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 2110 3306 gene locus_tag LOCUS_05570 2110 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 5491 3296 gene locus_tag LOCUS_05580 5491 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence074 879 181 gene locus_tag LOCUS_05590 gene phoB 879 181 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_05590 1726 1076 gene locus_tag LOCUS_05600 1726 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_05600 3014 1788 gene locus_tag LOCUS_05610 gene ampG 3014 1788 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040617.1 protein_id gnl|my_center|LOCUS_05610 3368 5089 gene locus_tag LOCUS_05620 3368 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 >Feature sequence075 788 354 gene locus_tag LOCUS_05630 788 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 977 2704 gene locus_tag LOCUS_05640 gene nadE2 977 2704 CDS product putative glutamine-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0Y0 protein_id gnl|my_center|LOCUS_05640 3621 2731 gene locus_tag LOCUS_05650 3621 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 4056 5702 gene locus_tag LOCUS_05660 4056 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 >Feature sequence076 2302 1280 gene locus_tag LOCUS_05670 gene cheB 2302 1280 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIX8 protein_id gnl|my_center|LOCUS_05670 2736 3260 gene locus_tag LOCUS_05680 2736 3260 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJJ7 protein_id gnl|my_center|LOCUS_05680 3301 4386 gene locus_tag LOCUS_05690 gene recA 3301 4386 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62215 protein_id gnl|my_center|LOCUS_05690 4412 4903 gene locus_tag LOCUS_05700 4412 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 5042 5815 gene locus_tag LOCUS_05710 gene pilD 5042 5815 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ8 protein_id gnl|my_center|LOCUS_05710 5903 6424 gene locus_tag LOCUS_05720 5903 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence077 1752 637 gene locus_tag LOCUS_05730 1752 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 2851 1733 gene locus_tag LOCUS_05740 2851 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 3528 2947 gene locus_tag LOCUS_05750 3528 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 3663 3893 gene locus_tag LOCUS_05760 3663 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 4062 4673 gene locus_tag LOCUS_05770 gene lexA 4062 4673 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31080 protein_id gnl|my_center|LOCUS_05770 5081 6256 gene locus_tag LOCUS_05780 gene dinP 5081 6256 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FZ2 protein_id gnl|my_center|LOCUS_05780 6399 6716 gene locus_tag LOCUS_05790 6399 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 >Feature sequence078 3035 1419 gene locus_tag LOCUS_05800 3035 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 6800 3111 gene locus_tag LOCUS_05810 gene putA 6800 3111 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121781.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence079 882 376 gene locus_tag LOCUS_05820 882 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1522 995 gene locus_tag LOCUS_05830 1522 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 3042 2656 gene locus_tag LOCUS_05840 3042 2656 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391250.1 protein_id gnl|my_center|LOCUS_05840 4225 3065 gene locus_tag LOCUS_05850 4225 3065 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_05850 5949 4483 gene locus_tag LOCUS_05860 5949 4483 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943221.1 protein_id gnl|my_center|LOCUS_05860 6181 5942 gene locus_tag LOCUS_05870 6181 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence080 1592 1032 gene locus_tag LOCUS_05880 gene gmhA 1592 1032 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67054 protein_id gnl|my_center|LOCUS_05880 2321 1626 gene locus_tag LOCUS_05890 2321 1626 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G62 protein_id gnl|my_center|LOCUS_05890 3271 2318 gene locus_tag LOCUS_05900 3271 2318 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_05900 4240 3284 gene locus_tag LOCUS_05910 gene fmt 4240 3284 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_05910 4793 4272 gene locus_tag LOCUS_05920 gene def 4793 4272 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF24 protein_id gnl|my_center|LOCUS_05920 6145 4934 gene locus_tag LOCUS_05930 gene argJ 6145 4934 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE46 protein_id gnl|my_center|LOCUS_05930 <6775 6182 gene locus_tag LOCUS_05940 <6775 6182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9X2A2:N-acetyl-gamma-glutamyl-phosphate reductase >Feature sequence081 <1 516 gene locus_tag LOCUS_05950 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8GVN6:30S ribosomal protein S6 509 910 gene locus_tag LOCUS_05960 509 910 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK70 protein_id gnl|my_center|LOCUS_05960 937 1188 gene locus_tag LOCUS_05970 gene rpsR 937 1188 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7Z9 protein_id gnl|my_center|LOCUS_05970 1192 2160 gene locus_tag LOCUS_05980 1192 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 2203 2700 gene locus_tag LOCUS_05990 gene rplI 2203 2700 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE1 protein_id gnl|my_center|LOCUS_05990 2739 4127 gene locus_tag LOCUS_06000 gene dnaB 2739 4127 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EG4 protein_id gnl|my_center|LOCUS_06000 4446 4213 gene locus_tag LOCUS_06010 4446 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 4631 5218 gene locus_tag LOCUS_06020 4631 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 <6769 5308 gene locus_tag LOCUS_06030 <6769 5308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001146752.1:D-alanine--poly(phosphoribitol) ligase >Feature sequence082 215 2245 gene locus_tag LOCUS_06040 215 2245 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_06040 2329 2871 gene locus_tag LOCUS_06050 2329 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 3991 2930 gene locus_tag LOCUS_06060 3991 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 4332 4886 gene locus_tag LOCUS_06070 4332 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 6021 4939 gene locus_tag LOCUS_06080 6021 4939 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767200.1 protein_id gnl|my_center|LOCUS_06080 <6761 6076 gene locus_tag LOCUS_06090 <6761 6076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015643.1:phosphatidylinositol-4-phosphate 5-kinase >Feature sequence083 2831 411 gene locus_tag LOCUS_06100 gene gyrA 2831 411 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H88 protein_id gnl|my_center|LOCUS_06100 5526 2926 gene locus_tag LOCUS_06110 gene gyrB 5526 2926 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H89 protein_id gnl|my_center|LOCUS_06110 5587 5721 gene locus_tag LOCUS_06120 5587 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 <6748 5741 gene locus_tag LOCUS_06130 <6748 5741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8DYG0:chromosomal replication initiator protein DnaA >Feature sequence084 150 977 gene locus_tag LOCUS_06140 150 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 1720 1067 gene locus_tag LOCUS_06150 1720 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 4113 1891 gene locus_tag LOCUS_06160 4113 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 5271 4117 gene locus_tag LOCUS_06170 gene acd 5271 4117 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227551.1 protein_id gnl|my_center|LOCUS_06170 5739 6425 gene locus_tag LOCUS_06180 5739 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 6500 6712 gene locus_tag LOCUS_06190 6500 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence085 1 1521 gene locus_tag LOCUS_06200 1 1521 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211632.1 protein_id gnl|my_center|LOCUS_06200 1518 3497 gene locus_tag LOCUS_06210 1518 3497 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097960.1 protein_id gnl|my_center|LOCUS_06210 3507 4061 gene locus_tag LOCUS_06220 3507 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 >Feature sequence086 3021 3359 gene locus_tag LOCUS_06230 3021 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 3669 3481 gene locus_tag LOCUS_06240 3669 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3935 5614 gene locus_tag LOCUS_06250 3935 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 6187 5666 gene locus_tag LOCUS_06260 6187 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence087 376 53 gene locus_tag LOCUS_06270 376 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 665 369 gene locus_tag LOCUS_06280 665 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 843 1367 gene locus_tag LOCUS_06290 843 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 1384 2757 gene locus_tag LOCUS_06300 gene merA 1384 2757 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0E4 protein_id gnl|my_center|LOCUS_06300 3307 2792 gene locus_tag LOCUS_06310 3307 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 3855 3310 gene locus_tag LOCUS_06320 3855 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 4310 4792 gene locus_tag LOCUS_06330 4310 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 5314 4811 gene locus_tag LOCUS_06340 5314 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5540 6325 gene locus_tag LOCUS_06350 5540 6325 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence088 <1 786 gene locus_tag LOCUS_06360 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005455119.1:ABC transporter ATP-binding protein 849 1973 gene locus_tag LOCUS_06370 849 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 1975 2895 gene locus_tag LOCUS_06380 1975 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 3047 3967 gene locus_tag LOCUS_06390 3047 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121742.1 protein_id gnl|my_center|LOCUS_06390 4077 6218 gene locus_tag LOCUS_06400 4077 6218 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120924.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence089 1073 48 gene locus_tag LOCUS_06410 gene ruvB 1073 48 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61532 protein_id gnl|my_center|LOCUS_06410 1700 1110 gene locus_tag LOCUS_06420 gene ruvA 1700 1110 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E87 protein_id gnl|my_center|LOCUS_06420 2214 1723 gene locus_tag LOCUS_06430 gene ruvC 2214 1723 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183P3 protein_id gnl|my_center|LOCUS_06430 3043 2291 gene locus_tag LOCUS_06440 3043 2291 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62036 protein_id gnl|my_center|LOCUS_06440 3230 3904 gene locus_tag LOCUS_06450 3230 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 3901 5589 gene locus_tag LOCUS_06460 3901 5589 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869524.1 protein_id gnl|my_center|LOCUS_06460 6508 5684 gene locus_tag LOCUS_06470 6508 5684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence090 1353 553 gene locus_tag LOCUS_06480 1353 553 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832012.1 protein_id gnl|my_center|LOCUS_06480 1654 4251 gene locus_tag LOCUS_06490 1654 4251 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_06490 4386 5009 gene locus_tag LOCUS_06500 4386 5009 CDS product organic solvent tolerance ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 protein_id gnl|my_center|LOCUS_06500 5029 6048 gene locus_tag LOCUS_06510 5029 6048 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870599.1 protein_id gnl|my_center|LOCUS_06510 >Feature sequence091 1174 1599 gene locus_tag LOCUS_06520 1174 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 1596 2465 gene locus_tag LOCUS_06530 1596 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 2482 3309 gene locus_tag LOCUS_06540 2482 3309 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_06540 3415 4692 gene locus_tag LOCUS_06550 3415 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence092 235 1380 gene locus_tag LOCUS_06560 235 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 1508 3286 gene locus_tag LOCUS_06570 1508 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3351 4718 gene locus_tag LOCUS_06580 gene radA 3351 4718 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CB3 protein_id gnl|my_center|LOCUS_06580 4755 5468 gene locus_tag LOCUS_06590 4755 5468 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_06590 5474 5704 gene locus_tag LOCUS_06600 5474 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 5816 6253 gene locus_tag LOCUS_06610 5816 6253 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence093 2178 778 gene locus_tag LOCUS_06620 2178 778 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_06620 3436 2228 gene locus_tag LOCUS_06630 gene argG 3436 2228 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61523 protein_id gnl|my_center|LOCUS_06630 4800 3562 gene locus_tag LOCUS_06640 4800 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 6118 4805 gene locus_tag LOCUS_06650 gene pgi 6118 4805 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180C9 protein_id gnl|my_center|LOCUS_06650 >Feature sequence094 <1 1362 gene locus_tag LOCUS_06660 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JN48:NAD(P) transhydrogenase subunit alpha 1374 2771 gene locus_tag LOCUS_06670 gene pntB 1374 2771 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN46 protein_id gnl|my_center|LOCUS_06670 3110 4462 gene locus_tag LOCUS_06680 3110 4462 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B650 protein_id gnl|my_center|LOCUS_06680 4481 5083 gene locus_tag LOCUS_06690 gene tpm 4481 5083 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence095 911 135 gene locus_tag LOCUS_06700 911 135 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_06700 1062 2564 gene locus_tag LOCUS_06710 1062 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089877.1 protein_id gnl|my_center|LOCUS_06710 2956 2612 gene locus_tag LOCUS_06720 2956 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 3414 2953 gene locus_tag LOCUS_06730 3414 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 3805 4701 gene locus_tag LOCUS_06740 3805 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 4901 5293 gene locus_tag LOCUS_06750 4901 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 >Feature sequence096 1947 3923 gene locus_tag LOCUS_06760 1947 3923 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_06760 4268 4537 gene locus_tag LOCUS_06770 4268 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 4479 5417 gene locus_tag LOCUS_06780 4479 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 <6268 5458 gene locus_tag LOCUS_06790 <6268 5458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932712.1:DEAD/DEAH box family ATP-dependent RNA helicase >Feature sequence097 1006 182 gene locus_tag LOCUS_06800 1006 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 1698 1003 gene locus_tag LOCUS_06810 1698 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357807.1 protein_id gnl|my_center|LOCUS_06810 3086 1698 gene locus_tag LOCUS_06820 3086 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 4212 3094 gene locus_tag LOCUS_06830 4212 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 4585 6069 gene locus_tag LOCUS_06840 4585 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence098 1444 113 gene locus_tag LOCUS_06850 gene rhlB 1444 113 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FT4 protein_id gnl|my_center|LOCUS_06850 1687 3411 gene locus_tag LOCUS_06860 1687 3411 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIC0 protein_id gnl|my_center|LOCUS_06860 3411 4352 gene locus_tag LOCUS_06870 3411 4352 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCN4 protein_id gnl|my_center|LOCUS_06870 4349 5227 gene locus_tag LOCUS_06880 4349 5227 CDS product heterodisulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_06880 5611 5769 gene locus_tag LOCUS_06890 5611 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence099 1210 791 gene locus_tag LOCUS_06900 1210 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 2705 1251 gene locus_tag LOCUS_06910 2705 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 2941 3471 gene locus_tag LOCUS_06920 gene aroK 2941 3471 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BL5 protein_id gnl|my_center|LOCUS_06920 3464 4252 gene locus_tag LOCUS_06930 3464 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 4249 4905 gene locus_tag LOCUS_06940 4249 4905 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820119.1 protein_id gnl|my_center|LOCUS_06940 4919 5551 gene locus_tag LOCUS_06950 gene omt 4919 5551 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880979.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence100 30 650 gene locus_tag LOCUS_06960 30 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 685 1248 gene locus_tag LOCUS_06970 685 1248 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEM4 protein_id gnl|my_center|LOCUS_06970 1259 2155 gene locus_tag LOCUS_06980 1259 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 2185 3228 gene locus_tag LOCUS_06990 gene dusB 2185 3228 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F5 protein_id gnl|my_center|LOCUS_06990 3306 4124 gene locus_tag LOCUS_07000 3306 4124 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957298.1 protein_id gnl|my_center|LOCUS_07000 4161 4577 gene locus_tag LOCUS_07010 4161 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 6025 5033 gene locus_tag LOCUS_07020 6025 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 >Feature sequence101 2729 1332 gene locus_tag LOCUS_07030 2729 1332 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_07030 3151 3573 gene locus_tag LOCUS_07040 3151 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3631 5061 gene locus_tag LOCUS_07050 3631 5061 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFM9 protein_id gnl|my_center|LOCUS_07050 5103 6014 gene locus_tag LOCUS_07060 gene ykwC 5103 6014 CDS product putative oxidoreductase YkwC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34948 protein_id gnl|my_center|LOCUS_07060 >Feature sequence102 3729 1051 gene locus_tag LOCUS_07070 3729 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence103 48 1121 gene locus_tag LOCUS_07080 48 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1173 1862 gene locus_tag LOCUS_07090 1173 1862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897077.1 protein_id gnl|my_center|LOCUS_07090 2054 2521 gene locus_tag LOCUS_07100 2054 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 2631 3113 gene locus_tag LOCUS_07110 2631 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 3178 3762 gene locus_tag LOCUS_07120 gene ylaC 3178 3762 CDS product RNA polymerase sigma factor YlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07627 protein_id gnl|my_center|LOCUS_07120 3774 4100 gene locus_tag LOCUS_07130 3774 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 4100 4525 gene locus_tag LOCUS_07140 4100 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 4924 4529 gene locus_tag LOCUS_07150 4924 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 5265 4954 gene locus_tag LOCUS_07160 5265 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 5470 6072 gene locus_tag LOCUS_07170 5470 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 >Feature sequence104 1439 828 gene locus_tag LOCUS_07180 1439 828 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405454.1 protein_id gnl|my_center|LOCUS_07180 1705 2385 gene locus_tag LOCUS_07190 1705 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2393 4081 gene locus_tag LOCUS_07200 gene recN 2393 4081 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q836W1 protein_id gnl|my_center|LOCUS_07200 5981 4107 gene locus_tag LOCUS_07210 5981 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence105 559 1176 gene locus_tag LOCUS_07220 559 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 1173 6029 gene locus_tag LOCUS_07230 1173 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 >Feature sequence106 1622 1990 gene locus_tag LOCUS_07240 1622 1990 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085073.1 protein_id gnl|my_center|LOCUS_07240 1992 2711 gene locus_tag LOCUS_07250 1992 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07250 2824 3096 gene locus_tag LOCUS_07260 gene rpsT 2824 3096 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AU4 protein_id gnl|my_center|LOCUS_07260 4086 3085 gene locus_tag LOCUS_07270 gene holA 4086 3085 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362655.1 protein_id gnl|my_center|LOCUS_07270 4659 4099 gene locus_tag LOCUS_07280 4659 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 <6071 4680 gene locus_tag LOCUS_07290 <6071 4680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74AZ0:leucine--tRNA ligase >Feature sequence107 453 43 gene locus_tag LOCUS_07300 453 43 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671181.1 protein_id gnl|my_center|LOCUS_07300 1630 458 gene locus_tag LOCUS_07310 gene proB 1630 458 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Q3 protein_id gnl|my_center|LOCUS_07310 2110 1781 gene locus_tag LOCUS_07320 2110 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 3156 2125 gene locus_tag LOCUS_07330 3156 2125 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942955.1 protein_id gnl|my_center|LOCUS_07330 3947 3159 gene locus_tag LOCUS_07340 3947 3159 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_07340 5263 3959 gene locus_tag LOCUS_07350 5263 3959 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_07350 <6059 5266 gene locus_tag LOCUS_07360 <6059 5266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036522.1:DUF1365 domain-containing protein >Feature sequence108 448 137 gene locus_tag LOCUS_07370 448 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 1313 462 gene locus_tag LOCUS_07380 gene fliC 1313 462 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748G4 protein_id gnl|my_center|LOCUS_07380 1720 1926 gene locus_tag LOCUS_07390 1720 1926 CDS product copper chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021355.1 protein_id gnl|my_center|LOCUS_07390 3147 1921 gene locus_tag LOCUS_07400 3147 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 3733 3140 gene locus_tag LOCUS_07410 3733 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 5114 3915 gene locus_tag LOCUS_07420 5114 3915 CDS product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546485.1 protein_id gnl|my_center|LOCUS_07420 5986 5192 gene locus_tag LOCUS_07430 gene waaM 5986 5192 CDS product lipid A lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948625.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence109 747 205 gene locus_tag LOCUS_07440 747 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3830 963 gene locus_tag LOCUS_07450 3830 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 <5913 3947 gene locus_tag LOCUS_07460 <5913 3947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262962.1:TonB-dependent receptor >Feature sequence110 1544 1017 gene locus_tag LOCUS_07470 gene hslV 1544 1017 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJP6 protein_id gnl|my_center|LOCUS_07470 2578 1616 gene locus_tag LOCUS_07480 gene xerC 2578 1616 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFZ8 protein_id gnl|my_center|LOCUS_07480 2771 3268 gene locus_tag LOCUS_07490 2771 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 3950 3432 gene locus_tag LOCUS_07500 3950 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 5772 4138 gene locus_tag LOCUS_07510 5772 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence111 123 1070 gene locus_tag LOCUS_07520 123 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1388 1729 gene locus_tag LOCUS_07530 1388 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 1755 2261 gene locus_tag LOCUS_07540 1755 2261 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254296.1 protein_id gnl|my_center|LOCUS_07540 2550 2278 gene locus_tag LOCUS_07550 2550 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 4101 2770 gene locus_tag LOCUS_07560 4101 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 4738 4130 gene locus_tag LOCUS_07570 4738 4130 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942276.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence112 684 133 gene locus_tag LOCUS_07580 684 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939699.1 protein_id gnl|my_center|LOCUS_07580 1217 2119 gene locus_tag LOCUS_07590 gene rmlA 1217 2119 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MUA7 protein_id gnl|my_center|LOCUS_07590 2280 4172 gene locus_tag LOCUS_07600 2280 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 4647 4372 gene locus_tag LOCUS_07610 gene hup2 4647 4372 CDS product SPBc2 prophage-derived DNA-binding protein HU 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P68573 protein_id gnl|my_center|LOCUS_07610 4982 5542 gene locus_tag LOCUS_07620 gene def 4982 5542 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93LE9 protein_id gnl|my_center|LOCUS_07620 >Feature sequence113 2221 1274 gene locus_tag LOCUS_07630 2221 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 2395 2859 gene locus_tag LOCUS_07640 gene ybeY 2395 2859 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67367 protein_id gnl|my_center|LOCUS_07640 2920 3408 gene locus_tag LOCUS_07650 2920 3408 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence114 440 1555 gene locus_tag LOCUS_07660 440 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 1583 2713 gene locus_tag LOCUS_07670 1583 2713 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895386.1 protein_id gnl|my_center|LOCUS_07670 2723 3184 gene locus_tag LOCUS_07680 2723 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 3193 4032 gene locus_tag LOCUS_07690 gene hydG-2 3193 4032 CDS product Ni/Fe hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_07690 4034 4810 gene locus_tag LOCUS_07700 4034 4810 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence115 2223 1084 gene locus_tag LOCUS_07710 2223 1084 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191693.1 protein_id gnl|my_center|LOCUS_07710 4061 2265 gene locus_tag LOCUS_07720 4061 2265 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098136.1 protein_id gnl|my_center|LOCUS_07720 4463 5041 gene locus_tag LOCUS_07730 4463 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence116 1006 407 gene locus_tag LOCUS_07740 1006 407 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089436.1 protein_id gnl|my_center|LOCUS_07740 1362 2951 gene locus_tag LOCUS_07750 gene hyfR 1362 2951 CDS product hydrogenase-4 transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122367.1 protein_id gnl|my_center|LOCUS_07750 3330 3683 gene locus_tag LOCUS_07760 3330 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 4446 5309 gene locus_tag LOCUS_07770 4446 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 5718 5557 gene locus_tag LOCUS_07780 5718 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence117 318 638 gene locus_tag LOCUS_07790 318 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 927 1790 gene locus_tag LOCUS_07800 927 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 2785 1808 gene locus_tag LOCUS_07810 2785 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 5051 2832 gene locus_tag LOCUS_07820 5051 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence118 730 1479 gene locus_tag LOCUS_07830 730 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 1732 2316 gene locus_tag LOCUS_07840 1732 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 2320 2499 gene locus_tag LOCUS_07850 2320 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 2566 3282 gene locus_tag LOCUS_07860 2566 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 3761 3931 gene locus_tag LOCUS_07870 3761 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 4087 4716 gene locus_tag LOCUS_07880 gene cobC 4087 4716 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943637.1 protein_id gnl|my_center|LOCUS_07880 4745 5536 gene locus_tag LOCUS_07890 4745 5536 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023583.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence119 974 216 gene locus_tag LOCUS_07900 974 216 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F308 protein_id gnl|my_center|LOCUS_07900 1255 1040 gene locus_tag LOCUS_07910 1255 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 2130 1255 gene locus_tag LOCUS_07920 gene flhG 2130 1255 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E8 protein_id gnl|my_center|LOCUS_07920 3285 2131 gene locus_tag LOCUS_07930 gene flhF 3285 2131 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943680.1 protein_id gnl|my_center|LOCUS_07930 5359 3275 gene locus_tag LOCUS_07940 gene flhA 5359 3275 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence120 1394 2539 gene locus_tag LOCUS_07950 1394 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 2536 4194 gene locus_tag LOCUS_07960 2536 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 4225 5256 gene locus_tag LOCUS_07970 4225 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence121 2058 1150 gene locus_tag LOCUS_07980 2058 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2639 2082 gene locus_tag LOCUS_07990 2639 2082 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085798.1 protein_id gnl|my_center|LOCUS_07990 3104 2694 gene locus_tag LOCUS_08000 3104 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 4596 3388 gene locus_tag LOCUS_08010 4596 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 4979 4602 gene locus_tag LOCUS_08020 4979 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 <5709 5007 gene locus_tag LOCUS_08030 <5709 5007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583115.1:alkaline phosphatase >Feature sequence122 506 910 gene locus_tag LOCUS_08040 gene mraZ 506 910 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5L6 protein_id gnl|my_center|LOCUS_08040 987 1925 gene locus_tag LOCUS_08050 gene rsmH 987 1925 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60396 protein_id gnl|my_center|LOCUS_08050 1918 2235 gene locus_tag LOCUS_08060 1918 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 2240 3988 gene locus_tag LOCUS_08070 gene ftsI 2240 3988 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_08070 4045 5550 gene locus_tag LOCUS_08080 gene murE 4045 5550 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_08080 >Feature sequence123 623 4087 gene locus_tag LOCUS_08090 623 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 4512 5441 gene locus_tag LOCUS_08100 4512 5441 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940498.