>Feature sequence0001 770 1693 gene locus_tag LOCUS_00010 770 1693 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403447.1 protein_id gnl|my_center|LOCUS_00010 3192 1792 gene locus_tag LOCUS_00020 3192 1792 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_00020 4738 3380 gene locus_tag LOCUS_00030 4738 3380 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_00030 6237 4777 gene locus_tag LOCUS_00040 6237 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6341 6703 gene locus_tag LOCUS_00050 6341 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003257809.1 protein_id gnl|my_center|LOCUS_00050 6823 8223 gene locus_tag LOCUS_00060 6823 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_00060 8482 8276 gene locus_tag LOCUS_00070 8482 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9042 8479 gene locus_tag LOCUS_00080 9042 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10019 9039 gene locus_tag LOCUS_00090 10019 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10519 10016 gene locus_tag LOCUS_00100 10519 10016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11115 10519 gene locus_tag LOCUS_00110 gene rpsH 11115 10519 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW29 protein_id gnl|my_center|LOCUS_00110 12446 11172 gene locus_tag LOCUS_00120 12446 11172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13773 12487 gene locus_tag LOCUS_00130 13773 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14159 13827 gene locus_tag LOCUS_00140 gene trxA 14159 13827 CDS product thioredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AA29 protein_id gnl|my_center|LOCUS_00140 15382 14261 gene locus_tag LOCUS_00150 15382 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16078 15386 gene locus_tag LOCUS_00160 16078 15386 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809953.1 protein_id gnl|my_center|LOCUS_00160 16378 17409 gene locus_tag LOCUS_00170 gene kdsD 16378 17409 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_00170 17406 17933 gene locus_tag LOCUS_00180 17406 17933 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766514.1 protein_id gnl|my_center|LOCUS_00180 17930 20947 gene locus_tag LOCUS_00190 17930 20947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20986 23610 gene locus_tag LOCUS_00200 20986 23610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23639 23998 gene locus_tag LOCUS_00210 23639 23998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 26448 24013 gene locus_tag LOCUS_00220 gene gyrB 26448 24013 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM28 protein_id gnl|my_center|LOCUS_00220 26974 26576 gene locus_tag LOCUS_00230 26974 26576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 28085 26982 gene locus_tag LOCUS_00240 gene dnaN 28085 26982 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKK1 protein_id gnl|my_center|LOCUS_00240 30211 28811 gene locus_tag LOCUS_00250 gene dnaA 30211 28811 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X9D5 protein_id gnl|my_center|LOCUS_00250 31637 30456 gene locus_tag LOCUS_00260 gene iscS 31637 30456 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZS1 protein_id gnl|my_center|LOCUS_00260 32780 31653 gene locus_tag LOCUS_00270 32780 31653 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_00270 33517 32777 gene locus_tag LOCUS_00280 33517 32777 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_00280 35118 33514 gene locus_tag LOCUS_00290 gene bshC 35118 33514 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEP5 protein_id gnl|my_center|LOCUS_00290 35864 35115 gene locus_tag LOCUS_00300 35864 35115 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404618.1 protein_id gnl|my_center|LOCUS_00300 36784 35861 gene locus_tag LOCUS_00310 gene pyrF 36784 35861 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 protein_id gnl|my_center|LOCUS_00310 37353 36757 gene locus_tag LOCUS_00320 37353 36757 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_00320 38306 37350 gene locus_tag LOCUS_00330 38306 37350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 39321 38410 gene locus_tag LOCUS_00340 39321 38410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41082 39628 gene locus_tag LOCUS_00350 41082 39628 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_00350 41342 42718 gene locus_tag LOCUS_00360 41342 42718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 >Feature sequence0002 2363 2893 gene locus_tag LOCUS_00370 2363 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 3071 6262 gene locus_tag LOCUS_00380 3071 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_00380 10042 6290 gene locus_tag LOCUS_00390 10042 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141887.1 protein_id gnl|my_center|LOCUS_00390 10764 10165 gene locus_tag LOCUS_00400 10764 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 11281 10757 gene locus_tag LOCUS_00410 11281 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 11461 15156 gene locus_tag LOCUS_00420 11461 15156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142223.1 protein_id gnl|my_center|LOCUS_00420 16590 15163 gene locus_tag LOCUS_00430 gene ybfO 16590 15163 CDS product putative hydrolase YbfO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31455 protein_id gnl|my_center|LOCUS_00430 16844 18286 gene locus_tag LOCUS_00440 16844 18286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 18463 18954 gene locus_tag LOCUS_00450 18463 18954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 19037 20260 gene locus_tag LOCUS_00460 19037 20260 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQG8 protein_id gnl|my_center|LOCUS_00460 20368 20847 gene locus_tag LOCUS_00470 20368 20847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 >Feature sequence0003 717 346 gene locus_tag LOCUS_00480 717 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 691 876 gene locus_tag LOCUS_00490 691 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 1145 1567 gene locus_tag LOCUS_00500 1145 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 2002 2760 gene locus_tag LOCUS_00510 2002 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 3906 3253 gene locus_tag LOCUS_00520 3906 3253 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809641.1 protein_id gnl|my_center|LOCUS_00520 4666 3920 gene locus_tag LOCUS_00530 4666 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 5361 4663 gene locus_tag LOCUS_00540 gene pmtA 5361 4663 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089374.1 protein_id gnl|my_center|LOCUS_00540 7886 5358 gene locus_tag LOCUS_00550 7886 5358 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 protein_id gnl|my_center|LOCUS_00550 11184 8020 gene locus_tag LOCUS_00560 11184 8020 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087702.1 protein_id gnl|my_center|LOCUS_00560 12377 11193 gene locus_tag LOCUS_00570 12377 11193 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_00570 13825 12380 gene locus_tag LOCUS_00580 13825 12380 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 protein_id gnl|my_center|LOCUS_00580 14852 13830 gene locus_tag LOCUS_00590 14852 13830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 15274 14849 gene locus_tag LOCUS_00600 15274 14849 CDS product penicillinase repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257725.1 protein_id gnl|my_center|LOCUS_00600 15576 15370 gene locus_tag LOCUS_00610 15576 15370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 16154 15573 gene locus_tag LOCUS_00620 16154 15573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 16531 16229 gene locus_tag LOCUS_00630 16531 16229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 16971 16741 gene locus_tag LOCUS_00640 16971 16741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 17726 16980 gene locus_tag LOCUS_00650 17726 16980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 18160 17723 gene locus_tag LOCUS_00660 18160 17723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 20074 18170 gene locus_tag LOCUS_00670 20074 18170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 >Feature sequence0004 3381 1312 gene locus_tag LOCUS_00680 gene uvrB 3381 1312 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747K3 protein_id gnl|my_center|LOCUS_00680 3483 4412 gene locus_tag LOCUS_00690 3483 4412 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 protein_id gnl|my_center|LOCUS_00690 4513 5340 gene locus_tag LOCUS_00700 4513 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 6265 5357 gene locus_tag LOCUS_00710 6265 5357 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_00710 6513 6262 gene locus_tag LOCUS_00720 6513 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 7374 6616 gene locus_tag LOCUS_00730 7374 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 8591 7371 gene locus_tag LOCUS_00740 8591 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119080.1 protein_id gnl|my_center|LOCUS_00740 10005 8713 gene locus_tag LOCUS_00750 gene purD 10005 8713 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FJ8 protein_id gnl|my_center|LOCUS_00750 10187 10264 gene locus_tag LOCUS_t00010 10187 10264 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10370 10588 gene locus_tag LOCUS_00760 10370 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 10745 11515 gene locus_tag LOCUS_00770 10745 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00770 11558 12346 gene locus_tag LOCUS_00780 11558 12346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 12420 13013 gene locus_tag LOCUS_00790 12420 13013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 13235 13630 gene locus_tag LOCUS_00800 13235 13630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 14338 13631 gene locus_tag LOCUS_00810 14338 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 15552 15202 gene locus_tag LOCUS_00820 