>Feature sequence01 545 228 gene locus_tag LOCUS_0010 545 228 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945172.1 protein_id gnl|my_center|LOCUS_0010 2140 761 gene locus_tag LOCUS_0020 2140 761 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_0020 2495 2121 gene locus_tag LOCUS_0030 2495 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 2980 3056 gene locus_tag LOCUS_t0010 2980 3056 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3237 4172 gene locus_tag LOCUS_0040 gene argC 3237 4172 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z3 protein_id gnl|my_center|LOCUS_0040 4190 4360 gene locus_tag LOCUS_0050 4190 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0050 4388 5284 gene locus_tag LOCUS_0060 4388 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0060 5325 7226 gene locus_tag LOCUS_0070 gene ftsH 5325 7226 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEJ0 protein_id gnl|my_center|LOCUS_0070 7298 8911 gene locus_tag LOCUS_0080 gene mviN 7298 8911 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL17 protein_id gnl|my_center|LOCUS_0080 9466 8963 gene locus_tag LOCUS_0090 9466 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0090 9519 11303 gene locus_tag LOCUS_0100 gene lepA 9519 11303 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65274 protein_id gnl|my_center|LOCUS_0100 12460 11300 gene locus_tag LOCUS_0110 12460 11300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 12559 13947 gene locus_tag LOCUS_0120 12559 13947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0120 15315 14086 gene locus_tag LOCUS_0130 gene folC 15315 14086 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141076.1 protein_id gnl|my_center|LOCUS_0130 15403 16140 gene locus_tag LOCUS_0140 gene gmk 15403 16140 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RS38 protein_id gnl|my_center|LOCUS_0140 16185 16889 gene locus_tag LOCUS_0150 16185 16889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 16955 17536 gene locus_tag LOCUS_0160 16955 17536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0160 17608 17793 gene locus_tag LOCUS_0170 17608 17793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0170 17935 19878 gene locus_tag LOCUS_0180 gene dnaK 17935 19878 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42374 protein_id gnl|my_center|LOCUS_0180 19937 20536 gene locus_tag LOCUS_0190 19937 20536 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 protein_id gnl|my_center|LOCUS_0190 20556 21662 gene locus_tag LOCUS_0200 gene dnaJ 20556 21662 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDK8 protein_id gnl|my_center|LOCUS_0200 22144 21797 gene locus_tag LOCUS_0210 22144 21797 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249910.1 protein_id gnl|my_center|LOCUS_0210 22313 22807 gene locus_tag LOCUS_0220 22313 22807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 22807 23718 gene locus_tag LOCUS_0230 gene rimK 22807 23718 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_0230 23678 24145 gene locus_tag LOCUS_0240 23678 24145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0240 24191 24673 gene locus_tag LOCUS_0250 24191 24673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 24746 24822 gene locus_tag LOCUS_t0020 24746 24822 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 24867 25652 gene locus_tag LOCUS_0260 24867 25652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 26231 25710 gene locus_tag LOCUS_0270 26231 25710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0270 26214 27251 gene locus_tag LOCUS_0280 26214 27251 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017189.1 protein_id gnl|my_center|LOCUS_0280 27301 27609 gene locus_tag LOCUS_0290 27301 27609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 27763 28383 gene locus_tag LOCUS_0300 27763 28383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 28408 28950 gene locus_tag LOCUS_0310 28408 28950 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251061.1 protein_id gnl|my_center|LOCUS_0310 28950 29573 gene locus_tag LOCUS_0320 28950 29573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 29796 31037 gene locus_tag LOCUS_0330 29796 31037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 31287 32000 gene locus_tag LOCUS_0340 31287 32000 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F839 protein_id gnl|my_center|LOCUS_0340 32055 33668 gene locus_tag LOCUS_0350 32055 33668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 33742 34548 gene locus_tag LOCUS_0360 33742 34548 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_0360 34529 34987 gene locus_tag LOCUS_0370 34529 34987 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_0370 35340 35912 gene locus_tag LOCUS_0380 gene ruvA 35340 35912 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QX6 protein_id gnl|my_center|LOCUS_0380 35917 36753 gene locus_tag LOCUS_0390 35917 36753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 36756 37778 gene locus_tag LOCUS_0400 gene ruvB 36756 37778 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHT7 protein_id gnl|my_center|LOCUS_0400 37802 38518 gene locus_tag LOCUS_0410 37802 38518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 38926 38525 gene locus_tag LOCUS_0420 38926 38525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0420 38978 40054 gene locus_tag LOCUS_0430 gene recA 38978 40054 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_0430 40062 40448 gene locus_tag LOCUS_0440 40062 40448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0440 40450 40887 gene locus_tag LOCUS_0450 40450 40887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0450 40916 41587 gene locus_tag LOCUS_0460 gene recX 40916 41587 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DSK2 protein_id gnl|my_center|LOCUS_0460 41580 41954 gene locus_tag LOCUS_0470 41580 41954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0470 42466 41903 gene locus_tag LOCUS_0480 42466 41903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 42531 44315 gene locus_tag LOCUS_0490 42531 44315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0490 44325 45548 gene locus_tag LOCUS_0500 44325 45548 CDS product phytochrome sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_0500 45678 46085 gene locus_tag LOCUS_0510 45678 46085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0510 46172 46561 gene locus_tag LOCUS_0520 46172 46561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0520 46570 47232 gene locus_tag LOCUS_0530 46570 47232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0530 47225 48649 gene locus_tag LOCUS_0540 47225 48649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0540 48685 49773 gene locus_tag LOCUS_0550 48685 49773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 49773 50414 gene locus_tag LOCUS_0560 49773 50414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0560 50414 51004 gene locus_tag LOCUS_0570 50414 51004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 51001 51294 gene locus_tag LOCUS_0580 51001 51294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0580 51327 51803 gene locus_tag LOCUS_0590 51327 51803 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082108.1 protein_id gnl|my_center|LOCUS_0590 51800 52198 gene locus_tag LOCUS_0600 51800 52198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0600 52264 52575 gene locus_tag LOCUS_0610 52264 52575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0610 >Feature sequence02 2868 349 gene locus_tag LOCUS_0620 2868 349 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_0620 3986 2919 gene locus_tag LOCUS_0630 3986 2919 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864071.1 protein_id gnl|my_center|LOCUS_0630 4153 5142 gene locus_tag LOCUS_0640 4153 5142 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_0640 5144 5953 gene locus_tag LOCUS_0650 5144 5953 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y8C8 protein_id gnl|my_center|LOCUS_0650 6709 6068 gene locus_tag LOCUS_0660 6709 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0660 7195 7004 gene locus_tag LOCUS_0670 7195 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0670 7370 7639 gene locus_tag LOCUS_0680 7370 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0680 8730 7915 gene locus_tag LOCUS_0690 8730 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 9444 8989 gene locus_tag LOCUS_0700 9444 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0700 10384 9695 gene locus_tag LOCUS_0710 10384 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0710 11737 10496 gene locus_tag LOCUS_0720 gene yxbA 11737 10496 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906398.1 protein_id gnl|my_center|LOCUS_0720 12101 11712 gene locus_tag LOCUS_0730 gene panD 12101 11712 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58285 protein_id gnl|my_center|LOCUS_0730 12663 12247 gene locus_tag LOCUS_0740 12663 12247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0740 14970 12988 gene locus_tag LOCUS_0750 14970 12988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0750 15658 16095 gene locus_tag LOCUS_0760 15658 16095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0760 16085 16477 gene locus_tag LOCUS_0770 16085 16477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 16908 16474 gene locus_tag LOCUS_0780 16908 16474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0780 19530 16924 gene locus_tag LOCUS_0790 19530 16924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0790 20081 19494 gene locus_tag LOCUS_0800 20081 19494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0800 21847 20078 gene locus_tag LOCUS_0810 21847 20078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0810 22476 21844 gene locus_tag LOCUS_0820 22476 21844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0820 22957 22442 gene locus_tag LOCUS_0830 22957 22442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0830 24426 22954 gene locus_tag LOCUS_0840 24426 22954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 24773 24432 gene locus_tag LOCUS_0850 24773 24432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0850 25360 25001 gene locus_tag LOCUS_0860 25360 25001 CDS product putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704424.1 protein_id gnl|my_center|LOCUS_0860 27671 25773 gene locus_tag LOCUS_0870 27671 25773 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086363.1 protein_id gnl|my_center|LOCUS_0870 28890 27736 gene locus_tag LOCUS_0880 28890 27736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0880 29096 28899 gene locus_tag LOCUS_0890 29096 28899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0890 29368 29111 gene locus_tag LOCUS_0900 29368 29111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002831611.1 protein_id gnl|my_center|LOCUS_0900 30025 29387 gene locus_tag LOCUS_0910 30025 29387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0910 31266 30406 gene locus_tag LOCUS_0920 31266 30406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0920 32402 31296 gene locus_tag LOCUS_0930 32402 31296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0930 32846 32472 gene locus_tag LOCUS_0940 32846 32472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0940 33669 32908 gene locus_tag LOCUS_0950 33669 32908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0950 34532 33675 gene locus_tag LOCUS_0960 34532 33675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0960 35023 34580 gene locus_tag LOCUS_0970 35023 34580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0970 35151 37304 gene locus_tag LOCUS_0980 35151 37304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477318.1 protein_id gnl|my_center|LOCUS_0980 37567 37310 gene locus_tag LOCUS_0990 37567 37310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 37712 39070 gene locus_tag LOCUS_1000 37712 39070 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967584.1 protein_id gnl|my_center|LOCUS_1000 39471 39746 gene locus_tag LOCUS_1010 39471 39746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1010 39743 40195 gene locus_tag LOCUS_1020 39743 40195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 40192 40680 gene locus_tag LOCUS_1030 40192 40680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 40916 41188 gene locus_tag LOCUS_1040 40916 41188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1040 41997 41215 gene locus_tag LOCUS_1050 41997 41215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 42258 42455 gene locus_tag LOCUS_1060 42258 42455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1060 42521 42709 gene locus_tag LOCUS_1070 42521 42709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1070 42702 44201 gene locus_tag LOCUS_1080 42702 44201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1080 44358 44284 gene locus_tag LOCUS_t0030 44358 44284 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence03 2132 1302 gene locus_tag LOCUS_1090 2132 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404288.1 protein_id gnl|my_center|LOCUS_1090 2501 2427 gene locus_tag LOCUS_t0040 2501 2427 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2645 3292 gene locus_tag LOCUS_1100 2645 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1100 3294 3992 gene locus_tag LOCUS_1110 3294 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528316.1 protein_id gnl|my_center|LOCUS_1110 4032 5669 gene locus_tag LOCUS_1120 4032 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1120 5757 6080 gene locus_tag LOCUS_1130 5757 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1130 6094 6636 gene locus_tag LOCUS_1140 6094 6636 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810198.1 protein_id gnl|my_center|LOCUS_1140 6641 6886 gene locus_tag LOCUS_1150 6641 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1150 7026 7451 gene locus_tag LOCUS_1160 gene rplK 7026 7451 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFH3 