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence124 1308 364 gene locus_tag LOCUS_08110 1308 364 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_08110 1525 3159 gene locus_tag LOCUS_08120 1525 3159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_08120 <5665 3176 gene locus_tag LOCUS_08130 <5665 3176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103862.1:histidine kinase >Feature sequence125 551 375 gene locus_tag LOCUS_08140 551 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 2084 1302 gene locus_tag LOCUS_08150 2084 1302 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_08150 3290 2094 gene locus_tag LOCUS_08160 3290 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 5628 3673 gene locus_tag LOCUS_08170 5628 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence126 <1 666 gene locus_tag LOCUS_08180 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KP35:fructose-1,6-bisphosphatase class 1 813 2081 gene locus_tag LOCUS_08190 813 2081 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_08190 2191 2619 gene locus_tag LOCUS_08200 gene fur 2191 2619 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_08200 3534 2632 gene locus_tag LOCUS_08210 3534 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence127 1952 243 gene locus_tag LOCUS_08220 gene proS 1952 243 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D59 protein_id gnl|my_center|LOCUS_08220 3820 2093 gene locus_tag LOCUS_08230 3820 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 4104 3838 gene locus_tag LOCUS_08240 4104 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 5491 4121 gene locus_tag LOCUS_08250 5491 4121 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N6 protein_id gnl|my_center|LOCUS_08250 >Feature sequence128 2 427 gene locus_tag LOCUS_08260 2 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 558 851 gene locus_tag LOCUS_08270 558 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 855 2336 gene locus_tag LOCUS_08280 855 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 2348 3700 gene locus_tag LOCUS_08290 2348 3700 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259605.1 protein_id gnl|my_center|LOCUS_08290 3723 4301 gene locus_tag LOCUS_08300 gene vioB 3723 4301 CDS product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084180.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence129 2041 1328 gene locus_tag LOCUS_08310 gene rsmI 2041 1328 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZG8 protein_id gnl|my_center|LOCUS_08310 2489 2094 gene locus_tag LOCUS_08320 2489 2094 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039429.1 protein_id gnl|my_center|LOCUS_08320 3443 2562 gene locus_tag LOCUS_08330 3443 2562 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001605.1 protein_id gnl|my_center|LOCUS_08330 4305 3535 gene locus_tag LOCUS_08340 gene parA 4305 3535 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_08340 5085 4444 gene locus_tag LOCUS_08350 5085 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence130 <1 1140 gene locus_tag LOCUS_08360 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261505.1:peptidase 1347 2099 gene locus_tag LOCUS_08370 gene mtgA 1347 2099 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H228 protein_id gnl|my_center|LOCUS_08370 2096 3292 gene locus_tag LOCUS_08380 2096 3292 CDS product rRNA (guanine-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886697.1 protein_id gnl|my_center|LOCUS_08380 3934 3341 gene locus_tag LOCUS_08390 3934 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 4079 4627 gene locus_tag LOCUS_08400 4079 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 5084 5323 gene locus_tag LOCUS_08410 5084 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence131 469 1143 gene locus_tag LOCUS_08420 469 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 1170 1361 gene locus_tag LOCUS_08430 1170 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2135 1368 gene locus_tag LOCUS_08440 2135 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2371 2655 gene locus_tag LOCUS_08450 2371 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 5077 2642 gene locus_tag LOCUS_08460 5077 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence132 488 1300 gene locus_tag LOCUS_08470 488 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1302 1634 gene locus_tag LOCUS_08480 1302 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1649 3226 gene locus_tag LOCUS_08490 1649 3226 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114382.1 protein_id gnl|my_center|LOCUS_08490 3657 3307 gene locus_tag LOCUS_08500 3657 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 4347 4694 gene locus_tag LOCUS_08510 4347 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602437.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence133 <1 872 gene locus_tag LOCUS_08520 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ61:histidine kinase 856 1983 gene locus_tag LOCUS_08530 856 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 2240 2983 gene locus_tag LOCUS_08540 2240 2983 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459147.1 protein_id gnl|my_center|LOCUS_08540 3514 3077 gene locus_tag LOCUS_08550 3514 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4391 3582 gene locus_tag LOCUS_08560 4391 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 4676 4867 gene locus_tag LOCUS_08570 4676 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 <5469 4924 gene locus_tag LOCUS_08580 <5469 4924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254402.1:multidrug ABC transporter ATP-binding protein >Feature sequence134 142 1563 gene locus_tag LOCUS_08590 142 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2875 1940 gene locus_tag LOCUS_08600 2875 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 5344 4574 gene locus_tag LOCUS_08610 5344 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence135 116 1378 gene locus_tag LOCUS_08620 gene purD 116 1378 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FJ8 protein_id gnl|my_center|LOCUS_08620 1787 1401 gene locus_tag LOCUS_08630 1787 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 1910 2698 gene locus_tag LOCUS_08640 1910 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 3420 2701 gene locus_tag LOCUS_08650 3420 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869292.1 protein_id gnl|my_center|LOCUS_08650 3643 4110 gene locus_tag LOCUS_08660 3643 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 5347 4157 gene locus_tag LOCUS_08670 gene kbl 5347 4157 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F40 protein_id gnl|my_center|LOCUS_08670 >Feature sequence136 <1 1575 gene locus_tag LOCUS_08680 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902151.1:nucleotide pyrophosphatase 1641 1826 gene locus_tag LOCUS_08690 1641 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 1878 2693 gene locus_tag LOCUS_08700 1878 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3379 2717 gene locus_tag LOCUS_08710 3379 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 4415 3585 gene locus_tag LOCUS_08720 4415 3585 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090743.1 protein_id gnl|my_center|LOCUS_08720 5230 4430 gene locus_tag LOCUS_08730 5230 4430 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207902.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence137 2044 2982 gene locus_tag LOCUS_08740 2044 2982 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_08740 3327 2989 gene locus_tag LOCUS_08750 3327 2989 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_08750 5168 3345 gene locus_tag LOCUS_08760 gene ogt 5168 3345 CDS product O-GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence138 169 2322 gene locus_tag LOCUS_08770 169 2322 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_08770 2473 3045 gene locus_tag LOCUS_08780 2473 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3433 4545 gene locus_tag LOCUS_08790 3433 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 4511 4975 gene locus_tag LOCUS_08800 4511 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence139 <1 2661 gene locus_tag LOCUS_08810 <1 2661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022279.1:5-oxoprolinase 2877 3674 gene locus_tag LOCUS_08820 2877 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 4620 3817 gene locus_tag LOCUS_08830 gene ate 4620 3817 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNQ6 protein_id gnl|my_center|LOCUS_08830 >Feature sequence140 1251 751 gene locus_tag LOCUS_08840 1251 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1700 1972 gene locus_tag LOCUS_08850 1700 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2292 3998 gene locus_tag LOCUS_08860 gene dnaX 2292 3998 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_08860 4026 4346 gene locus_tag LOCUS_08870 4026 4346 CDS product nucleoid-associated protein, YbaB/EbfC family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_08870 4533 4991 gene locus_tag LOCUS_08880 gene recR 4533 4991 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI4 protein_id gnl|my_center|LOCUS_08880 >Feature sequence141 571 888 gene locus_tag LOCUS_08890 571 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1049 2881 gene locus_tag LOCUS_08900 gene uvrC 1049 2881 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LP6 protein_id gnl|my_center|LOCUS_08900 >Feature sequence142 369 842 gene locus_tag LOCUS_08910 369 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1682 852 gene locus_tag LOCUS_08920 1682 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 2253 1684 gene locus_tag LOCUS_08930 2253 1684 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_08930 2581 2895 gene locus_tag LOCUS_08940 gene rplU 2581 2895 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL02 protein_id gnl|my_center|LOCUS_08940 2902 3165 gene locus_tag LOCUS_08950 gene rpmA 2902 3165 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ66 protein_id gnl|my_center|LOCUS_08950 3205 4224 gene locus_tag LOCUS_08960 gene obg 3205 4224 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ65 protein_id gnl|my_center|LOCUS_08960 4552 5313 gene locus_tag LOCUS_08970 4552 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence143 1649 657 gene locus_tag LOCUS_08980 1649 657 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118170.1 protein_id gnl|my_center|LOCUS_08980 2669 1653 gene locus_tag LOCUS_08990 gene tsaD 2669 1653 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I738 protein_id gnl|my_center|LOCUS_08990 4220 2760 gene locus_tag LOCUS_09000 gene ctpA-2 4220 2760 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_09000 <5362 4345 gene locus_tag LOCUS_09010 <5362 4345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942417.1:peptidase M23 >Feature sequence144 <1 3058 gene locus_tag LOCUS_09020 <1 3058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:RNA-binding protein 3139 3747 gene locus_tag LOCUS_09030 3139 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence145 1332 97 gene locus_tag LOCUS_09040 1332 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 2130 1333 gene locus_tag LOCUS_09050 2130 1333 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035669.1 protein_id gnl|my_center|LOCUS_09050 2807 2253 gene locus_tag LOCUS_09060 2807 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 4348 3023 gene locus_tag LOCUS_09070 4348 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence146 177 1523 gene locus_tag LOCUS_09080 177 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2694 1717 gene locus_tag LOCUS_09090 2694 1717 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969712.1 protein_id gnl|my_center|LOCUS_09090 2799 3347 gene locus_tag LOCUS_09100 2799 3347 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066818.1 protein_id gnl|my_center|LOCUS_09100 3374 3907 gene locus_tag LOCUS_09110 3374 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 <5334 3988 gene locus_tag LOCUS_09120 <5334 3988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ61:histidine kinase >Feature sequence147 181 945 gene locus_tag LOCUS_09130 gene cbiF 181 945 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870280.1 protein_id gnl|my_center|LOCUS_09130 932 1741 gene locus_tag LOCUS_09140 932 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1734 2477 gene locus_tag LOCUS_09150 1734 2477 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461546.1 protein_id gnl|my_center|LOCUS_09150 2467 3249 gene locus_tag LOCUS_09160 2467 3249 CDS product cobalt-precorrin-6A/precorrin-6x reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721598.1 protein_id gnl|my_center|LOCUS_09160 4052 3519 gene locus_tag LOCUS_09170 4052 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 5042 4467 gene locus_tag LOCUS_09180 5042 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence148 220 1452 gene locus_tag LOCUS_09190 gene ftsA 220 1452 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E0 protein_id gnl|my_center|LOCUS_09190 1612 2796 gene locus_tag LOCUS_09200 gene ftsZ 1612 2796 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEQ8 protein_id gnl|my_center|LOCUS_09200 3674 2865 gene locus_tag LOCUS_09210 3674 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 3861 4715 gene locus_tag LOCUS_09220 3861 4715 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence149 <1 2169 gene locus_tag LOCUS_09230 <1 2169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250673.1:glycosyl transferase family 2 2172 3116 gene locus_tag LOCUS_09240 2172 3116 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877828.1 protein_id gnl|my_center|LOCUS_09240 3708 3211 gene locus_tag LOCUS_09250 3708 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 5181 3793 gene locus_tag LOCUS_09260 5181 3793 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940275.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence150 858 235 gene locus_tag LOCUS_09270 858 235 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877575.1 protein_id gnl|my_center|LOCUS_09270 1634 915 gene locus_tag LOCUS_09280 1634 915 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969401.1 protein_id gnl|my_center|LOCUS_09280 4398 2029 gene locus_tag LOCUS_09290 4398 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 4817 5218 gene locus_tag LOCUS_09300 4817 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence151 102 611 gene locus_tag LOCUS_09310 102 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 983 648 gene locus_tag LOCUS_09320 983 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1351 1124 gene locus_tag LOCUS_09330 1351 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1837 2379 gene locus_tag LOCUS_09340 1837 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 4171 2411 gene locus_tag LOCUS_09350 4171 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence152 1924 890 gene locus_tag LOCUS_09360 gene ltaE 1924 890 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903270.1 protein_id gnl|my_center|LOCUS_09360 2261 1911 gene locus_tag LOCUS_09370 2261 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 3529 2399 gene locus_tag LOCUS_09380 3529 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 4931 3642 gene locus_tag LOCUS_09390 gene amtB 4931 3642 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EM2 protein_id gnl|my_center|LOCUS_09390 >Feature sequence153 98 289 gene locus_tag LOCUS_09400 98 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 747 2372 gene locus_tag LOCUS_09410 747 2372 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388808.1 protein_id gnl|my_center|LOCUS_09410 3015 2488 gene locus_tag LOCUS_09420 3015 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 <5168 3102 gene locus_tag LOCUS_09430 <5168 3102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E0S8:DNA-directed DNA polymerase >Feature sequence154 1324 2241 gene locus_tag LOCUS_09440 1324 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_09440 2241 2933 gene locus_tag LOCUS_09450 2241 2933 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941968.1 protein_id gnl|my_center|LOCUS_09450 3955 2942 gene locus_tag LOCUS_09460 3955 2942 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022155.1 protein_id gnl|my_center|LOCUS_09460 4792 3998 gene locus_tag LOCUS_09470 4792 3998 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence155 294 1313 gene locus_tag LOCUS_09480 294 1313 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142257.1 protein_id gnl|my_center|LOCUS_09480 1407 1655 gene locus_tag LOCUS_09490 gene purS 1407 1655 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 protein_id gnl|my_center|LOCUS_09490 1683 2369 gene locus_tag LOCUS_09500 gene purQ 1683 2369 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S567 protein_id gnl|my_center|LOCUS_09500 2380 4614 gene locus_tag LOCUS_09510 gene purL 2380 4614 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU5 protein_id gnl|my_center|LOCUS_09510 >Feature sequence156 <1 1620 gene locus_tag LOCUS_09520 <1 1620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ61:histidine kinase 2502 1726 gene locus_tag LOCUS_09530 2502 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3361 2525 gene locus_tag LOCUS_09540 3361 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028520.1 protein_id gnl|my_center|LOCUS_09540 4063 3500 gene locus_tag LOCUS_09550 4063 3500 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_09550 <5145 4144 gene locus_tag LOCUS_09560 <5145 4144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932301.1:3-isopropylmalate dehydratase large subunit >Feature sequence157 380 1870 gene locus_tag LOCUS_09570 380 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2532 2116 gene locus_tag LOCUS_09580 2532 2116 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_09580 2752 2516 gene locus_tag LOCUS_09590 2752 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3078 4976 gene locus_tag LOCUS_09600 3078 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence158 1439 435 gene locus_tag LOCUS_09610 gene aniA 1439 435 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYE1 protein_id gnl|my_center|LOCUS_09610 2273 1542 gene locus_tag LOCUS_09620 2273 1542 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963399.1 protein_id gnl|my_center|LOCUS_09620 2772 2350 gene locus_tag LOCUS_09630 2772 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 2997 3422 gene locus_tag LOCUS_09640 2997 3422 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889501.1 protein_id gnl|my_center|LOCUS_09640 3422 3997 gene locus_tag LOCUS_09650 3422 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 <5123 4025 gene locus_tag LOCUS_09660 <5123 4025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000837658.1:hybrid sensor histidine kinase/response regulator >Feature sequence159 502 711 gene locus_tag LOCUS_09670 502 711 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391951.1 protein_id gnl|my_center|LOCUS_09670 708 953 gene locus_tag LOCUS_09680 708 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1817 1158 gene locus_tag LOCUS_09690 1817 1158 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013970.1 protein_id gnl|my_center|LOCUS_09690 2562 1804 gene locus_tag LOCUS_09700 2562 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2694 3689 gene locus_tag LOCUS_09710 2694 3689 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_09710 3865 4164 gene locus_tag LOCUS_09720 gene fdx1 3865 4164 CDS product ferredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67065 protein_id gnl|my_center|LOCUS_09720 <5097 4511 gene locus_tag LOCUS_09730 <5097 4511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404046.1:ATP--cob(I)alamin adenosyltransferase >Feature sequence160 590 102 gene locus_tag LOCUS_09740 590 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1273 2163 gene locus_tag LOCUS_09750 1273 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 3715 2210 gene locus_tag LOCUS_09760 3715 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 4410 4111 gene locus_tag LOCUS_09770 4410 4111 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_09770 4700 4419 gene locus_tag LOCUS_09780 4700 4419 CDS product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence161 944 1624 gene locus_tag LOCUS_09790 944 1624 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105616.1 protein_id gnl|my_center|LOCUS_09790 2519 1683 gene locus_tag LOCUS_09800 2519 1683 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence162 1281 547 gene locus_tag LOCUS_09810 1281 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_09810 2365 1466 gene locus_tag LOCUS_09820 gene secF 2365 1466 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_09820 3957 2407 gene locus_tag LOCUS_09830 gene secD 3957 2407 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X5 protein_id gnl|my_center|LOCUS_09830 4285 3965 gene locus_tag LOCUS_09840 4285 3965 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence163 943 272 gene locus_tag LOCUS_09850 943 272 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964173.1 protein_id gnl|my_center|LOCUS_09850 1664 945 gene locus_tag LOCUS_09860 gene lepB 1664 945 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHC8 protein_id gnl|my_center|LOCUS_09860 3456 1654 gene locus_tag LOCUS_09870 gene lepA 3456 1654 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60789 protein_id gnl|my_center|LOCUS_09870 4636 3617 gene locus_tag LOCUS_09880 4636 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence164 872 309 gene locus_tag LOCUS_09890 872 309 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 protein_id gnl|my_center|LOCUS_09890 1359 862 gene locus_tag LOCUS_09900 1359 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2327 1392 gene locus_tag LOCUS_09910 2327 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 4387 2582 gene locus_tag LOCUS_09920 4387 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence165 285 1139 gene locus_tag LOCUS_09930 gene ureD 285 1139 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E725 protein_id gnl|my_center|LOCUS_09930 1167 1469 gene locus_tag LOCUS_09940 gene ureA 1167 1469 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUU8 protein_id gnl|my_center|LOCUS_09940 1484 1801 gene locus_tag LOCUS_09950 gene ureB 1484 1801 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UG2 protein_id gnl|my_center|LOCUS_09950 1798 3501 gene locus_tag LOCUS_09960 gene ureC 1798 3501 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUU5 protein_id gnl|my_center|LOCUS_09960 3514 3972 gene locus_tag LOCUS_09970 gene ureE 3514 3972 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E729 protein_id gnl|my_center|LOCUS_09970 3972 4652 gene locus_tag LOCUS_09980 gene ureF 3972 4652 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E730 protein_id gnl|my_center|LOCUS_09980 >Feature sequence166 1089 2399 gene locus_tag LOCUS_09990 1089 2399 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943971.1 protein_id gnl|my_center|LOCUS_09990 2469 3293 gene locus_tag LOCUS_10000 2469 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 4994 3306 gene locus_tag LOCUS_10010 gene ilvD 4994 3306 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF68 protein_id gnl|my_center|LOCUS_10010 >Feature sequence167 <1 810 gene locus_tag LOCUS_10020 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942910.1:ABC transporter permease 803 1513 gene locus_tag LOCUS_10030 gene lolD 803 1513 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT2 protein_id gnl|my_center|LOCUS_10030 1526 1960 gene locus_tag LOCUS_10040 1526 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094613.1 protein_id gnl|my_center|LOCUS_10040 2376 2005 gene locus_tag LOCUS_10050 2376 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 3823 2639 gene locus_tag LOCUS_10060 3823 2639 CDS product TIGR00299 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460167.1 protein_id gnl|my_center|LOCUS_10060 4212 3937 gene locus_tag LOCUS_10070 4212 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence168 232 1140 gene locus_tag LOCUS_10080 gene glcK 232 1140 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254107.1 protein_id gnl|my_center|LOCUS_10080 1227 2081 gene locus_tag LOCUS_10090 1227 2081 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708167.1 protein_id gnl|my_center|LOCUS_10090 2454 2089 gene locus_tag LOCUS_10100 2454 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4397 2559 gene locus_tag LOCUS_10110 4397 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence169 <1 682 gene locus_tag LOCUS_10120 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023815.1:ABC transporter ATP-binding protein 682 1689 gene locus_tag LOCUS_10130 682 1689 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027506.1 protein_id gnl|my_center|LOCUS_10130 1706 3214 gene locus_tag LOCUS_10140 gene cobQ 1706 3214 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0A5 protein_id gnl|my_center|LOCUS_10140 3208 3948 gene locus_tag LOCUS_10150 gene cobS 3208 3948 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NC26 protein_id gnl|my_center|LOCUS_10150 >Feature sequence170 598 176 gene locus_tag LOCUS_10160 598 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1526 732 gene locus_tag LOCUS_10170 1526 732 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_10170 2615 1545 gene locus_tag LOCUS_10180 2615 1545 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_10180 3437 2718 gene locus_tag LOCUS_10190 3437 2718 CDS product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_10190 4549 3440 gene locus_tag LOCUS_10200 4549 3440 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence171 1283 144 gene locus_tag LOCUS_10210 gene hemN 1283 144 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 protein_id gnl|my_center|LOCUS_10210 1389 2297 gene locus_tag LOCUS_10220 gene era 1389 2297 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818G1 protein_id gnl|my_center|LOCUS_10220 2284 3045 gene locus_tag LOCUS_10230 gene map 2284 3045 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY1 protein_id gnl|my_center|LOCUS_10230 3088 4956 gene locus_tag LOCUS_10240 3088 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 >Feature sequence172 81 506 gene locus_tag LOCUS_10250 gene nusB 81 506 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHQ2 protein_id gnl|my_center|LOCUS_10250 623 1351 gene locus_tag LOCUS_10260 623 1351 CDS product metallophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_10260 1494 3209 gene locus_tag LOCUS_10270 1494 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3211 4551 gene locus_tag LOCUS_10280 gene der 3211 4551 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5W8 protein_id gnl|my_center|LOCUS_10280 >Feature sequence173 755 2335 gene locus_tag LOCUS_10290 755 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2655 4613 gene locus_tag LOCUS_10300 2655 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence174 3037 1091 gene locus_tag LOCUS_10310 gene metG 3037 1091 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ14 protein_id gnl|my_center|LOCUS_10310 3982 3110 gene locus_tag LOCUS_10320 3982 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 <4963 4034 gene locus_tag LOCUS_10330 <4963 4034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942870.1:DNA polymerase III subunit delta' >Feature sequence175 53 226 gene locus_tag LOCUS_10340 53 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 228 665 gene locus_tag LOCUS_10350 gene dtd 228 665 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FT1 protein_id gnl|my_center|LOCUS_10350 1866 670 gene locus_tag LOCUS_10360 1866 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3587 2061 gene locus_tag LOCUS_10370 gene nuoN-1 3587 2061 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_10370 >Feature sequence176 1177 539 gene locus_tag LOCUS_10380 1177 539 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_10380 2555 1170 gene locus_tag LOCUS_10390 2555 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 4534 2888 gene locus_tag LOCUS_10400 4534 2888 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122718.