15552 15202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 16692 15892 gene locus_tag LOCUS_00830 16692 15892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072850.1 protein_id gnl|my_center|LOCUS_00830 16830 16906 gene locus_tag LOCUS_t00020 16830 16906 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18110 16956 gene locus_tag LOCUS_00840 18110 16956 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727659.1 protein_id gnl|my_center|LOCUS_00840 >Feature sequence0005 1951 1247 gene locus_tag LOCUS_00850 1951 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 4060 1967 gene locus_tag LOCUS_00860 gene fusA2 4060 1967 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73NV3 protein_id gnl|my_center|LOCUS_00860 4381 5613 gene locus_tag LOCUS_00870 4381 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 5822 6472 gene locus_tag LOCUS_00880 5822 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 6523 7578 gene locus_tag LOCUS_00890 6523 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141419.1 protein_id gnl|my_center|LOCUS_00890 7663 9216 gene locus_tag LOCUS_00900 7663 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 9506 10771 gene locus_tag LOCUS_00910 9506 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 10916 11980 gene locus_tag LOCUS_00920 10916 11980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 12355 12044 gene locus_tag LOCUS_00930 12355 12044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 13189 12371 gene locus_tag LOCUS_00940 13189 12371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 14055 13273 gene locus_tag LOCUS_00950 14055 13273 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103486.1 protein_id gnl|my_center|LOCUS_00950 14411 14052 gene locus_tag LOCUS_00960 14411 14052 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815875.1 protein_id gnl|my_center|LOCUS_00960 15109 14411 gene locus_tag LOCUS_00970 15109 14411 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172134.1 protein_id gnl|my_center|LOCUS_00970 16698 15184 gene locus_tag LOCUS_00980 16698 15184 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_00980 17392 16802 gene locus_tag LOCUS_00990 17392 16802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00990 18703 17408 gene locus_tag LOCUS_01000 18703 17408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01000 >Feature sequence0006 <1 576 gene locus_tag LOCUS_01010 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023979.1:molybdopterin molybdenumtransferase MoeA 590 2449 gene locus_tag LOCUS_01020 590 2449 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085096.1 protein_id gnl|my_center|LOCUS_01020 2446 3267 gene locus_tag LOCUS_01030 2446 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 3308 5059 gene locus_tag LOCUS_01040 3308 5059 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_01040 5122 7281 gene locus_tag LOCUS_01050 5122 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 9076 7289 gene locus_tag LOCUS_01060 gene sglT 9076 7289 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_01060 10776 9073 gene locus_tag LOCUS_01070 10776 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 10961 11704 gene locus_tag LOCUS_01080 10961 11704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120779.1 protein_id gnl|my_center|LOCUS_01080 12889 11708 gene locus_tag LOCUS_01090 12889 11708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 13319 14800 gene locus_tag LOCUS_01100 13319 14800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 15102 15491 gene locus_tag LOCUS_01110 15102 15491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 15513 16190 gene locus_tag LOCUS_01120 15513 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 17305 16187 gene locus_tag LOCUS_01130 17305 16187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 17554 17898 gene locus_tag LOCUS_01140 17554 17898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969851.1 protein_id gnl|my_center|LOCUS_01140 18089 17838 gene locus_tag LOCUS_01150 18089 17838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 >Feature sequence0007 1416 1063 gene locus_tag LOCUS_01160 1416 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 1390 2040 gene locus_tag LOCUS_01170 1390 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 2037 3461 gene locus_tag LOCUS_01180 2037 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_01180 5208 3517 gene locus_tag LOCUS_01190 5208 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 7220 5541 gene locus_tag LOCUS_01200 7220 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 7493 7948 gene locus_tag LOCUS_01210 7493 7948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 9670 8030 gene locus_tag LOCUS_01220 9670 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 12230 9819 gene locus_tag LOCUS_01230 12230 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 12588 13142 gene locus_tag LOCUS_01240 12588 13142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 13139 13933 gene locus_tag LOCUS_01250 13139 13933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 15185 13962 gene locus_tag LOCUS_01260 15185 13962 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258650.1 protein_id gnl|my_center|LOCUS_01260 16075 15341 gene locus_tag LOCUS_01270 16075 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 >Feature sequence0008 92 1081 gene locus_tag LOCUS_01280 gene xcsF 92 1081 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038521.1 protein_id gnl|my_center|LOCUS_01280 2620 1313 gene locus_tag LOCUS_01290 2620 1313 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_01290 2896 4326 gene locus_tag LOCUS_01300 2896 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 4358 5899 gene locus_tag LOCUS_01310 4358 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 9195 6268 gene locus_tag LOCUS_01320 9195 6268 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_01320 9713 9336 gene locus_tag LOCUS_01330 9713 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 10391 12772 gene locus_tag LOCUS_01340 gene xcpQ 10391 12772 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_01340 12783 14492 gene locus_tag LOCUS_01350 gene gspE 12783 14492 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 protein_id gnl|my_center|LOCUS_01350 14515 15735 gene locus_tag LOCUS_01360 gene gspF 14515 15735 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_01360 15768 16211 gene locus_tag LOCUS_01370 15768 16211 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533582.1 protein_id gnl|my_center|LOCUS_01370 16234 16803 gene locus_tag LOCUS_01380 16234 16803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 >Feature sequence0009 1959 139 gene locus_tag LOCUS_01390 1959 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 2276 3574 gene locus_tag LOCUS_01400 2276 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 4244 3654 gene locus_tag LOCUS_01410 gene pyrE 4244 3654 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727B2 protein_id gnl|my_center|LOCUS_01410 4344 5567 gene locus_tag LOCUS_01420 4344 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 5640 6617 gene locus_tag LOCUS_01430 5640 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 8904 6676 gene locus_tag LOCUS_01440 8904 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 10939 8975 gene locus_tag LOCUS_01450 10939 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 11290 12381 gene locus_tag LOCUS_01460 11290 12381 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_01460 15568 12284 gene locus_tag LOCUS_01470 15568 12284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 15699 16472 gene locus_tag LOCUS_01480 15699 16472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 >Feature sequence0010 832 4197 gene locus_tag LOCUS_01490 832 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 4949 4176 gene locus_tag LOCUS_01500 4949 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 6362 5076 gene locus_tag LOCUS_01510 6362 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 7282 6359 gene locus_tag LOCUS_01520 7282 6359 CDS product glycosyl transferase family A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024331.1 protein_id gnl|my_center|LOCUS_01520 9513 7279 gene locus_tag LOCUS_01530 9513 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 11984 9513 gene locus_tag LOCUS_01540 11984 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 12184 11981 gene locus_tag LOCUS_01550 12184 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 12243 12905 gene locus_tag LOCUS_01560 12243 12905 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_01560 12986 13645 gene locus_tag LOCUS_01570 12986 13645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 13783 15357 gene locus_tag LOCUS_01580 13783 15357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 >Feature sequence0011 363 1586 gene locus_tag LOCUS_01590 363 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 1854 2093 gene locus_tag LOCUS_01600 1854 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 3055 2735 gene locus_tag LOCUS_01610 3055 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 3672 3403 gene locus_tag LOCUS_01620 3672 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 4640 3690 gene locus_tag LOCUS_01630 4640 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 5173 4862 gene locus_tag LOCUS_01640 5173 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 5238 5483 gene locus_tag LOCUS_01650 5238 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 6610 5432 gene locus_tag LOCUS_01660 6610 5432 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_01660 6911 6738 gene locus_tag LOCUS_01670 6911 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 8024 6981 gene locus_tag LOCUS_01680 8024 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 9218 8208 gene locus_tag