protein_id gnl|my_center|LOCUS_1160 7457 7831 gene locus_tag LOCUS_1170 7457 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 7887 8918 gene locus_tag LOCUS_1180 7887 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1180 9094 9873 gene locus_tag LOCUS_1190 9094 9873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1190 9877 10773 gene locus_tag LOCUS_1200 9877 10773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1200 11701 10757 gene locus_tag LOCUS_1210 11701 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 12630 11704 gene locus_tag LOCUS_1220 12630 11704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 12764 15127 gene locus_tag LOCUS_1230 12764 15127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1230 15857 15138 gene locus_tag LOCUS_1240 15857 15138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1240 16102 17310 gene locus_tag LOCUS_1250 16102 17310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1250 17541 18062 gene locus_tag LOCUS_1260 gene rplJ 17541 18062 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J51 protein_id gnl|my_center|LOCUS_1260 18088 18540 gene locus_tag LOCUS_1270 gene rplL 18088 18540 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ6 protein_id gnl|my_center|LOCUS_1270 21328 18608 gene locus_tag LOCUS_1280 21328 18608 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141744.1 protein_id gnl|my_center|LOCUS_1280 21512 22522 gene locus_tag LOCUS_1290 21512 22522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1290 22598 23107 gene locus_tag LOCUS_1300 22598 23107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1300 23193 23894 gene locus_tag LOCUS_1310 23193 23894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1310 23929 24513 gene locus_tag LOCUS_1320 23929 24513 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDB3 protein_id gnl|my_center|LOCUS_1320 24529 26106 gene locus_tag LOCUS_1330 24529 26106 CDS product DNA polymerase III, subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582668.1 protein_id gnl|my_center|LOCUS_1330 26099 27457 gene locus_tag LOCUS_1340 gene dnaC 26099 27457 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAG8 protein_id gnl|my_center|LOCUS_1340 27469 27636 gene locus_tag LOCUS_1350 27469 27636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 27673 29118 gene locus_tag LOCUS_1360 27673 29118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1360 29174 29461 gene locus_tag LOCUS_1370 29174 29461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1370 29515 29874 gene locus_tag LOCUS_1380 29515 29874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1380 29924 30535 gene locus_tag LOCUS_1390 gene recR 29924 30535 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMH0 protein_id gnl|my_center|LOCUS_1390 31073 30588 gene locus_tag LOCUS_1400 31073 30588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1400 31185 32147 gene locus_tag LOCUS_1410 31185 32147 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881055.1 protein_id gnl|my_center|LOCUS_1410 >Feature sequence04 542 3142 gene locus_tag LOCUS_1420 542 3142 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_1420 3222 4505 gene locus_tag LOCUS_1430 3222 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1430 4507 5811 gene locus_tag LOCUS_1440 gene murD 4507 5811 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7P2 protein_id gnl|my_center|LOCUS_1440 6469 5783 gene locus_tag LOCUS_1450 gene murI 6469 5783 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVD0 protein_id gnl|my_center|LOCUS_1450 6468 7526 gene locus_tag LOCUS_1460 6468 7526 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFM9 protein_id gnl|my_center|LOCUS_1460 7568 8245 gene locus_tag LOCUS_1470 7568 8245 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815584.1 protein_id gnl|my_center|LOCUS_1470 8245 9204 gene locus_tag LOCUS_1480 gene ftsX 8245 9204 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CM92 protein_id gnl|my_center|LOCUS_1480 9368 10441 gene locus_tag LOCUS_1490 9368 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1490 10592 11731 gene locus_tag LOCUS_1500 10592 11731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1500 12796 11786 gene locus_tag LOCUS_1510 12796 11786 CDS product peptidoglycan bridge formation protein FemAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068007.1 protein_id gnl|my_center|LOCUS_1510 12828 14051 gene locus_tag LOCUS_1520 gene prc 12828 14051 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_1520 14260 15888 gene locus_tag LOCUS_1530 gene pyrG 14260 15888 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ75 protein_id gnl|my_center|LOCUS_1530 15888 16268 gene locus_tag LOCUS_1540 15888 16268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 16275 16442 gene locus_tag LOCUS_1550 16275 16442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1550 16527 17960 gene locus_tag LOCUS_1560 16527 17960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1560 18244 17972 gene locus_tag LOCUS_1570 gene rpmA 18244 17972 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DK1 protein_id gnl|my_center|LOCUS_1570 19459 18248 gene locus_tag LOCUS_1580 19459 18248 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248963.1 protein_id gnl|my_center|LOCUS_1580 19506 20582 gene locus_tag LOCUS_1590 19506 20582 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022231.1 protein_id gnl|my_center|LOCUS_1590 20575 21711 gene locus_tag LOCUS_1600 gene xseA 20575 21711 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C85 protein_id gnl|my_center|LOCUS_1600 21701 21904 gene locus_tag LOCUS_1610 21701 21904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1610 21924 22406 gene locus_tag LOCUS_1620 21924 22406 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240557.1 protein_id gnl|my_center|LOCUS_1620 22419 22679 gene locus_tag LOCUS_1630 22419 22679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 22752 23387 gene locus_tag LOCUS_1640 22752 23387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1640 23473 24192 gene locus_tag LOCUS_1650 23473 24192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 24203 24598 gene locus_tag LOCUS_1660 24203 24598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 24595 25266 gene locus_tag LOCUS_1670 24595 25266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1670 25494 26777 gene locus_tag LOCUS_1680 gene glyQS 25494 26777 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6C0 protein_id gnl|my_center|LOCUS_1680 27465 26812 gene locus_tag LOCUS_1690 27465 26812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1690 27515 28042 gene locus_tag LOCUS_1700 27515 28042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061380.1 protein_id gnl|my_center|LOCUS_1700 28089 28388 gene locus_tag LOCUS_1710 28089 28388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1710 28392 28907 gene locus_tag LOCUS_1720 28392 28907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1720 29340 28918 gene locus_tag LOCUS_1730 29340 28918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1730 29428 29871 gene locus_tag LOCUS_1740 gene rnhA 29428 29871 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH79 protein_id gnl|my_center|LOCUS_1740 29887 30525 gene locus_tag LOCUS_1750 29887 30525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1750 30638 31069 gene locus_tag LOCUS_1760 30638 31069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553163.1 protein_id gnl|my_center|LOCUS_1760 31070 31381 gene locus_tag LOCUS_1770 31070 31381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1770 31521 32255 gene locus_tag LOCUS_1780 31521 32255 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_1780 32257 33051 gene locus_tag LOCUS_1790 32257 33051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 >Feature sequence05 138 1802 gene locus_tag LOCUS_1800 138 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1800 1806 3287 gene locus_tag LOCUS_1810 1806 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 3681 4739 gene locus_tag LOCUS_1820 3681 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1820 4851 6143 gene locus_tag LOCUS_1830 gene obg 4851 6143 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FKH5 protein_id gnl|my_center|LOCUS_1830 6329 6799 gene locus_tag LOCUS_1840 6329 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523304.1 protein_id gnl|my_center|LOCUS_1840 6977 7576 gene locus_tag LOCUS_1850 6977 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1850 7623 9122 gene locus_tag LOCUS_1860 7623 9122 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705774.1 protein_id gnl|my_center|LOCUS_1860 9459 9109 gene locus_tag LOCUS_1870 9459 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 9974 9561 gene locus_tag LOCUS_1880 9974 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1880 10642 10013 gene locus_tag LOCUS_1890 10642 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1890 12698 10683 gene locus_tag LOCUS_1900 12698 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 12785 15625 gene locus_tag LOCUS_1910 gene uvrA 12785 15625 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HBC3 protein_id gnl|my_center|LOCUS_1910 16316 15630 gene locus_tag LOCUS_1920 16316 15630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 protein_id gnl|my_center|LOCUS_1920 16401 17144 gene locus_tag LOCUS_1930 gene rplY 16401 17144 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157650.1 protein_id gnl|my_center|LOCUS_1930 17605 17141 gene locus_tag LOCUS_1940 17605 17141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 19583 17805 gene locus_tag LOCUS_1950 19583 17805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1950 19641 20519 gene locus_tag LOCUS_1960 19641 20519 CDS product UPF0176 protein Cgl2992/cg3319 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NLF0 protein_id gnl|my_center|LOCUS_1960 20646 21836 gene locus_tag LOCUS_1970 20646 21836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1970 21891 23066 gene locus_tag LOCUS_1980 21891 23066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 23084 23707 gene locus_tag LOCUS_1990 23084 23707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1990 23795 25360 gene locus_tag LOCUS_2000 gene uvrC 23795 25360 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD6 protein_id gnl|my_center|LOCUS_2000 25366 25743 gene locus_tag LOCUS_2010 25366 25743 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640659.1 protein_id gnl|my_center|LOCUS_2010 25745 25966 gene locus_tag LOCUS_2020 25745 25966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 25983 27749 gene locus_tag LOCUS_2030 25983 27749 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_2030 28173 27871 gene locus_tag LOCUS_2040 28173 27871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2040 28308 28222 gene locus_tag LOCUS_t0050 28308 28222 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28517 30148 gene locus_tag LOCUS_2050 28517 30148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2050 30337 30413 gene locus_tag LOCUS_t0060 30337 30413 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 30539 30627 gene locus_tag LOCUS_t0070 30539 30627 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 30859 30935 gene locus_tag LOCUS_t0080 30859 30935 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 31041 31811 gene locus_tag LOCUS_2060 31041 31811 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878917.1 protein_id gnl|my_center|LOCUS_2060 31912 32541 gene locus_tag LOCUS_2070 31912 32541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2070 32716 32791 gene locus_tag LOCUS_t0090 32716 32791 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 32915 32990 gene locus_tag LOCUS_t0100 32915 32990 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence06 194 523 gene locus_tag LOCUS_2080 194 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2080 1365 574 gene locus_tag LOCUS_2090 1365 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2090 1559 1954 gene locus_tag LOCUS_2100 1559 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2100 2240 1962 gene locus_tag LOCUS_2110 2240 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2110 2322 2990 gene locus_tag LOCUS_2120 2322 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2120 3744 3214 gene locus_tag LOCUS_2130 3744 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2130 4414 4034 gene locus_tag LOCUS_2140 4414 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2140 5088 4684 gene locus_tag LOCUS_2150 5088 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2150 6150 5290 gene locus_tag LOCUS_2160 6150 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2160 8697 6151 gene locus_tag LOCUS_2170 8697 6151 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_2170 9290 10009 gene locus_tag LOCUS_2180 9290 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2180 11062 10004 gene locus_tag LOCUS_2190 gene tsaD 11062 10004 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGJ3 protein_id gnl|my_center|LOCUS_2190 11114 11725 gene locus_tag LOCUS_2200 11114 11725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2200 11747 13093 gene locus_tag LOCUS_2210 gene murE 11747 13093 CDS product UDP-N-acetylmuramyl-tripeptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGL6 protein_id gnl|my_center|LOCUS_2210 13597 13088 gene locus_tag LOCUS_2220 13597 13088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2220 14464 13643 gene locus_tag LOCUS_2230 14464 13643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2230 14583 14912 gene locus_tag LOCUS_2240 14583 14912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2240 15412 14909 gene locus_tag LOCUS_2250 15412 14909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2250 16158 15628 gene locus_tag LOCUS_2260 16158 15628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2260 16261 16839 gene locus_tag LOCUS_2270 16261 