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence177 <1 1647 gene locus_tag LOCUS_10410 <1 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919618.1:TonB-dependent receptor 1757 2353 gene locus_tag LOCUS_10420 1757 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 2437 2706 gene locus_tag LOCUS_10430 2437 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 4044 2722 gene locus_tag LOCUS_10440 4044 2722 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I762 protein_id gnl|my_center|LOCUS_10440 4371 4667 gene locus_tag LOCUS_10450 4371 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence178 <1 617 gene locus_tag LOCUS_10460 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000077913.1:protocatechuate 3,4-dioxygenase subunit beta 2361 646 gene locus_tag LOCUS_10470 2361 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2906 2364 gene locus_tag LOCUS_10480 2906 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 3099 4769 gene locus_tag LOCUS_10490 3099 4769 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence179 2306 1662 gene locus_tag LOCUS_10500 2306 1662 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256806.1 protein_id gnl|my_center|LOCUS_10500 2600 3034 gene locus_tag LOCUS_10510 2600 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence180 3002 1434 gene locus_tag LOCUS_10520 gene cimA 3002 1434 CDS product (R)-citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C76 protein_id gnl|my_center|LOCUS_10520 4259 3027 gene locus_tag LOCUS_10530 4259 3027 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885I9 protein_id gnl|my_center|LOCUS_10530 <4848 4347 gene locus_tag LOCUS_10540 <4848 4347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020191.1:phosphoglycerate mutase >Feature sequence181 201 563 gene locus_tag LOCUS_10550 201 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2356 608 gene locus_tag LOCUS_10560 2356 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 2919 2353 gene locus_tag LOCUS_10570 2919 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 4702 2930 gene locus_tag LOCUS_10580 4702 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence182 1927 317 gene locus_tag LOCUS_10590 gene arc 1927 317 CDS product proteasome-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ58 protein_id gnl|my_center|LOCUS_10590 2188 3486 gene locus_tag LOCUS_10600 2188 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 3534 4643 gene locus_tag LOCUS_10610 3534 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4733 4807 gene locus_tag LOCUS_t00040 4733 4807 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence183 379 1533 gene locus_tag LOCUS_10620 379 1533 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143401.1 protein_id gnl|my_center|LOCUS_10620 1670 2071 gene locus_tag LOCUS_10630 1670 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 2079 2774 gene locus_tag LOCUS_10640 2079 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2888 3451 gene locus_tag LOCUS_10650 gene tesA 2888 3451 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576212.1 protein_id gnl|my_center|LOCUS_10650 4583 3468 gene locus_tag LOCUS_10660 4583 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence184 1117 347 gene locus_tag LOCUS_10670 gene lgt 1117 347 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1A4 protein_id gnl|my_center|LOCUS_10670 1560 1159 gene locus_tag LOCUS_10680 1560 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 4467 1678 gene locus_tag LOCUS_10690 gene ileS 4467 1678 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747X9 protein_id gnl|my_center|LOCUS_10690 >Feature sequence185 510 827 gene locus_tag LOCUS_10700 510 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1448 942 gene locus_tag LOCUS_10710 1448 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2626 1445 gene locus_tag LOCUS_10720 2626 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459849.1 protein_id gnl|my_center|LOCUS_10720 3128 2601 gene locus_tag LOCUS_10730 3128 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3282 3115 gene locus_tag LOCUS_10740 3282 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 3461 3847 gene locus_tag LOCUS_10750 3461 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3844 4749 gene locus_tag LOCUS_10760 3844 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence186 256 930 gene locus_tag LOCUS_10770 256 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2932 1001 gene locus_tag LOCUS_10780 gene thiC 2932 1001 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ2 protein_id gnl|my_center|LOCUS_10780 3566 2925 gene locus_tag LOCUS_10790 gene thiE 3566 2925 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ74 protein_id gnl|my_center|LOCUS_10790 4384 3587 gene locus_tag LOCUS_10800 gene thiG 4384 3587 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FL9 protein_id gnl|my_center|LOCUS_10800 >Feature sequence187 1585 575 gene locus_tag LOCUS_10810 1585 575 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_10810 1861 2583 gene locus_tag LOCUS_10820 1861 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2622 3746 gene locus_tag LOCUS_10830 2622 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4691 3750 gene locus_tag LOCUS_10840 4691 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence188 312 2696 gene locus_tag LOCUS_10850 312 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2953 3132 gene locus_tag LOCUS_10860 2953 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3906 3463 gene locus_tag LOCUS_10870 3906 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence189 1253 597 gene locus_tag LOCUS_10880 1253 597 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_10880 2856 1261 gene locus_tag LOCUS_10890 2856 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3475 3050 gene locus_tag LOCUS_10900 3475 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 3942 3514 gene locus_tag LOCUS_10910 3942 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 <4737 3981 gene locus_tag LOCUS_10920 <4737 3981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943001.1:NAD(P)-dependent oxidoreductase >Feature sequence190 1958 2284 gene locus_tag LOCUS_10930 1958 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2476 2552 gene locus_tag LOCUS_t00050 2476 2552 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2775 3320 gene locus_tag LOCUS_10940 2775 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 4675 3572 gene locus_tag LOCUS_10950 4675 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence191 <1 1730 gene locus_tag LOCUS_10960 <1 1730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144078.1:tetratricopeptide repeat protein 3222 1906 gene locus_tag LOCUS_10970 gene yegQ 3222 1906 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704950.1 protein_id gnl|my_center|LOCUS_10970 4112 3291 gene locus_tag LOCUS_10980 gene kcnb2 4112 3291 CDS product potassium voltage gated channel, Shab-related subfamily, member 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_10980 4647 4264 gene locus_tag LOCUS_10990 4647 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence192 310 1986 gene locus_tag LOCUS_11000 310 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 3283 1988 gene locus_tag LOCUS_11010 gene cnt1 3283 1988 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122543.1 protein_id gnl|my_center|LOCUS_11010 3381 3764 gene locus_tag LOCUS_11020 3381 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 4324 3761 gene locus_tag LOCUS_11030 4324 3761 CDS product non-canonical purine NTP pyrophosphatase, RdgB/HAM1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496428.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence193 555 88 gene locus_tag LOCUS_11040 555 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1039 623 gene locus_tag LOCUS_11050 gene ndk 1039 623 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E54 protein_id gnl|my_center|LOCUS_11050 1399 1136 gene locus_tag LOCUS_11060 gene forD2 1399 1136 CDS product ferredoxin oxidoreductase 2 subunit ForD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67232 protein_id gnl|my_center|LOCUS_11060 2150 1422 gene locus_tag LOCUS_11070 gene forG2 2150 1422 CDS product ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880733.1 protein_id gnl|my_center|LOCUS_11070 3040 2168 gene locus_tag LOCUS_11080 gene forB2 3040 2168 CDS product ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880732.1 protein_id gnl|my_center|LOCUS_11080 4358 3126 gene locus_tag LOCUS_11090 gene forA2 4358 3126 CDS product ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880731.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence194 3411 2164 gene locus_tag LOCUS_11100 gene clpX 3411 2164 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C83 protein_id gnl|my_center|LOCUS_11100 4107 3460 gene locus_tag LOCUS_11110 gene clpP 4107 3460 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY6 protein_id gnl|my_center|LOCUS_11110 >Feature sequence195 421 122 gene locus_tag LOCUS_11120 421 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 800 480 gene locus_tag LOCUS_11130 800 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1106 906 gene locus_tag LOCUS_11140 1106 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1959 1540 gene locus_tag LOCUS_11150 1959 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 2286 3917 gene locus_tag LOCUS_11160 2286 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 4234 3935 gene locus_tag LOCUS_11170 4234 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence196 <1 934 gene locus_tag LOCUS_11180 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967814.1:methyl-accepting chemotaxis protein 1819 941 gene locus_tag LOCUS_11190 gene oleB 1819 941 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_11190 2859 1813 gene locus_tag LOCUS_11200 gene fabH 2859 1813 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123917.1 protein_id gnl|my_center|LOCUS_11200 <4647 2939 gene locus_tag LOCUS_11210 <4647 2939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938960.1:ABC transporter ATP-binding protein >Feature sequence197 1769 1083 gene locus_tag LOCUS_11220 1769 1083 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_11220 2607 1780 gene locus_tag LOCUS_11230 2607 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 3485 2649 gene locus_tag LOCUS_11240 3485 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 4439 3555 gene locus_tag LOCUS_11250 gene legL1 4439 3555 CDS product GALA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946680.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence198 2301 859 gene locus_tag LOCUS_11260 2301 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 2451 2630 gene locus_tag LOCUS_11270 2451 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 2663 2803 gene locus_tag LOCUS_11280 2663 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2827 3318 gene locus_tag LOCUS_11290 2827 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 4113 3334 gene locus_tag LOCUS_11300 4113 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence199 654 385 gene locus_tag LOCUS_11310 654 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1057 1362 gene locus_tag LOCUS_11320 1057 1362 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817039.1 protein_id gnl|my_center|LOCUS_11320 2101 4539 gene locus_tag LOCUS_11330 2101 4539 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966917.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence200 309 2606 gene locus_tag LOCUS_11340 309 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 4041 2626 gene locus_tag LOCUS_11350 4041 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence201 1617 331 gene locus_tag LOCUS_11360 gene gltA 1617 331 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW5 protein_id gnl|my_center|LOCUS_11360 1834 3063 gene locus_tag LOCUS_11370 1834 3063 CDS product ethanolamine utilization protein EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119028.1 protein_id gnl|my_center|LOCUS_11370 3066 3419 gene locus_tag LOCUS_11380 3066 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence202 1251 55 gene locus_tag LOCUS_11390 1251 55 CDS product glutaconyl-CoA decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_11390 3059 1251 gene locus_tag LOCUS_11400 3059 1251 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_11400 <4598 3228 gene locus_tag LOCUS_11410 <4598 3228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870209.1:Trk system potassium transporter TrkH >Feature sequence203 185 2113 gene locus_tag LOCUS_11420 185 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2138 2545 gene locus_tag LOCUS_11430 2138 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3650 2838 gene locus_tag LOCUS_11440 gene uppP 3650 2838 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SL0 protein_id gnl|my_center|LOCUS_11440 3746 4438 gene locus_tag LOCUS_11450 3746 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence204 486 932 gene locus_tag LOCUS_11460 486 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2910 1063 gene locus_tag LOCUS_11470 2910 1063 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876408.1 protein_id gnl|my_center|LOCUS_11470 4436 2901 gene locus_tag LOCUS_11480 4436 2901 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876381.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence205 1370 756 gene locus_tag LOCUS_11490 1370 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1693 2805 gene locus_tag LOCUS_11500 gene thiO 1693 2805 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403986.1 protein_id gnl|my_center|LOCUS_11500 2854 4215 gene locus_tag LOCUS_11510 gene bioA 2854 4215 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I693 protein_id gnl|my_center|LOCUS_11510 >Feature sequence206 213 797 gene locus_tag LOCUS_11520 213 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1088 834 gene locus_tag LOCUS_11530 1088 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1399 2844 gene locus_tag LOCUS_11540 1399 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 3702 2869 gene locus_tag LOCUS_11550 3702 2869 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_11550 <4566 3783 gene locus_tag LOCUS_11560 <4566 3783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940643.1:lipoprotein >Feature sequence207 946 194 gene locus_tag LOCUS_11570 946 194 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425498.1 protein_id gnl|my_center|LOCUS_11570 3426 955 gene locus_tag LOCUS_11580 gene priA 3426 955 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y675 protein_id gnl|my_center|LOCUS_11580 <4560 3446 gene locus_tag LOCUS_11590 <4560 3446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709314.1:adenylate cyclase >Feature sequence208 <1 531 gene locus_tag LOCUS_11600 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962745.1:macrolide ABC transporter ATP-binding protein 528 1736 gene locus_tag LOCUS_11610 528 1736 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_11610 1746 2966 gene locus_tag LOCUS_11620 1746 2966 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786907.1 protein_id gnl|my_center|LOCUS_11620 3170 4144 gene locus_tag LOCUS_11630 3170 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence209 1704 532 gene locus_tag LOCUS_11640 1704 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 2315 1902 gene locus_tag LOCUS_11650 gene atpC 2315 1902 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462228.1 protein_id gnl|my_center|LOCUS_11650 3735 2320 gene locus_tag LOCUS_11660 gene atpD 3735 2320 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFX9 protein_id gnl|my_center|LOCUS_11660 <4548 3769 gene locus_tag LOCUS_11670 <4548 3769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GY1:ATP synthase gamma chain >Feature sequence210 1967 306 gene locus_tag LOCUS_11680 gene groL 1967 306 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C7 protein_id gnl|my_center|LOCUS_11680 2315 2025 gene locus_tag LOCUS_11690 gene groS 2315 2025 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C8 protein_id gnl|my_center|LOCUS_11690 2556 2939 gene locus_tag LOCUS_11700 gene queF 2556 2939 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKP6 protein_id gnl|my_center|LOCUS_11700 2964 3290 gene locus_tag LOCUS_11710 2964 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 3312 3755 gene locus_tag LOCUS_11720 3312 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 3759 4028 gene locus_tag LOCUS_11730 3759 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence211 127 411 gene locus_tag LOCUS_11740 127 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1494 466 gene locus_tag LOCUS_11750 1494 466 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941710.1 protein_id gnl|my_center|LOCUS_11750 2628 1567 gene locus_tag LOCUS_11760 gene prfB 2628 1567 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AS3 protein_id gnl|my_center|LOCUS_11760 3269 4129 gene locus_tag LOCUS_11770 3269 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 >Feature sequence212 331 1917 gene locus_tag LOCUS_11780 gene rny 331 1917 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E27 protein_id gnl|my_center|LOCUS_11780 1929 2708 gene locus_tag LOCUS_11790 1929 2708 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_11790 2929 4434 gene locus_tag LOCUS_11800 gene lysS 2929 4434 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT0 protein_id gnl|my_center|LOCUS_11800 >Feature sequence213 43 326 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgatcttcagctgccgcttcttc 1333 2271 gene locus_tag LOCUS_11810 1333 2271 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986927.1 protein_id gnl|my_center|LOCUS_11810 2501 2349 gene locus_tag LOCUS_11820 2501 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 2923 2561 gene locus_tag LOCUS_11830 2923 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3438 3025 gene locus_tag LOCUS_11840 3438 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 4501 3854 gene locus_tag LOCUS_11850 4501 3854 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence214 1063 1515 gene locus_tag LOCUS_11860 1063 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2598 1537 gene locus_tag LOCUS_11870 2598 1537 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_11870 3373 2633 gene locus_tag LOCUS_11880 3373 2633 CDS product polyprenol phosphate mannosyl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_11880 4470 3400 gene locus_tag LOCUS_11890 4470 3400 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence215 66 395 gene locus_tag LOCUS_11900 66 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 409 855 gene locus_tag LOCUS_11910 409 855 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943168.1 protein_id gnl|my_center|LOCUS_11910 1009 1656 gene locus_tag LOCUS_11920 1009 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2293 1712 gene locus_tag LOCUS_11930 2293 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3541 2717 gene locus_tag LOCUS_11940 3541 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence216 274 1683 gene locus_tag LOCUS_11950 274 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1817 3601 gene locus_tag LOCUS_11960 gene aspS 1817 3601 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D56 protein_id gnl|my_center|LOCUS_11960 3869 4105 gene locus_tag LOCUS_11970 3869 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence217 1422 2114 gene locus_tag LOCUS_11980 1422 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 2784 2503 gene locus_tag LOCUS_11990 2784 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 <4463 3302 gene locus_tag LOCUS_12000 <4463 3302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388476.1:methyl-accepting chemotaxis protein >Feature sequence218 101 928 gene locus_tag LOCUS_12010 101 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460802.1 protein_id gnl|my_center|LOCUS_12010 1030 2103 gene locus_tag LOCUS_12020 gene ribD 1030 2103 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LH1 protein_id gnl|my_center|LOCUS_12020 2103 2759 gene locus_tag LOCUS_12030 2103 2759 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483039.1 protein_id gnl|my_center|LOCUS_12030 2763 3977 gene locus_tag LOCUS_12040 gene ribBA 2763 3977 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHZ1 protein_id gnl|my_center|LOCUS_12040 3989 4456 gene locus_tag LOCUS_12050 gene ribH 3989 4456 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK04 protein_id gnl|my_center|LOCUS_12050 >Feature sequence219 708 355 gene locus_tag LOCUS_12060 gene ydeP 708 355 CDS product putative HTH-type transcriptional regulator YdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96673 protein_id gnl|my_center|LOCUS_12060 819 1256 gene locus_tag LOCUS_12070 819 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709523.1 protein_id gnl|my_center|LOCUS_12070 1326 1697 gene locus_tag LOCUS_12080 1326 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2684 1887 gene locus_tag LOCUS_12090 2684 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3130 2711 gene locus_tag LOCUS_12100 3130 2711 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482828.1 protein_id gnl|my_center|LOCUS_12100 3977 3372 gene locus_tag LOCUS_12110 3977 3372 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence220 3962 2457 gene locus_tag LOCUS_12120 3962 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence221 163 972 gene locus_tag LOCUS_12130 163 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1171 1347 gene locus_tag LOCUS_12140 1171 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1299 1700 gene locus_tag LOCUS_12150 1299 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1729 2430 gene locus_tag LOCUS_12160 1729 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 3531 2536 gene locus_tag LOCUS_12170 3531 2536 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence222 1518 283 gene locus_tag LOCUS_12180 1518 283 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHD3 protein_id gnl|my_center|LOCUS_12180 1770 1537 gene locus_tag LOCUS_12190 gene acpP 1770 1537 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43709 protein_id gnl|my_center|LOCUS_12190 2534 1794 gene locus_tag LOCUS_12200 gene fabG 2534 1794 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933770.1 protein_id gnl|my_center|LOCUS_12200 3567 2605 gene locus_tag LOCUS_12210 gene fabD-2 3567 2605 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS0 protein_id gnl|my_center|LOCUS_12210 <4439 3540 gene locus_tag LOCUS_12220 <4439 3540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CS1:3-oxoacyl-[acyl-carrier-protein] synthase 3 >Feature sequence223 <1 914 gene locus_tag LOCUS_12230 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082593.1:ATPase 1280 936 gene locus_tag LOCUS_12240 1280 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 3464 1953 gene locus_tag LOCUS_12250 gene gcvP' 3464 1953 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZP2 protein_id gnl|my_center|LOCUS_12250 <4436 3575 gene locus_tag LOCUS_12260 <4436 3575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546733.1:glycosyl transferase family 9 >Feature sequence224 <1 1112 gene locus_tag LOCUS_12270 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583203.1:secretion protein HlyD 1109 1804 gene locus_tag LOCUS_12280 1109 1804 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 protein_id gnl|my_center|LOCUS_12280 1798 3006 gene locus_tag LOCUS_12290 1798 3006 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_12290 3036 3908 gene locus_tag LOCUS_12300 gene ilvE 3036 3908 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528132.1 protein_id gnl|my_center|LOCUS_12300 3948 4382 gene locus_tag LOCUS_12310 3948 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence225 828 649 gene locus_tag LOCUS_12320 828 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_12320 1797 862 gene locus_tag LOCUS_12330 gene acuC2 1797 862 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_12330 2278 1823 gene locus_tag LOCUS_12340 2278 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2457 3581 gene locus_tag LOCUS_12350 gene queG 2457 3581 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WH3 protein_id gnl|my_center|LOCUS_12350 >Feature sequence226 1758 1156 gene locus_tag LOCUS_12360 1758 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 3822 1882 gene locus_tag LOCUS_12370 gene dnaK 3822 1882 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEY0 protein_id gnl|my_center|LOCUS_12370 >Feature sequence227 3298 1775 gene locus_tag LOCUS_12380 3298 1775 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055172.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence228 <1 706 gene locus_tag LOCUS_12390 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003081747.1:Crp/Fnr family transcriptional regulator 2968 752 gene locus_tag LOCUS_12400 2968 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence229 86 2101 gene locus_tag LOCUS_12410 86 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 2149 3324 gene locus_tag LOCUS_12420 2149 3324 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388449.1 protein_id gnl|my_center|LOCUS_12420 <4396 3421 gene locus_tag LOCUS_12430 <4396 3421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388448.1:histidine kinase >Feature sequence230 2990 879 gene locus_tag LOCUS_12440 2990 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence231 1582 2937 gene locus_tag LOCUS_12450 1582 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 2953 3990 gene locus_tag LOCUS_12460 2953 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence232 1101 3320 gene locus_tag LOCUS_12470 1101 3320 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545777.1 protein_id gnl|my_center|LOCUS_12470 4290 3313 gene locus_tag LOCUS_12480 4290 3313 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532524.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence233 2228 834 gene locus_tag LOCUS_12490 2228 834 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LN4 protein_id gnl|my_center|LOCUS_12490 2379 3212 gene locus_tag LOCUS_12500 2379 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 <4361 3281 gene locus_tag LOCUS_12510 <4361 3281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071150.1:two-component system response regulator >Feature sequence234 1430 72 gene locus_tag LOCUS_12520 1430 72 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_12520 2441 1590 gene locus_tag LOCUS_12530 2441 1590 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E95 protein_id gnl|my_center|LOCUS_12530 3541 2489 gene locus_tag LOCUS_12540 3541 2489 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937987.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence235 <1 1350 gene locus_tag LOCUS_12550 <1 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065170.1:histidine kinase 3029 1437 gene locus_tag LOCUS_12560 3029 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 4345 3299 gene locus_tag LOCUS_12570 4345 3299 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence236 <1 1352 gene locus_tag LOCUS_12580 <1 1352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071740.1:tRNA/rRNA cytosine-C5-methylase RsmB 1523 2167 gene locus_tag LOCUS_12590 1523 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2279 3115 gene locus_tag LOCUS_12600 2279 3115 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391780.1 protein_id gnl|my_center|LOCUS_12600 3112 4050 gene locus_tag LOCUS_12610 3112 4050 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence237 1360 2118 gene locus_tag LOCUS_12620 1360 2118 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_12620 2389 2982 gene locus_tag LOCUS_12630 gene tsf 2389 2982 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61333 protein_id gnl|my_center|LOCUS_12630 2948 3715 gene locus_tag LOCUS_12640 gene pyrH 2948 3715 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGE1 protein_id gnl|my_center|LOCUS_12640 3719 4273 gene locus_tag LOCUS_12650 gene frr 3719 4273 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DQ9 protein_id gnl|my_center|LOCUS_12650 >Feature sequence238 4202 1581 gene locus_tag LOCUS_12660 gene clpB 4202 1581 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence239 <1 2541 gene locus_tag LOCUS_12670 <1 2541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861545.1:multidrug transporter 2830 2558 gene locus_tag LOCUS_12680 2830 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 <4297 2898 gene locus_tag LOCUS_12690 <4297 2898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085716.1:chemotaxis protein >Feature sequence240 <1 711 gene locus_tag LOCUS_12700 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545245.1:twitching motility protein PilT 745 1434 gene locus_tag LOCUS_12710 745 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1431 1853 gene locus_tag LOCUS_12720 1431 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1866 3068 gene locus_tag LOCUS_12730 gene pilC 1866 3068 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence241 221 904 gene locus_tag LOCUS_12740 gene modC 221 904 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_12740 901 1995 gene locus_tag LOCUS_12750 gene modC 901 1995 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q881C1 protein_id gnl|my_center|LOCUS_12750 2008 3429 gene locus_tag LOCUS_12760 2008 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 4102 3524 gene locus_tag LOCUS_12770 4102 3524 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence242 1676 720 gene locus_tag LOCUS_12780 1676 720 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436527.1 protein_id gnl|my_center|LOCUS_12780 2924 1698 gene locus_tag LOCUS_12790 2924 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 4043 2985 gene locus_tag LOCUS_12800 4043 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence243 >Feature sequence244 2 1225 gene locus_tag LOCUS_12810 2 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 3715 1232 gene locus_tag LOCUS_12820 3715 1232 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546286.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence245 94 1179 gene locus_tag LOCUS_12830 94 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 2383 2877 gene locus_tag LOCUS_12840 2383 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence246 2668 2015 gene locus_tag LOCUS_12850 2668 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence247 2978 900 gene locus_tag LOCUS_12860 2978 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544993.1 protein_id gnl|my_center|LOCUS_12860 3136 3693 gene locus_tag LOCUS_12870 3136 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3714 4214 gene locus_tag LOCUS_12880 3714 4214 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198805.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence248 176 832 gene locus_tag LOCUS_12890 gene nth 176 832 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D69 protein_id gnl|my_center|LOCUS_12890 1594 872 gene locus_tag LOCUS_12900 gene rph 1594 872 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RV5 protein_id gnl|my_center|LOCUS_12900 1832 3820 gene locus_tag LOCUS_12910 1832 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence249 1124 1780 gene locus_tag LOCUS_12920 1124 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 4073 1920 gene locus_tag LOCUS_12930 4073 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence250 216 1319 gene locus_tag LOCUS_12940 216 1319 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967877.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence251 1941 271 gene locus_tag LOCUS_12950 gene yidC 1941 271 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Q2 protein_id gnl|my_center|LOCUS_12950 2948 4036 gene locus_tag LOCUS_12960 2948 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence252 52 390 gene locus_tag LOCUS_12970 52 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1588 410 gene locus_tag LOCUS_12980 1588 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2891 1620 gene locus_tag LOCUS_12990 2891 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 4010 3009 gene locus_tag LOCUS_13000 4010 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 4217 4056 gene locus_tag LOCUS_13010 4217 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence253 786 1160 gene locus_tag LOCUS_13020 786 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_13020 2104 1418 gene locus_tag LOCUS_13030 2104 1418 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461702.1 protein_id gnl|my_center|LOCUS_13030 2195 3604 gene locus_tag LOCUS_13040 2195 3604 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842981.