LOCUS_01690 9218 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 9544 9344 gene locus_tag LOCUS_01700 9544 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 9772 10584 gene locus_tag LOCUS_01710 9772 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 11053 10691 gene locus_tag LOCUS_01720 11053 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 12245 11163 gene locus_tag LOCUS_01730 12245 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 12703 12251 gene locus_tag LOCUS_01740 12703 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 13320 13679 gene locus_tag LOCUS_01750 13320 13679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 13700 14791 gene locus_tag LOCUS_01760 13700 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 14848 15093 gene locus_tag LOCUS_01770 14848 15093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 15428 15341 gene locus_tag LOCUS_t00030 15428 15341 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0012 <1 816 gene locus_tag LOCUS_01780 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887886.1:RNA polymerase sigma factor SigJ 1760 858 gene locus_tag LOCUS_01790 1760 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 1932 2594 gene locus_tag LOCUS_01800 1932 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 2602 4851 gene locus_tag LOCUS_01810 2602 4851 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123669.1 protein_id gnl|my_center|LOCUS_01810 8330 4875 gene locus_tag LOCUS_01820 8330 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143578.1 protein_id gnl|my_center|LOCUS_01820 10052 8520 gene locus_tag LOCUS_01830 10052 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 10263 10652 gene locus_tag LOCUS_01840 10263 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 11351 10653 gene locus_tag LOCUS_01850 11351 10653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01850 11666 11394 gene locus_tag LOCUS_01860 11666 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 11951 13822 gene locus_tag LOCUS_01870 11951 13822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 14555 13866 gene locus_tag LOCUS_01880 14555 13866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942024.1 protein_id gnl|my_center|LOCUS_01880 <15657 14552 gene locus_tag LOCUS_01890 <15657 14552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122176.1:thiol-disulfide isomerase >Feature sequence0013 <1 2578 gene locus_tag LOCUS_01900 <1 2578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123669.1:serine/threonine protein kinase 2629 2725 gene locus_tag LOCUS_t00040 2629 2725 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 2880 4535 gene locus_tag LOCUS_01910 2880 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 4710 5051 gene locus_tag LOCUS_01920 4710 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 5464 6159 gene locus_tag LOCUS_01930 5464 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 6502 7320 gene locus_tag LOCUS_01940 6502 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 7420 7707 gene locus_tag LOCUS_01950 7420 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 7882 8607 gene locus_tag LOCUS_01960 7882 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 8655 10451 gene locus_tag LOCUS_01970 8655 10451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 11153 10632 gene locus_tag LOCUS_01980 11153 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 11428 11150 gene locus_tag LOCUS_01990 11428 11150 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230147.1 protein_id gnl|my_center|LOCUS_01990 11618 13264 gene locus_tag LOCUS_02000 11618 13264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 13300 14589 gene locus_tag LOCUS_02010 13300 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_02010 >Feature sequence0014 <1 633 gene locus_tag LOCUS_02020 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887549.1:hybrid sensor histidine kinase/response regulator 1608 667 gene locus_tag LOCUS_02030 1608 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 1925 1773 gene locus_tag LOCUS_02040 1925 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 2153 1947 gene locus_tag LOCUS_02050 2153 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 2389 4449 gene locus_tag LOCUS_02060 2389 4449 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_02060 4551 5249 gene locus_tag LOCUS_02070 4551 5249 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED46 protein_id gnl|my_center|LOCUS_02070 5566 7434 gene locus_tag LOCUS_02080 5566 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 7637 7431 gene locus_tag LOCUS_02090 7637 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 10530 7663 gene locus_tag LOCUS_02100 10530 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 10782 12035 gene locus_tag LOCUS_02110 10782 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 12151 14217 gene locus_tag LOCUS_02120 12151 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 >Feature sequence0015 842 1030 gene locus_tag LOCUS_02130 842 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 1044 1838 gene locus_tag LOCUS_02140 1044 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 1970 3112 gene locus_tag LOCUS_02150 gene glxK 1970 3112 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42100 protein_id gnl|my_center|LOCUS_02150 3127 3585 gene locus_tag LOCUS_02160 3127 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 3779 4252 gene locus_tag LOCUS_02170 3779 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 4274 4897 gene locus_tag LOCUS_02180 4274 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 8536 4955 gene locus_tag LOCUS_02190 8536 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 8744 8929 gene locus_tag LOCUS_02200 8744 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 8933 9517 gene locus_tag LOCUS_02210 8933 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 9507 11159 gene locus_tag LOCUS_02220 9507 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120249.1 protein_id gnl|my_center|LOCUS_02220 11206 12189 gene locus_tag LOCUS_02230 11206 12189 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_02230 12176 13177 gene locus_tag LOCUS_02240 12176 13177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 13177 14121 gene locus_tag LOCUS_02250 13177 14121 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_02250 14121 14897 gene locus_tag LOCUS_02260 14121 14897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 >Feature sequence0016 290 1534 gene locus_tag LOCUS_02270 290 1534 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_02270 2875 1574 gene locus_tag LOCUS_02280 gene tyrS 2875 1574 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E127 protein_id gnl|my_center|LOCUS_02280 3463 3062 gene locus_tag LOCUS_02290 3463 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 5390 3696 gene locus_tag LOCUS_02300 gene fhs 5390 3696 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM91 protein_id gnl|my_center|LOCUS_02300 5465 6232 gene locus_tag LOCUS_02310 5465 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123408.1 protein_id gnl|my_center|LOCUS_02310 6696 6277 gene locus_tag LOCUS_02320 6696 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 6939 6862 gene locus_tag LOCUS_t00050 6939 6862 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9209 7011 gene locus_tag LOCUS_02330 9209 7011 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_02330 9880 9389 gene locus_tag LOCUS_02340 9880 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460462.1 protein_id gnl|my_center|LOCUS_02340 11337 9931 gene locus_tag LOCUS_02350 gene atoC 11337 9931 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06065 protein_id gnl|my_center|LOCUS_02350 12097 11309 gene locus_tag LOCUS_02360 12097 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 12511 13851 gene locus_tag LOCUS_02370 12511 13851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 13978 15372 gene locus_tag LOCUS_02380 13978 15372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 >Feature sequence0017 2052 67 gene locus_tag LOCUS_02390 2052 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 4173 2266 gene locus_tag LOCUS_02400 4173 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 4405 5265 gene locus_tag LOCUS_02410 4405 5265 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_02410 5414 7219 gene locus_tag LOCUS_02420 5414 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 7775 7248 gene locus_tag LOCUS_02430 7775 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 10141 8000 gene locus_tag LOCUS_02440 10141 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 10384 12375 gene locus_tag LOCUS_02450 10384 12375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 13128 12442 gene locus_tag LOCUS_02460 13128 12442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 <14846 13181 gene locus_tag LOCUS_02470 <14846 13181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67078:3-isopropylmalate dehydratase large subunit >Feature sequence0018 848 603 gene locus_tag LOCUS_02480 848 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 1261 845 gene locus_tag LOCUS_02490 1261 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 1424 3433 gene locus_tag LOCUS_02500 1424 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 3531 4889 gene locus_tag LOCUS_02510 3531 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_02510 5056 8190 gene locus_tag LOCUS_02520 5056 8190 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_02520 8208 8735 gene locus_tag LOCUS_02530 8208 8735 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 protein_id gnl|my_center|LOCUS_02530 9639 8758 gene locus_tag LOCUS_02540 9639 8758 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102980.1 protein_id gnl|my_center|LOCUS_02540 9813 10622 gene locus_tag LOCUS_02550 gene