16839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2270 16928 17194 gene locus_tag LOCUS_2280 16928 17194 CDS product molecular chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817319.1 protein_id gnl|my_center|LOCUS_2280 17286 18914 gene locus_tag LOCUS_2290 gene groL1 17286 18914 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJN7 protein_id gnl|my_center|LOCUS_2290 20151 19012 gene locus_tag LOCUS_2300 20151 19012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2300 20266 20916 gene locus_tag LOCUS_2310 20266 20916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2310 21009 21722 gene locus_tag LOCUS_2320 21009 21722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2320 21827 23437 gene locus_tag LOCUS_2330 21827 23437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2330 23638 23898 gene locus_tag LOCUS_2340 23638 23898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2340 23898 24287 gene locus_tag LOCUS_2350 23898 24287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2350 24337 24639 gene locus_tag LOCUS_2360 24337 24639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2360 25365 24646 gene locus_tag LOCUS_2370 25365 24646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2370 25383 26408 gene locus_tag LOCUS_2380 25383 26408 CDS product phosphate starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392147.1 protein_id gnl|my_center|LOCUS_2380 26475 27044 gene locus_tag LOCUS_2390 26475 27044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2390 <27881 27051 gene locus_tag LOCUS_2400 <27881 27051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339253.1:multidrug ABC transporter substrate-binding protein >Feature sequence07 1063 665 gene locus_tag LOCUS_2410 gene rpsI 1063 665 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH97 protein_id gnl|my_center|LOCUS_2410 1515 1063 gene locus_tag LOCUS_2420 gene rplM 1515 1063 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748X4 protein_id gnl|my_center|LOCUS_2420 1967 1515 gene locus_tag LOCUS_2430 gene rplQ 1967 1515 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME9 protein_id gnl|my_center|LOCUS_2430 2891 1968 gene locus_tag LOCUS_2440 gene rpoA 2891 1968 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFS6 protein_id gnl|my_center|LOCUS_2440 3529 2912 gene locus_tag LOCUS_2450 gene rpsD 3529 2912 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH92 protein_id gnl|my_center|LOCUS_2450 3994 3533 gene locus_tag LOCUS_2460 gene rpsK 3994 3533 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6MSP8 protein_id gnl|my_center|LOCUS_2460 4389 4003 gene locus_tag LOCUS_2470 gene rpsM 4389 4003 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7I0 protein_id gnl|my_center|LOCUS_2470 4766 4548 gene locus_tag LOCUS_2480 gene infA 4766 4548 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM07 protein_id gnl|my_center|LOCUS_2480 5457 4783 gene locus_tag LOCUS_2490 5457 4783 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048326.1 protein_id gnl|my_center|LOCUS_2490 6858 5461 gene locus_tag LOCUS_2500 gene secY 6858 5461 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5V5 protein_id gnl|my_center|LOCUS_2500 7404 6931 gene locus_tag LOCUS_2510 gene rplO 7404 6931 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q035A2 protein_id gnl|my_center|LOCUS_2510 7925 7404 gene locus_tag LOCUS_2520 gene rpsE 7925 7404 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113851.1 protein_id gnl|my_center|LOCUS_2520 8283 7927 gene locus_tag LOCUS_2530 gene rplR 8283 7927 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88XX0 protein_id gnl|my_center|LOCUS_2530 8819 8283 gene locus_tag LOCUS_2540 gene rplF 8819 8283 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5W0 protein_id gnl|my_center|LOCUS_2540 9237 8842 gene locus_tag LOCUS_2550 gene rpsH 9237 8842 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CG6 protein_id gnl|my_center|LOCUS_2550 9518 9249 gene locus_tag LOCUS_2560 gene rpsN 9518 9249 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66420 protein_id gnl|my_center|LOCUS_2560 10096 9518 gene locus_tag LOCUS_2570 10096 9518 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_2570 10419 10093 gene locus_tag LOCUS_2580 gene rplX 10419 10093 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y443 protein_id gnl|my_center|LOCUS_2580 10790 10422 gene locus_tag LOCUS_2590 gene rplN 10790 10422 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E2C4 protein_id gnl|my_center|LOCUS_2590 11053 10787 gene locus_tag LOCUS_2600 gene rpsQ 11053 10787 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXJ3 protein_id gnl|my_center|LOCUS_2600 11269 11057 gene locus_tag LOCUS_2610 11269 11057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2610 11685 11269 gene locus_tag LOCUS_2620 gene rplP 11685 11269 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926310.1 protein_id gnl|my_center|LOCUS_2620 12317 11685 gene locus_tag LOCUS_2630 gene rpsC 12317 11685 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O85388 protein_id gnl|my_center|LOCUS_2630 12733 12317 gene locus_tag LOCUS_2640 gene rplV 12733 12317 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYY4 protein_id gnl|my_center|LOCUS_2640 12999 12736 gene locus_tag LOCUS_2650 gene rpsS 12999 12736 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5X1 protein_id gnl|my_center|LOCUS_2650 13838 13002 gene locus_tag LOCUS_2660 gene rplB 13838 13002 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60401 protein_id gnl|my_center|LOCUS_2660 14146 13838 gene locus_tag LOCUS_2670 gene rplW 14146 13838 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q13 protein_id gnl|my_center|LOCUS_2670 14786 14139 gene locus_tag LOCUS_2680 gene rplD 14786 14139 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CRG1 protein_id gnl|my_center|LOCUS_2680 15405 14788 gene locus_tag LOCUS_2690 gene rplC 15405 14788 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG0 protein_id gnl|my_center|LOCUS_2690 16190 15582 gene locus_tag LOCUS_2700 16190 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2700 16516 16238 gene locus_tag LOCUS_2710 16516 16238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 16941 16618 gene locus_tag LOCUS_2720 gene rpsJ 16941 16618 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WS89 protein_id gnl|my_center|LOCUS_2720 17264 17070 gene locus_tag LOCUS_2730 17264 17070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2730 18597 17416 gene locus_tag LOCUS_2740 gene tufA 18597 17416 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8H4 protein_id gnl|my_center|LOCUS_2740 19437 18784 gene locus_tag LOCUS_2750 19437 18784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2750 21571 19484 gene locus_tag LOCUS_2760 gene fusA2 21571 19484 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_2760 21925 21596 gene locus_tag LOCUS_2770 21925 21596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2770 22406 21927 gene locus_tag LOCUS_2780 gene rpsG 22406 21927 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1C9 protein_id gnl|my_center|LOCUS_2780 22819 22409 gene locus_tag LOCUS_2790 gene rpsL 22819 22409 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH60 protein_id gnl|my_center|LOCUS_2790 26761 22952 gene locus_tag LOCUS_2800 gene rpoC 26761 22952 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH11 protein_id gnl|my_center|LOCUS_2800 <27543 26761 gene locus_tag LOCUS_2810 <27543 26761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8E239:DNA-directed RNA polymerase subunit beta >Feature sequence08 1046 504 gene locus_tag LOCUS_2820 1046 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2820 1786 1265 gene locus_tag LOCUS_2830 1786 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2830 2608 2144 gene locus_tag LOCUS_2840 2608 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 2741 2665 gene locus_tag LOCUS_t0110 2741 2665 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3703 2987 gene locus_tag LOCUS_2850 3703 2987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 protein_id gnl|my_center|LOCUS_2850 4492 3968 gene locus_tag LOCUS_2860 4492 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2860 5194 4514 gene locus_tag LOCUS_2870 5194 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2870 5616 5245 gene locus_tag LOCUS_2880 5616 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2880 6119 5661 gene locus_tag LOCUS_2890 6119 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2890 8228 6135 gene locus_tag LOCUS_2900 8228 6135 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256866.1 protein_id gnl|my_center|LOCUS_2900 8533 8228 gene locus_tag LOCUS_2910 8533 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2910 9215 8643 gene locus_tag LOCUS_2920 9215 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2920 11218 9353 gene locus_tag LOCUS_2930 11218 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 11517 12278 gene locus_tag LOCUS_2940 11517 12278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2940 14007 12661 gene locus_tag LOCUS_2950 14007 12661 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890728.1 protein_id gnl|my_center|LOCUS_2950 14764 13973 gene locus_tag LOCUS_2960 14764 13973 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258912.1 protein_id gnl|my_center|LOCUS_2960 15668 14757 gene locus_tag LOCUS_2970 15668 14757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626569.1 protein_id gnl|my_center|LOCUS_2970 16092 15670 gene locus_tag LOCUS_2980 16092 15670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2980 16229 18895 gene locus_tag LOCUS_2990 16229 18895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 18925 19362 gene locus_tag LOCUS_3000 18925 19362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3000 19371 19949 gene locus_tag LOCUS_3010 19371 19949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3010 19975 20259 gene locus_tag LOCUS_3020 19975 20259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3020 20663 20587 gene locus_tag LOCUS_t0120 20663 20587 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20842 21894 gene locus_tag LOCUS_3030 gene murB 20842 21894 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF8 protein_id gnl|my_center|LOCUS_3030 21910 22527 gene locus_tag LOCUS_3040 21910 22527 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_3040 22616 23122 gene locus_tag LOCUS_3050 22616 23122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3050 24428 23145 gene locus_tag LOCUS_3060 gene glyA 24428 23145 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89HS7 protein_id gnl|my_center|LOCUS_3060 24524 26038 gene locus_tag LOCUS_3070 24524 26038 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_3070 >Feature sequence09 231 1781 gene locus_tag LOCUS_3080 231 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3080 1817 1740 gene locus_tag LOCUS_t0130 1817 1740 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1929 2005 gene locus_tag LOCUS_t0140 1929 2005 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2006 2080 gene locus_tag LOCUS_t0150 2006 2080 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2349 2939 gene locus_tag LOCUS_3090 2349 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3090 3223 3657 gene locus_tag LOCUS_3100 3223 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3100 3651 4994 gene locus_tag LOCUS_3110 3651 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3110 4991 5596 gene locus_tag LOCUS_3120 4991 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3120 5580 6173 gene locus_tag LOCUS_3130 5580 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3130 6283 6651 gene locus_tag LOCUS_3140 6283 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3140 6648 8297 gene locus_tag LOCUS_3150 6648 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3150 8535 8317 gene locus_tag LOCUS_3160 8535 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3160 9572 8862 gene locus_tag LOCUS_3170 9572 8862 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023449.1 protein_id gnl|my_center|LOCUS_3170 9967 11037 gene locus_tag LOCUS_3180 gene tgt 9967 11037 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDR5 protein_id gnl|my_center|LOCUS_3180 11149 11793 gene locus_tag LOCUS_3190 11149 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3190 12178 11777 gene locus_tag LOCUS_3200 12178 11777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3200 12279 12355 gene locus_tag LOCUS_t0160 12279 12355 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12586 14445 gene locus_tag LOCUS_3210 gene thrS 12586 14445 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCU0 protein_id gnl|my_center|LOCUS_3210 14457 14783 gene locus_tag LOCUS_3220 14457 14783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3220 14773 15654 gene locus_tag LOCUS_3230 gene miaA 14773 15654 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y7I3 protein_id gnl|my_center|LOCUS_3230 15661 16086 gene locus_tag LOCUS_3240 15661 16086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3240 16119 16958 gene locus_tag LOCUS_3250 16119 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3250 16952 17677 gene locus_tag LOCUS_3260 16952 17677 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257489.1 protein_id gnl|my_center|LOCUS_3260 17740 18354 gene locus_tag LOCUS_3270 17740 18354 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870347.1 protein_id gnl|my_center|LOCUS_3270 18370 18996 gene locus_tag LOCUS_3280 18370 18996 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_3280 19280 19083 gene locus_tag LOCUS_3290 19280 19083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 19506 20444 gene locus_tag LOCUS_3300 19506 20444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3300 19520 19596 gene locus_tag LOCUS_t0170 19520 19596 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21223 20879 gene locus_tag LOCUS_3310 gene rplT 21223 20879 