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence254 1684 3918 gene locus_tag LOCUS_13050 1684 3918 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence255 1195 98 gene locus_tag LOCUS_13060 1195 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1481 2830 gene locus_tag LOCUS_13070 1481 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 3747 2959 gene locus_tag LOCUS_13080 3747 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence256 <1 1368 gene locus_tag LOCUS_13090 <1 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YLD2:threonine--tRNA ligase 1427 1924 gene locus_tag LOCUS_13100 gene infC 1427 1924 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728R6 protein_id gnl|my_center|LOCUS_13100 2201 2560 gene locus_tag LOCUS_13110 gene rplT 2201 2560 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RSW7 protein_id gnl|my_center|LOCUS_13110 3737 2802 gene locus_tag LOCUS_13120 3737 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence257 1297 500 gene locus_tag LOCUS_13130 gene hisN 1297 500 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_13130 2367 1294 gene locus_tag LOCUS_13140 gene mnmA 2367 1294 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A22 protein_id gnl|my_center|LOCUS_13140 2951 2394 gene locus_tag LOCUS_13150 2951 2394 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_13150 3163 3645 gene locus_tag LOCUS_13160 3163 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 3680 3753 gene locus_tag LOCUS_t00060 3680 3753 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence258 564 115 gene locus_tag LOCUS_13170 564 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 730 1548 gene locus_tag LOCUS_13180 730 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_13180 1605 2429 gene locus_tag LOCUS_13190 1605 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2433 3431 gene locus_tag LOCUS_13200 gene sppA 2433 3431 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941487.1 protein_id gnl|my_center|LOCUS_13200 3453 4100 gene locus_tag LOCUS_13210 gene yflK 3453 4100 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262987.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence259 1517 36 gene locus_tag LOCUS_13220 1517 36 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257638.1 protein_id gnl|my_center|LOCUS_13220 1845 2912 gene locus_tag LOCUS_13230 1845 2912 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067131.1 protein_id gnl|my_center|LOCUS_13230 2933 3175 gene locus_tag LOCUS_13240 2933 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3210 3809 gene locus_tag LOCUS_13250 3210 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence260 2 1438 gene locus_tag LOCUS_13260 2 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1660 4005 gene locus_tag LOCUS_13270 1660 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence261 428 895 gene locus_tag LOCUS_13280 428 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 956 1444 gene locus_tag LOCUS_13290 gene greA 956 1444 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q725M4 protein_id gnl|my_center|LOCUS_13290 1444 2073 gene locus_tag LOCUS_13300 gene trmB 1444 2073 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FT5 protein_id gnl|my_center|LOCUS_13300 2139 4160 gene locus_tag LOCUS_13310 2139 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence262 794 2482 gene locus_tag LOCUS_13320 794 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 2479 3312 gene locus_tag LOCUS_13330 2479 3312 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 protein_id gnl|my_center|LOCUS_13330 3317 4039 gene locus_tag LOCUS_13340 3317 4039 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727611.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence263 483 79 gene locus_tag LOCUS_13350 483 79 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530912.1 protein_id gnl|my_center|LOCUS_13350 629 2110 gene locus_tag LOCUS_13360 629 2110 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_13360 2349 3182 gene locus_tag LOCUS_13370 gene dapF 2349 3182 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67693 protein_id gnl|my_center|LOCUS_13370 3211 4086 gene locus_tag LOCUS_13380 gene dapA 3211 4086 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AX2 protein_id gnl|my_center|LOCUS_13380 >Feature sequence264 221 2857 gene locus_tag LOCUS_13390 gene alaS 221 2857 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61701 protein_id gnl|my_center|LOCUS_13390 2973 3305 gene locus_tag LOCUS_13400 2973 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 3314 3387 gene locus_tag LOCUS_t00070 3314 3387 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence265 <1 586 gene locus_tag LOCUS_13410 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888196.1:colanic acid biosynthesis glycosyltransferase WcaL 1897 2919 gene locus_tag LOCUS_13420 1897 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence266 532 371 gene locus_tag LOCUS_13430 532 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1231 953 gene locus_tag LOCUS_13440 1231 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 2124 1843 gene locus_tag LOCUS_13450 2124 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2447 2286 gene locus_tag LOCUS_13460 2447 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 2871 3611 gene locus_tag LOCUS_13470 2871 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence267 44 844 gene locus_tag LOCUS_13480 gene flgF 44 844 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F0 protein_id gnl|my_center|LOCUS_13480 884 1672 gene locus_tag LOCUS_13490 gene flgG 884 1672 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F1 protein_id gnl|my_center|LOCUS_13490 1689 2444 gene locus_tag LOCUS_13500 1689 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2460 3197 gene locus_tag LOCUS_13510 gene flgH 2460 3197 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F4 protein_id gnl|my_center|LOCUS_13510 3267 3659 gene locus_tag LOCUS_13520 3267 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence268 1579 1295 gene locus_tag LOCUS_13530 1579 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13530 1750 1607 gene locus_tag LOCUS_13540 1750 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1880 1761 gene locus_tag LOCUS_13550 1880 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13550 2005 2505 gene locus_tag LOCUS_13560 2005 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 2513 3376 gene locus_tag LOCUS_13570 2513 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence269 2208 643 gene locus_tag LOCUS_13580 gene mviN 2208 643 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DZ3 protein_id gnl|my_center|LOCUS_13580 >Feature sequence270 1340 378 gene locus_tag LOCUS_13590 gene accA 1340 378 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB5 protein_id gnl|my_center|LOCUS_13590 2294 1362 gene locus_tag LOCUS_13600 2294 1362 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109422.1 protein_id gnl|my_center|LOCUS_13600 3502 2474 gene locus_tag LOCUS_13610 gene lpxD 3502 2474 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHC2 protein_id gnl|my_center|LOCUS_13610 <4107 3576 gene locus_tag LOCUS_13620 <4107 3576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261708.1:protein NirV >Feature sequence271 74 286 gene locus_tag LOCUS_13630 74 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 858 346 gene locus_tag LOCUS_13640 858 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 2027 873 gene locus_tag LOCUS_13650 2027 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 3430 1994 gene locus_tag LOCUS_13660 3430 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence272 1340 687 gene locus_tag LOCUS_13670 1340 687 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938322.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence273 <1 2141 gene locus_tag LOCUS_13680 <1 2141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000612757.1:serine phosphatase 2163 2423 gene locus_tag LOCUS_13690 2163 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3059 2469 gene locus_tag LOCUS_13700 3059 2469 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188272.1 protein_id gnl|my_center|LOCUS_13700 3793 3056 gene locus_tag LOCUS_13710 3793 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205421.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence274 176 712 gene locus_tag LOCUS_13720 gene ycgM 176 712 CDS product acylpyruvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941248.1 protein_id gnl|my_center|LOCUS_13720 1110 1643 gene locus_tag LOCUS_13730 1110 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1684 2196 gene locus_tag LOCUS_13740 1684 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2315 2740 gene locus_tag LOCUS_13750 2315 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 <4049 2755 gene locus_tag LOCUS_13760 <4049 2755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267333.1:histidine kinase >Feature sequence275 670 83 gene locus_tag LOCUS_13770 670 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1199 657 gene locus_tag LOCUS_13780 1199 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1321 1707 gene locus_tag LOCUS_13790 gene glod5 1321 1707 CDS product virulence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence276 831 622 gene locus_tag LOCUS_13800 831 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1031 828 gene locus_tag LOCUS_13810 1031 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 2544 1138 gene locus_tag LOCUS_13820 2544 1138 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063909.1 protein_id gnl|my_center|LOCUS_13820 3415 2609 gene locus_tag LOCUS_13830 gene mqnA 3415 2609 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT25 protein_id gnl|my_center|LOCUS_13830 >Feature sequence277 554 156 gene locus_tag LOCUS_13840 554 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 834 3248 gene locus_tag LOCUS_13850 834 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 <4022 3287 gene locus_tag LOCUS_13860 <4022 3287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460349.1:MBL fold metallo-hydrolase >Feature sequence278 1090 491 gene locus_tag LOCUS_13870 1090 491 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082103.1 protein_id gnl|my_center|LOCUS_13870 3005 1191 gene locus_tag LOCUS_13880 3005 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence279 404 1402 gene locus_tag LOCUS_13890 404 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1645 2322 gene locus_tag LOCUS_13900 1645 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2327 3805 gene locus_tag LOCUS_13910 2327 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence280 1086 106 gene locus_tag LOCUS_13920 1086 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1391 1822 gene locus_tag LOCUS_13930 1391 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1887 2807 gene locus_tag LOCUS_13940 1887 2807 CDS product heme-binding sensor globin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943923.1 protein_id gnl|my_center|LOCUS_13940 <4009 2888 gene locus_tag LOCUS_13950 <4009 2888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388476.1:methyl-accepting chemotaxis protein >Feature sequence281 221 1174 gene locus_tag LOCUS_13960 221 1174 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_13960 1337 2329 gene locus_tag LOCUS_13970 gene bioB 1337 2329 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT7 protein_id gnl|my_center|LOCUS_13970 2839 2654 gene locus_tag LOCUS_13980 2839 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3357 2860 gene locus_tag LOCUS_13990 3357 2860 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence282 263 1456 gene locus_tag LOCUS_14000 263 1456 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIE3 protein_id gnl|my_center|LOCUS_14000 1467 2771 gene locus_tag LOCUS_14010 gene hom 1467 2771 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI0 protein_id gnl|my_center|LOCUS_14010 >Feature sequence283 1593 634 gene locus_tag LOCUS_14020 gene dmt 1593 634 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_14020 3324 1786 gene locus_tag LOCUS_14030 3324 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 <3982 3346 gene locus_tag LOCUS_14040 <3982 3346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259612.1:radical SAM protein >Feature sequence284 316 83 gene locus_tag LOCUS_14050 316 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1017 751 gene locus_tag LOCUS_14060 1017 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1599 1348 gene locus_tag LOCUS_14070 gene moaD 1599 1348 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXJ8 protein_id gnl|my_center|LOCUS_14070 2105 1596 gene locus_tag LOCUS_14080 gene moaC 2105 1596 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y871 protein_id gnl|my_center|LOCUS_14080 2262 2876 gene locus_tag LOCUS_14090 2262 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2914 3501 gene locus_tag LOCUS_14100 2914 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence285 1852 143 gene locus_tag LOCUS_14110 1852 143 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948187.1 protein_id gnl|my_center|LOCUS_14110 2757 1879 gene locus_tag LOCUS_14120 2757 1879 CDS product methylthioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868192.1 protein_id gnl|my_center|LOCUS_14120 3275 2757 gene locus_tag LOCUS_14130 3275 2757 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_14130 <3974 3369 gene locus_tag LOCUS_14140 <3974 3369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006310200.1:1-acyl-sn-glycerol-3-phosphate acyltransferase >Feature sequence286 <1 691 gene locus_tag LOCUS_14150 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206734.1:catalase 1091 2536 gene locus_tag LOCUS_14160 1091 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2536 3294 gene locus_tag LOCUS_14170 gene fliP 2536 3294 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V8D2 protein_id gnl|my_center|LOCUS_14170 3326 3595 gene locus_tag LOCUS_14180 gene fliQ 3326 3595 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937354.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence287 <1 1423 gene locus_tag LOCUS_14190 <1 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258815.1:pyruvate, phosphate dikinase >Feature sequence288 206 36 gene locus_tag LOCUS_14200 206 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1479 451 gene locus_tag LOCUS_14210 1479 451 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_14210 2237 1506 gene locus_tag LOCUS_14220 2237 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2752 2360 gene locus_tag LOCUS_14230 2752 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 3032 2796 gene locus_tag LOCUS_14240 3032 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence289 84 1016 gene locus_tag LOCUS_14250 84 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1110 1301 gene locus_tag LOCUS_14260 1110 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1792 1298 gene locus_tag LOCUS_14270 1792 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 3313 1817 gene locus_tag LOCUS_14280 3313 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143565.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence290 1618 2310 gene locus_tag LOCUS_14290 1618 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 2488 2742 gene locus_tag LOCUS_14300 2488 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2770 3573 gene locus_tag LOCUS_14310 2770 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 3825 3574 gene locus_tag LOCUS_14320 3825 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence291 291 82 gene locus_tag LOCUS_14330 291 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 364 1806 gene locus_tag LOCUS_14340 gene gatB 364 1806 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL60 protein_id gnl|my_center|LOCUS_14340 1846 2412 gene locus_tag LOCUS_14350 1846 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence292 3 1013 gene locus_tag LOCUS_14360 3 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1086 1943 gene locus_tag LOCUS_14370 gene folD 1086 1943 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIB4 protein_id gnl|my_center|LOCUS_14370 1949 3607 gene locus_tag LOCUS_14380 1949 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence293 713 934 gene locus_tag LOCUS_14390 713 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 981 1295 gene locus_tag LOCUS_14400 981 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1356 1940 gene locus_tag LOCUS_14410 1356 1940 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_14410 2402 1953 gene locus_tag LOCUS_14420 2402 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence294 140 1564 gene locus_tag LOCUS_14430 140 1564 CDS product membrane-bound O-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379730.1 protein_id gnl|my_center|LOCUS_14430 1539 2627 gene locus_tag LOCUS_14440 1539 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence295 156 1346 gene locus_tag LOCUS_14450 gene nuoD 156 1346 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7Q2 protein_id gnl|my_center|LOCUS_14450 1527 2477 gene locus_tag LOCUS_14460 1527 2477 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551381.1 protein_id gnl|my_center|LOCUS_14460 3041 2520 gene locus_tag LOCUS_14470 3041 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 3600 3244 gene locus_tag LOCUS_14480 3600 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence296 1785 2315 gene locus_tag LOCUS_14490 1785 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 3432 2365 gene locus_tag LOCUS_14500 gene flhB 3432 2365 CDS product flagellar biosynthetic protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35538 protein_id gnl|my_center|LOCUS_14500 >Feature sequence297 1050 514 gene locus_tag LOCUS_14510 1050 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1911 1213 gene locus_tag LOCUS_14520 1911 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 3415 1895 gene locus_tag LOCUS_14530 3415 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868303.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence298 >Feature sequence299 237 1154 gene locus_tag LOCUS_14540 237 1154 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947921.1 protein_id gnl|my_center|LOCUS_14540 1987 1151 gene locus_tag LOCUS_14550 gene hisF 1987 1151 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60715 protein_id gnl|my_center|LOCUS_14550 2711 1977 gene locus_tag LOCUS_14560 gene hisA 2711 1977 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60581 protein_id gnl|my_center|LOCUS_14560 >Feature sequence300 1496 3406 gene locus_tag LOCUS_14570 1496 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence301 1215 2177 gene locus_tag LOCUS_14580 1215 2177 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_14580 2203 3024 gene locus_tag LOCUS_14590 gene cheR1 2203 3024 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XC4 protein_id gnl|my_center|LOCUS_14590 >Feature sequence302 140 700 gene locus_tag LOCUS_14600 140 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 713 1858 gene locus_tag LOCUS_14610 713 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1972 3354 gene locus_tag LOCUS_14620 gene argH 1972 3354 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI1 protein_id gnl|my_center|LOCUS_14620 3351 3479 gene locus_tag LOCUS_14630 3351 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence303 73 873 gene locus_tag LOCUS_14640 73 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 protein_id gnl|my_center|LOCUS_14640 1836 928 gene locus_tag LOCUS_14650 gene desC1 1836 928 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058212.1 protein_id gnl|my_center|LOCUS_14650 2035 2997 gene locus_tag LOCUS_14660 2035 2997 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942523.1 protein_id gnl|my_center|LOCUS_14660 3028 3747 gene locus_tag LOCUS_14670 3028 3747 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence304 358 2121 gene locus_tag LOCUS_14680 358 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence305 2440 656 gene locus_tag LOCUS_14690 2440 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 3220 2558 gene locus_tag LOCUS_14700 3220 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3713 3240 gene locus_tag LOCUS_14710 3713 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence306 2018 1368 gene locus_tag LOCUS_14720 2018 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence307 1270 764 gene locus_tag LOCUS_14730 1270 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1565 3760 gene locus_tag LOCUS_14740 1565 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence308 1901 1275 gene locus_tag LOCUS_14750 1901 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1987 2565 gene locus_tag LOCUS_14760 gene btuE 1987 2565 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJH2 protein_id gnl|my_center|LOCUS_14760 3206 2580 gene locus_tag LOCUS_14770 3206 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence309 1321 983 gene locus_tag LOCUS_14780 gene spoIIAA 1321 983 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1N6 protein_id gnl|my_center|LOCUS_14780 1766 1329 gene locus_tag LOCUS_14790 1766 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3061 1763 gene locus_tag LOCUS_14800 3061 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence310 3373 1424 gene locus_tag LOCUS_14810 gene xapA 3373 1424 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942144.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence311 1667 162 gene locus_tag LOCUS_14820 gene atpA 1667 162 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY2 protein_id gnl|my_center|LOCUS_14820 2219 1668 gene locus_tag LOCUS_14830 gene atpH 2219 1668 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGF0 protein_id gnl|my_center|LOCUS_14830 2829 2320 gene locus_tag LOCUS_14840 2829 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3077 2853 gene locus_tag LOCUS_14850 3077 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3637 3110 gene locus_tag LOCUS_14860 3637 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence312 1043 288 gene locus_tag LOCUS_14870 1043 288 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_14870 1543 1208 gene locus_tag LOCUS_14880 1543 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2051 1551 gene locus_tag LOCUS_14890 2051 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 <3701 2057 gene locus_tag LOCUS_14900 <3701 2057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886991.1:cytochrome c biogenesis protein CcmF >Feature sequence313 522 205 gene locus_tag LOCUS_14910 522 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14910 810 574 gene locus_tag LOCUS_14920 810 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1012 1215 gene locus_tag LOCUS_14930 1012 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1444 2283 gene locus_tag LOCUS_14940 1444 2283 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_14940 2936 2322 gene locus_tag LOCUS_14950 2936 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence314 1045 719 gene locus_tag LOCUS_14960 gene ihfB-2 1045 719 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_14960 2186 1260 gene locus_tag LOCUS_14970 gene sppA 2186 1260 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_14970 <3696 2217 gene locus_tag LOCUS_14980 <3696 2217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943240.1:30S ribosomal protein S1 >Feature sequence315 771 3203 gene locus_tag LOCUS_14990 771 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence316 1775 1002 gene locus_tag LOCUS_15000 gene gldF 1775 1002 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_15000 2707 1778 gene locus_tag LOCUS_15010 2707 1778 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_15010 3683 2922 gene locus_tag LOCUS_15020 3683 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence317 85 2427 gene locus_tag LOCUS_15030 85 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2964 2602 gene locus_tag LOCUS_15040 2964 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence318 316 1686 gene locus_tag LOCUS_15050 316 1686 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118315.1 protein_id gnl|my_center|LOCUS_15050 1745 2488 gene locus_tag LOCUS_15060 1745 2488 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_15060 3350 2595 gene locus_tag LOCUS_15070 3350 2595 CDS product dimethylargininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868883.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence319 1283 372 gene locus_tag LOCUS_15080 1283 372 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_15080 1574 3085 gene locus_tag LOCUS_15090 gene dhaS 1574 3085 CDS product putative aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34660 protein_id gnl|my_center|LOCUS_15090 3658 3140 gene locus_tag LOCUS_15100 3658 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence320 2826 1330 gene locus_tag LOCUS_15110 2826 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 3433 2858 gene locus_tag LOCUS_15120 3433 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence321 991 299 gene locus_tag LOCUS_15130 991 299 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262990.1 protein_id gnl|my_center|LOCUS_15130 1324 1091 gene locus_tag LOCUS_15140 1324 1091 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_15140 1492 2013 gene locus_tag LOCUS_15150 1492 2013 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112585.1 protein_id gnl|my_center|LOCUS_15150 3618 2116 gene locus_tag LOCUS_15160 gene degP 3618 2116 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence322 <1 916 gene locus_tag LOCUS_15170 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000810922.1:4-hydroxyphenylpyruvate dioxygenase 941 1792 gene locus_tag LOCUS_15180 941 1792 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674004.1 protein_id gnl|my_center|LOCUS_15180 1894 2991 gene locus_tag LOCUS_15190 1894 2991 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_15190 2988 3620 gene locus_tag LOCUS_15200 2988 3620 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117903.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence323 2984 2298 gene locus_tag LOCUS_15210 2984 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence324 >Feature sequence325 1043 855 gene locus_tag LOCUS_15220 1043 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 2761 1193 gene locus_tag LOCUS_15230 2761 1193 CDS product quaternary ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957420.1 protein_id gnl|my_center|LOCUS_15230 3513 2761 gene locus_tag LOCUS_15240 3513 2761 CDS product glycine/betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772946.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence326 1005 3026 gene locus_tag LOCUS_15250 gene rne 1005 3026 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EP1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence327 71 2050 gene locus_tag LOCUS_15260 71 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence328 3058 2039 gene locus_tag LOCUS_15270 gene asd 3058 2039 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHE3 protein_id gnl|my_center|LOCUS_15270 <3595 3052 gene locus_tag LOCUS_15280 <3595 3052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E2X2:3-isopropylmalate dehydrogenase >Feature sequence329 182 1363 gene locus_tag LOCUS_15290 182 1363 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_15290 1472 2263 gene locus_tag LOCUS_15300 1472 2263 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_15300 2425 2619 gene locus_tag LOCUS_15310 2425 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 2805 2620 gene locus_tag LOCUS_15320 2805 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3195 3593 gene locus_tag LOCUS_15330 3195 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence330 1152 1430 gene locus_tag LOCUS_15340 1152 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1807 2652 gene locus_tag LOCUS_15350 1807 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 <3592 2757 gene locus_tag LOCUS_15360 <3592 2757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815017.1:esterase >Feature sequence331 1152 223 gene locus_tag LOCUS_15370 1152 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_15370 1727 1200 gene locus_tag LOCUS_15380 1727 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2033 1734 gene locus_tag LOCUS_15390 2033 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2193 3452 gene locus_tag LOCUS_15400 gene aroA 2193 3452 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QX9 protein_id gnl|my_center|LOCUS_15400 >Feature sequence332 2198 1716 gene locus_tag LOCUS_15410 2198 1716 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73LE0 protein_id gnl|my_center|LOCUS_15410 3501 2383 gene locus_tag LOCUS_15420 3501 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence333 1585 1322 gene locus_tag LOCUS_15430 1585 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 2887 1637 gene locus_tag LOCUS_15440 gene fabF 2887 1637 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118441.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence334 <1 687 gene locus_tag LOCUS_15450 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266434.1:chemotaxis protein 1657 677 gene locus_tag LOCUS_15460 1657 677 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_15460 3477 1831 gene locus_tag LOCUS_15470 3477 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence335 3134 2166 gene locus_tag LOCUS_15480 3134 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143966.