lpxA-2 9813 10622 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EG3 protein_id gnl|my_center|LOCUS_02550 10627 12003 gene locus_tag LOCUS_02560 10627 12003 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939113.1 protein_id gnl|my_center|LOCUS_02560 13030 12020 gene locus_tag LOCUS_02570 13030 12020 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_02570 13522 13115 gene locus_tag LOCUS_02580 13522 13115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 13711 14247 gene locus_tag LOCUS_02590 13711 14247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 >Feature sequence0019 2888 2457 gene locus_tag LOCUS_02600 2888 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 3349 2915 gene locus_tag LOCUS_02610 3349 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 3812 3357 gene locus_tag LOCUS_02620 3812 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 4681 3809 gene locus_tag LOCUS_02630 4681 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 5119 4706 gene locus_tag LOCUS_02640 5119 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 5494 5180 gene locus_tag LOCUS_02650 5494 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 6141 6524 gene locus_tag LOCUS_02660 6141 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 7268 6888 gene locus_tag LOCUS_02670 7268 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816964.1 protein_id gnl|my_center|LOCUS_02670 7673 7272 gene locus_tag LOCUS_02680 7673 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 8251 7730 gene locus_tag LOCUS_02690 8251 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 8686 8279 gene locus_tag LOCUS_02700 8686 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 9238 8702 gene locus_tag LOCUS_02710 9238 8702 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389144.1 protein_id gnl|my_center|LOCUS_02710 9632 9222 gene locus_tag LOCUS_02720 9632 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 11124 9685 gene locus_tag LOCUS_02730 11124 9685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970484.1 protein_id gnl|my_center|LOCUS_02730 11937 11155 gene locus_tag LOCUS_02740 11937 11155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 <14732 12037 gene locus_tag LOCUS_02750 <14732 12037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967604.1:haloacid dehalogenase >Feature sequence0020 956 723 gene locus_tag LOCUS_02760 956 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 3088 1130 gene locus_tag LOCUS_02770 gene gpi2 3088 1130 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_02770 4579 3248 gene locus_tag LOCUS_02780 4579 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 6030 4813 gene locus_tag LOCUS_02790 6030 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 6893 6147 gene locus_tag LOCUS_02800 6893 6147 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_02800 8346 6907 gene locus_tag LOCUS_02810 8346 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701462.1 protein_id gnl|my_center|LOCUS_02810 10292 8457 gene locus_tag LOCUS_02820 10292 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 10464 11387 gene locus_tag LOCUS_02830 10464 11387 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 protein_id gnl|my_center|LOCUS_02830 11381 11923 gene locus_tag LOCUS_02840 gene crtZ 11381 11923 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_02840 12794 11871 gene locus_tag LOCUS_02850 12794 11871 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388253.1 protein_id gnl|my_center|LOCUS_02850 14338 12791 gene locus_tag LOCUS_02860 14338 12791 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258284.1 protein_id gnl|my_center|LOCUS_02860 >Feature sequence0021 369 3809 gene locus_tag LOCUS_02870 gene icmF 369 3809 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F222 protein_id gnl|my_center|LOCUS_02870 5786 3834 gene locus_tag LOCUS_02880 gene fabY 5786 3834 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_02880 8007 6082 gene locus_tag LOCUS_02890 8007 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 8974 8270 gene locus_tag LOCUS_02900 8974 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 10303 9233 gene locus_tag LOCUS_02910 10303 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 12229 10388 gene locus_tag LOCUS_02920 12229 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 13836 12382 gene locus_tag LOCUS_02930 13836 12382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 <14619 13833 gene locus_tag LOCUS_02940 <14619 13833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877193.1:peptide transporter >Feature sequence0022 286 2709 gene locus_tag LOCUS_02950 286 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 2706 4580 gene locus_tag LOCUS_02960 2706 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 4580 6586 gene locus_tag LOCUS_02970 4580 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 6658 7608 gene locus_tag LOCUS_02980 6658 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 9430 7640 gene locus_tag LOCUS_02990 9430 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 9633 10385 gene locus_tag LOCUS_03000 9633 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 12011 10401 gene locus_tag LOCUS_03010 12011 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 12419 13468 gene locus_tag LOCUS_03020 12419 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 14582 13479 gene locus_tag LOCUS_03030 14582 13479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence0023 84 1091 gene locus_tag LOCUS_03040 gene flgI 84 1091 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F5 protein_id gnl|my_center|LOCUS_03040 1113 1496 gene locus_tag LOCUS_03050 1113 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 1627 2133 gene locus_tag LOCUS_03060 1627 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 2143 4470 gene locus_tag LOCUS_03070 2143 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 4545 5993 gene locus_tag LOCUS_03080 4545 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 6330 5995 gene locus_tag LOCUS_03090 6330 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 7389 6379 gene locus_tag LOCUS_03100 gene fliM 7389 6379 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811852.1 protein_id gnl|my_center|LOCUS_03100 7885 7370 gene locus_tag LOCUS_03110 7885 7370 CDS product flagellar protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937358.1 protein_id gnl|my_center|LOCUS_03110 8671 7964 gene locus_tag LOCUS_03120 8671 7964 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870067.1 protein_id gnl|my_center|LOCUS_03120 9404 8688 gene locus_tag LOCUS_03130 gene motB 9404 8688 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707084.1 protein_id gnl|my_center|LOCUS_03130 10184 9414 gene locus_tag LOCUS_03140 gene pomA 10184 9414 CDS product flagellar motor protein MotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937943.1 protein_id gnl|my_center|LOCUS_03140 10940 10188 gene locus_tag LOCUS_03150 10940 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 11395 10940 gene locus_tag LOCUS_03160 11395 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 12711 11392 gene locus_tag LOCUS_03170 12711 11392 CDS product EscN/YscN/HrcN family type III secretion system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_03170 13327 12713 gene locus_tag LOCUS_03180 13327 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 <14281 13320 gene locus_tag LOCUS_03190 <14281 13320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O25119:flagellar motor switch protein FliG >Feature sequence0024 <1 1793 gene locus_tag LOCUS_03200 <1 1793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URW4:DNA-directed RNA polymerase subunit beta' 1929 2300 gene locus_tag LOCUS_03210 gene rpsL 1929 2300 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73NV5 protein_id gnl|my_center|LOCUS_03210 2391 2864 gene locus_tag LOCUS_03220 gene rpsG 2391 2864 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN31 protein_id gnl|my_center|LOCUS_03220 3138 5204 gene locus_tag LOCUS_03230 gene fusA2 3138 5204 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_03230 5422 5730 gene locus_tag LOCUS_03240 5422 5730 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_03240 5897 6526 gene locus_tag LOCUS_03250 gene rplD 5897 6526 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFP8 protein_id gnl|my_center|LOCUS_03250 6519 6806 gene locus_tag LOCUS_03260 gene rplW 6519 6806 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPG8 protein_id gnl|my_center|LOCUS_03260 6926 7762 gene locus_tag LOCUS_03270 gene rplB 6926 7762 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAH5 protein_id gnl|my_center|LOCUS_03270 7792 8064 gene locus_tag LOCUS_03280 gene rpsS 7792 8064 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124353.1 protein_id gnl|my_center|LOCUS_03280 8114 8467 gene locus_tag LOCUS_03290 gene rplV 8114 8467 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK63 protein_id gnl|my_center|LOCUS_03290 8476 9117 gene locus_tag LOCUS_03300 gene rpsC 8476 9117 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN14 protein_id gnl|my_center|LOCUS_03300 9122 9541 gene locus_tag LOCUS_03310 gene rplP 9122 9541 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN13 protein_id gnl|my_center|LOCUS_03310 9538 9762 gene locus_tag LOCUS_03320 9538 9762 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810148.1 protein_id gnl|my_center|LOCUS_03320 9829 10098 gene locus_tag LOCUS_03330 gene rpsQ 9829 10098 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIG4 protein_id gnl|my_center|LOCUS_03330 10142 10510 gene locus_tag LOCUS_03340 gene rplN 10142 10510 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN10 protein_id gnl|my_center|LOCUS_03340 10536 10802 gene locus_tag LOCUS_03350 10536 10802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 