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBC9 protein_id gnl|my_center|LOCUS_3310 21441 21247 gene locus_tag LOCUS_3320 gene rpmI 21441 21247 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189N0 protein_id gnl|my_center|LOCUS_3320 21931 21428 gene locus_tag LOCUS_3330 gene infC 21931 21428 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_3330 <22649 22036 gene locus_tag LOCUS_3340 <22649 22036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081420.1:magnesium chelatase >Feature sequence10 2160 1285 gene locus_tag LOCUS_3350 2160 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3350 2274 3599 gene locus_tag LOCUS_3360 2274 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 4791 3580 gene locus_tag LOCUS_3370 4791 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3370 4849 5991 gene locus_tag LOCUS_3380 4849 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 6226 6032 gene locus_tag LOCUS_3390 6226 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3390 6345 8204 gene locus_tag LOCUS_3400 6345 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3400 8251 9498 gene locus_tag LOCUS_3410 gene lysA 8251 9498 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_3410 9523 9837 gene locus_tag LOCUS_3420 9523 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 9834 11096 gene locus_tag LOCUS_3430 gene umuC 9834 11096 CDS product umuC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940166.1 protein_id gnl|my_center|LOCUS_3430 11318 11392 gene locus_tag LOCUS_t0180 11318 11392 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11690 12139 gene locus_tag LOCUS_3440 11690 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3440 12448 13098 gene locus_tag LOCUS_3450 12448 13098 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783772.1 protein_id gnl|my_center|LOCUS_3450 13141 14052 gene locus_tag LOCUS_3460 13141 14052 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022202.1 protein_id gnl|my_center|LOCUS_3460 14618 14049 gene locus_tag LOCUS_3470 gene tag 14618 14049 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941230.1 protein_id gnl|my_center|LOCUS_3470 14854 15204 gene locus_tag LOCUS_3480 14854 15204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3480 15390 16058 gene locus_tag LOCUS_3490 15390 16058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3490 16792 16055 gene locus_tag LOCUS_3500 16792 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3500 16934 18373 gene locus_tag LOCUS_3510 16934 18373 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SME0 protein_id gnl|my_center|LOCUS_3510 18378 19586 gene locus_tag LOCUS_3520 gene pgk 18378 19586 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU1 protein_id gnl|my_center|LOCUS_3520 19624 20418 gene locus_tag LOCUS_3530 gene tpiA 19624 20418 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B7P5 protein_id gnl|my_center|LOCUS_3530 20415 21500 gene locus_tag LOCUS_3540 20415 21500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3540 >Feature sequence11 125 1564 gene locus_tag LOCUS_3550 125 1564 CDS product UDP-phosphate galactose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583255.1 protein_id gnl|my_center|LOCUS_3550 1564 2694 gene locus_tag LOCUS_3560 1564 2694 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_3560 2778 3206 gene locus_tag LOCUS_3570 2778 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3570 4819 3230 gene locus_tag LOCUS_3580 4819 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3580 6372 4870 gene locus_tag LOCUS_3590 6372 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3590 6739 7692 gene locus_tag LOCUS_3600 6739 7692 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_3600 9384 8170 gene locus_tag LOCUS_3610 9384 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 10136 9381 gene locus_tag LOCUS_3620 10136 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 11419 10334 gene locus_tag LOCUS_3630 11419 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 11516 12514 gene locus_tag LOCUS_3640 gene rfbB 11516 12514 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q832N1 protein_id gnl|my_center|LOCUS_3640 12514 13068 gene locus_tag LOCUS_3650 12514 13068 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877392.1 protein_id gnl|my_center|LOCUS_3650 13065 13925 gene locus_tag LOCUS_3660 13065 13925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3660 13922 14779 gene locus_tag LOCUS_3670 13922 14779 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NTH5 protein_id gnl|my_center|LOCUS_3670 14784 15593 gene locus_tag LOCUS_3680 14784 15593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3680 16524 15571 gene locus_tag LOCUS_3690 16524 15571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3690 17522 16521 gene locus_tag LOCUS_3700 17522 16521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3700 18606 17509 gene locus_tag LOCUS_3710 gene mnaA 18606 17509 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39131 protein_id gnl|my_center|LOCUS_3710 19574 18603 gene locus_tag LOCUS_3720 19574 18603 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_3720 >Feature sequence12 209 406 gene locus_tag LOCUS_3730 209 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3730 447 1010 gene locus_tag LOCUS_3740 gene efp 447 1010 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PHW3 protein_id gnl|my_center|LOCUS_3740 1014 1496 gene locus_tag LOCUS_3750 1014 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3750 1493 2209 gene locus_tag LOCUS_3760 1493 2209 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228016.1 protein_id gnl|my_center|LOCUS_3760 2212 3843 gene locus_tag LOCUS_3770 2212 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3770 4493 3846 gene locus_tag LOCUS_3780 4493 3846 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_3780 4639 5175 gene locus_tag LOCUS_3790 4639 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3790 6278 5178 gene locus_tag LOCUS_3800 gene ychF 6278 5178 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADE6 protein_id gnl|my_center|LOCUS_3800 6314 7132 gene locus_tag LOCUS_3810 6314 7132 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_3810 7342 7746 gene locus_tag LOCUS_3820 7342 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3820 7747 10065 gene locus_tag LOCUS_3830 7747 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3830 10127 11182 gene locus_tag LOCUS_3840 10127 11182 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_3840 11179 11865 gene locus_tag LOCUS_3850 11179 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3850 11865 12494 gene locus_tag LOCUS_3860 11865 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3860 12494 12736 gene locus_tag LOCUS_3870 12494 12736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3870 12751 14568 gene locus_tag LOCUS_3880 gene pilB 12751 14568 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_3880 14578 15645 gene locus_tag LOCUS_3890 gene pilT 14578 15645 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073221.1 protein_id gnl|my_center|LOCUS_3890 15652 16860 gene locus_tag LOCUS_3900 gene pilC 15652 16860 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_3900 16942 17451 gene locus_tag LOCUS_3910 16942 17451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3910 17510 18343 gene locus_tag LOCUS_3920 gene pilD 17510 18343 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2R3 protein_id gnl|my_center|LOCUS_3920 18386 19153 gene locus_tag LOCUS_3930 18386 19153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3930 19144 19686 gene locus_tag LOCUS_3940 19144 19686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3940 >Feature sequence13 554 210 gene locus_tag LOCUS_3950 554 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811508.1 protein_id gnl|my_center|LOCUS_3950 911 822 gene locus_tag LOCUS_t0190 911 822 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1419 973 gene locus_tag LOCUS_3960 1419 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3960 1755 2249 gene locus_tag LOCUS_3970 1755 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3970 2819 2400 gene locus_tag LOCUS_3980 2819 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3980 3348 2920 gene locus_tag LOCUS_3990 3348 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3990 3871 3425 gene locus_tag LOCUS_4000 3871 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4000 4328 3903 gene locus_tag LOCUS_4010 4328 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4010 4735 4325 gene locus_tag LOCUS_4020 4735 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4020 5099 4740 gene locus_tag LOCUS_4030 5099 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4030 5729 5127 gene locus_tag LOCUS_4040 5729 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4040 6019 8997 gene locus_tag LOCUS_4050 6019 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4050 8997 9803 gene locus_tag LOCUS_4060 8997 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4060 10292 11083 gene locus_tag LOCUS_4070 10292 11083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4070 11083 12996 gene locus_tag LOCUS_4080 11083 12996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4080 13018 16521 gene locus_tag LOCUS_4090 13018 16521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4090 16638 18374 gene locus_tag LOCUS_4100 16638 18374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4100 >Feature sequence14 1659 181 gene locus_tag LOCUS_4110 gene der 1659 181 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHH9 protein_id gnl|my_center|LOCUS_4110 2379 1675 gene locus_tag LOCUS_4120 2379 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4120 3101 2406 gene locus_tag LOCUS_4130 3101 2406 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_4130 3689 3108 gene locus_tag LOCUS_4140 3689 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4140 5428 3740 gene locus_tag LOCUS_4150 5428 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4150 5643 5717 gene locus_tag LOCUS_t0200 5643 5717 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7370 5895 gene locus_tag LOCUS_4160 7370 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447105.1 protein_id gnl|my_center|LOCUS_4160 7794 8027 gene locus_tag LOCUS_4170 7794 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4170 8032 8304 gene locus_tag LOCUS_4180 8032 8304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4180 9919 8342 gene locus_tag LOCUS_4190 9919 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4190 11558 9939 gene locus_tag LOCUS_4200 11558 9939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4200 12990 11548 gene locus_tag LOCUS_4210 12990 11548 CDS product restriction endonuclease EcoEI subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480516.1 protein_id gnl|my_center|LOCUS_4210 14012 12987 gene locus_tag LOCUS_4220 14012 12987 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_4220 16418 14013 gene locus_tag LOCUS_4230 gene hsdR 16418 14013 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819015.1 protein_id gnl|my_center|LOCUS_4230 17086 16442 gene locus_tag LOCUS_4240 17086 16442 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546157.1 protein_id gnl|my_center|LOCUS_4240 17656 17147 gene locus_tag LOCUS_4250 17656 17147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4250 >Feature sequence15 471 797 gene locus_tag LOCUS_4260 471 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4260 1363 794 gene locus_tag LOCUS_4270 1363 794 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392864.1 protein_id gnl|my_center|LOCUS_4270 1817 1392 gene locus_tag LOCUS_4280 1817 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4280 2310 1882 gene locus_tag LOCUS_4290 2310 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4290 2366 2608 gene locus_tag LOCUS_4300 2366 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4300 3102 2602 gene locus_tag LOCUS_4310 3102 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4310 3386 3126 gene locus_tag LOCUS_4320 3386 3126 CDS product NrdH-redoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080491.1 protein_id gnl|my_center|LOCUS_4320 3695 3402 gene locus_tag LOCUS_4330 3695 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4330 4425 3883 gene locus_tag LOCUS_4340 4425 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4340 5259 4951 gene locus_tag LOCUS_4350 5259 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4350 5715 5479 gene locus_tag LOCUS_4360 5715 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4360 5941 6792 gene locus_tag LOCUS_4370 5941 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 6837 7082 gene locus_tag LOCUS_4380 6837 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4380 7240 7788 gene locus_tag LOCUS_4390 7240 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4390 7785 8165 gene locus_tag LOCUS_4400 7785 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4400 8168 8380 gene locus_tag LOCUS_4410 8168 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4410 8377 9942 gene locus_tag LOCUS_4420 gene atpA 8377 9942 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GY2 protein_id gnl|my_center|LOCUS_4420 9958 10302 gene locus_tag LOCUS_4430 9958 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4430 10302 11168 gene locus_tag LOCUS_4440 gene atpG 10302 11168 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRA0 protein_id gnl|my_center|LOCUS_4440 11165 11533 gene locus_tag LOCUS_4450 11165 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4450 11530 11763 gene locus_tag LOCUS_4460 11530 11763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4460 11764 13155 gene locus_tag LOCUS_4470 gene atpD 11764 13155 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HY52 protein_id gnl|my_center|LOCUS_4470 13157 13579 gene locus_tag LOCUS_4480 13157 13579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4480 14508 