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence336 153 875 gene locus_tag LOCUS_15490 153 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1863 1201 gene locus_tag LOCUS_15500 1863 1201 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU9 protein_id gnl|my_center|LOCUS_15500 >Feature sequence337 1526 828 gene locus_tag LOCUS_15510 1526 828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381711.1 protein_id gnl|my_center|LOCUS_15510 2806 1652 gene locus_tag LOCUS_15520 2806 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3344 2859 gene locus_tag LOCUS_15530 3344 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence338 857 468 gene locus_tag LOCUS_15540 gene rpsI 857 468 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGF4 protein_id gnl|my_center|LOCUS_15540 1373 942 gene locus_tag LOCUS_15550 gene rplM 1373 942 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748X4 protein_id gnl|my_center|LOCUS_15550 2199 1504 gene locus_tag LOCUS_15560 2199 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056977.1 protein_id gnl|my_center|LOCUS_15560 2444 2710 gene locus_tag LOCUS_15570 2444 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence339 <1 581 gene locus_tag LOCUS_15580 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YHI4:3-dehydroquinate synthase 641 1258 gene locus_tag LOCUS_15590 641 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1309 2493 gene locus_tag LOCUS_15600 1309 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2808 3347 gene locus_tag LOCUS_15610 2808 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence340 209 1720 gene locus_tag LOCUS_15620 209 1720 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence341 2184 349 gene locus_tag LOCUS_15630 2184 349 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530880.1 protein_id gnl|my_center|LOCUS_15630 3323 2196 gene locus_tag LOCUS_15640 3323 2196 CDS product nucleoside-diphosphate-sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence342 96 383 gene locus_tag LOCUS_15650 96 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1546 392 gene locus_tag LOCUS_15660 1546 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1603 2475 gene locus_tag LOCUS_15670 1603 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence343 2241 1492 gene locus_tag LOCUS_15680 2241 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_15680 2756 2433 gene locus_tag LOCUS_15690 2756 2433 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522937.1 protein_id gnl|my_center|LOCUS_15690 <3489 2772 gene locus_tag LOCUS_15700 <3489 2772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404767.1:cysteine synthase B >Feature sequence344 1014 337 gene locus_tag LOCUS_15710 gene pcm 1014 337 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ5 protein_id gnl|my_center|LOCUS_15710 1365 1096 gene locus_tag LOCUS_15720 1365 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1534 2397 gene locus_tag LOCUS_15730 1534 2397 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence345 800 2119 gene locus_tag LOCUS_15740 800 2119 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117040.1 protein_id gnl|my_center|LOCUS_15740 2315 3460 gene locus_tag LOCUS_15750 gene ispG 2315 3460 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWC8 protein_id gnl|my_center|LOCUS_15750 >Feature sequence346 437 2095 gene locus_tag LOCUS_15760 gene argS 437 2095 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46906 protein_id gnl|my_center|LOCUS_15760 2131 2889 gene locus_tag LOCUS_15770 2131 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence347 <1 724 gene locus_tag LOCUS_15780 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392070.1:bifunctional folylpolyglutamate synthase/dihydrofolate synthase 708 2897 gene locus_tag LOCUS_15790 gene lptD 708 2897 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI7 protein_id gnl|my_center|LOCUS_15790 >Feature sequence348 1485 142 gene locus_tag LOCUS_15800 1485 142 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_15800 1594 1797 gene locus_tag LOCUS_15810 1594 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1880 2119 gene locus_tag LOCUS_15820 gene parD4 1880 2119 CDS product antitoxin ParD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A458 protein_id gnl|my_center|LOCUS_15820 2106 2405 gene locus_tag LOCUS_15830 2106 2405 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971677.1 protein_id gnl|my_center|LOCUS_15830 2448 2909 gene locus_tag LOCUS_15840 2448 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence349 140 958 gene locus_tag LOCUS_15850 140 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 994 1671 gene locus_tag LOCUS_15860 gene nfi 994 1671 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDJ2 protein_id gnl|my_center|LOCUS_15860 1689 1967 gene locus_tag LOCUS_15870 1689 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 2712 1969 gene locus_tag LOCUS_15880 2712 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence350 58 942 gene locus_tag LOCUS_15890 58 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1544 1089 gene locus_tag LOCUS_15900 1544 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 3207 1897 gene locus_tag LOCUS_15910 gene ahcY 3207 1897 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXV1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence351 223 681 gene locus_tag LOCUS_15920 223 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 821 1003 gene locus_tag LOCUS_15930 821 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 2019 1141 gene locus_tag LOCUS_15940 2019 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15940 >Feature sequence352 675 166 gene locus_tag LOCUS_15950 675 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1776 790 gene locus_tag LOCUS_15960 1776 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2366 1776 gene locus_tag LOCUS_15970 2366 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence353 990 2165 gene locus_tag LOCUS_15980 990 2165 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787406.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence354 179 1012 gene locus_tag LOCUS_15990 gene panB 179 1012 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C32 protein_id gnl|my_center|LOCUS_15990 1131 1979 gene locus_tag LOCUS_16000 gene panC 1131 1979 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0G6 protein_id gnl|my_center|LOCUS_16000 1979 2329 gene locus_tag LOCUS_16010 gene panD 1979 2329 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYS2 protein_id gnl|my_center|LOCUS_16010 2396 3142 gene locus_tag LOCUS_16020 2396 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence355 2328 40 gene locus_tag LOCUS_16030 2328 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2935 2372 gene locus_tag LOCUS_16040 2935 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence356 797 273 gene locus_tag LOCUS_16050 797 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1171 2253 gene locus_tag LOCUS_16060 gene intD 1171 2253 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947770.1 protein_id gnl|my_center|LOCUS_16060 2590 2267 gene locus_tag LOCUS_16070 2590 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2775 3284 gene locus_tag LOCUS_16080 2775 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence357 3312 448 gene locus_tag LOCUS_16090 3312 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence358 573 151 gene locus_tag LOCUS_16100 573 151 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083398.1 protein_id gnl|my_center|LOCUS_16100 890 1840 gene locus_tag LOCUS_16110 890 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1846 2502 gene locus_tag LOCUS_16120 gene eda-1 1846 2502 CDS product bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367887.1 protein_id gnl|my_center|LOCUS_16120 2543 2806 gene locus_tag LOCUS_16130 2543 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 <3411 2833 gene locus_tag LOCUS_16140 <3411 2833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012372824.1:iron permease >Feature sequence359 1565 3202 gene locus_tag LOCUS_16150 1565 3202 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389402.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence360 553 840 gene locus_tag LOCUS_16160 553 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1088 1945 gene locus_tag LOCUS_16170 1088 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence361 395 775 gene locus_tag LOCUS_16180 395 775 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIA9 protein_id gnl|my_center|LOCUS_16180 1118 1948 gene locus_tag LOCUS_16190 1118 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1989 2333 gene locus_tag LOCUS_16200 1989 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 3207 2344 gene locus_tag LOCUS_16210 3207 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence362 902 300 gene locus_tag LOCUS_16220 902 300 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084100.1 protein_id gnl|my_center|LOCUS_16220 1196 927 gene locus_tag LOCUS_16230 1196 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1643 1251 gene locus_tag LOCUS_16240 1643 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2283 1957 gene locus_tag LOCUS_16250 2283 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 <3389 2741 gene locus_tag LOCUS_16260 <3389 2741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546548.1:metal-dependent phosphohydrolase >Feature sequence363 1152 88 gene locus_tag LOCUS_16270 1152 88 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 protein_id gnl|my_center|LOCUS_16270 1291 2415 gene locus_tag LOCUS_16280 1291 2415 CDS product glycosyl transferase group 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence364 3140 960 gene locus_tag LOCUS_16290 3140 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence365 <1 1831 gene locus_tag LOCUS_16300 <1 1831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943566.1:cytochrome c >Feature sequence366 1028 60 gene locus_tag LOCUS_16310 1028 60 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_16310 2692 1172 gene locus_tag LOCUS_16320 2692 1172 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957831.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence367 34 1029 gene locus_tag LOCUS_16330 gene pstS 34 1029 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_16330 1029 3305 gene locus_tag LOCUS_16340 gene pstC 1029 3305 CDS product ABC high affinity phosphate uptake system permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071862.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence368 8 1258 gene locus_tag LOCUS_16350 gene rho 8 1258 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748A7 protein_id gnl|my_center|LOCUS_16350 1270 1518 gene locus_tag LOCUS_16360 1270 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1653 2669 gene locus_tag LOCUS_16370 gene prfA 1653 2669 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIQ7 protein_id gnl|my_center|LOCUS_16370 >Feature sequence369 2174 1080 gene locus_tag LOCUS_16380 2174 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 <3347 2666 gene locus_tag LOCUS_16390 <3347 2666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943853.1:ribonuclease G >Feature sequence370 1219 2025 gene locus_tag LOCUS_16400 gene cysD 1219 2025 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942362.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence371 126 602 gene locus_tag LOCUS_16410 126 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 2776 1061 gene locus_tag LOCUS_16420 gene SUL1 2776 1061 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124397.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence372 733 476 gene locus_tag LOCUS_16430 gene xseB 733 476 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CA8 protein_id gnl|my_center|LOCUS_16430 3094 2852 gene locus_tag LOCUS_16440 3094 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence373 >Feature sequence374 937 2766 gene locus_tag LOCUS_16450 gene nuoF-1 937 2766 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941011.1 protein_id gnl|my_center|LOCUS_16450 3188 2850 gene locus_tag LOCUS_16460 3188 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence375 >Feature sequence376 2185 557 gene locus_tag LOCUS_16470 gene pyrG 2185 557 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY3 protein_id gnl|my_center|LOCUS_16470 3034 2246 gene locus_tag LOCUS_16480 gene kdsB 3034 2246 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY2 protein_id gnl|my_center|LOCUS_16480 >Feature sequence377 181 975 gene locus_tag LOCUS_16490 181 975 CDS product phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023447.1 protein_id gnl|my_center|LOCUS_16490 1313 2029 gene locus_tag LOCUS_16500 1313 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence378 362 6 gene locus_tag LOCUS_16510 gene nuoA1 362 6 CDS product NADH-quinone oxidoreductase subunit A 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA8 protein_id gnl|my_center|LOCUS_16510 1133 1750 gene locus_tag LOCUS_16520 1133 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1899 2321 gene locus_tag LOCUS_16530 1899 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 2761 2318 gene locus_tag LOCUS_16540 2761 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence379 252 578 gene locus_tag LOCUS_16550 gene trxA 252 578 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEB8 protein_id gnl|my_center|LOCUS_16550 674 1378 gene locus_tag LOCUS_16560 674 1378 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_16560 1479 2765 gene locus_tag LOCUS_16570 1479 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2783 3091 gene locus_tag LOCUS_16580 2783 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence380 119 628 gene locus_tag LOCUS_16590 119 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1048 764 gene locus_tag LOCUS_16600 1048 764 CDS product type III secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811967.1 protein_id gnl|my_center|LOCUS_16600 2526 1045 gene locus_tag LOCUS_16610 2526 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 3044 2529 gene locus_tag LOCUS_16620 3044 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence381 1113 130 gene locus_tag LOCUS_16630 1113 130 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_16630 2406 1174 gene locus_tag LOCUS_16640 gene gltP 2406 1174 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_16640 <3291 2518 gene locus_tag LOCUS_16650 <3291 2518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94598:glutamate dehydrogenase >Feature sequence382 1457 393 gene locus_tag LOCUS_16660 1457 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2387 1680 gene locus_tag LOCUS_16670 2387 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence383 1350 202 gene locus_tag LOCUS_16680 1350 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 <3285 1740 gene locus_tag LOCUS_16690 <3285 1740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545943.1:tetratricopeptide repeat domain protein >Feature sequence384 2911 1658 gene locus_tag LOCUS_16700 2911 1658 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865056.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence385 698 1888 gene locus_tag LOCUS_16710 698 1888 CDS product conjugal transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_16710 1899 2831 gene locus_tag LOCUS_16720 1899 2831 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584122.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence386 55 741 gene locus_tag LOCUS_16730 55 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 944 1765 gene locus_tag LOCUS_16740 944 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477260.1 protein_id gnl|my_center|LOCUS_16740 3209 1767 gene locus_tag LOCUS_16750 3209 1767 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence387 748 65 gene locus_tag LOCUS_16760 748 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1882 806 gene locus_tag LOCUS_16770 1882 806 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_16770 2213 3157 gene locus_tag LOCUS_16780 2213 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence388 816 1772 gene locus_tag LOCUS_16790 816 1772 CDS product NDP-sugar dehydratase or epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_16790 1769 2719 gene locus_tag LOCUS_16800 1769 2719 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965465.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence389 2086 17 gene locus_tag LOCUS_16810 2086 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence390 103 516 gene locus_tag LOCUS_16820 gene rplS 103 516 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CSU9 protein_id gnl|my_center|LOCUS_16820 625 1044 gene locus_tag LOCUS_16830 625 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1187 2347 gene locus_tag LOCUS_16840 1187 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2349 2660 gene locus_tag LOCUS_16850 2349 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2657 3241 gene locus_tag LOCUS_16860 2657 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence391 <1 638 gene locus_tag LOCUS_16870 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q1WTL7:tyrosine recombinase XerD 1134 3113 gene locus_tag LOCUS_16880 1134 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence392 225 2939 gene locus_tag LOCUS_16890 225 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence393 <1 783 gene locus_tag LOCUS_16900 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZL9:lipoyl synthase 865 1689 gene locus_tag LOCUS_16910 865 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1964 1707 gene locus_tag LOCUS_16920 1964 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2347 1967 gene locus_tag LOCUS_16930 2347 1967 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_16930 3139 2384 gene locus_tag LOCUS_16940 gene recO 3139 2384 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIN3 protein_id gnl|my_center|LOCUS_16940 >Feature sequence394 1280 225 gene locus_tag LOCUS_16950 1280 225 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933710.1 protein_id gnl|my_center|LOCUS_16950 1390 1716 gene locus_tag LOCUS_16960 gene fer2 1390 1716 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084574.1 protein_id gnl|my_center|LOCUS_16960 2364 1768 gene locus_tag LOCUS_16970 gene engB 2364 1768 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88VE3 protein_id gnl|my_center|LOCUS_16970 >Feature sequence395 >Feature sequence396 1291 2457 gene locus_tag LOCUS_16980 1291 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 2600 2881 gene locus_tag LOCUS_16990 2600 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence397 1712 870 gene locus_tag LOCUS_17000 1712 870 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_17000 2802 1756 gene locus_tag LOCUS_17010 2802 1756 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249584.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence398 1120 557 gene locus_tag LOCUS_17020 1120 557 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_17020 2628 1240 gene locus_tag LOCUS_17030 2628 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 3193 2807 gene locus_tag LOCUS_17040 3193 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence399 701 973 gene locus_tag LOCUS_17050 701 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence400 <1 1432 gene locus_tag LOCUS_17060 <1 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891851.1:chemotaxis protein A >Feature sequence401 995 489 gene locus_tag LOCUS_17070 995 489 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546745.1 protein_id gnl|my_center|LOCUS_17070 2071 1061 gene locus_tag LOCUS_17080 gene ispB 2071 1061 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence402 50 940 gene locus_tag LOCUS_17090 50 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1517 1008 gene locus_tag LOCUS_17100 1517 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 2922 1510 gene locus_tag LOCUS_17110 2922 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence403 843 70 gene locus_tag LOCUS_17120 843 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1816 866 gene locus_tag LOCUS_17130 gene cbiB 1816 866 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180T1 protein_id gnl|my_center|LOCUS_17130 2988 1819 gene locus_tag LOCUS_17140 2988 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence404 238 621 gene locus_tag LOCUS_17150 238 621 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919370.1 protein_id gnl|my_center|LOCUS_17150 660 2903 gene locus_tag LOCUS_17160 660 2903 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545777.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence405 72 254 gene locus_tag LOCUS_17170 72 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1663 593 gene locus_tag LOCUS_17180 1663 593 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_17180 1831 2700 gene locus_tag LOCUS_17190 1831 2700 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013300.1 protein_id gnl|my_center|LOCUS_17190 2848 3069 gene locus_tag LOCUS_17200 2848 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence406 324 1397 gene locus_tag LOCUS_17210 324 1397 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_17210 1425 2606 gene locus_tag LOCUS_17220 1425 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2859 2650 gene locus_tag LOCUS_17230 2859 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence407 <3174 1731 gene locus_tag LOCUS_17240 <3174 1731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ61:histidine kinase >Feature sequence408 >Feature sequence409 <1 887 gene locus_tag LOCUS_17250 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DL63:GDP-mannose 4,6-dehydratase 888 1619 gene locus_tag LOCUS_17260 888 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1718 2072 gene locus_tag LOCUS_tm00010 1718 2072 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 <3163 2130 gene locus_tag LOCUS_17270 <3163 2130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769896.1:cell division protein Fic >Feature sequence410 2655 28 gene locus_tag LOCUS_17280 2655 28 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence411 <1 1631 gene locus_tag LOCUS_17290 <1 1631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864120.1:membrane protein 2932 1670 gene locus_tag LOCUS_17300 2932 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence412 1198 62 gene locus_tag LOCUS_17310 gene carA 1198 62 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP3 protein_id gnl|my_center|LOCUS_17310 1365 1216 gene locus_tag LOCUS_17320 1365 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 2504 1386 gene locus_tag LOCUS_17330 gene pyrC 2504 1386 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP4 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17330 <3154 2488 gene locus_tag LOCUS_17340 <3154 2488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E2K5:aspartate carbamoyltransferase >Feature sequence413 817 194 gene locus_tag LOCUS_17350 817 194 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_17350 1772 870 gene locus_tag LOCUS_17360 1772 870 CDS product cation ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_17360 <3138 1844 gene locus_tag LOCUS_17370 <3138 1844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256261.1:thymidylate synthase >Feature sequence414 394 1164 gene locus_tag LOCUS_17380 394 1164 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975233.1 protein_id gnl|my_center|LOCUS_17380 1204 3048 gene locus_tag LOCUS_17390 1204 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence415 308 111 gene locus_tag LOCUS_17400 308 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1060 380 gene locus_tag LOCUS_17410 1060 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 3126 1171 gene locus_tag LOCUS_17420 3126 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence416 <1 1953 gene locus_tag LOCUS_17430 <1 1953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943112.1:Fis family transcriptional regulator 1976 2383 gene locus_tag LOCUS_17440 1976 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 2376 2876 gene locus_tag LOCUS_17450 2376 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence417 <1 534 gene locus_tag LOCUS_17460 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776911.1:xylose ABC transporter ATP-binding protein 535 1491 gene locus_tag LOCUS_17470 535 1491 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896747.1 protein_id gnl|my_center|LOCUS_17470 1529 2443 gene locus_tag LOCUS_17480 gene glcK 1529 2443 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence418 366 1256 gene locus_tag LOCUS_17490 366 1256 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZ90 protein_id gnl|my_center|LOCUS_17490 1266 1706 gene locus_tag LOCUS_17500 1266 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2257 3039 gene locus_tag LOCUS_17510 2257 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence419 1479 82 gene locus_tag LOCUS_17520 1479 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107761.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence420 2515 737 gene locus_tag LOCUS_17530 2515 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2897 2580 gene locus_tag LOCUS_17540 2897 2580 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174252.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence421 482 1768 gene locus_tag LOCUS_17550 gene serS 482 1768 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H55 protein_id gnl|my_center|LOCUS_17550 1872 1954 gene locus_tag LOCUS_t00080 1872 1954 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1984 2075 gene locus_tag LOCUS_t00090 1984 2075 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2024 2701 gene locus_tag LOCUS_17560 2024 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 2761 2835 gene locus_tag LOCUS_t00100 2761 2835 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2944 3033 gene locus_tag LOCUS_t00110 2944 3033 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence422 1999 1181 gene locus_tag LOCUS_17570 gene mreC 1999 1181 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BG0 protein_id gnl|my_center|LOCUS_17570 3021 2002 gene locus_tag LOCUS_17580 gene mreB-1 3021 2002 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence423 >Feature sequence424 556 128 gene locus_tag LOCUS_17590 556 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1059 580 gene locus_tag LOCUS_17600 1059 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17600 1357 1049 gene locus_tag LOCUS_17610 1357 1049 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224553.1 protein_id gnl|my_center|LOCUS_17610 1928 1569 gene locus_tag LOCUS_17620 1928 1569 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867231.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence425 <1 2215 gene locus_tag LOCUS_17630 <1 2215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74AM0:UPF0182 protein <3104 2262 gene locus_tag LOCUS_17640 <3104 2262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CN7:amidophosphoribosyltransferase >Feature sequence426 110 769 gene locus_tag LOCUS_17650 110 769 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923440.1 protein_id gnl|my_center|LOCUS_17650 1406 795 gene locus_tag LOCUS_17660 1406 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1592 2014 gene locus_tag LOCUS_17670 1592 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 2421 2011 gene locus_tag LOCUS_17680 2421 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 <3100 2470 gene locus_tag LOCUS_17690 <3100 2470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583119.1:nicotinate-nucleotide diphosphorylase (carboxylating) >Feature sequence427 1959 1084 gene locus_tag LOCUS_17700 1959 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence428 195 1868 gene locus_tag LOCUS_17710 195 1868 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence429 2912 501 gene locus_tag LOCUS_17720 2912 501 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684941.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence430 560 3025 gene locus_tag LOCUS_17730 560 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence431 386 2125 gene locus_tag LOCUS_17740 386 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2390 2142 gene locus_tag LOCUS_17750 2390 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence432 491 51 gene locus_tag LOCUS_17760 491 51 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_17760 782 2392 gene locus_tag LOCUS_17770 782 2392 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706481.1 protein_id gnl|my_center|LOCUS_17770 2635 3015 gene locus_tag LOCUS_17780 2635 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence433 2069 633 gene locus_tag LOCUS_17790 2069 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 <3073 2131 gene locus_tag LOCUS_17800 <3073 2131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073814.1:pilus (MSHA type) biogenesis protein MshL >Feature sequence434 650 1681 gene locus_tag LOCUS_17810 650 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 <3070 1723 gene locus_tag LOCUS_17820 <3070 1723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546696.1:sodium/hydrogen exchanger family/TrkA domain protein >Feature sequence435 1128 283 gene locus_tag LOCUS_17830 1128 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1501 2280 gene locus_tag LOCUS_17840 1501 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2655 3044 gene locus_tag LOCUS_17850 2655 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence436 2724 1183 gene locus_tag LOCUS_17860 2724 1183 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196385.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence437 1306 437 gene locus_tag LOCUS_17870 gene sucD 1306 437 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ3 protein_id gnl|my_center|LOCUS_17870 2463 1303 gene locus_tag LOCUS_17880 gene sucC 2463 1303 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80886 protein_id gnl|my_center|LOCUS_17880 >Feature sequence438 422 928 gene locus_tag LOCUS_17890 422 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1130 1693 gene locus_tag LOCUS_17900 1130 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2725 1742 gene locus_tag LOCUS_17910 2725 1742 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103416.