10831 11373 gene locus_tag LOCUS_03360 gene rplE 10831 11373 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T01 protein_id gnl|my_center|LOCUS_03360 11456 11854 gene locus_tag LOCUS_03370 gene rpsH 11456 11854 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN06 protein_id gnl|my_center|LOCUS_03370 11868 12422 gene locus_tag LOCUS_03380 gene rplF 11868 12422 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR2 protein_id gnl|my_center|LOCUS_03380 12441 12812 gene locus_tag LOCUS_03390 gene rplR 12441 12812 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46899 protein_id gnl|my_center|LOCUS_03390 12904 13401 gene locus_tag LOCUS_03400 gene rpsE 12904 13401 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR4 protein_id gnl|my_center|LOCUS_03400 13398 13850 gene locus_tag LOCUS_03410 gene rplO 13398 13850 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J23 protein_id gnl|my_center|LOCUS_03410 >Feature sequence0025 850 17 gene locus_tag LOCUS_03420 850 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 3270 847 gene locus_tag LOCUS_03430 gene napA 3270 847 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P019 protein_id gnl|my_center|LOCUS_03430 3546 3274 gene locus_tag LOCUS_03440 3546 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 3712 4395 gene locus_tag LOCUS_03450 3712 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 4388 5314 gene locus_tag LOCUS_03460 4388 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5337 6605 gene locus_tag LOCUS_03470 5337 6605 CDS product Hdr menaquinol oxidoreductase integral membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_03470 7612 6602 gene locus_tag LOCUS_03480 7612 6602 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706261.1 protein_id gnl|my_center|LOCUS_03480 7746 8606 gene locus_tag LOCUS_03490 7746 8606 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_03490 8685 9182 gene locus_tag LOCUS_03500 8685 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 9307 11445 gene locus_tag LOCUS_03510 9307 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 11694 11458 gene locus_tag LOCUS_03520 11694 11458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 13679 11979 gene locus_tag LOCUS_03530 13679 11979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 >Feature sequence0026 387 43 gene locus_tag LOCUS_03540 387 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 1970 558 gene locus_tag LOCUS_03550 1970 558 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_03550 4018 2060 gene locus_tag LOCUS_03560 4018 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 4195 5160 gene locus_tag LOCUS_03570 4195 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 5125 5214 gene locus_tag LOCUS_t00060 5125 5214 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7565 5157 gene locus_tag LOCUS_03580 7565 5157 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118806.1 protein_id gnl|my_center|LOCUS_03580 10348 7652 gene locus_tag LOCUS_03590 10348 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 10524 12716 gene locus_tag LOCUS_03600 10524 12716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence0027 638 2413 gene locus_tag LOCUS_03610 638 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 2579 4600 gene locus_tag LOCUS_03620 2579 4600 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877796.1 protein_id gnl|my_center|LOCUS_03620 4652 5863 gene locus_tag LOCUS_03630 4652 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460369.1 protein_id gnl|my_center|LOCUS_03630 7110 6271 gene locus_tag LOCUS_03640 7110 6271 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_03640 7316 7636 gene locus_tag LOCUS_03650 7316 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 7872 8969 gene locus_tag LOCUS_03660 gene lpxD 7872 8969 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT5 protein_id gnl|my_center|LOCUS_03660 9536 8988 gene locus_tag LOCUS_03670 9536 8988 CDS product 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_03670 9858 11591 gene locus_tag LOCUS_03680 9858 11591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 13119 11680 gene locus_tag LOCUS_03690 13119 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 >Feature sequence0028 188 1720 gene locus_tag LOCUS_03700 gene int 188 1720 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_03700 1717 1998 gene locus_tag LOCUS_03710 1717 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 2358 2092 gene locus_tag LOCUS_03720 2358 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 2836 3060 gene locus_tag LOCUS_03730 2836 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 4254 3379 gene locus_tag LOCUS_03740 gene xerD 4254 3379 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DC22 protein_id gnl|my_center|LOCUS_03740 4941 4330 gene locus_tag LOCUS_03750 4941 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5231 6607 gene locus_tag LOCUS_03760 5231 6607 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q832V4 protein_id gnl|my_center|LOCUS_03760 6555 7016 gene locus_tag LOCUS_03770 6555 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 7048 7299 gene locus_tag LOCUS_03780 7048 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 7964 7515 gene locus_tag LOCUS_03790 7964 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 9254 8181 gene locus_tag LOCUS_03800 9254 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 9804 9729 gene locus_tag LOCUS_t00070 9804 9729 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 10937 9933 gene locus_tag LOCUS_03810 gene accD 10937 9933 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI7 protein_id gnl|my_center|LOCUS_03810 11640 10957 gene locus_tag LOCUS_03820 gene rpe 11640 10957 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WI51 protein_id gnl|my_center|LOCUS_03820 12836 11640 gene locus_tag LOCUS_03830 gene pgk 12836 11640 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU1 protein_id gnl|my_center|LOCUS_03830 <13722 12906 gene locus_tag LOCUS_03840 <13722 12906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z518:glyceraldehyde-3-phosphate dehydrogenase >Feature sequence0029 2188 3024 gene locus_tag LOCUS_03850 gene mutM 2188 3024 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403240.1 protein_id gnl|my_center|LOCUS_03850 3124 5271 gene locus_tag LOCUS_03860 3124 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 6040 5297 gene locus_tag LOCUS_03870 6040 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 6100 6738 gene locus_tag LOCUS_03880 6100 6738 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118202.1 protein_id gnl|my_center|LOCUS_03880 6835 7446 gene locus_tag LOCUS_03890 6835 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 8605 7418 gene locus_tag LOCUS_03900 8605 7418 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228092.1 protein_id gnl|my_center|LOCUS_03900 9741 8719 gene locus_tag LOCUS_03910 9741 8719 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766463.1 protein_id gnl|my_center|LOCUS_03910 10102 11166 gene locus_tag LOCUS_03920 10102 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119280.1 protein_id gnl|my_center|LOCUS_03920 11352 12203 gene locus_tag LOCUS_03930 gene panB 11352 12203 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFR7 protein_id gnl|my_center|LOCUS_03930 <13720 12238 gene locus_tag LOCUS_03940 <13720 12238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257563.1:2-oxoisovalerate dehydrogenase subunit beta >Feature sequence0030 631 95 gene locus_tag LOCUS_03950 631 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141087.1 protein_id gnl|my_center|LOCUS_03950 808 1473 gene locus_tag LOCUS_03960 808 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 1559 2995 gene locus_tag LOCUS_03970 gene dagA 1559 2995 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836461.1 protein_id gnl|my_center|LOCUS_03970 4169 2934 gene locus_tag LOCUS_03980 4169 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 4065 4319 gene locus_tag LOCUS_03990 4065 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 6451 4946 gene locus_tag LOCUS_04000 gene pepA 6451 4946 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJQ9 protein_id gnl|my_center|LOCUS_04000 8081 6468 gene locus_tag LOCUS_04010 8081 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 8193 10373 gene locus_tag LOCUS_04020 8193 10373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 10420 11361 gene locus_tag LOCUS_04030 10420 11361 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYG1 protein_id gnl|my_center|LOCUS_04030 11361 12275 gene locus_tag LOCUS_04040 11361 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 12882 12331 gene locus_tag LOCUS_04050 gene dcd 12882 12331 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI96 protein_id gnl|my_center|LOCUS_04050 >Feature sequence0031 <1 1703 gene locus_tag LOCUS_04060 <1 1703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895703.1:phosphate ABC transporter permease 1713 3311 gene locus_tag LOCUS_04070 gene pstA 1713 3311 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ5 protein_id gnl|my_center|LOCUS_04070 3316 4146 gene locus_tag LOCUS_04080 gene pstB1 3316 4146 CDS product phosphate import ATP-binding protein PstB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG82 protein_id gnl|my_center|LOCUS_04080 4166 4840 gene locus_tag LOCUS_04090 gene phoU 4166 4840 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP22 protein_id gnl|my_center|LOCUS_04090 5786 4872 gene locus_tag LOCUS_04100 gene prmA 5786 4872 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G05 protein_id gnl|my_center|LOCUS_04100 6889 5783 gene locus_tag LOCUS_04110 6889 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 7124 8689 gene locus_tag LOCUS_04120 7124 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 8995 8702 gene locus_tag