13576 gene locus_tag LOCUS_4490 14508 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4490 15437 14538 gene locus_tag LOCUS_4500 gene dus2 15437 14538 CDS product putative tRNA-dihydrouridine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31546 protein_id gnl|my_center|LOCUS_4500 15968 15894 gene locus_tag LOCUS_t0210 15968 15894 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 <17767 16277 gene locus_tag LOCUS_4510 <17767 16277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012972514.1:DNA-dependent ATPase >Feature sequence16 672 1157 gene locus_tag LOCUS_4520 672 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4520 1242 1412 gene locus_tag LOCUS_4530 1242 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4530 1878 2120 gene locus_tag LOCUS_4540 1878 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4540 2398 3606 gene locus_tag LOCUS_4550 2398 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4550 3695 4954 gene locus_tag LOCUS_4560 gene treF 3695 4954 CDS product cytoplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z277 protein_id gnl|my_center|LOCUS_4560 5309 6766 gene locus_tag LOCUS_4570 gene metG 5309 6766 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67298 protein_id gnl|my_center|LOCUS_4570 7601 7071 gene locus_tag LOCUS_4580 7601 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4580 7672 8457 gene locus_tag LOCUS_4590 7672 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4590 8399 8749 gene locus_tag LOCUS_4600 8399 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4600 8739 9155 gene locus_tag LOCUS_4610 8739 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4610 9173 10333 gene locus_tag LOCUS_4620 gene iscS 9173 10333 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZS1 protein_id gnl|my_center|LOCUS_4620 10341 10907 gene locus_tag LOCUS_4630 10341 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4630 10904 11956 gene locus_tag LOCUS_4640 gene mnmA 10904 11956 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32EZ1 protein_id gnl|my_center|LOCUS_4640 12023 13231 gene locus_tag LOCUS_4650 gene gcd 12023 13231 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_4650 13628 13236 gene locus_tag LOCUS_4660 13628 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4660 14112 13909 gene locus_tag LOCUS_4670 14112 13909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4670 14380 16275 gene locus_tag LOCUS_4680 gene alaS 14380 16275 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61708 protein_id gnl|my_center|LOCUS_4680 16278 16691 gene locus_tag LOCUS_4690 16278 16691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4690 >Feature sequence17 1615 212 gene locus_tag LOCUS_4700 1615 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4700 1906 2340 gene locus_tag LOCUS_4710 1906 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4710 2625 3455 gene locus_tag LOCUS_4720 2625 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4720 4139 3570 gene locus_tag LOCUS_4730 4139 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4730 4962 4294 gene locus_tag LOCUS_4740 4962 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4740 5483 5094 gene locus_tag LOCUS_4750 5483 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4750 6057 5506 gene locus_tag LOCUS_4760 6057 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014412.1 protein_id gnl|my_center|LOCUS_4760 6650 6138 gene locus_tag LOCUS_4770 6650 6138 CDS product nucleoside-triphosphatase THEP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WXP3 protein_id gnl|my_center|LOCUS_4770 8109 6985 gene locus_tag LOCUS_4780 8109 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4780 9332 8109 gene locus_tag LOCUS_4790 9332 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_4790 9633 9325 gene locus_tag LOCUS_4800 9633 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4800 11759 9630 gene locus_tag LOCUS_4810 11759 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262810.1 protein_id gnl|my_center|LOCUS_4810 12121 11945 gene locus_tag LOCUS_4820 12121 11945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4820 12657 12118 gene locus_tag LOCUS_4830 12657 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4830 12856 13368 gene locus_tag LOCUS_4840 12856 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4840 13512 14048 gene locus_tag LOCUS_4850 13512 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4850 14197 15675 gene locus_tag LOCUS_4860 14197 15675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4860 15708 15634 gene locus_tag LOCUS_t0220 15708 15634 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 16245 15805 gene locus_tag LOCUS_4870 16245 15805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4870 16694 16245 gene locus_tag LOCUS_4880 16694 16245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 17265 16765 gene locus_tag LOCUS_4890 17265 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4890 >Feature sequence18 129 1433 gene locus_tag LOCUS_4900 gene nusA 129 1433 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGP4 protein_id gnl|my_center|LOCUS_4900 1483 4008 gene locus_tag LOCUS_4910 1483 4008 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810223.1 protein_id gnl|my_center|LOCUS_4910 4030 4986 gene locus_tag LOCUS_4920 4030 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4920 5007 6350 gene locus_tag LOCUS_4930 gene radA 5007 6350 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37572 protein_id gnl|my_center|LOCUS_4930 6368 7255 gene locus_tag LOCUS_4940 6368 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4940 9952 7262 gene locus_tag LOCUS_4950 9952 7262 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_4950 10022 11263 gene locus_tag LOCUS_4960 gene tyrS 10022 11263 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K7 protein_id gnl|my_center|LOCUS_4960 11660 11367 gene locus_tag LOCUS_4970 11660 11367 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI69 protein_id gnl|my_center|LOCUS_4970 12347 11889 gene locus_tag LOCUS_4980 12347 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4980 12458 14488 gene locus_tag LOCUS_4990 gene recG 12458 14488 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2R9 protein_id gnl|my_center|LOCUS_4990 14505 15035 gene locus_tag LOCUS_5000 14505 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705686.1 protein_id gnl|my_center|LOCUS_5000 15073 15876 gene locus_tag LOCUS_5010 15073 15876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5010 15873 16400 gene locus_tag LOCUS_5020 gene ywdG 15873 16400 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906349.1 protein_id gnl|my_center|LOCUS_5020 16587 16671 gene locus_tag LOCUS_t0230 16587 16671 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence19 3124 2282 gene locus_tag LOCUS_5030 3124 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5030 3204 3917 gene locus_tag LOCUS_5040 3204 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5040 3914 4489 gene locus_tag LOCUS_5050 3914 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5050 4494 4838 gene locus_tag LOCUS_5060 4494 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5060 5365 4835 gene locus_tag LOCUS_5070 5365 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5070 5423 5731 gene locus_tag LOCUS_5080 5423 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703236.1 protein_id gnl|my_center|LOCUS_5080 7047 5911 gene locus_tag LOCUS_5090 7047 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5090 7350 7276 gene locus_tag LOCUS_t0240 7350 7276 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7687 8055 gene locus_tag LOCUS_5100 7687 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5100 8185 9474 gene locus_tag LOCUS_5110 8185 9474 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674375.1 protein_id gnl|my_center|LOCUS_5110 9523 9819 gene locus_tag LOCUS_5120 9523 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5120 9864 10775 gene locus_tag LOCUS_5130 9864 10775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5130 11808 10759 gene locus_tag LOCUS_5140 gene queA 11808 10759 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ44 protein_id gnl|my_center|LOCUS_5140 12164 13324 gene locus_tag LOCUS_5150 12164 13324 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224220.1 protein_id gnl|my_center|LOCUS_5150 14184 13378 gene locus_tag LOCUS_5160 14184 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 14894 14184 gene locus_tag LOCUS_5170 14894 14184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5170 15020 15490 gene locus_tag LOCUS_5180 15020 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5180 15850 15452 gene locus_tag LOCUS_5190 15850 15452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5190 16563 15853 gene locus_tag LOCUS_5200 16563 15853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5200 >Feature sequence20 1078 1377 gene locus_tag LOCUS_5210 gene gatC 1078 1377 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHS7 protein_id gnl|my_center|LOCUS_5210 1380 2819 gene locus_tag LOCUS_5220 gene gatA 1380 2819 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK65 protein_id gnl|my_center|LOCUS_5220 2816 3211 gene locus_tag LOCUS_5230 2816 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5230 3208 4659 gene locus_tag LOCUS_5240 gene gatB 3208 4659 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2U6 protein_id gnl|my_center|LOCUS_5240 5426 4656 gene locus_tag LOCUS_5250 5426 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5250 5495 5764 gene locus_tag LOCUS_5260 5495 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5260 5764 6180 gene locus_tag LOCUS_5270 5764 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5270 6184 6414 gene locus_tag LOCUS_5280 6184 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5280 6404 6670 gene locus_tag LOCUS_5290 6404 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 7785 6700 gene locus_tag LOCUS_5300 gene recF 7785 6700 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DWQ8 protein_id gnl|my_center|LOCUS_5300 7836 11540 gene locus_tag LOCUS_5310 7836 11540 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB7 protein_id gnl|my_center|LOCUS_5310 12042 11533 gene locus_tag LOCUS_5320 12042 11533 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_5320 12090 13712 gene locus_tag LOCUS_5330 12090 13712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5330 14960 13806 gene locus_tag LOCUS_5340 14960 13806 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_5340 15077 15604 gene locus_tag LOCUS_5350 15077 15604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5350 >Feature sequence21 353 1426 gene locus_tag LOCUS_5360 353 1426 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259411.1 protein_id gnl|my_center|LOCUS_5360 1432 2130 gene locus_tag LOCUS_5370 1432 2130 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048030.1 protein_id gnl|my_center|LOCUS_5370 2284 3039 gene locus_tag LOCUS_5380 2284 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5380 3044 4300 gene locus_tag LOCUS_5390 gene proS 3044 4300 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KM8 protein_id gnl|my_center|LOCUS_5390 4494 4949 gene locus_tag LOCUS_5400 gene greA 4494 4949 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CHT2 protein_id gnl|my_center|LOCUS_5400 5118 6392 gene locus_tag LOCUS_5410 5118 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5410 6419 7930 gene locus_tag LOCUS_5420 gene lysS 6419 7930 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X231 protein_id gnl|my_center|LOCUS_5420 8161 8952 gene locus_tag LOCUS_5430 8161 8952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296133.1 protein_id gnl|my_center|LOCUS_5430 9031 9753 gene locus_tag LOCUS_5440 9031 9753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357457.1 protein_id gnl|my_center|LOCUS_5440 9750 11135 gene locus_tag LOCUS_5450 9750 11135 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357458.1 protein_id gnl|my_center|LOCUS_5450 11145 12188 gene locus_tag LOCUS_5460 11145 12188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5460 12339 13637 gene locus_tag LOCUS_5470 gene serS 12339 13637 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81JC4 protein_id gnl|my_center|LOCUS_5470 13762 14139 gene locus_tag LOCUS_5480 13762 14139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5480 14597 14977 gene locus_tag LOCUS_5490 14597 14977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5490 14977 15576 gene locus_tag LOCUS_5500 14977 15576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5500 >Feature sequence22 633 717 gene locus_tag LOCUS_t0250 633 717 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1554 769 gene locus_tag LOCUS_5510 1554 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 2120 1587 gene locus_tag LOCUS_5520 gene msrA 2120 1587 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3M7 protein_id gnl|my_center|LOCUS_5520 2940 2125 gene locus_tag LOCUS_5530 2940 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5530 3640 2915 gene locus_tag LOCUS_5540 3640 2915 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356878.1 protein_id gnl|my_center|LOCUS_5540 4113 3640 gene locus_tag LOCUS_5550 4113 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5550 4907 4110 gene locus_tag LOCUS_5560 4907 4110 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_5560 5718 5032 gene locus_tag LOCUS_5570 5718 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5570 7359 5788 gene locus_tag LOCUS_5580 7359 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5580 7582 8304 gene locus_tag LOCUS_5590 7582 8304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5590 8330 9034 gene locus_tag LOCUS_5600 gene pyrH 8330 9034 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGE1 protein_id gnl|my_center|LOCUS_5600 9725 9027 gene locus_tag LOCUS_5610 9725 9027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 