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence439 <1 1304 gene locus_tag LOCUS_17920 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 1320 1973 gene locus_tag LOCUS_17930 1320 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 <3041 1966 gene locus_tag LOCUS_17940 <3041 1966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83E18:UvrABC system protein B >Feature sequence440 1089 718 gene locus_tag LOCUS_17950 1089 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_17950 1866 1138 gene locus_tag LOCUS_17960 1866 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence441 926 537 gene locus_tag LOCUS_17970 926 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1345 1719 gene locus_tag LOCUS_17980 1345 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1724 2038 gene locus_tag LOCUS_17990 1724 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2035 2679 gene locus_tag LOCUS_18000 2035 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence442 <1 2381 gene locus_tag LOCUS_18010 <1 2381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C55:bifunctional uridylyltransferase/uridylyl-removing enzyme >Feature sequence443 <1 2146 gene locus_tag LOCUS_18020 <1 2146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918481.1:chemotaxis protein CheA 2149 2610 gene locus_tag LOCUS_18030 gene cheW-2 2149 2610 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence444 375 1007 gene locus_tag LOCUS_18040 375 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1016 1852 gene locus_tag LOCUS_18050 1016 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence445 <3019 827 gene locus_tag LOCUS_18060 <3019 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933331.1:DNA polymerase I >Feature sequence446 278 1261 gene locus_tag LOCUS_18070 gene trpS 278 1261 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RGA3 protein_id gnl|my_center|LOCUS_18070 1258 2403 gene locus_tag LOCUS_18080 1258 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence447 <3018 957 gene locus_tag LOCUS_18090 <3018 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705867.1:peptidase M16 >Feature sequence448 1155 694 gene locus_tag LOCUS_18100 1155 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 2210 1152 gene locus_tag LOCUS_18110 2210 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2772 2251 gene locus_tag LOCUS_18120 2772 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence449 >Feature sequence450 >Feature sequence451 1123 782 gene locus_tag LOCUS_18130 1123 782 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978149.1 protein_id gnl|my_center|LOCUS_18130 1267 2139 gene locus_tag LOCUS_18140 1267 2139 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998802.1 protein_id gnl|my_center|LOCUS_18140 2623 2207 gene locus_tag LOCUS_18150 gene vapC 2623 2207 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NI02 protein_id gnl|my_center|LOCUS_18150 2862 2620 gene locus_tag LOCUS_18160 2862 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence452 2438 363 gene locus_tag LOCUS_18170 gene hppA1 2438 363 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_18170 <3005 2432 gene locus_tag LOCUS_18180 <3005 2432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P37470:peptidyl-tRNA hydrolase >Feature sequence453 956 198 gene locus_tag LOCUS_18190 956 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1900 1043 gene locus_tag LOCUS_18200 gene fliC 1900 1043 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748G4 protein_id gnl|my_center|LOCUS_18200 <3004 2322 gene locus_tag LOCUS_18210 <3004 2322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q748G4:flagellin >Feature sequence454 2898 1147 gene locus_tag LOCUS_18220 2898 1147 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence455 1263 442 gene locus_tag LOCUS_18230 gene cheR1 1263 442 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XC4 protein_id gnl|my_center|LOCUS_18230 1926 1306 gene locus_tag LOCUS_18240 1926 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 2464 2093 gene locus_tag LOCUS_18250 gene cheY 2464 2093 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71403 protein_id gnl|my_center|LOCUS_18250 >Feature sequence456 1784 672 gene locus_tag LOCUS_18260 1784 672 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLS7 protein_id gnl|my_center|LOCUS_18260 >Feature sequence457 1112 612 gene locus_tag LOCUS_18270 1112 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1216 2478 gene locus_tag LOCUS_18280 1216 2478 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYM0 protein_id gnl|my_center|LOCUS_18280 >Feature sequence458 559 2112 gene locus_tag LOCUS_18290 559 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence459 830 153 gene locus_tag LOCUS_18300 830 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941153.1 protein_id gnl|my_center|LOCUS_18300 1451 2536 gene locus_tag LOCUS_18310 1451 2536 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_18310 2536 2718 gene locus_tag LOCUS_18320 2536 2718 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIG0 protein_id gnl|my_center|LOCUS_18320 >Feature sequence460 287 469 gene locus_tag LOCUS_18330 287 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 515 1003 gene locus_tag LOCUS_18340 515 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1059 1229 gene locus_tag LOCUS_18350 1059 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence461 1410 880 gene locus_tag LOCUS_18360 1410 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2275 1550 gene locus_tag LOCUS_18370 gene surE 2275 1550 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_18370 <2956 2376 gene locus_tag LOCUS_18380 <2956 2376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948187.1:methyltransferase >Feature sequence462 443 1123 gene locus_tag LOCUS_18390 443 1123 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_18390 1254 1601 gene locus_tag LOCUS_18400 1254 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1623 2693 gene locus_tag LOCUS_18410 gene mqnC 1623 2693 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT24 protein_id gnl|my_center|LOCUS_18410 >Feature sequence463 1313 411 gene locus_tag LOCUS_18420 gene purC 1313 411 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9Q8 protein_id gnl|my_center|LOCUS_18420 2666 1377 gene locus_tag LOCUS_18430 gene purB 2666 1377 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CP1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence464 <2952 90 gene locus_tag LOCUS_18440 <2952 90 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943246.1:general secretory pathway protein GspE >Feature sequence465 1244 177 gene locus_tag LOCUS_18450 1244 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence466 1189 1710 gene locus_tag LOCUS_18460 1189 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 2586 1966 gene locus_tag LOCUS_18470 2586 1966 CDS product UPF0056 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRY9 protein_id gnl|my_center|LOCUS_18470 >Feature sequence467 679 2088 gene locus_tag LOCUS_18480 679 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2095 2781 gene locus_tag LOCUS_18490 2095 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence468 2345 1578 gene locus_tag LOCUS_18500 2345 1578 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947852.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence469 326 1147 gene locus_tag LOCUS_18510 326 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1295 1786 gene locus_tag LOCUS_18520 1295 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence470 711 178 gene locus_tag LOCUS_18530 711 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1203 1613 gene locus_tag LOCUS_18540 1203 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1603 2448 gene locus_tag LOCUS_18550 1603 2448 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence471 701 2671 gene locus_tag LOCUS_18560 701 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence472 <1 961 gene locus_tag LOCUS_18570 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937723.1:GGDEF domain-containing protein 1939 983 gene locus_tag LOCUS_18580 1939 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 <2916 1927 gene locus_tag LOCUS_18590 <2916 1927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940999.1:peptidase >Feature sequence473 <1 1778 gene locus_tag LOCUS_18600 <1 1778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C66:ATP-dependent zinc metalloprotease FtsH 1859 2674 gene locus_tag LOCUS_18610 gene folP 1859 2674 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJQ5 protein_id gnl|my_center|LOCUS_18610 >Feature sequence474 >Feature sequence475 47 715 gene locus_tag LOCUS_18620 47 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 797 1504 gene locus_tag LOCUS_18630 797 1504 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864434.1 protein_id gnl|my_center|LOCUS_18630 1501 2493 gene locus_tag LOCUS_18640 1501 2493 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808328.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence476 <2909 1877 gene locus_tag LOCUS_18650 <2909 1877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257500.1:ABC transporter ATP-binding protein >Feature sequence477 194 379 gene locus_tag LOCUS_18660 194 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 387 536 gene locus_tag LOCUS_18670 387 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 533 1252 gene locus_tag LOCUS_18680 533 1252 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065117.1 protein_id gnl|my_center|LOCUS_18680 1440 1811 gene locus_tag LOCUS_18690 1440 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 1835 2224 gene locus_tag LOCUS_18700 1835 2224 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence478 <1 616 gene locus_tag LOCUS_18710 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017028.1:lipoprotein 1177 1515 gene locus_tag LOCUS_18720 gene glnB 1177 1515 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence479 934 62 gene locus_tag LOCUS_18730 934 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1913 1164 gene locus_tag LOCUS_18740 1913 1164 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RY41 protein_id gnl|my_center|LOCUS_18740 >Feature sequence480 868 116 gene locus_tag LOCUS_18750 gene pssA 868 116 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_18750 1507 869 gene locus_tag LOCUS_18760 gene psd 1507 869 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BX0 protein_id gnl|my_center|LOCUS_18760 2618 1611 gene locus_tag LOCUS_18770 2618 1611 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816729.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence481 322 543 gene locus_tag LOCUS_18780 322 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1721 717 gene locus_tag LOCUS_18790 1721 717 CDS product hopanoid biosynthesis associated radical SAM protein HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141746.1 protein_id gnl|my_center|LOCUS_18790 1857 2132 gene locus_tag LOCUS_18800 1857 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence482 183 497 gene locus_tag LOCUS_18810 183 497 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294651.1 protein_id gnl|my_center|LOCUS_18810 1638 628 gene locus_tag LOCUS_18820 1638 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2505 1687 gene locus_tag LOCUS_18830 2505 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence483 19 588 gene locus_tag LOCUS_18840 19 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 674 1504 gene locus_tag LOCUS_18850 674 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1544 2299 gene locus_tag LOCUS_18860 1544 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence484 2186 912 gene locus_tag LOCUS_18870 2186 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence485 2661 1054 gene locus_tag LOCUS_18880 2661 1054 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence486 847 350 gene locus_tag LOCUS_18890 847 350 CDS product type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312802.1 protein_id gnl|my_center|LOCUS_18890 2411 945 gene locus_tag LOCUS_18900 2411 945 CDS product uricase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089494.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence487 <1 501 gene locus_tag LOCUS_18910 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943180.1:YggS family pyridoxal phosphate enzyme 631 1458 gene locus_tag LOCUS_18920 gene proC 631 1458 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97E64 protein_id gnl|my_center|LOCUS_18920 1504 2208 gene locus_tag LOCUS_18930 1504 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 2224 2637 gene locus_tag LOCUS_18940 2224 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence488 202 375 gene locus_tag LOCUS_18950 202 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 384 758 gene locus_tag LOCUS_18960 384 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 2607 793 gene locus_tag LOCUS_18970 2607 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence489 1821 553 gene locus_tag LOCUS_18980 1821 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence490 >Feature sequence491 2 1075 gene locus_tag LOCUS_18990 2 1075 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_18990 1958 1092 gene locus_tag LOCUS_19000 1958 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020226.1 protein_id gnl|my_center|LOCUS_19000 2779 1985 gene locus_tag LOCUS_19010 2779 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence492 245 655 gene locus_tag LOCUS_19020 245 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1480 779 gene locus_tag LOCUS_19030 1480 779 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158923.1 protein_id gnl|my_center|LOCUS_19030 1721 1542 gene locus_tag LOCUS_19040 1721 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2724 1897 gene locus_tag LOCUS_19050 2724 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence493 1882 350 gene locus_tag LOCUS_19060 1882 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2781 1918 gene locus_tag LOCUS_19070 2781 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880491.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence494 220 1383 gene locus_tag LOCUS_19080 gene iscS 220 1383 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZS1 protein_id gnl|my_center|LOCUS_19080 1590 2558 gene locus_tag LOCUS_19090 1590 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence495 1695 2426 gene locus_tag LOCUS_19100 1695 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence496 992 207 gene locus_tag LOCUS_19110 992 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2418 1123 gene locus_tag LOCUS_19120 2418 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2828 2520 gene locus_tag LOCUS_19130 2828 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence497 1121 372 gene locus_tag LOCUS_19140 gene fabG 1121 372 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51831 protein_id gnl|my_center|LOCUS_19140 1591 1169 gene locus_tag LOCUS_19150 1591 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2359 1610 gene locus_tag LOCUS_19160 2359 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2713 2474 gene locus_tag LOCUS_19170 2713 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence498 223 1215 gene locus_tag LOCUS_19180 223 1215 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_19180 1230 2183 gene locus_tag LOCUS_19190 1230 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_19190 2186 2608 gene locus_tag LOCUS_19200 2186 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence499 701 54 gene locus_tag LOCUS_19210 701 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1651 833 gene locus_tag LOCUS_19220 gene srtN 1651 833 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943708.1 protein_id gnl|my_center|LOCUS_19220 2300 1644 gene locus_tag LOCUS_19230 2300 1644 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_19230 2483 2725 gene locus_tag LOCUS_19240 2483 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence500 <1 757 gene locus_tag LOCUS_19250 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVK1:RNA-splicing ligase RtcB 920 2044 gene locus_tag LOCUS_19260 920 2044 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence501 2534 1617 gene locus_tag LOCUS_19270 2534 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence502 379 245 gene locus_tag LOCUS_19280 379 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1144 461 gene locus_tag LOCUS_19290 1144 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 1766 1473 gene locus_tag LOCUS_19300 1766 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2179 2625 gene locus_tag LOCUS_19310 2179 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence503 1232 2617 gene locus_tag LOCUS_19320 gene tolB 1232 2617 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H67 protein_id gnl|my_center|LOCUS_19320 >Feature sequence504 546 205 gene locus_tag LOCUS_19330 546 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 653 994 gene locus_tag LOCUS_19340 653 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 1077 1301 gene locus_tag LOCUS_19350 1077 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1947 1306 gene locus_tag LOCUS_19360 1947 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 <2806 1991 gene locus_tag LOCUS_19370 <2806 1991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065100.1:peptide transporter >Feature sequence505 2644 983 gene locus_tag LOCUS_19380 gene nadB 2644 983 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C48 protein_id gnl|my_center|LOCUS_19380 >Feature sequence506 <1 1812 gene locus_tag LOCUS_19390 <1 1812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142782.1:aminopeptidase 1885 2457 gene locus_tag LOCUS_19400 1885 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence507 <1 1978 gene locus_tag LOCUS_19410 <1 1978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942876.1:GTP pyrophosphokinase 2218 2027 gene locus_tag LOCUS_19420 gene rpmB 2218 2027 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AW5 protein_id gnl|my_center|LOCUS_19420 2304 2537 gene locus_tag LOCUS_19430 2304 2537 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964076.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence508 87 359 gene locus_tag LOCUS_19440 87 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 356 793 gene locus_tag LOCUS_19450 356 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 790 978 gene locus_tag LOCUS_19460 790 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 1007 1162 gene locus_tag LOCUS_19470 1007 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1900 1397 gene locus_tag LOCUS_19480 1900 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2222 1914 gene locus_tag LOCUS_19490 2222 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 >Feature sequence509 1384 368 gene locus_tag LOCUS_19500 gene gapA 1384 368 CDS product glyceraldehyde-3-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P09124 protein_id gnl|my_center|LOCUS_19500 2366 1536 gene locus_tag LOCUS_19510 2366 1536 CDS product NDP-sugar dehydratase or epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence510 378 55 gene locus_tag LOCUS_19520 378 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1686 613 gene locus_tag LOCUS_19530 gene dsbG 1686 613 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_19530 2714 1701 gene locus_tag LOCUS_19540 2714 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence511 520 870 gene locus_tag LOCUS_19550 520 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1162 1848 gene locus_tag LOCUS_19560 1162 1848 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943050.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence512 >Feature sequence513 2151 919 gene locus_tag LOCUS_19570 2151 919 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941878.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence514 2221 1340 gene locus_tag LOCUS_19580 2221 1340 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence515 <1 1062 gene locus_tag LOCUS_19590 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141047.1:deoxyhypusine synthase 2283 1111 gene locus_tag LOCUS_19600 2283 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence516 <2757 531 gene locus_tag LOCUS_19610 <2757 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204155.1:glutamate synthase >Feature sequence517 371 195 gene locus_tag LOCUS_19620 371 195 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942676.1 protein_id gnl|my_center|LOCUS_19620 1975 905 gene locus_tag LOCUS_19630 1975 905 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_19630 2480 1986 gene locus_tag LOCUS_19640 2480 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence518 1891 683 gene locus_tag LOCUS_19650 1891 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 <2748 1981 gene locus_tag LOCUS_19660 <2748 1981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000008116.1:alpha/beta hydrolase >Feature sequence519 441 992 gene locus_tag LOCUS_19670 441 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 1435 1103 gene locus_tag LOCUS_19680 1435 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1591 2193 gene locus_tag LOCUS_19690 1591 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2618 2241 gene locus_tag LOCUS_19700 2618 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence520 24 1304 gene locus_tag LOCUS_19710 24 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 1337 2680 gene locus_tag LOCUS_19720 1337 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence521 265 1353 gene locus_tag LOCUS_19730 265 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence522 586 879 gene locus_tag LOCUS_19740 586 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 1325 1002 gene locus_tag LOCUS_19750 1325 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1615 2382 gene locus_tag LOCUS_19760 1615 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence523 <2729 1781 gene locus_tag LOCUS_19770 <2729 1781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957843.1:NAD-dependent epimerase >Feature sequence524 >Feature sequence525 527 1249 gene locus_tag LOCUS_19780 527 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1372 2535 gene locus_tag LOCUS_19790 1372 2535 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_19790 2649 2722 gene locus_tag LOCUS_t00120 2649 2722 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence526 110 706 gene locus_tag LOCUS_19800 110 706 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272276.1 protein_id gnl|my_center|LOCUS_19800 2219 684 gene locus_tag LOCUS_19810 2219 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 <2718 2216 gene locus_tag LOCUS_19820 <2718 2216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942207.1:penicillin-binding protein 1A >Feature sequence527 201 1982 gene locus_tag LOCUS_19830 201 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence528 2484 1090 gene locus_tag LOCUS_19840 2484 1090 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence529 879 1514 gene locus_tag LOCUS_19850 879 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1758 2576 gene locus_tag LOCUS_19860 1758 2576 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448524.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence530 <1 1635 gene locus_tag LOCUS_19870 <1 1635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228113.1:ferredoxin--nitrite reductase 1652 2536 gene locus_tag LOCUS_19880 1652 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence531 147 674 gene locus_tag LOCUS_19890 147 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 746 2449 gene locus_tag LOCUS_19900 746 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence532 <2709 1287 gene locus_tag LOCUS_19910 <2709 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BJ6:valine--tRNA ligase >Feature sequence533 377 2005 gene locus_tag LOCUS_19920 377 2005 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence534 537 46 gene locus_tag LOCUS_19930 537 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 877 1560 gene locus_tag LOCUS_19940 gene nadD 877 1560 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK67 protein_id gnl|my_center|LOCUS_19940 1575 1916 gene locus_tag LOCUS_19950 gene rsfS 1575 1916 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9UNR7 protein_id gnl|my_center|LOCUS_19950 1936 2313 gene locus_tag LOCUS_19960 1936 2313 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943824.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence535 701 372 gene locus_tag LOCUS_19970 701 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2161 926 gene locus_tag LOCUS_19980 gene glyA 2161 926 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CR5 protein_id gnl|my_center|LOCUS_19980 <2707 2166 gene locus_tag LOCUS_19990 <2707 2166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546357.1:ribose 5-phosphate isomerase B >Feature sequence536 1586 486 gene locus_tag LOCUS_20000 1586 486 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767200.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence537 1545 862 gene locus_tag LOCUS_20010 1545 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 1868 1653 gene locus_tag LOCUS_20020 1868 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 2576 2052 gene locus_tag LOCUS_20030 2576 2052 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0U2 protein_id gnl|my_center|LOCUS_20030 >Feature sequence538 829 29 gene locus_tag LOCUS_20040 829 29 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_20040 <2703 1162 gene locus_tag LOCUS_20050 <2703 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705254.1:acriflavine resistance protein B >Feature sequence539 96 854 gene locus_tag LOCUS_20060 96 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 1708 869 gene locus_tag LOCUS_20070 1708 869 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_20070 2366 1977 gene locus_tag LOCUS_20080 2366 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence540 2574 232 gene locus_tag LOCUS_20090 2574 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence541 <1 519 gene locus_tag LOCUS_20100 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813193.1:signal recognition particle protein 634 885 gene locus_tag LOCUS_20110 gene rpsP 634 885 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4M6 protein_id gnl|my_center|LOCUS_20110 1009 1239 gene locus_tag LOCUS_20120 1009 1239 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DU1 protein_id gnl|my_center|LOCUS_20120 1236 1748 gene locus_tag LOCUS_20130 1236 1748 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813199.1 protein_id gnl|my_center|LOCUS_20130 1738 2433 gene locus_tag LOCUS_20140 gene trmD 1738 2433 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FG3 protein_id gnl|my_center|LOCUS_20140 >Feature sequence542 <1 508 gene locus_tag LOCUS_20150 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229333.1:DNA-binding response regulator 617 2383 gene locus_tag LOCUS_20160 gene phoR 617 2383 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence543 253 708 gene locus_tag LOCUS_20170 253 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 1222 1731 gene locus_tag LOCUS_20180 1222 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1739 2263 gene locus_tag LOCUS_20190 gene def-2 1739 2263 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746R2 protein_id gnl|my_center|LOCUS_20190 2272 2640 gene locus_tag LOCUS_20200 2272 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence544 295 74 gene locus_tag LOCUS_20210 295 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 952 365 gene locus_tag LOCUS_20220 952 365 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_20220 1551 1916 gene locus_tag LOCUS_20230 1551 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2377 1949 gene locus_tag LOCUS_20240 2377 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence545 734 1039 gene locus_tag LOCUS_20250 734 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 1798 1250 gene locus_tag LOCUS_20260 1798 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 2380 1844 gene locus_tag LOCUS_20270 2380 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 >Feature sequence546 113 919 gene locus_tag LOCUS_20280 gene dapB1 113 919 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGJ4 protein_id gnl|my_center|LOCUS_20280 968 1732 gene locus_tag LOCUS_20290 968 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 1729 2535 gene locus_tag LOCUS_20300 1729 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence547 299 21 gene locus_tag LOCUS_20310 299 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 835 2037 gene locus_tag LOCUS_20320 835 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence548 329 1765 gene locus_tag LOCUS_20330 329 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence549 1698 505 gene locus_tag LOCUS_20340 1698 505 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261001.1 protein_id gnl|my_center|LOCUS_20340 2350 1727 gene locus_tag LOCUS_20350 2350 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence550 1971 160 gene locus_tag LOCUS_20360 1971 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence551 375 680 gene locus_tag LOCUS_20370 375 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 677 1258 gene locus_tag LOCUS_20380 677 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence552 910 2157 gene locus_tag LOCUS_20390 910 2157 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E198 protein_id gnl|my_center|LOCUS_20390 >Feature sequence553 415 1005 gene locus_tag LOCUS_20400 gene orn 415 1005 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VI6 protein_id gnl|my_center|LOCUS_20400 1008 1274 gene locus_tag LOCUS_20410 1008 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 1430 2398 gene locus_tag LOCUS_20420 gene yedY 1430 2398 CDS product mononuclear molybdenum enzyme YedY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence554 <1 1351 gene locus_tag LOCUS_20430 <1 1351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118525.1:UDP-glucose 6-dehydrogenase >Feature sequence555 2518 587 gene locus_tag LOCUS_20440 2518 587 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D64 protein_id gnl|my_center|LOCUS_20440 >Feature sequence556 249 1451 gene locus_tag LOCUS_20450 249 1451 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_20450 1864 1505 gene locus_tag LOCUS_20460 1864 1505 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112329.1 protein_id gnl|my_center|LOCUS_20460 2209 2472 gene locus_tag LOCUS_20470 2209 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence557 197 1141 gene locus_tag LOCUS_20480 197 1141 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_20480 1149 2147 gene locus_tag LOCUS_20490 1149 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942340.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence558 325 1446 gene locus_tag LOCUS_20500 gene flgI 325 1446 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F5 protein_id gnl|my_center|LOCUS_20500 1873 2265 gene locus_tag LOCUS_20510 1873 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence559 1730 1317 gene locus_tag LOCUS_20520 1730 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956671.1 protein_id gnl|my_center|LOCUS_20520 1945 1727 gene locus_tag LOCUS_20530 1945 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2521 2099 gene locus_tag LOCUS_20540 2521 2099 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978373.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence560 371 1702 gene locus_tag LOCUS_20550 371 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20550 >Feature sequence561 1222 140 gene locus_tag LOCUS_20560 1222 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 <2633 1512 gene locus_tag LOCUS_20570 <2633 1512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388476.1:methyl-accepting chemotaxis protein >Feature sequence562 205 1158 gene locus_tag LOCUS_20580 gene oxyR 205 1158 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence563 1154 1480 gene locus_tag LOCUS_20590 1154 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 1496 1690 gene locus_tag LOCUS_20600 1496 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 1977 2186 gene locus_tag LOCUS_20610 1977 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence564 593 1228 gene locus_tag LOCUS_20620 gene acuB 593 1228 CDS product acetoin utilization protein AcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634568.1 protein_id gnl|my_center|LOCUS_20620 1444 1962 gene locus_tag LOCUS_20630 gene hpt 1444 1962 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546262.1 protein_id gnl|my_center|LOCUS_20630 2364 1981 gene locus_tag LOCUS_20640 2364 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2534 2397 gene locus_tag LOCUS_20650 2534 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence565 <1 909 gene locus_tag LOCUS_20660 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933145.1:UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase 926 2044 gene locus_tag LOCUS_20670 926 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2602 2126 gene locus_tag LOCUS_20680 2602 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence566 518 952 gene locus_tag LOCUS_20690 518 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence567 2337 103 gene locus_tag LOCUS_20700 2337 103 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence568 1436 534 gene locus_tag LOCUS_20710 1436 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_20710 1710 2486 gene locus_tag LOCUS_20720 1710 2486 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence569 975 418 gene locus_tag LOCUS_20730 gene cysC 975 418 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN99 protein_id gnl|my_center|LOCUS_20730 2594 999 gene locus_tag LOCUS_20740 2594 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence570 952 779 gene locus_tag LOCUS_20750 952 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1317 1637 gene locus_tag LOCUS_20760 1317 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 <2594 1696 gene locus_tag LOCUS_20770 <2594 1696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003897870.1:dihydropyrimidine dehydrogenase subunit A >Feature sequence571 1787 312 gene locus_tag LOCUS_20780 gene degP 1787 312 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_20780 2250 2092 gene locus_tag LOCUS_20790 2250 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence572 >Feature sequence573 2539 374 gene locus_tag LOCUS_20800 gene cheA 2539 374 CDS product chemotaxis protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891851.