LOCUS_04130 8995 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 10315 9059 gene locus_tag LOCUS_04140 10315 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 11523 10312 gene locus_tag LOCUS_04150 11523 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 >Feature sequence0032 72 389 gene locus_tag LOCUS_04160 72 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 446 2689 gene locus_tag LOCUS_04170 446 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 2709 4730 gene locus_tag LOCUS_04180 2709 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 4748 4945 gene locus_tag LOCUS_04190 4748 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 4992 5822 gene locus_tag LOCUS_04200 4992 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 7257 5848 gene locus_tag LOCUS_04210 7257 5848 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_04210 7341 7949 gene locus_tag LOCUS_04220 7341 7949 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_04220 7946 9619 gene locus_tag LOCUS_04230 7946 9619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 9616 11112 gene locus_tag LOCUS_04240 9616 11112 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405428.1 protein_id gnl|my_center|LOCUS_04240 11249 11752 gene locus_tag LOCUS_04250 11249 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 11952 13271 gene locus_tag LOCUS_04260 11952 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 >Feature sequence0033 <1 715 gene locus_tag LOCUS_04270 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804122.1:arylsulfatase A family protein 1623 1045 gene locus_tag LOCUS_04280 1623 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 2158 1637 gene locus_tag LOCUS_04290 2158 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 2429 2797 gene locus_tag LOCUS_04300 2429 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 7547 2847 gene locus_tag LOCUS_04310 7547 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 8311 7748 gene locus_tag LOCUS_04320 8311 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 8514 8708 gene locus_tag LOCUS_04330 8514 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 10249 9368 gene locus_tag LOCUS_04340 10249 9368 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477402.1 protein_id gnl|my_center|LOCUS_04340 10429 11418 gene locus_tag LOCUS_04350 10429 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309936.1 protein_id gnl|my_center|LOCUS_04350 11569 13029 gene locus_tag LOCUS_04360 11569 13029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence0034 5414 5560 gene locus_tag LOCUS_04370 5414 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 5648 5941 gene locus_tag LOCUS_04380 5648 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 7543 5996 gene locus_tag LOCUS_04390 7543 5996 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107896.1 protein_id gnl|my_center|LOCUS_04390 11277 7612 gene locus_tag LOCUS_04400 11277 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 11975 11364 gene locus_tag LOCUS_04410 11975 11364 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_04410 12055 12261 gene locus_tag LOCUS_04420 12055 12261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 >Feature sequence0035 1855 1607 gene locus_tag LOCUS_04430 1855 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 2525 1977 gene locus_tag LOCUS_04440 2525 1977 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_04440 4309 2630 gene locus_tag LOCUS_04450 4309 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 6822 4306 gene locus_tag LOCUS_04460 6822 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 8139 7063 gene locus_tag LOCUS_04470 8139 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 8638 10098 gene locus_tag LOCUS_04480 8638 10098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 <13212 10162 gene locus_tag LOCUS_04490 <13212 10162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029781.1:ATP-binding protein >Feature sequence0036 2009 459 gene locus_tag LOCUS_04500 2009 459 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942078.1 protein_id gnl|my_center|LOCUS_04500 2181 2690 gene locus_tag LOCUS_04510 2181 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013556.1 protein_id gnl|my_center|LOCUS_04510 3173 3097 gene locus_tag LOCUS_t00080 3173 3097 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3494 4549 gene locus_tag LOCUS_04520 gene dhlE 3494 4549 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162675.1 protein_id gnl|my_center|LOCUS_04520 5155 4736 gene locus_tag LOCUS_04530 gene rsfS 5155 4736 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DY34 protein_id gnl|my_center|LOCUS_04530 7421 5259 gene locus_tag LOCUS_04540 gene hppA1 7421 5259 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_04540 8414 7500 gene locus_tag LOCUS_04550 8414 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 9637 8411 gene locus_tag LOCUS_04560 9637 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 10512 9634 gene locus_tag LOCUS_04570 10512 9634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120812.1 protein_id gnl|my_center|LOCUS_04570 10602 11165 gene locus_tag LOCUS_04580 10602 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 11384 12442 gene locus_tag LOCUS_04590 11384 12442 CDS product Fe3+/spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385515.1 protein_id gnl|my_center|LOCUS_04590 >Feature sequence0037 3329 1980 gene locus_tag LOCUS_04600 3329 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 3756 7286 gene locus_tag LOCUS_04610 3756 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 7283 7852 gene locus_tag LOCUS_04620 7283 7852 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_04620 8627 7977 gene locus_tag LOCUS_04630 8627 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 10088 8778 gene locus_tag LOCUS_04640 10088 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 12164 10092 gene locus_tag LOCUS_04650 12164 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 <12852 12169 gene locus_tag LOCUS_04660 <12852 12169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525085.1:exopolysaccharide biosynthesis protein BceE >Feature sequence0038 <1 658 gene locus_tag LOCUS_04670 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000503330.1:DeoR family transcriptional regulator 1942 677 gene locus_tag LOCUS_04680 gene truD 1942 677 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60347 protein_id gnl|my_center|LOCUS_04680 2327 1959 gene locus_tag LOCUS_04690 2327 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 2477 3121 gene locus_tag LOCUS_04700 2477 3121 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_04700 3283 3858 gene locus_tag LOCUS_04710 3283 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 4044 6095 gene locus_tag LOCUS_04720 4044 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462072.1 protein_id gnl|my_center|LOCUS_04720 6096 7058 gene locus_tag LOCUS_04730 6096 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 8487 7171 gene locus_tag LOCUS_04740 gene vdh 8487 7171 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_04740 8730 10436 gene locus_tag LOCUS_04750 8730 10436 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_04750 10450 11061 gene locus_tag LOCUS_04760 10450 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 11058 11873 gene locus_tag LOCUS_04770 11058 11873 CDS product molybdenum hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459388.1 protein_id gnl|my_center|LOCUS_04770 11870 12409 gene locus_tag LOCUS_04780 11870 12409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence0039 4558 3305 gene locus_tag LOCUS_04790 4558 3305 CDS product aminoacetone oxidase family FAD-binding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_04790 5351 4641 gene locus_tag LOCUS_04800 5351 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 5506 7146 gene locus_tag LOCUS_04810 5506 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 8916 7240 gene locus_tag LOCUS_04820 8916 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 10963 9041 gene locus_tag LOCUS_04830 10963 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence0040 2188 1202 gene locus_tag LOCUS_04840 2188 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 5247 2290 gene locus_tag LOCUS_04850 5247 2290 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257471.1 protein_id gnl|my_center|LOCUS_04850 6038 5304 gene locus_tag LOCUS_04860 gene ate 6038 5304 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTR8 protein_id gnl|my_center|LOCUS_04860 5928 6218 gene locus_tag LOCUS_04870 5928 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 6234 7961 gene locus_tag LOCUS_04880 6234 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 8133 8459 gene locus_tag LOCUS_04890 8133 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 8461 10362 gene locus_tag LOCUS_04900 8461 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 10378 10731 gene locus_tag LOCUS_04910 10378 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 10833 12515 gene locus_tag LOCUS_04920 10833 12515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142737.