10179 9718 gene locus_tag LOCUS_5620 gene smpB 10179 9718 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CEW2 protein_id gnl|my_center|LOCUS_5620 11104 10205 gene locus_tag LOCUS_5630 11104 10205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5630 12240 11101 gene locus_tag LOCUS_5640 12240 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5640 12312 13166 gene locus_tag LOCUS_5650 12312 13166 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068782.1 protein_id gnl|my_center|LOCUS_5650 13748 13167 gene locus_tag LOCUS_5660 13748 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5660 13904 15145 gene locus_tag LOCUS_5670 13904 15145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5670 >Feature sequence23 <1 1299 gene locus_tag LOCUS_5680 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E2J3:leucine--tRNA ligase 1327 2487 gene locus_tag LOCUS_5690 1327 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5690 2484 3149 gene locus_tag LOCUS_5700 2484 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5700 3710 3495 gene locus_tag LOCUS_5710 3710 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5710 3860 4018 gene locus_tag LOCUS_5720 3860 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5720 4128 4676 gene locus_tag LOCUS_5730 4128 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5730 4666 5160 gene locus_tag LOCUS_5740 4666 5160 CDS product diadenosine 5'5'''-P1,P4-tetraphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_5740 5259 5963 gene locus_tag LOCUS_5750 gene rnc 5259 5963 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3TY87 protein_id gnl|my_center|LOCUS_5750 6026 6751 gene locus_tag LOCUS_5760 6026 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5760 6837 7376 gene locus_tag LOCUS_5770 6837 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5770 7482 8000 gene locus_tag LOCUS_5780 7482 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5780 8270 8914 gene locus_tag LOCUS_5790 gene trmD 8270 8914 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FG3 protein_id gnl|my_center|LOCUS_5790 9057 9470 gene locus_tag LOCUS_5800 9057 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5800 11039 10506 gene locus_tag LOCUS_5810 11039 10506 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022393.1 protein_id gnl|my_center|LOCUS_5810 11892 11098 gene locus_tag LOCUS_5820 11892 11098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5820 12174 12974 gene locus_tag LOCUS_5830 12174 12974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5830 13007 14377 gene locus_tag LOCUS_5840 gene purF 13007 14377 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MAJ2 protein_id gnl|my_center|LOCUS_5840 14451 14594 gene locus_tag LOCUS_5850 14451 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 >Feature sequence24 1155 463 gene locus_tag LOCUS_5860 gene trmB 1155 463 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P45 protein_id gnl|my_center|LOCUS_5860 1540 1157 gene locus_tag LOCUS_5870 1540 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5870 2033 1533 gene locus_tag LOCUS_5880 2033 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5880 2876 2100 gene locus_tag LOCUS_5890 2876 2100 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_5890 4679 2970 gene locus_tag LOCUS_5900 4679 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5900 6222 4672 gene locus_tag LOCUS_5910 6222 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804657.1 protein_id gnl|my_center|LOCUS_5910 7229 6306 gene locus_tag LOCUS_5920 gene pyrB 7229 6306 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP66 protein_id gnl|my_center|LOCUS_5920 7721 7266 gene locus_tag LOCUS_5930 7721 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_5930 9279 7867 gene locus_tag LOCUS_5940 9279 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5940 11033 9288 gene locus_tag LOCUS_5950 gene aspS 11033 9288 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCT7 protein_id gnl|my_center|LOCUS_5950 11244 11876 gene locus_tag LOCUS_5960 gene adk 11244 11876 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE38 protein_id gnl|my_center|LOCUS_5960 12739 11873 gene locus_tag LOCUS_5970 12739 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 >Feature sequence25 413 1333 gene locus_tag LOCUS_5980 gene fmt 413 1333 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_5980 2020 1415 gene locus_tag LOCUS_5990 2020 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5990 3821 2055 gene locus_tag LOCUS_6000 3821 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 4919 3861 gene locus_tag LOCUS_6010 4919 3861 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_6010 5466 5020 gene locus_tag LOCUS_6020 5466 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6020 5572 6387 gene locus_tag LOCUS_6030 5572 6387 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058188.1 protein_id gnl|my_center|LOCUS_6030 6365 6832 gene locus_tag LOCUS_6040 6365 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6040 7111 6887 gene locus_tag LOCUS_6050 7111 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6050 12680 7449 gene locus_tag LOCUS_6060 12680 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6060 10795 11126 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acgttccagttgttgaggggttggttgaa 12965 12890 gene locus_tag LOCUS_r0010 12965 12890 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 63 percent of the 5S ribosomal RNA >Feature sequence26 <1 1218 gene locus_tag LOCUS_6070 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJJ4:ribonuclease Y 1294 2226 gene locus_tag LOCUS_6080 1294 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6080 2467 2279 gene locus_tag LOCUS_6090 2467 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6090 4085 2490 gene locus_tag LOCUS_6100 4085 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6100 4507 4583 gene locus_tag LOCUS_t0260 4507 4583 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5117 7546 gene locus_tag LOCUS_6110 5117 7546 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836945.1 protein_id gnl|my_center|LOCUS_6110 7814 7738 gene locus_tag LOCUS_t0270 7814 7738 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7901 7827 gene locus_tag LOCUS_t0280 7901 7827 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8362 7958 gene locus_tag LOCUS_6120 8362 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6120 8427 9077 gene locus_tag LOCUS_6130 8427 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6130 9121 9705 gene locus_tag LOCUS_6140 9121 9705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 9826 11619 gene locus_tag LOCUS_6150 9826 11619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6150 >Feature sequence27 950 336 gene locus_tag LOCUS_6160 950 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6160 1707 961 gene locus_tag LOCUS_6170 gene pyrF 1707 961 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDI3 protein_id gnl|my_center|LOCUS_6170 1749 2819 gene locus_tag LOCUS_6180 gene pyr 1749 2819 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389462.1 protein_id gnl|my_center|LOCUS_6180 3888 2830 gene locus_tag LOCUS_6190 3888 2830 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868871.1 protein_id gnl|my_center|LOCUS_6190 5191 4043 gene locus_tag LOCUS_6200 gene dapD 5191 4043 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X9V6 protein_id gnl|my_center|LOCUS_6200 7489 5396 gene locus_tag LOCUS_6210 7489 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6210 7786 8898 gene locus_tag LOCUS_6220 7786 8898 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891590.1 protein_id gnl|my_center|LOCUS_6220 10302 8899 gene locus_tag LOCUS_6230 gene cysS 10302 8899 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E391 protein_id gnl|my_center|LOCUS_6230 11476 10313 gene locus_tag LOCUS_6240 11476 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6240 11781 11473 gene locus_tag LOCUS_6250 11781 11473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6250 >Feature sequence28 931 389 gene locus_tag LOCUS_6260 931 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6260 3060 937 gene locus_tag LOCUS_6270 gene pnp 3060 937 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CST1 protein_id gnl|my_center|LOCUS_6270 3523 3257 gene locus_tag LOCUS_6280 gene rpsO 3523 3257 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2S4 protein_id gnl|my_center|LOCUS_6280 4153 3647 gene locus_tag LOCUS_6290 4153 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6290 4220 5956 gene locus_tag LOCUS_6300 4220 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6300 7700 6042 gene locus_tag LOCUS_6310 7700 6042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150916.1 protein_id gnl|my_center|LOCUS_6310 9189 7825 gene locus_tag LOCUS_6320 9189 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6320 9924 9238 gene locus_tag LOCUS_6330 gene truB 9924 9238 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L8 protein_id gnl|my_center|LOCUS_6330 11661 9940 gene locus_tag LOCUS_6340 11661 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6340 >Feature sequence29 1292 2068 gene locus_tag LOCUS_6350 1292 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6350 2025 2693 gene locus_tag LOCUS_6360 2025 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6360 2771 2986 gene locus_tag LOCUS_6370 2771 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6370 3143 4642 gene locus_tag LOCUS_6380 3143 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6380 4713 5489 gene locus_tag LOCUS_6390 4713 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6390 5492 6601 gene locus_tag LOCUS_6400 5492 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6400 6659 7102 gene locus_tag LOCUS_6410 6659 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6410 7226 7151 gene locus_tag LOCUS_t0290 7226 7151 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7372 7848 gene locus_tag LOCUS_6420 7372 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6420 7917 7991 gene locus_tag LOCUS_t0300 7917 7991 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8867 8046 gene locus_tag LOCUS_6430 8867 8046 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068192.1 protein_id gnl|my_center|LOCUS_6430 9032 10213 gene locus_tag LOCUS_6440 9032 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6440 10268 10525 gene locus_tag LOCUS_6450 10268 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6450 >Feature sequence30 889 89 gene locus_tag LOCUS_6460 889 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6460 1434 865 gene locus_tag LOCUS_6470 1434 865 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762369.1 protein_id gnl|my_center|LOCUS_6470 1970 1431 gene locus_tag LOCUS_6480 1970 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6480 5225 2565 gene locus_tag LOCUS_6490 gene polA 5225 2565 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCU4 protein_id gnl|my_center|LOCUS_6490 5844 5263 gene locus_tag LOCUS_6500 5844 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6500 6988 5828 gene locus_tag LOCUS_6510 6988 5828 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_6510 8730 6994 gene locus_tag LOCUS_6520 8730 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6520 8832 9410 gene locus_tag LOCUS_6530 8832 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6530 9780 9412 gene locus_tag LOCUS_6540 9780 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706385.1 protein_id gnl|my_center|LOCUS_6540 10386 9826 gene locus_tag LOCUS_6550 gene orn 10386 9826 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NI61 protein_id gnl|my_center|LOCUS_6550 10744 10361 gene locus_tag LOCUS_6560 10744 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6560 >Feature sequence31 2140 206 gene locus_tag LOCUS_6570 2140 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6570 2173 2826 gene locus_tag LOCUS_6580 2173 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6580 2877 3152 gene locus_tag LOCUS_6590 2877 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6590 3186 3410 gene locus_tag LOCUS_6600 3186 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6600 3410 3862 gene locus_tag LOCUS_6610 gene gatB2 3410 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319218.1 protein_id gnl|my_center|LOCUS_6610 3872 4426 gene locus_tag LOCUS_6620 gene adk 3872 4426 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33007 protein_id gnl|my_center|LOCUS_6620 4431 5180 gene locus_tag LOCUS_6630 gene map 4431 5180 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1I7 protein_id gnl|my_center|LOCUS_6630 5237 6484 gene locus_tag LOCUS_6640 gene ftsA 5237 6484 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8E6 protein_id gnl|my_center|LOCUS_6640 6623 7888 gene locus_tag LOCUS_6650 gene ftsZ 6623 7888 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK72 protein_id gnl|my_center|LOCUS_6650 7993 8454 gene locus_tag LOCUS_6660 gene nrdR 7993 8454 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45549 protein_id gnl|my_center|LOCUS_6660 >Feature sequence32 <1 997 gene locus_tag LOCUS_6670 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RZP4:phospho-2-dehydro-3-deoxyheptonate aldolase 1000 2067 gene locus_tag LOCUS_6680 1000 2067 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259168.1 protein_id gnl|my_center|LOCUS_6680 2244 2468 gene locus_tag LOCUS_6690 2244 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6690 2524 2931 gene locus_tag LOCUS_6700 2524 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6700 2924 3952 gene locus_tag LOCUS_6710 gene trpS 2924 3952 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43835 protein_id gnl|my_center|LOCUS_6710 3955 4725 gene locus_tag LOCUS_6720 3955 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6720 4730 5605 gene locus_tag LOCUS_6730 4730 5605 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYT3 