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence574 236 1498 gene locus_tag LOCUS_20810 236 1498 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871002.1 protein_id gnl|my_center|LOCUS_20810 1504 2304 gene locus_tag LOCUS_20820 1504 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence575 617 2413 gene locus_tag LOCUS_20830 gene uup 617 2413 CDS product ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261895.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence576 1300 344 gene locus_tag LOCUS_20840 1300 344 CDS product NDP-sugar dehydratase or epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_20840 1959 1501 gene locus_tag LOCUS_20850 gene bcp 1959 1501 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 protein_id gnl|my_center|LOCUS_20850 2290 2024 gene locus_tag LOCUS_20860 2290 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence577 704 1594 gene locus_tag LOCUS_20870 704 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence578 44 571 gene locus_tag LOCUS_20880 44 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 <2573 614 gene locus_tag LOCUS_20890 <2573 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121932.1:formate dehydrogenase >Feature sequence579 >Feature sequence580 <1 1310 gene locus_tag LOCUS_20900 <1 1310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ61:histidine kinase >Feature sequence581 120 611 gene locus_tag LOCUS_20910 120 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 2281 650 gene locus_tag LOCUS_20920 2281 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103407.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence582 1849 1655 gene locus_tag LOCUS_20930 1849 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence583 494 111 gene locus_tag LOCUS_20940 494 111 CDS product cysteine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946033.1 protein_id gnl|my_center|LOCUS_20940 1754 627 gene locus_tag LOCUS_20950 1754 627 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence584 >Feature sequence585 481 1503 gene locus_tag LOCUS_20960 481 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1651 1848 gene locus_tag LOCUS_20970 1651 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 2029 2394 gene locus_tag LOCUS_20980 2029 2394 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545378.1 protein_id gnl|my_center|LOCUS_20980 >Feature sequence586 337 570 gene locus_tag LOCUS_20990 337 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 630 854 gene locus_tag LOCUS_21000 630 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 1380 2444 gene locus_tag LOCUS_21010 1380 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence587 3 146 gene locus_tag LOCUS_21020 3 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 1410 160 gene locus_tag LOCUS_21030 1410 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence588 1060 1326 gene locus_tag LOCUS_21040 1060 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 1362 2045 gene locus_tag LOCUS_21050 1362 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence589 1256 2248 gene locus_tag LOCUS_21060 1256 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence590 777 79 gene locus_tag LOCUS_21070 777 79 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976284.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence591 >Feature sequence592 2120 24 gene locus_tag LOCUS_21080 gene fusA-1 2120 24 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence593 1808 1260 gene locus_tag LOCUS_21090 1808 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2465 2079 gene locus_tag LOCUS_21100 2465 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence594 253 1302 gene locus_tag LOCUS_21110 gene hrcA 253 1302 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H61 protein_id gnl|my_center|LOCUS_21110 1307 2011 gene locus_tag LOCUS_21120 gene grpE 1307 2011 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH60 protein_id gnl|my_center|LOCUS_21120 >Feature sequence595 <1 543 gene locus_tag LOCUS_21130 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056777.1:transglycosylase 579 1169 gene locus_tag LOCUS_21140 579 1169 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194486.1 protein_id gnl|my_center|LOCUS_21140 1199 1465 gene locus_tag LOCUS_21150 1199 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 1469 2062 gene locus_tag LOCUS_21160 1469 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 >Feature sequence596 <1 1216 gene locus_tag LOCUS_21170 <1 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942226.1:poly(A) polymerase 1708 1941 gene locus_tag LOCUS_21180 1708 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 1934 2476 gene locus_tag LOCUS_21190 1934 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence597 1055 1375 gene locus_tag LOCUS_21200 1055 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 <2485 1586 gene locus_tag LOCUS_21210 <2485 1586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704482.1:glycosyl transferase >Feature sequence598 691 945 gene locus_tag LOCUS_21220 691 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 1140 1631 gene locus_tag LOCUS_21230 1140 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence599 352 2217 gene locus_tag LOCUS_21240 352 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143991.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence600 <1 823 gene locus_tag LOCUS_21250 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003402868.1:UDP-glucose 4-epimerase 820 1530 gene locus_tag LOCUS_21260 gene gcd1 820 1530 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774263.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence601 <1 970 gene locus_tag LOCUS_21270 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388476.1:methyl-accepting chemotaxis protein 1835 987 gene locus_tag LOCUS_21280 1835 987 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence602 1003 851 gene locus_tag LOCUS_21290 1003 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 1248 2219 gene locus_tag LOCUS_21300 1248 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence603 <2459 125 gene locus_tag LOCUS_21310 <2459 125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q835H3:endonuclease MutS2 >Feature sequence604 >Feature sequence605 317 2332 gene locus_tag LOCUS_21320 gene shc-1 317 2332 CDS product squalene-hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence606 376 300 gene locus_tag LOCUS_t00130 376 300 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1972 593 gene locus_tag LOCUS_21330 1972 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence607 55 1452 gene locus_tag LOCUS_21340 55 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence608 774 142 gene locus_tag LOCUS_21350 774 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 1433 810 gene locus_tag LOCUS_21360 gene coaE 1433 810 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58897 protein_id gnl|my_center|LOCUS_21360 2352 1477 gene locus_tag LOCUS_21370 gene ilvE 2352 1477 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence609 1237 629 gene locus_tag LOCUS_21380 gene purN 1237 629 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67023 protein_id gnl|my_center|LOCUS_21380 <2434 1450 gene locus_tag LOCUS_21390 <2434 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257538.1:methyl-accepting chemotaxis protein >Feature sequence610 906 643 gene locus_tag LOCUS_21400 906 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence611 285 2201 gene locus_tag LOCUS_21410 285 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55493 protein_id gnl|my_center|LOCUS_21410 >Feature sequence612 213 1010 gene locus_tag LOCUS_21420 213 1010 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 protein_id gnl|my_center|LOCUS_21420 986 1774 gene locus_tag LOCUS_21430 986 1774 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence613 440 36 gene locus_tag LOCUS_21440 440 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 1629 2066 gene locus_tag LOCUS_21450 1629 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence614 181 498 gene locus_tag LOCUS_21460 gene glpE 181 498 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEH8 protein_id gnl|my_center|LOCUS_21460 <2405 500 gene locus_tag LOCUS_21470 <2405 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096489.1:TonB-dependent receptor >Feature sequence615 204 1250 gene locus_tag LOCUS_21480 204 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence616 1179 430 gene locus_tag LOCUS_21490 1179 430 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_21490 2198 1176 gene locus_tag LOCUS_21500 gene gpsA 2198 1176 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61740 protein_id gnl|my_center|LOCUS_21500 >Feature sequence617 1860 37 gene locus_tag LOCUS_21510 gene typA 1860 37 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_21510 2390 1971 gene locus_tag LOCUS_21520 2390 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence618 126 515 gene locus_tag LOCUS_21530 126 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 836 552 gene locus_tag LOCUS_21540 836 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1532 876 gene locus_tag LOCUS_21550 1532 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence619 119 961 gene locus_tag LOCUS_21560 119 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 1843 971 gene locus_tag LOCUS_21570 1843 971 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_21570 2346 1843 gene locus_tag LOCUS_21580 2346 1843 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403506.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence620 >Feature sequence621 389 961 gene locus_tag LOCUS_21590 389 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence622 <1 620 gene locus_tag LOCUS_21600 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87LP2:pyridoxine 5'-phosphate synthase 757 1593 gene locus_tag LOCUS_21610 757 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence623 <1 717 gene locus_tag LOCUS_21620 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ61:histidine kinase 1127 786 gene locus_tag LOCUS_21630 1127 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 1366 1863 gene locus_tag LOCUS_21640 1366 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2232 1960 gene locus_tag LOCUS_21650 2232 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence624 >Feature sequence625 330 1613 gene locus_tag LOCUS_21660 330 1613 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence626 >Feature sequence627 663 738 gene locus_tag LOCUS_t00140 663 738 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 761 837 gene locus_tag LOCUS_t00150 761 837 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1002 2063 gene locus_tag LOCUS_21670 gene pleD 1002 2063 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377275.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence628 1941 1270 gene locus_tag LOCUS_21680 1941 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2355 1966 gene locus_tag LOCUS_21690 2355 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence629 <1 697 gene locus_tag LOCUS_21700 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DJ0:ATP-dependent DNA helicase RecG 906 2045 gene locus_tag LOCUS_21710 906 2045 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479994.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence630 257 1228 gene locus_tag LOCUS_21720 257 1228 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_21720 1319 2368 gene locus_tag LOCUS_21730 1319 2368 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812925.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence631 >Feature sequence632 <1 745 gene locus_tag LOCUS_21740 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108484.1:membrane protein >Feature sequence633 1161 19 gene locus_tag LOCUS_21750 1161 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 1219 1302 gene locus_tag LOCUS_t00160 1219 1302 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence634 2017 35 gene locus_tag LOCUS_21760 2017 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462072.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence635 619 1608 gene locus_tag LOCUS_21770 619 1608 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124958.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence636 1012 2199 gene locus_tag LOCUS_21780 1012 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 >Feature sequence637 1629 715 gene locus_tag LOCUS_21790 1629 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence638 >Feature sequence639 <1 610 gene locus_tag LOCUS_21800 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546761.1:membrane protein 992 627 gene locus_tag LOCUS_21810 992 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 1697 1449 gene locus_tag LOCUS_21820 1697 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 2074 2316 gene locus_tag LOCUS_21830 2074 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence640 735 1616 gene locus_tag LOCUS_21840 735 1616 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391125.1 protein_id gnl|my_center|LOCUS_21840 <2347 1622 gene locus_tag LOCUS_21850 <2347 1622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74AI4:acetyl-coenzyme A carboxylase carboxyl transferase subunit beta >Feature sequence641 276 851 gene locus_tag LOCUS_21860 gene nuoI 276 851 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q5 protein_id gnl|my_center|LOCUS_21860 879 1385 gene locus_tag LOCUS_21870 gene nuoJ-1 879 1385 CDS product NADH dehydrogenase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_21870 1395 1697 gene locus_tag LOCUS_21880 gene nuoK 1395 1697 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFC1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence642 1133 228 gene locus_tag LOCUS_21890 1133 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 <2344 1233 gene locus_tag LOCUS_21900 <2344 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YIG4:flagellar hook protein FlgE >Feature sequence643 671 1933 gene locus_tag LOCUS_21910 gene acrE 671 1933 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880415.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence644 1474 524 gene locus_tag LOCUS_21920 gene trxB 1474 524 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3B3 protein_id gnl|my_center|LOCUS_21920 2223 1474 gene locus_tag LOCUS_21930 2223 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence645 824 141 gene locus_tag LOCUS_21940 824 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 1328 2305 gene locus_tag LOCUS_21950 1328 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence646 <2332 1259 gene locus_tag LOCUS_21960 <2332 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103006.1:transcriptional regulator >Feature sequence647 >Feature sequence648 654 1202 gene locus_tag LOCUS_21970 654 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 1398 1222 gene locus_tag LOCUS_21980 1398 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence649 471 178 gene locus_tag LOCUS_21990 471 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 1933 644 gene locus_tag LOCUS_22000 1933 644 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 protein_id gnl|my_center|LOCUS_22000 2262 2083 gene locus_tag LOCUS_22010 2262 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence650 587 189 gene locus_tag LOCUS_22020 587 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1908 601 gene locus_tag LOCUS_22030 1908 601 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence651 >Feature sequence652 629 165 gene locus_tag LOCUS_22040 629 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2104 674 gene locus_tag LOCUS_22050 2104 674 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 protein_id gnl|my_center|LOCUS_22050 >Feature sequence653 48 278 gene locus_tag LOCUS_22060 48 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 335 862 gene locus_tag LOCUS_22070 335 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 859 1284 gene locus_tag LOCUS_22080 859 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_22080 1922 1281 gene locus_tag LOCUS_22090 1922 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence654 1172 507 gene locus_tag LOCUS_22100 1172 507 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZC4 protein_id gnl|my_center|LOCUS_22100 >Feature sequence655 98 283 gene locus_tag LOCUS_22110 98 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 501 2054 gene locus_tag LOCUS_22120 gene purH 501 2054 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HA6 protein_id gnl|my_center|LOCUS_22120 >Feature sequence656 545 844 gene locus_tag LOCUS_22130 545 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1064 1762 gene locus_tag LOCUS_22140 1064 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 >Feature sequence657 2031 775 gene locus_tag LOCUS_22150 2031 775 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022337.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence658 1520 411 gene locus_tag LOCUS_22160 gene dnaN 1520 411 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H91 protein_id gnl|my_center|LOCUS_22160 >Feature sequence659 <1 696 gene locus_tag LOCUS_22170 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q181S7:tRNA modification GTPase MnmE 1651 731 gene locus_tag LOCUS_22180 1651 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence660 708 1748 gene locus_tag LOCUS_22190 708 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 1979 1905 gene locus_tag LOCUS_t00170 1979 1905 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2087 2013 gene locus_tag LOCUS_t00180 2087 2013 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence661 326 1795 gene locus_tag LOCUS_22200 326 1795 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence662 1137 1625 gene locus_tag LOCUS_22210 1137 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 <2270 1675 gene locus_tag LOCUS_22220 <2270 1675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403941.1:aminotransferase >Feature sequence663 2 475 gene locus_tag LOCUS_22230 2 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 774 1856 gene locus_tag LOCUS_22240 774 1856 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence664 960 1715 gene locus_tag LOCUS_22250 960 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence665 >Feature sequence666 453 1814 gene locus_tag LOCUS_22260 453 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence667 1558 1007 gene locus_tag LOCUS_22270 gene folE 1558 1007 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEA8 protein_id gnl|my_center|LOCUS_22270 1967 1563 gene locus_tag LOCUS_22280 1967 1563 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_22280 >Feature sequence668 554 1186 gene locus_tag LOCUS_22290 554 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence669 1060 1725 gene locus_tag LOCUS_22300 1060 1725 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184839.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence670 <1 1713 gene locus_tag LOCUS_22310 <1 1713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123499.1:cytochrome c >Feature sequence671 3 449 gene locus_tag LOCUS_22320 3 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 463 1371 gene locus_tag LOCUS_22330 463 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 1385 1807 gene locus_tag LOCUS_22340 1385 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence672 >Feature sequence673 1005 172 gene locus_tag LOCUS_22350 1005 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence674 227 658 gene locus_tag LOCUS_22360 227 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 <2235 711 gene locus_tag LOCUS_22370 <2235 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258732.1:ABC transporter ATP-binding protein >Feature sequence675 418 1671 gene locus_tag LOCUS_22380 gene murA 418 1671 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748B3 protein_id gnl|my_center|LOCUS_22380 >Feature sequence676 >Feature sequence677 1502 2125 gene locus_tag LOCUS_22390 1502 2125 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418930.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence678 1899 916 gene locus_tag LOCUS_22400 1899 916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868769.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence679 2163 700 gene locus_tag LOCUS_22410 gene guaB 2163 700 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B47 protein_id gnl|my_center|LOCUS_22410 >Feature sequence680 1147 422 gene locus_tag LOCUS_22420 1147 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1957 1310 gene locus_tag LOCUS_22430 1957 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence681 1082 447 gene locus_tag LOCUS_22440 1082 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence682 <1 925 gene locus_tag LOCUS_22450 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121146.1:cytochrome c554 1058 1681 gene locus_tag LOCUS_22460 1058 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence683 968 441 gene locus_tag LOCUS_22470 gene rplJ 968 441 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727C9 protein_id gnl|my_center|LOCUS_22470 1726 1037 gene locus_tag LOCUS_22480 gene rplA 1726 1037 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFN6 protein_id gnl|my_center|LOCUS_22480 2163 1735 gene locus_tag LOCUS_22490 gene rplK 2163 1735 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6U1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence684 2031 1054 gene locus_tag LOCUS_22500 2031 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence685 274 1782 gene locus_tag LOCUS_22510 274 1782 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3V1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence686 1819 866 gene locus_tag LOCUS_22520 1819 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324266.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence687 1334 189 gene locus_tag LOCUS_22530 1334 189 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142438.1 protein_id gnl|my_center|LOCUS_22530 1653 1381 gene locus_tag LOCUS_22540 1653 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence688 <1 1344 gene locus_tag LOCUS_22550 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948289.1:D-alanyl-D-alanine carboxypeptidase 2003 1362 gene locus_tag LOCUS_22560 2003 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence689 <1 1763 gene locus_tag LOCUS_22570 <1 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CPY9:UvrABC system protein A >Feature sequence690 <1 1190 gene locus_tag LOCUS_22580 <1 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UXM8:dihydrolipoyl dehydrogenase 1288 2124 gene locus_tag LOCUS_22590 1288 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence691 1472 1296 gene locus_tag LOCUS_22600 1472 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 1892 1515 gene locus_tag LOCUS_22610 1892 1515 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence692 964 206 gene locus_tag LOCUS_22620 gene wbmT 964 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807061.1 protein_id gnl|my_center|LOCUS_22620 1138 2004 gene locus_tag LOCUS_22630 gene lpxD 1138 2004 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43888 protein_id gnl|my_center|LOCUS_22630 >Feature sequence693 1556 783 gene locus_tag LOCUS_22640 gene lpxA 1556 783 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHC0 protein_id gnl|my_center|LOCUS_22640 2081 1653 gene locus_tag LOCUS_22650 gene fabZ 2081 1653 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Z3 protein_id gnl|my_center|LOCUS_22650 >Feature sequence694 <1 605 gene locus_tag LOCUS_22660 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020083.1:zinc ABC transporter ATP-binding protein 621 1448 gene locus_tag LOCUS_22670 621 1448 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_22670 2172 1465 gene locus_tag LOCUS_22680 2172 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence695 <1 1189 gene locus_tag LOCUS_22690 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A9H3:GDP-perosamine synthase >Feature sequence696 >Feature sequence697 <1 671 gene locus_tag LOCUS_22700 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584099.1:diguanylate cyclase 683 1201 gene locus_tag LOCUS_22710 gene argA 683 1201 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942702.1 protein_id gnl|my_center|LOCUS_22710 1412 2125 gene locus_tag LOCUS_22720 gene flgG 1412 2125 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence698 <1 778 gene locus_tag LOCUS_22730 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702756.1:putative bifunctional enzyme HhdD isomerase + cyclase/dehydrase <2147 807 gene locus_tag LOCUS_22740 <2147 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UHW9:acetolactate synthase >Feature sequence699 >Feature sequence700 943 1131 gene locus_tag LOCUS_22750 943 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence701 1244 63 gene locus_tag LOCUS_22760 1244 63 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937637.1 protein_id gnl|my_center|LOCUS_22760 <2134 1241 gene locus_tag LOCUS_22770 <2134 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007337813.1:two-component system response regulator >Feature sequence702 384 695 gene locus_tag LOCUS_22780 384 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 1570 767 gene locus_tag LOCUS_22790 1570 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2130 1630 gene locus_tag LOCUS_22800 2130 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence703 313 654 gene locus_tag LOCUS_22810 313 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 689 1504 gene locus_tag LOCUS_22820 689 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence704 1805 894 gene locus_tag LOCUS_22830 1805 894 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence705 1137 202 gene locus_tag LOCUS_22840 gene dnaJ 1137 202 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73Q15 protein_id gnl|my_center|LOCUS_22840 1319 1510 gene locus_tag LOCUS_22850 1319 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence706 >Feature sequence707 2034 1660 gene locus_tag LOCUS_22860 2034 1660 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546608.