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence0041 49 243 gene locus_tag LOCUS_04930 49 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 1974 283 gene locus_tag LOCUS_04940 1974 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 2531 2211 gene locus_tag LOCUS_04950 2531 2211 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225051.1 protein_id gnl|my_center|LOCUS_04950 2671 4290 gene locus_tag LOCUS_04960 2671 4290 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 protein_id gnl|my_center|LOCUS_04960 4680 4447 gene locus_tag LOCUS_04970 4680 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 6299 4812 gene locus_tag LOCUS_04980 6299 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 6498 9029 gene locus_tag LOCUS_04990 gene leuS 6498 9029 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A1P0 protein_id gnl|my_center|LOCUS_04990 9036 9500 gene locus_tag LOCUS_05000 9036 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 9557 11743 gene locus_tag LOCUS_05010 9557 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 >Feature sequence0042 303 88 gene locus_tag LOCUS_05020 303 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 1953 307 gene locus_tag LOCUS_05030 1953 307 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940504.1 protein_id gnl|my_center|LOCUS_05030 4119 1954 gene locus_tag LOCUS_05040 4119 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 5860 4232 gene locus_tag LOCUS_05050 5860 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 7808 5865 gene locus_tag LOCUS_05060 7808 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675225.1 protein_id gnl|my_center|LOCUS_05060 8177 8734 gene locus_tag LOCUS_05070 8177 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 8945 9811 gene locus_tag LOCUS_05080 gene egtD 8945 9811 CDS product histidine N-alpha-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFS1 protein_id gnl|my_center|LOCUS_05080 9916 10617 gene locus_tag LOCUS_05090 gene fabG 9916 10617 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002027497.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence0043 1483 2508 gene locus_tag LOCUS_05100 1483 2508 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_05100 2585 3184 gene locus_tag LOCUS_05110 2585 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 3188 3583 gene locus_tag LOCUS_05120 3188 3583 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083673.1 protein_id gnl|my_center|LOCUS_05120 5921 3645 gene locus_tag LOCUS_05130 5921 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 6260 5925 gene locus_tag LOCUS_05140 6260 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 7231 6257 gene locus_tag LOCUS_05150 7231 6257 CDS product FAD-binding molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268938.1 protein_id gnl|my_center|LOCUS_05150 9359 7257 gene locus_tag LOCUS_05160 9359 7257 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706200.1 protein_id gnl|my_center|LOCUS_05160 10001 9366 gene locus_tag LOCUS_05170 10001 9366 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531562.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence0044 3145 1502 gene locus_tag LOCUS_05180 3145 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 5285 3162 gene locus_tag LOCUS_05190 5285 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 5985 5329 gene locus_tag LOCUS_05200 5985 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 7103 5985 gene locus_tag LOCUS_05210 7103 5985 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454833.1 protein_id gnl|my_center|LOCUS_05210 7894 7100 gene locus_tag LOCUS_05220 7894 7100 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454839.1 protein_id gnl|my_center|LOCUS_05220 9017 7899 gene locus_tag LOCUS_05230 9017 7899 CDS product glycoprotein endopeptidase metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454927.1 protein_id gnl|my_center|LOCUS_05230 10328 9108 gene locus_tag LOCUS_05240 10328 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 10690 11175 gene locus_tag LOCUS_05250 10690 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 12102 11182 gene locus_tag LOCUS_05260 12102 11182 CDS product heparan sulfate glucosamine 3-O-sulfotransferase 3B1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887312.1 protein_id gnl|my_center|LOCUS_05260 >Feature sequence0045 553 3021 gene locus_tag LOCUS_05270 gene clpC 553 3021 CDS product ATP-dependent Clp protease ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_05270 3205 4245 gene locus_tag LOCUS_05280 3205 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 4526 4164 gene locus_tag LOCUS_05290 4526 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 4515 5258 gene locus_tag LOCUS_05300 4515 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 5308 6372 gene locus_tag LOCUS_05310 gene queA 5308 6372 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X2 protein_id gnl|my_center|LOCUS_05310 6369 7193 gene locus_tag LOCUS_05320 6369 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05320 7209 8408 gene locus_tag LOCUS_05330 7209 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05330 8392 9318 gene locus_tag LOCUS_05340 gene rsgA 8392 9318 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK24 protein_id gnl|my_center|LOCUS_05340 10705 9785 gene locus_tag LOCUS_05350 10705 9785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 >Feature sequence0046 2655 1450 gene locus_tag LOCUS_05360 2655 1450 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942161.1 protein_id gnl|my_center|LOCUS_05360 4388 2652 gene locus_tag LOCUS_05370 4388 2652 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230581.1 protein_id gnl|my_center|LOCUS_05370 5088 4540 gene locus_tag LOCUS_05380 5088 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 5401 5787 gene locus_tag LOCUS_05390 5401 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 6734 5871 gene locus_tag LOCUS_05400 gene prmC 6734 5871 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727D9 protein_id gnl|my_center|LOCUS_05400 7386 6784 gene locus_tag LOCUS_05410 7386 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 8554 7472 gene locus_tag LOCUS_05420 8554 7472 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199033.1 protein_id gnl|my_center|LOCUS_05420 9297 8650 gene locus_tag LOCUS_05430 9297 8650 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EP2 protein_id gnl|my_center|LOCUS_05430 10342 9299 gene locus_tag LOCUS_05440 10342 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 10680 10411 gene locus_tag LOCUS_05450 gene rpsP 10680 10411 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC3 protein_id gnl|my_center|LOCUS_05450 12282 10744 gene locus_tag LOCUS_05460 12282 10744 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_05460 >Feature sequence0047 875 1759 gene locus_tag LOCUS_05470 875 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 1848 2423 gene locus_tag LOCUS_05480 1848 2423 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_05480 2410 5088 gene locus_tag LOCUS_05490 2410 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 5832 5089 gene locus_tag LOCUS_05500 5832 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 6775 5924 gene locus_tag LOCUS_05510 6775 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 6962 7552 gene locus_tag LOCUS_05520 6962 7552 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_05520 7549 10287 gene locus_tag LOCUS_05530 7549 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 10795 10298 gene locus_tag LOCUS_05540 10795 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence0048 580 1845 gene locus_tag LOCUS_05550 580 1845 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_05550 1842 3899 gene locus_tag LOCUS_05560 1842 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3968 6622 gene locus_tag LOCUS_05570 3968 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 6657 7487 gene locus_tag LOCUS_05580 6657 7487 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_05580 8849 7500 gene locus_tag LOCUS_05590 8849 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531181.1 protein_id gnl|my_center|LOCUS_05590 10456 9041 gene locus_tag LOCUS_05600 10456 9041 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 protein_id gnl|my_center|LOCUS_05600 10685 11008 gene locus_tag LOCUS_05610 10685 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 <12257 11111 gene locus_tag LOCUS_05620 <12257 11111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065115.1:MFS transporter >Feature sequence0049 2174 1980 gene locus_tag LOCUS_05630 2174 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05630 2546 2319 gene locus_tag LOCUS_05640 2546 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 2695 3516 gene locus_tag LOCUS_05650 2695 3516 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_05650 4500 3538 gene locus_tag LOCUS_05660 4500 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 4775 5386 gene locus_tag LOCUS_05670 4775 5386 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_05670 5440 5829 gene locus_tag LOCUS_05680 5440 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 5826 6638 gene locus_tag LOCUS_05690 5826 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 6758 7561 gene locus_tag LOCUS_05700 6758 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 8761 7583 gene locus_tag LOCUS_05710 8761 7583 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403190.1 protein_id gnl|my_center|LOCUS_05710 10127 8754 gene locus_tag LOCUS_05720 10127 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582879.1 protein_id gnl|my_center|LOCUS_05720 10645 10124 gene locus_tag LOCUS_05730 10645 10124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence0050 1692 658 gene locus_tag LOCUS_05740 1692 658 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249584.1 protein_id gnl|my_center|LOCUS_05740 2736 1912 gene locus_tag LOCUS_05750 gene cobB 2736 1912 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3Z6 protein_id gnl|my_center|LOCUS_05750 3022 5568 gene locus_tag LOCUS_05760 3022 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 5593 6510 gene locus_tag LOCUS_05770 5593 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 8125 6551 gene locus_tag LOCUS_05780 8125 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 9210 8362 gene locus_tag LOCUS_05790 9210 8362 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082932.1 protein_id gnl|my_center|LOCUS_05790 9389 10327 gene locus_tag LOCUS_05800 9389 10327 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_05800 10320 11378 gene locus_tag LOCUS_05810 10320 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522893.