protein_id gnl|my_center|LOCUS_6730 5602 6435 gene locus_tag LOCUS_6740 5602 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6740 6469 7128 gene locus_tag LOCUS_6750 6469 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6750 7299 7214 gene locus_tag LOCUS_t0310 7299 7214 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 7500 7424 gene locus_tag LOCUS_t0320 7500 7424 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7609 8295 gene locus_tag LOCUS_6760 7609 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6760 8402 8476 gene locus_tag LOCUS_t0330 8402 8476 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8750 9667 gene locus_tag LOCUS_6770 8750 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6770 9753 10442 gene locus_tag LOCUS_6780 9753 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6780 >Feature sequence33 920 279 gene locus_tag LOCUS_6790 920 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6790 2158 917 gene locus_tag LOCUS_6800 2158 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6800 3116 2151 gene locus_tag LOCUS_6810 3116 2151 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762863.1 protein_id gnl|my_center|LOCUS_6810 4030 3119 gene locus_tag LOCUS_6820 4030 3119 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_6820 5024 4041 gene locus_tag LOCUS_6830 5024 4041 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932485.1 protein_id gnl|my_center|LOCUS_6830 5880 5017 gene locus_tag LOCUS_6840 5880 5017 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462198.1 protein_id gnl|my_center|LOCUS_6840 6577 5942 gene locus_tag LOCUS_6850 gene rpe 6577 5942 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_6850 6632 8086 gene locus_tag LOCUS_6860 6632 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6860 8532 8083 gene locus_tag LOCUS_6870 8532 8083 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141687.1 protein_id gnl|my_center|LOCUS_6870 9579 8554 gene locus_tag LOCUS_6880 9579 8554 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2J2 protein_id gnl|my_center|LOCUS_6880 10247 9672 gene locus_tag LOCUS_6890 10247 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6890 >Feature sequence34 1356 259 gene locus_tag LOCUS_6900 1356 259 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIW8 protein_id gnl|my_center|LOCUS_6900 2958 1624 gene locus_tag LOCUS_6910 gene dnaA 2958 1624 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05648 protein_id gnl|my_center|LOCUS_6910 3371 3718 gene locus_tag LOCUS_6920 3371 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6920 3754 4776 gene locus_tag LOCUS_6930 3754 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6930 4776 5249 gene locus_tag LOCUS_6940 4776 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6940 5324 5902 gene locus_tag LOCUS_6950 5324 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6950 6210 8618 gene locus_tag LOCUS_6960 6210 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6960 8694 8954 gene locus_tag LOCUS_6970 8694 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6970 8944 9345 gene locus_tag LOCUS_6980 8944 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6980 >Feature sequence35 3336 2041 gene locus_tag LOCUS_6990 3336 2041 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871000.1 protein_id gnl|my_center|LOCUS_6990 4249 3326 gene locus_tag LOCUS_7000 gene ddl 4249 3326 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46805 protein_id gnl|my_center|LOCUS_7000 5516 4242 gene locus_tag LOCUS_7010 gene murF 5516 4242 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFT9 protein_id gnl|my_center|LOCUS_7010 5607 5531 gene locus_tag LOCUS_t0340 5607 5531 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5714 6097 gene locus_tag LOCUS_7020 5714 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7020 6670 6104 gene locus_tag LOCUS_7030 gene nadD 6670 6104 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I72 protein_id gnl|my_center|LOCUS_7030 6731 8656 gene locus_tag LOCUS_7040 gene nadE 6731 8656 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948279.1 protein_id gnl|my_center|LOCUS_7040 >Feature sequence36 1505 690 gene locus_tag LOCUS_7050 1505 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7050 2207 1515 gene locus_tag LOCUS_7060 2207 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 protein_id gnl|my_center|LOCUS_7060 3283 2204 gene locus_tag LOCUS_7070 3283 2204 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202147.1 protein_id gnl|my_center|LOCUS_7070 4458 3280 gene locus_tag LOCUS_7080 gene rgpD 4458 3280 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837183.1 protein_id gnl|my_center|LOCUS_7080 5074 5265 gene locus_tag LOCUS_7090 5074 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7090 5294 6316 gene locus_tag LOCUS_7100 5294 6316 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877828.1 protein_id gnl|my_center|LOCUS_7100 6402 6638 gene locus_tag LOCUS_7110 6402 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7110 6620 6952 gene locus_tag LOCUS_7120 6620 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7120 6949 8055 gene locus_tag LOCUS_7130 6949 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7130 8280 8702 gene locus_tag LOCUS_7140 8280 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7140 >Feature sequence37 389 793 gene locus_tag LOCUS_7150 389 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7150 858 1508 gene locus_tag LOCUS_7160 858 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7160 1666 2349 gene locus_tag LOCUS_7170 1666 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7170 2444 2854 gene locus_tag LOCUS_7180 2444 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7180 2890 3330 gene locus_tag LOCUS_7190 2890 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7190 3444 4064 gene locus_tag LOCUS_7200 3444 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7200 4133 4399 gene locus_tag LOCUS_7210 4133 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7210 5287 4436 gene locus_tag LOCUS_7220 gene ubiA 5287 4436 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804089.1 protein_id gnl|my_center|LOCUS_7220 5576 5280 gene locus_tag LOCUS_7230 5576 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7230 7413 5872 gene locus_tag LOCUS_7240 7413 5872 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804092.1 protein_id gnl|my_center|LOCUS_7240 8255 7410 gene locus_tag LOCUS_7250 gene crtB 8255 7410 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_7250 <8995 8264 gene locus_tag LOCUS_7260 <8995 8264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804096.1:geranylgeranyl pyrophosphate synthase >Feature sequence38 194 652 gene locus_tag LOCUS_7270 194 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7270 649 1188 gene locus_tag LOCUS_7280 649 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080450.1 protein_id gnl|my_center|LOCUS_7280 1185 2489 gene locus_tag LOCUS_7290 gene hisS 1185 2489 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9Y3 protein_id gnl|my_center|LOCUS_7290 2473 2784 gene locus_tag LOCUS_7300 2473 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7300 2831 4111 gene locus_tag LOCUS_7310 gene tig 2831 4111 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HD53 protein_id gnl|my_center|LOCUS_7310 4092 4388 gene locus_tag LOCUS_7320 4092 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7320 4422 5006 gene locus_tag LOCUS_7330 gene clpP 4422 5006 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXI7 protein_id gnl|my_center|LOCUS_7330 5010 5657 gene locus_tag LOCUS_7340 5010 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7340 >Feature sequence39 820 1908 gene locus_tag LOCUS_7350 820 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7350 2860 2033 gene locus_tag LOCUS_7360 2860 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7360 3073 4428 gene locus_tag LOCUS_7370 3073 4428 CDS product ferric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_7370 4833 4432 gene locus_tag LOCUS_7380 4833 4432 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812063.1 protein_id gnl|my_center|LOCUS_7380 4938 5756 gene locus_tag LOCUS_7390 4938 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7390 7057 5747 gene locus_tag LOCUS_7400 7057 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 protein_id gnl|my_center|LOCUS_7400 7582 7082 gene locus_tag LOCUS_7410 7582 7082 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR4 protein_id gnl|my_center|LOCUS_7410 >Feature sequence40 1317 1538 gene locus_tag LOCUS_7420 1317 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7420 2613 1570 gene locus_tag LOCUS_7430 2613 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7430 3136 2591 gene locus_tag LOCUS_7440 3136 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7440 3724 3314 gene locus_tag LOCUS_7450 3724 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7450 4266 3826 gene locus_tag LOCUS_7460 4266 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7460 4367 4291 gene locus_tag LOCUS_t0350 4367 4291 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4936 4409 gene locus_tag LOCUS_7470 gene ndk 4936 4409 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51419 protein_id gnl|my_center|LOCUS_7470 5173 6099 gene locus_tag LOCUS_7480 gene xerD 5173 6099 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46352 protein_id gnl|my_center|LOCUS_7480 7186 6104 gene locus_tag LOCUS_7490 7186 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7490 7797 7183 gene locus_tag LOCUS_7500 7797 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7500 >Feature sequence41 556 840 gene locus_tag LOCUS_7510 556 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7510 2017 854 gene locus_tag LOCUS_7520 2017 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_7520 2767 2039 gene locus_tag LOCUS_7530 gene spoU 2767 2039 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229887.1 protein_id gnl|my_center|LOCUS_7530 4158 2764 gene locus_tag LOCUS_7540 gene gltX 4158 2764 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DVX9 protein_id gnl|my_center|LOCUS_7540 5396 4239 gene locus_tag LOCUS_7550 5396 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7550 5426 6922 gene locus_tag LOCUS_7560 5426 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7560 <7628 6908 gene locus_tag LOCUS_7570 <7628 6908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000828081.1:class C sortase >Feature sequence42 352 47 gene locus_tag LOCUS_7580 gene rplU 352 47 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS68 protein_id gnl|my_center|LOCUS_7580 830 438 gene locus_tag LOCUS_7590 830 438 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052767.1 protein_id gnl|my_center|LOCUS_7590 2172 853 gene locus_tag LOCUS_7600 2172 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7600 5044 2186 gene locus_tag LOCUS_7610 gene ileS 5044 2186 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73JB2 protein_id gnl|my_center|LOCUS_7610 5783 5034 gene locus_tag LOCUS_7620 5783 5034 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967932.1 protein_id gnl|my_center|LOCUS_7620 6632 6159 gene locus_tag LOCUS_7630 6632 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7630 6892 6629 gene locus_tag LOCUS_7640 6892 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7640 >Feature sequence43 3712 2435 gene locus_tag LOCUS_7650 3712 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7650 5043 3826 gene locus_tag LOCUS_7660 5043 3826 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_7660 5779 5036 gene locus_tag LOCUS_7670 5779 5036 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_7670 5967 5806 gene locus_tag LOCUS_7680 5967 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7680 >Feature sequence44 132 1844 gene locus_tag LOCUS_7690 132 1844 CDS product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_7690 3229 1874 gene locus_tag LOCUS_7700 3229 1874 CDS product sodium:glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056889.1 protein_id gnl|my_center|LOCUS_7700 3990 3382 gene locus_tag LOCUS_7710 gene nadD 3990 3382 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57090 protein_id gnl|my_center|LOCUS_7710 5465 3987 gene locus_tag LOCUS_7720 5465 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7720 5829 6173 gene locus_tag LOCUS_7730 5829 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7730 >Feature sequence45 <1 1696 gene locus_tag LOCUS_7740 <1 1696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D3H9A2:UvrABC system protein B 1729 2007 gene locus_tag LOCUS_7750 1729 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7750 2745 2065 gene locus_tag LOCUS_7760 2745 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7760 2959 3855 gene locus_tag LOCUS_7770 2959 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7770 3919 4266 gene locus_tag LOCUS_7780 3919 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7780 4383 4697 gene locus_tag LOCUS_7790 4383 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7790 5541 4906 gene locus_tag LOCUS_7800 5541 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7800 5714 6022 gene locus_tag LOCUS_7810 5714 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7810 >Feature sequence46 1170 1853 gene locus_tag LOCUS_7820 1170 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7820 3115 1850 gene locus_tag LOCUS_7830 3115 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7830 4296 3187 gene locus_tag LOCUS_7840 4296 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7840 6020 4338 gene locus_tag LOCUS_7850 6020 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7850 >Feature sequence47 252 1019 gene locus_tag LOCUS_7860 gene rsmA 252 1019 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH36 protein_id gnl|my_center|LOCUS_7860 1347 1901 gene locus_tag LOCUS_7870 1347 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7870 