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence708 1957 1484 gene locus_tag LOCUS_22870 1957 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence709 384 1820 gene locus_tag LOCUS_22880 384 1820 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence710 227 793 gene locus_tag LOCUS_22890 gene tpx 227 793 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCN8 protein_id gnl|my_center|LOCUS_22890 >Feature sequence711 1 393 gene locus_tag LOCUS_22900 1 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 393 1355 gene locus_tag LOCUS_22910 393 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence712 <1 1427 gene locus_tag LOCUS_22920 <1 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CS9:polyribonucleotide nucleotidyltransferase >Feature sequence713 >Feature sequence714 <1 832 gene locus_tag LOCUS_22930 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966255.1:cysteine desulfurase 832 2016 gene locus_tag LOCUS_22940 gene thiI 832 2016 CDS product putative tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189U8 protein_id gnl|my_center|LOCUS_22940 >Feature sequence715 <1 865 gene locus_tag LOCUS_22950 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7AJA5:serine/threonine-protein kinase pkn1 871 1596 gene locus_tag LOCUS_22960 871 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 2023 1844 gene locus_tag LOCUS_22970 2023 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence716 >Feature sequence717 2 163 gene locus_tag LOCUS_22980 2 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 280 675 gene locus_tag LOCUS_22990 280 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 712 1434 gene locus_tag LOCUS_23000 712 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence718 1395 22 gene locus_tag LOCUS_23010 gene acoL 1395 22 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CN25 protein_id gnl|my_center|LOCUS_23010 >Feature sequence719 174 1739 gene locus_tag LOCUS_23020 174 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence720 163 615 gene locus_tag LOCUS_23030 163 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence721 215 1126 gene locus_tag LOCUS_23040 215 1126 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_23040 1490 1648 gene locus_tag LOCUS_23050 1490 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 1641 1910 gene locus_tag LOCUS_23060 1641 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence722 193 1521 gene locus_tag LOCUS_23070 193 1521 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_23070 1720 2019 gene locus_tag LOCUS_23080 1720 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence723 <2084 111 gene locus_tag LOCUS_23090 <2084 111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000228905.1:thioredoxin domain-containing protein >Feature sequence724 760 1149 gene locus_tag LOCUS_23100 760 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 1611 2066 gene locus_tag LOCUS_23110 1611 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence725 >Feature sequence726 >Feature sequence727 545 2038 gene locus_tag LOCUS_23120 gene trpE 545 2038 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence728 2 598 gene locus_tag LOCUS_23130 gene rnhB 2 598 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FG0 protein_id gnl|my_center|LOCUS_23130 >Feature sequence729 233 943 gene locus_tag LOCUS_23140 233 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence730 1031 372 gene locus_tag LOCUS_23150 1031 372 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944017.1 protein_id gnl|my_center|LOCUS_23150 <2066 1180 gene locus_tag LOCUS_23160 <2066 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141404.1:ABC transporter ATP-binding protein >Feature sequence731 >Feature sequence732 >Feature sequence733 2059 1679 gene locus_tag LOCUS_23170 2059 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence734 >Feature sequence735 265 861 gene locus_tag LOCUS_23180 265 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 941 1840 gene locus_tag LOCUS_23190 941 1840 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence736 398 952 gene locus_tag LOCUS_23200 398 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 1261 1016 gene locus_tag LOCUS_23210 1261 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 <2040 1275 gene locus_tag LOCUS_23220 <2040 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942161.1:heptosyltransferase >Feature sequence737 690 313 gene locus_tag LOCUS_23230 gene cheY-3 690 313 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940486.1 protein_id gnl|my_center|LOCUS_23230 1998 895 gene locus_tag LOCUS_23240 gene mqnE 1998 895 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHE3 protein_id gnl|my_center|LOCUS_23240 >Feature sequence738 >Feature sequence739 811 1638 gene locus_tag LOCUS_23250 811 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence740 <1 1076 gene locus_tag LOCUS_23260 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258438.1:cobaltochelatase subunit CobN 1192 1479 gene locus_tag LOCUS_23270 1192 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_23270 1476 1820 gene locus_tag LOCUS_23280 1476 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 >Feature sequence741 277 74 gene locus_tag LOCUS_23290 277 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 684 370 gene locus_tag LOCUS_23300 684 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 <2018 717 gene locus_tag LOCUS_23310 <2018 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39695:ComE operon protein 3 note possible pseudo, internal stop codon, frameshifted >Feature sequence742 354 950 gene locus_tag LOCUS_23320 354 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 1684 1130 gene locus_tag LOCUS_23330 1684 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence743 314 228 gene locus_tag LOCUS_t00190 314 228 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 494 1339 gene locus_tag LOCUS_23340 494 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 1905 1336 gene locus_tag LOCUS_23350 1905 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence744 >Feature sequence745 1783 497 gene locus_tag LOCUS_23360 gene purA 1783 497 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747F9 protein_id gnl|my_center|LOCUS_23360 >Feature sequence746 <2002 360 gene locus_tag LOCUS_23370 <2002 360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F5D7:histidine kinase note possible pseudo, internal stop codon, frameshifted >Feature sequence747 1713 553 gene locus_tag LOCUS_23380 gene metK 1713 553 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61946 protein_id gnl|my_center|LOCUS_23380 >Feature sequence748 391 1092 gene locus_tag LOCUS_23390 391 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 1453 1094 gene locus_tag LOCUS_23400 1453 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence749 41 847 gene locus_tag LOCUS_23410 41 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 966 1664 gene locus_tag LOCUS_23420 966 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence750 1943 471 gene locus_tag LOCUS_23430 1943 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence751 <1 1360 gene locus_tag LOCUS_23440 <1 1360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGX9:DNA helicase >Feature sequence752 480 1427 gene locus_tag LOCUS_23450 480 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 >Feature sequence753 >Feature sequence754 1675 860 gene locus_tag LOCUS_23460 1675 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence755 260 1474 gene locus_tag LOCUS_23470 260 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence756 144 515 gene locus_tag LOCUS_23480 144 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 597 1610 gene locus_tag LOCUS_23490 597 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence757 1109 99 gene locus_tag LOCUS_23500 1109 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence758 374 694 gene locus_tag LOCUS_23510 374 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 720 1253 gene locus_tag LOCUS_23520 720 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence759 >Feature sequence760 >Feature sequence761 805 38 gene locus_tag LOCUS_23530 805 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 1490 807 gene locus_tag LOCUS_23540 1490 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence762 544 702 gene locus_tag LOCUS_23550 544 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 1082 729 gene locus_tag LOCUS_23560 1082 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence763 416 198 gene locus_tag LOCUS_23570 416 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 1130 498 gene locus_tag LOCUS_23580 1130 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 1639 1202 gene locus_tag LOCUS_23590 1639 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 >Feature sequence764 >Feature sequence765 >Feature sequence766 <1 681 gene locus_tag LOCUS_23600 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975735.1:Sel1 domain-containing protein 904 1524 gene locus_tag LOCUS_23610 904 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence767 <1937 1075 gene locus_tag LOCUS_23620 <1937 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942720.1:rod shape-determining protein RodA >Feature sequence768 >Feature sequence769 1268 486 gene locus_tag LOCUS_23630 1268 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence770 1689 262 gene locus_tag LOCUS_23640 gene gltA 1689 262 CDS product glutamate synthase (NADPH), homotetrameric inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence771 >Feature sequence772 <1929 1047 gene locus_tag LOCUS_23650 <1929 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KAQ7:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence773 290 126 gene locus_tag LOCUS_23660 290 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 747 229 gene locus_tag LOCUS_23670 747 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 1297 950 gene locus_tag LOCUS_23680 1297 950 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MH6 protein_id gnl|my_center|LOCUS_23680 >Feature sequence774 648 334 gene locus_tag LOCUS_23690 648 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence775 3 281 gene locus_tag LOCUS_23700 3 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence776 <1 967 gene locus_tag LOCUS_23710 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66864:threonine synthase 1003 1284 gene locus_tag LOCUS_23720 1003 1284 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920730.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence777 361 1554 gene locus_tag LOCUS_23730 361 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence778 280 1716 gene locus_tag LOCUS_23740 280 1716 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence779 219 398 gene locus_tag LOCUS_23750 219 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 518 1786 gene locus_tag LOCUS_23760 518 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence780 548 216 gene locus_tag LOCUS_23770 548 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 1660 566 gene locus_tag LOCUS_23780 1660 566 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKJ7 protein_id gnl|my_center|LOCUS_23780 >Feature sequence781 1885 404 gene locus_tag LOCUS_23790 1885 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence782 >Feature sequence783 1640 999 gene locus_tag LOCUS_23800 1640 999 CDS product 2-oxoglutarate:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880730.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence784 586 1026 gene locus_tag LOCUS_23810 586 1026 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706152.1 protein_id gnl|my_center|LOCUS_23810 1040 1453 gene locus_tag LOCUS_23820 gene hsp15 1040 1453 CDS product putative 15 kDa heat shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93TV7 protein_id gnl|my_center|LOCUS_23820 >Feature sequence785 655 1506 gene locus_tag LOCUS_23830 655 1506 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_23830 1807 1655 gene locus_tag LOCUS_23840 1807 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence786 339 908 gene locus_tag LOCUS_23850 339 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence787 586 1107 gene locus_tag LOCUS_23860 gene purE-1 586 1107 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FJ7 protein_id gnl|my_center|LOCUS_23860 1082 1717 gene locus_tag LOCUS_23870 1082 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence788 >Feature sequence789 235 1686 gene locus_tag LOCUS_23880 gene gatA 235 1686 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL59 protein_id gnl|my_center|LOCUS_23880 >Feature sequence790 >Feature sequence791 >Feature sequence792 598 110 gene locus_tag LOCUS_23890 598 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_23890 1044 802 gene locus_tag LOCUS_23900 1044 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 1658 1041 gene locus_tag LOCUS_23910 1658 1041 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259729.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence793 >Feature sequence794 752 597 gene locus_tag LOCUS_23920 752 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 1381 1028 gene locus_tag LOCUS_23930 1381 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 >Feature sequence795 1285 290 gene locus_tag LOCUS_23940 1285 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_23940 <1876 1291 gene locus_tag LOCUS_23950 <1876 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064926.1:esterase >Feature sequence796 208 705 gene locus_tag LOCUS_23960 208 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 1000 1392 gene locus_tag LOCUS_23970 1000 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence797 <1870 234 gene locus_tag LOCUS_23980 <1870 234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ61:histidine kinase >Feature sequence798 1575 451 gene locus_tag LOCUS_23990 1575 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence799 >Feature sequence800 100 999 gene locus_tag LOCUS_24000 100 999 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256404.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence801 1091 444 gene locus_tag LOCUS_24010 1091 444 CDS product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGB4 protein_id gnl|my_center|LOCUS_24010 <1863 1100 gene locus_tag LOCUS_24020 <1863 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972916.1:hydroxymethylpyrimidine/phosphomethylpyrimidine kinase >Feature sequence802 <1 830 gene locus_tag LOCUS_24030 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942933.1:HD family phosphohydrolase 918 1757 gene locus_tag LOCUS_24040 918 1757 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence803 589 1062 gene locus_tag LOCUS_24050 589 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 1555 1172 gene locus_tag LOCUS_24060 1555 1172 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546608.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence804 945 451 gene locus_tag LOCUS_24070 945 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 1318 1527 gene locus_tag LOCUS_24080 1318 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence805 556 825 gene locus_tag LOCUS_24090 556 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 1069 1299 gene locus_tag LOCUS_24100 1069 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 >Feature sequence806 >Feature sequence807 385 1401 gene locus_tag LOCUS_24110 385 1401 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438208.1 protein_id gnl|my_center|LOCUS_24110 1421 1705 gene locus_tag LOCUS_24120 1421 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence808 >Feature sequence809 >Feature sequence810 >Feature sequence811 >Feature sequence812 1836 679 gene locus_tag LOCUS_24130 1836 679 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence813 646 1086 gene locus_tag LOCUS_24140 646 1086 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326711.1 protein_id gnl|my_center|LOCUS_24140 1707 1120 gene locus_tag LOCUS_24150 1707 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence814 281 1657 gene locus_tag LOCUS_24160 gene dctD 281 1657 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073030.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence815 1101 772 gene locus_tag LOCUS_24170 1101 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 1392 1114 gene locus_tag LOCUS_24180 1392 1114 CDS product killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence816 >Feature sequence817 1399 80 gene locus_tag LOCUS_24190 1399 80 CDS product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545891.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence818 <1 977 gene locus_tag LOCUS_24200 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257227.1:phosphodiesterase >Feature sequence819 >Feature sequence820 >Feature sequence821 153 518 gene locus_tag LOCUS_24210 153 518 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_774854.2 protein_id gnl|my_center|LOCUS_24210 515 1495 gene locus_tag LOCUS_24220 515 1495 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918510.1 protein_id gnl|my_center|LOCUS_24220 >Feature sequence822 88 1179 gene locus_tag LOCUS_24230 88 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence823 252 1145 gene locus_tag LOCUS_24240 252 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence824 >Feature sequence825 584 1420 gene locus_tag LOCUS_24250 584 1420 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence826 797 318 gene locus_tag LOCUS_24260 797 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 <1805 908 gene locus_tag LOCUS_24270 <1805 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000200026.1:nucleotide glucose-1-phosphate uridylyl transferase >Feature sequence827 <1 585 gene locus_tag LOCUS_24280 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267085.1:membrane protein 630 1352 gene locus_tag LOCUS_24290 630 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence828 1264 653 gene locus_tag LOCUS_24300 1264 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 >Feature sequence829 355 1776 gene locus_tag LOCUS_24310 355 1776 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941467.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence830 1344 310 gene locus_tag LOCUS_24320 1344 310 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957741.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence831 <1 1095 gene locus_tag LOCUS_24330 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ61:histidine kinase 1286 1684 gene locus_tag LOCUS_24340 1286 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 >Feature sequence832 1429 377 gene locus_tag LOCUS_24350 gene cobT 1429 377 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL85 protein_id gnl|my_center|LOCUS_24350 >Feature sequence833 267 740 gene locus_tag LOCUS_24360 267 740 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082774.1 protein_id gnl|my_center|LOCUS_24360 1113 847 gene locus_tag LOCUS_24370 1113 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence834 123 1055 gene locus_tag LOCUS_24380 123 1055 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_24380 <1791 1153 gene locus_tag LOCUS_24390 <1791 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103862.1:histidine kinase >Feature sequence835 >Feature sequence836 318 130 gene locus_tag LOCUS_24400 318 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 695 315 gene locus_tag LOCUS_24410 695 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence837 >Feature sequence838 107 1201 gene locus_tag LOCUS_24420 gene cbiD 107 1201 CDS product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZT9 protein_id gnl|my_center|LOCUS_24420 >Feature sequence839 <1 1126 gene locus_tag LOCUS_24430 <1 1126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943114.1:B12-binding domain-containing radical SAM protein <1778 1146 gene locus_tag LOCUS_24440 <1778 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2B1:biosynthetic arginine decarboxylase >Feature sequence840 <1 973 gene locus_tag LOCUS_24450 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943210.1:two-component system response regulator 1504 1037 gene locus_tag LOCUS_24460 1504 1037 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_24460 >Feature sequence841 <1775 721 gene locus_tag LOCUS_24470 <1775 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868672.1:chemotaxis response regulator protein-glutamate methylesterase >Feature sequence842 >Feature sequence843 >Feature sequence844 476 1066 gene locus_tag LOCUS_24480 gene prdX2 476 1066 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327091.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence845 758 249 gene locus_tag LOCUS_24490 758 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 1620 865 gene locus_tag LOCUS_24500 1620 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence846 <1 1558 gene locus_tag LOCUS_24510 <1 1558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B6G2:histidine kinase >Feature sequence847 568 1569 gene locus_tag LOCUS_24520 568 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence848 >Feature sequence849 460 759 gene locus_tag LOCUS_24530 460 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 1403 873 gene locus_tag LOCUS_24540 gene ppa 1403 873 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4C9 protein_id gnl|my_center|LOCUS_24540 >Feature sequence850 >Feature sequence851 >Feature sequence852 >Feature sequence853 >Feature sequence854 1422 220 gene locus_tag LOCUS_24550 gene coaBC 1422 220 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence855 <1 715 gene locus_tag LOCUS_24560 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to G5EBD4:chromosome partition protein Smc <1751 748 gene locus_tag LOCUS_24570 <1751 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8RHX4:L-lysine 2,3-aminomutase >Feature sequence856 958 563 gene locus_tag LOCUS_24580 gene exbD3 958 563 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_24580 <1746 1056 gene locus_tag LOCUS_24590 <1746 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118239.1:biopolymer transporter ExbB >Feature sequence857 1741 494 gene locus_tag LOCUS_24600 1741 494 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence858 >Feature sequence859 >Feature sequence860 <1737 940 gene locus_tag LOCUS_24610 <1737 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P80039:malate dehydrogenase >Feature sequence861 1627 77 gene locus_tag LOCUS_24620 gene pgk 1627 77 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2D3 protein_id gnl|my_center|LOCUS_24620 >Feature sequence862 3 1466 gene locus_tag LOCUS_24630 3 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140390.1 protein_id gnl|my_center|LOCUS_24630 1505 1660 gene locus_tag LOCUS_24640 1505 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence863 853 8 gene locus_tag LOCUS_24650 853 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 1469 972 gene locus_tag LOCUS_24660 1469 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1651 1469 gene locus_tag LOCUS_24670 1651 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence864 <1724 345 gene locus_tag LOCUS_24680 <1724 345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q181G3:tRNA(Ile)-lysidine synthase >Feature sequence865 >Feature sequence866 <1 713 gene locus_tag LOCUS_24690 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858299.1:membrane protein 728 1720 gene locus_tag LOCUS_24700 gene lmbP 728 1720 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383609.1 protein_id gnl|my_center|LOCUS_24700 >Feature sequence867 246 1034 gene locus_tag LOCUS_24710 gene uppS 246 1034 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_24710 >Feature sequence868 35 826 gene locus_tag LOCUS_24720 35 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545134.1 protein_id gnl|my_center|LOCUS_24720 826 1284 gene locus_tag LOCUS_24730 gene smpB 826 1284 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL97 protein_id gnl|my_center|LOCUS_24730 >Feature sequence869 1125 217 gene locus_tag LOCUS_24740 1125 217 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYT3 protein_id gnl|my_center|LOCUS_24740 1695 1177 gene locus_tag LOCUS_24750 1695 1177 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_24750 >Feature sequence870 185 667 gene locus_tag LOCUS_24760 gene rnhA 185 667 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T805 protein_id gnl|my_center|LOCUS_24760 >Feature sequence871 <1715 339 gene locus_tag LOCUS_24770 <1715 339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BZ1:RNA polymerase sigma-54 factor >Feature sequence872 1140 214 gene locus_tag LOCUS_24780 gene ribF 1140 214 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJY1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence873 <1 550 gene locus_tag LOCUS_24790 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000567017.1:tetratricopeptide repeat protein >Feature sequence874 213 1034 gene locus_tag LOCUS_24800 213 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 1043 1564 gene locus_tag LOCUS_24810 1043 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence875 908 1306 gene locus_tag LOCUS_24820 gene cheY 908 1306 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811911.1 protein_id gnl|my_center|LOCUS_24820 1602 1312 gene locus_tag LOCUS_24830 1602 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 >Feature sequence876 526 131 gene locus_tag LOCUS_24840 526 131 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_24840 901 554 gene locus_tag LOCUS_24850 901 554 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_24850 1704 934 gene locus_tag LOCUS_24860 1704 934 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence877 666 148 gene locus_tag LOCUS_24870 666 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence878 <1706 781 gene locus_tag LOCUS_24880 <1706 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403879.1:permease >Feature sequence879 >Feature sequence880 >Feature sequence881 >Feature sequence882 1453 302 gene locus_tag LOCUS_24890 1453 302 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence883 >Feature sequence884 1103 54 gene locus_tag LOCUS_24900 1103 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 1694 1167 gene locus_tag LOCUS_24910 1694 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence885 1020 757 gene locus_tag LOCUS_24920 1020 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 1494 1024 gene locus_tag LOCUS_24930 gene hybD 1494 1024 CDS product hydrogenase 2 maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173947.1 protein_id gnl|my_center|LOCUS_24930 >Feature sequence886 1092 652 gene locus_tag LOCUS_24940 1092 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 1319 1441 gene locus_tag LOCUS_24950 1319 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence887 1 1047 gene locus_tag LOCUS_24960 1 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 >Feature sequence888 748 59 gene locus_tag LOCUS_24970 gene queC 748 59 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSY8 protein_id gnl|my_center|LOCUS_24970 >Feature sequence889 110 493 gene locus_tag LOCUS_24980 110 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence890 436 714 gene locus_tag LOCUS_24990 436 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 1003 776 gene locus_tag LOCUS_25000 1003 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence891 1186 266 gene locus_tag LOCUS_25010 1186 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence892 >Feature sequence893 >Feature sequence894 204 488 gene locus_tag LOCUS_25020 204 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence895 >Feature sequence896 >Feature sequence897 253 1665 gene locus_tag LOCUS_25030 253 1665 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence898 1135 350 gene locus_tag LOCUS_25040 1135 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence899 664 248 gene locus_tag LOCUS_25050 664 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 1019 669 gene locus_tag LOCUS_25060 1019 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence900 611 1294 gene locus_tag LOCUS_25070 611 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence901 <1655 305 gene locus_tag LOCUS_25080 <1655 305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868288.1:nucleotide pyrophosphatase >Feature sequence902 517 32 gene locus_tag LOCUS_25090 gene coaD 517 32 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK79 protein_id gnl|my_center|LOCUS_25090 >Feature sequence903 103 1386 gene locus_tag LOCUS_25100 103 1386 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939710.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence904 605 1576 gene locus_tag LOCUS_25110 gene rfaD 605 1576 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHY3 protein_id gnl|my_center|LOCUS_25110 >Feature sequence905 1119 79 gene locus_tag LOCUS_25120 gene rlmN 1119 79 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E53 protein_id gnl|my_center|LOCUS_25120 >Feature sequence906 >Feature sequence907 >Feature sequence908 1495 221 gene locus_tag LOCUS_25130 1495 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence909 173 520 gene locus_tag LOCUS_25140 173 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 530 706 gene locus_tag LOCUS_25150 530 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 >Feature sequence910 >Feature sequence911 380 51 gene locus_tag LOCUS_25160 380 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 >Feature sequence912 <1 1492 gene locus_tag LOCUS_25170 <1 1492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000323161.1:SLC13 family permease >Feature sequence913 847 996 gene locus_tag LOCUS_25180 847 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence914 1398 880 gene locus_tag LOCUS_25190 1398 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 >Feature sequence915 711 1571 gene locus_tag LOCUS_25200 gene mtnP 711 1571 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E52 protein_id gnl|my_center|LOCUS_25200 >Feature sequence916 >Feature sequence917 >Feature sequence918 1005 46 gene locus_tag LOCUS_25210 1005 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142342.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence919 >Feature sequence920 159 1097 gene locus_tag LOCUS_25220 159 1097 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004564371.1 protein_id gnl|my_center|LOCUS_25220 >Feature sequence921 >Feature sequence922 166 525 gene locus_tag LOCUS_25230 166 525 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186556.1 protein_id gnl|my_center|LOCUS_25230 >Feature sequence923 895 539 gene locus_tag LOCUS_25240 895 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 >Feature sequence924 1233 1421 gene locus_tag LOCUS_25250 1233 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence925 <1590 466 gene locus_tag LOCUS_25260 <1590 466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940757.1:peptidase >Feature sequence926 <1587 57 gene locus_tag LOCUS_25270 <1587 57 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ61:histidine kinase >Feature sequence927 1523 768 gene locus_tag LOCUS_25280 1523 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence928 <1 1187 gene locus_tag LOCUS_25290 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027383.1:NAD(P)-dependent oxidoreductase >Feature sequence929 1126 176 gene locus_tag LOCUS_25300 gene ocd2 1126 176 CDS product cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888383.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence930 <1 632 gene locus_tag LOCUS_25310 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000639347.1:adenosylcobinamide amidohydrolase >Feature sequence931 >Feature sequence932 >Feature sequence933 692 363 gene locus_tag LOCUS_25320 692 363 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_25320 <1578 741 gene locus_tag LOCUS_25330 <1578 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071150.1:two-component system response regulator >Feature sequence934 >Feature sequence935 >Feature sequence936 1436 699 gene locus_tag LOCUS_25340 1436 699 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918305.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence937 >Feature sequence938 >Feature sequence939 <1 1369 gene locus_tag LOCUS_25350 <1 1369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YJL3:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG >Feature sequence940 <1 1241 gene locus_tag LOCUS_25360 <1 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P49850:DNA mismatch repair protein MutL >Feature sequence941 >Feature sequence942 789 1505 gene locus_tag LOCUS_25370 789 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence943 >Feature sequence944 >Feature sequence945 >Feature sequence946 >Feature sequence947 <1554 588 gene locus_tag LOCUS_25380 <1554 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74FM7:glycine--tRNA ligase beta subunit >Feature sequence948 806 108 gene locus_tag LOCUS_25390 806 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence949 >Feature sequence950 720 241 gene locus_tag LOCUS_25400 720 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 1352 1086 gene locus_tag LOCUS_25410 1352 1086 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970794.1 protein_id gnl|my_center|LOCUS_25410 1544 1425 gene locus_tag LOCUS_25420 1544 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence951 >Feature sequence952 >Feature sequence953 >Feature sequence954 >Feature sequence955 2 436 gene locus_tag LOCUS_25430 2 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence956 1255 77 gene locus_tag LOCUS_25440 1255 77 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544567.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence957 3 434 gene locus_tag LOCUS_25450 3 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 >Feature sequence958 <1511 650 gene locus_tag LOCUS_25460 <1511 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BH6:NAD kinase >Feature sequence959 <1 559 gene locus_tag LOCUS_25470 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGI3:alanine racemase 1472 570 gene locus_tag LOCUS_25480 gene pyrD 1472 570 CDS product dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB9 protein_id gnl|my_center|LOCUS_25480 >Feature sequence960 182 1324 gene locus_tag LOCUS_25490 182 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence961 348 764 gene locus_tag LOCUS_25500 348 764 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269266.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence962 <1 560 gene locus_tag LOCUS_25510 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O06735:putative adenylyl-sulfate kinase 677 982 gene locus_tag LOCUS_25520 677 982 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_25520 1377 1021 gene locus_tag LOCUS_25530 1377 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence963 <1 1116 gene locus_tag LOCUS_25540 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048254.1:peptidase