2608 2081 gene locus_tag LOCUS_7880 2608 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7880 3093 2896 gene locus_tag LOCUS_7890 3093 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7890 3266 3799 gene locus_tag LOCUS_7900 gene grpB 3266 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957538.1 protein_id gnl|my_center|LOCUS_7900 3998 4594 gene locus_tag LOCUS_7910 3998 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7910 4741 5076 gene locus_tag LOCUS_7920 4741 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7920 5146 5589 gene locus_tag LOCUS_7930 5146 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7930 >Feature sequence48 928 134 gene locus_tag LOCUS_7940 928 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7940 1764 3707 gene locus_tag LOCUS_7950 1764 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7950 3763 4038 gene locus_tag LOCUS_7960 3763 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7960 4113 4436 gene locus_tag LOCUS_7970 4113 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7970 4459 4896 gene locus_tag LOCUS_7980 gene msrB 4459 4896 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066093.1 protein_id gnl|my_center|LOCUS_7980 >Feature sequence49 289 840 gene locus_tag LOCUS_7990 289 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7990 837 3215 gene locus_tag LOCUS_8000 837 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8000 4377 4733 gene locus_tag LOCUS_8010 4377 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8010 <5664 4730 gene locus_tag LOCUS_8020 <5664 4730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975508.1:UDP-N-acetyl-D-glucosamine dehydrogenase >Feature sequence50 78 833 gene locus_tag LOCUS_8030 gene soj 78 833 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_8030 826 1686 gene locus_tag LOCUS_8040 gene spo0J 826 1686 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048450.1 protein_id gnl|my_center|LOCUS_8040 2415 1702 gene locus_tag LOCUS_8050 gene sipf 2415 1702 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJK6 protein_id gnl|my_center|LOCUS_8050 2537 4126 gene locus_tag LOCUS_8060 2537 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8060 4148 4921 gene locus_tag LOCUS_8070 4148 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8070 >Feature sequence51 590 1009 gene locus_tag LOCUS_8080 590 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8080 1906 1160 gene locus_tag LOCUS_8090 1906 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8090 2574 1903 gene locus_tag LOCUS_8100 2574 1903 CDS product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058341.1 protein_id gnl|my_center|LOCUS_8100 3869 2583 gene locus_tag LOCUS_8110 3869 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8110 3901 4713 gene locus_tag LOCUS_8120 3901 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8120 >Feature sequence52 303 1364 gene locus_tag LOCUS_8130 303 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8130 1361 3379 gene locus_tag LOCUS_8140 gene ligA 1361 3379 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q837V6 protein_id gnl|my_center|LOCUS_8140 4368 3376 gene locus_tag LOCUS_8150 4368 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8150 4705 4352 gene locus_tag LOCUS_8160 4705 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8160 5121 4672 gene locus_tag LOCUS_8170 5121 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8170 >Feature sequence53 <1 640 gene locus_tag LOCUS_8180 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259235.1:peptidase S8 630 1121 gene locus_tag LOCUS_8190 630 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8190 1171 3393 gene locus_tag LOCUS_8200 gene ftsK 1171 3393 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388321.1 protein_id gnl|my_center|LOCUS_8200 3434 4507 gene locus_tag LOCUS_8210 gene aroC 3434 4507 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_8210 4630 4983 gene locus_tag LOCUS_8220 gene rpsF 4630 4983 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK69 protein_id gnl|my_center|LOCUS_8220 >Feature sequence54 <1 571 gene locus_tag LOCUS_8230 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002439040.1:NADH dehydrogenase 1070 663 gene locus_tag LOCUS_8240 1070 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8240 1611 1132 gene locus_tag LOCUS_8250 1611 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8250 3489 1663 gene locus_tag LOCUS_8260 gene bipA 3489 1663 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_8260 3631 4803 gene locus_tag LOCUS_8270 gene rarA 3631 4803 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_8270 4996 4787 gene locus_tag LOCUS_8280 4996 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8280 >Feature sequence55 2024 885 gene locus_tag LOCUS_8290 gene murG1 2024 885 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q812W5 protein_id gnl|my_center|LOCUS_8290 3219 1972 gene locus_tag LOCUS_8300 3219 1972 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_8300 4265 3216 gene locus_tag LOCUS_8310 gene mraY 4265 3216 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG76 protein_id gnl|my_center|LOCUS_8310 <4862 4273 gene locus_tag LOCUS_8320 <4862 4273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943700.1:penicillin-binding protein >Feature sequence56 1775 2854 gene locus_tag LOCUS_8330 1775 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8330 2903 3733 gene locus_tag LOCUS_8340 2903 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8340 >Feature sequence57 738 178 gene locus_tag LOCUS_8350 738 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8350 2615 837 gene locus_tag LOCUS_8360 2615 837 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015020.1 protein_id gnl|my_center|LOCUS_8360 <4550 2619 gene locus_tag LOCUS_8370 <4550 2619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q189P6:phenylalanine--tRNA ligase beta subunit >Feature sequence58 132 683 gene locus_tag LOCUS_8380 132 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8380 693 1958 gene locus_tag LOCUS_8390 693 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_8390 2097 2816 gene locus_tag LOCUS_8400 gene rpsB 2097 2816 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73K75 protein_id gnl|my_center|LOCUS_8400 2833 3429 gene locus_tag LOCUS_8410 gene tsf 2833 3429 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61333 protein_id gnl|my_center|LOCUS_8410 3476 4027 gene locus_tag LOCUS_8420 gene frr 3476 4027 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P81101 protein_id gnl|my_center|LOCUS_8420 >Feature sequence59 172 1827 gene locus_tag LOCUS_8430 gene pif1 172 1827 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073697.1 protein_id gnl|my_center|LOCUS_8430 1842 3113 gene locus_tag LOCUS_8440 1842 3113 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_8440 3113 4099 gene locus_tag LOCUS_8450 3113 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8450 >Feature sequence60 879 1382 gene locus_tag LOCUS_8460 879 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8460 1831 1391 gene locus_tag LOCUS_8470 gene rplK 1831 1391 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A463 protein_id gnl|my_center|LOCUS_8470 2225 1962 gene locus_tag LOCUS_8480 2225 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8480 2880 2332 gene locus_tag LOCUS_8490 2880 2332 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810198.1 protein_id gnl|my_center|LOCUS_8490 3149 2880 gene locus_tag LOCUS_8500 3149 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8500 <4361 3205 gene locus_tag LOCUS_8510 <4361 3205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P35164:sensor histidine kinase ResE >Feature sequence61 2088 391 gene locus_tag LOCUS_8520 gene argS 2088 391 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RG14 protein_id gnl|my_center|LOCUS_8520 2312 2085 gene locus_tag LOCUS_8530 2312 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8530 2536 2309 gene locus_tag LOCUS_8540 2536 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8540 2633 2466 gene locus_tag LOCUS_8550 2633 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8550 2784 2692 gene locus_tag LOCUS_t0360 2784 2692 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2848 3621 gene locus_tag LOCUS_8560 2848 3621 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIN3 protein_id gnl|my_center|LOCUS_8560 >Feature sequence62 199 801 gene locus_tag LOCUS_8570 199 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8570 1472 804 gene locus_tag LOCUS_8580 1472 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8580 1883 1476 gene locus_tag LOCUS_8590 1883 1476 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912062.1 protein_id gnl|my_center|LOCUS_8590 2638 1883 gene locus_tag LOCUS_8600 2638 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_8600 3411 2635 gene locus_tag LOCUS_8610 3411 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8610 >Feature sequence63 356 1414 gene locus_tag LOCUS_8620 gene prfA 356 1414 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9V1 protein_id gnl|my_center|LOCUS_8620 1414 1929 gene locus_tag LOCUS_8630 1414 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8630 1926 2702 gene locus_tag LOCUS_8640 1926 2702 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_8640 2719 3540 gene locus_tag LOCUS_8650 2719 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8650 >Feature sequence64 1912 2922 gene locus_tag LOCUS_8660 1912 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8660 3268 3041 gene locus_tag LOCUS_8670 gene chaB 3268 3041 CDS product cation transport regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367102.1 protein_id gnl|my_center|LOCUS_8670 <3891 3293 gene locus_tag LOCUS_8680 <3891 3293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036279.1:NAD(P)-dependent oxidoreductase >Feature sequence65 957 127 gene locus_tag LOCUS_8690 957 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8690 1905 1030 gene locus_tag LOCUS_8700 gene mutM 1905 1030 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A131 protein_id gnl|my_center|LOCUS_8700 2172 1918 gene locus_tag LOCUS_8710 2172 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8710 2888 2322 gene locus_tag LOCUS_8720 2888 2322 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_8720 3319 2885 gene locus_tag LOCUS_8730 gene dut 3319 2885 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDD2 protein_id gnl|my_center|LOCUS_8730 >Feature sequence66 103 705 gene locus_tag LOCUS_8740 103 705 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684133.1 protein_id gnl|my_center|LOCUS_8740 901 1614 gene locus_tag LOCUS_8750 901 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8750 1661 2677 gene locus_tag LOCUS_8760 gene pheS 1661 2677 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYR3 protein_id gnl|my_center|LOCUS_8760 2677 3138 gene locus_tag LOCUS_8770 2677 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8770 >Feature sequence67 984 631 gene locus_tag LOCUS_8780 984 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8780 1984 1136 gene locus_tag LOCUS_8790 gene rsmH 1984 1136 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG80 protein_id gnl|my_center|LOCUS_8790 2757 2332 gene locus_tag LOCUS_8800 gene mraZ 2757 2332 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG81 protein_id gnl|my_center|LOCUS_8800 3683 2883 gene locus_tag LOCUS_8810 gene galU 3683 2883 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGS4 protein_id gnl|my_center|LOCUS_8810 >Feature sequence68 328 239 gene locus_tag LOCUS_t0370 328 239 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 395 1315 gene locus_tag LOCUS_8820 395 1315 CDS product magnesium transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939854.1 protein_id gnl|my_center|LOCUS_8820 1903 1529 gene locus_tag LOCUS_8830 1903 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8830 2196 2450 gene locus_tag LOCUS_8840 2196 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8840 2638 2562 gene locus_tag LOCUS_t0380 2638 2562 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3399 2827 gene locus_tag LOCUS_8850 3399 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8850 >Feature sequence69 <1 1048 gene locus_tag LOCUS_8860 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5FKT4:ribonuclease J 1252 1680 gene locus_tag LOCUS_8870 1252 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8870 >Feature sequence70 820 488 gene locus_tag LOCUS_8880 820 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8880 948 861 gene locus_tag LOCUS_t0390 948 861 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1027 954 gene locus_tag LOCUS_t0400 1027 954 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1282 1067 gene locus_tag LOCUS_8890 1282 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8890 2292 1360 gene locus_tag LOCUS_8900 2292 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8900 2919 2353 gene locus_tag LOCUS_8910 gene udk 2919 2353 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363049.1 protein_id gnl|my_center|LOCUS_8910 >Feature sequence71 1141 1704 gene locus_tag LOCUS_8920 1141 1704 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_8920 1731 2603 gene locus_tag LOCUS_8930 gene htpX 1731 2603 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DPH5 protein_id gnl|my_center|LOCUS_8930 >Feature sequence72 2310 1576 gene locus_tag LOCUS_8940 2310 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8940 >Feature sequence73 <1 784 gene locus_tag LOCUS_8950 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393182.1:(p)ppGpp synthetase 1311 790 gene locus_tag LOCUS_8960 gene ppa 1311 790 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0G4 protein_id gnl|my_center|LOCUS_8960 >Feature sequence74 <1 692 gene locus_tag LOCUS_8970 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005904393.1:transketolase