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence0051 3376 1103 gene locus_tag LOCUS_05820 3376 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 4857 3460 gene locus_tag LOCUS_05830 4857 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 6503 4938 gene locus_tag LOCUS_05840 6503 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 7309 6581 gene locus_tag LOCUS_05850 7309 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 8813 7518 gene locus_tag LOCUS_05860 8813 7518 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 protein_id gnl|my_center|LOCUS_05860 10312 8810 gene locus_tag LOCUS_05870 gene ppk-2 10312 8810 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_05870 10466 11941 gene locus_tag LOCUS_05880 10466 11941 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404692.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence0052 883 599 gene locus_tag LOCUS_05890 883 599 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_05890 2074 932 gene locus_tag LOCUS_05900 gene pntA 2074 932 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123663.1 protein_id gnl|my_center|LOCUS_05900 2625 2191 gene locus_tag LOCUS_05910 2625 2191 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_05910 5093 2622 gene locus_tag LOCUS_05920 5093 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 5854 5090 gene locus_tag LOCUS_05930 5854 5090 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122939.1 protein_id gnl|my_center|LOCUS_05930 5844 6146 gene locus_tag LOCUS_05940 5844 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 7078 6140 gene locus_tag LOCUS_05950 7078 6140 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707438.1 protein_id gnl|my_center|LOCUS_05950 7205 8107 gene locus_tag LOCUS_05960 7205 8107 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_05960 8095 8727 gene locus_tag LOCUS_05970 8095 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 10744 8753 gene locus_tag LOCUS_05980 10744 8753 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545101.1 protein_id gnl|my_center|LOCUS_05980 11474 10731 gene locus_tag LOCUS_05990 11474 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 <12051 11551 gene locus_tag LOCUS_06000 <12051 11551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943995.1:phospholipase D family protein >Feature sequence0053 5799 2074 gene locus_tag LOCUS_06010 5799 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 6054 6650 gene locus_tag LOCUS_06020 6054 6650 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_06020 8160 6667 gene locus_tag LOCUS_06030 8160 6667 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_06030 8386 9975 gene locus_tag LOCUS_06040 8386 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 10273 10656 gene locus_tag LOCUS_06050 10273 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 >Feature sequence0054 398 1750 gene locus_tag LOCUS_06060 398 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_06060 1809 3062 gene locus_tag LOCUS_06070 1809 3062 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121887.1 protein_id gnl|my_center|LOCUS_06070 5705 3066 gene locus_tag LOCUS_06080 5705 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 8064 5899 gene locus_tag LOCUS_06090 8064 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 8407 9765 gene locus_tag LOCUS_06100 gene cydA 8407 9765 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_06100 9765 10808 gene locus_tag LOCUS_06110 gene cydB 9765 10808 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942286.1 protein_id gnl|my_center|LOCUS_06110 <11951 10830 gene locus_tag LOCUS_06120 <11951 10830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UVG2:xylose isomerase >Feature sequence0055 570 2642 gene locus_tag LOCUS_06130 570 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 2642 4639 gene locus_tag LOCUS_06140 2642 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 7436 4629 gene locus_tag LOCUS_06150 7436 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 7825 7646 gene locus_tag LOCUS_06160 7825 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 10556 8010 gene locus_tag LOCUS_06170 10556 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 10751 11122 gene locus_tag LOCUS_06180 10751 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113301.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence0056 <1 2174 gene locus_tag LOCUS_06190 <1 2174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144060.1:serine/threonine protein kinase 3629 2247 gene locus_tag LOCUS_06200 3629 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 6324 3844 gene locus_tag LOCUS_06210 6324 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 6505 7113 gene locus_tag LOCUS_06220 6505 7113 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCH2 protein_id gnl|my_center|LOCUS_06220 7110 7883 gene locus_tag LOCUS_06230 7110 7883 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932930.1 protein_id gnl|my_center|LOCUS_06230 8001 9851 gene locus_tag LOCUS_06240 gene aepA 8001 9851 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206512.1 protein_id gnl|my_center|LOCUS_06240 10408 9836 gene locus_tag LOCUS_06250 10408 9836 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence0057 1099 350 gene locus_tag LOCUS_06260 1099 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1356 1159 gene locus_tag LOCUS_06270 1356 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 1872 2276 gene locus_tag LOCUS_06280 1872 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 2324 3625 gene locus_tag LOCUS_06290 2324 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3591 5582 gene locus_tag LOCUS_06300 3591 5582 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333785.1 protein_id gnl|my_center|LOCUS_06300 5594 7402 gene locus_tag LOCUS_06310 5594 7402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228613.1 protein_id gnl|my_center|LOCUS_06310 7399 9246 gene locus_tag LOCUS_06320 7399 9246 CDS product lipid A ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_06320 9714 11432 gene locus_tag LOCUS_06330 9714 11432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence0058 2558 1074 gene locus_tag LOCUS_06340 gene ibeB 2558 1074 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123112.1 protein_id gnl|my_center|LOCUS_06340 3226 2555 gene locus_tag LOCUS_06350 3226 2555 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_06350 3429 4052 gene locus_tag LOCUS_06360 gene folE 3429 4052 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEA8 protein_id gnl|my_center|LOCUS_06360 5904 4075 gene locus_tag LOCUS_06370 5904 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 6061 6795 gene locus_tag LOCUS_06380 6061 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 8223 6811 gene locus_tag LOCUS_06390 8223 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 8942 8430 gene locus_tag LOCUS_06400 gene infC 8942 8430 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_06400 9549 9785 gene locus_tag LOCUS_06410 9549 9785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 9805 10239 gene locus_tag LOCUS_06420 gene msrB 9805 10239 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK9 protein_id gnl|my_center|LOCUS_06420 >Feature sequence0059 1791 997 gene locus_tag LOCUS_06430 1791 997 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_06430 2013 4106 gene locus_tag LOCUS_06440 2013 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4629 4174 gene locus_tag LOCUS_06450 4629 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 5071 4802 gene locus_tag LOCUS_06460 5071 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5682 5068 gene locus_tag LOCUS_06470 5682 5068 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S48 protein_id gnl|my_center|LOCUS_06470 9152 6468 gene locus_tag LOCUS_06480 9152 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141887.1 protein_id gnl|my_center|LOCUS_06480 10125 9163 gene locus_tag LOCUS_06490 10125 9163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 10874 10122 gene locus_tag LOCUS_06500 10874 10122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 11568 10864 gene locus_tag LOCUS_06510 gene sigX 11568 10864 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087834.1 protein_id gnl|my_center|LOCUS_06510 >Feature sequence0060 2110 686 gene locus_tag LOCUS_06520 2110 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 2813 2130 gene locus_tag LOCUS_06530 2813 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3862 2819 gene locus_tag LOCUS_06540 gene pilM 3862 2819 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_06540 5918 4176 gene locus_tag LOCUS_06550 gene ptsI 5918 4176 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMU0 protein_id gnl|my_center|LOCUS_06550 6263 5985 gene locus_tag LOCUS_06560 gene ptsH 6263 5985 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_06560 6732 6256 gene locus_tag LOCUS_06570 gene fruA 6732 6256 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_06570 7214 6852 gene locus_tag LOCUS_06580 gene yhbH 7214 6852 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021962.1 protein_id gnl|my_center|LOCUS_06580 8074 7280 gene locus_tag LOCUS_06590 8074 7280 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_06590 8936 8118 gene locus_tag LOCUS_06600 gene truA 8936 8118 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P70973 protein_id gnl|my_center|LOCUS_06600 10458 8953 gene locus_tag LOCUS_06610 10458 8953 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120948.1 protein_id gnl|my_center|LOCUS_06610 11230 10496 gene locus_tag LOCUS_06620 gene recR 11230 10496 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ68 protein_id gnl|my_center|LOCUS_06620 >Feature sequence0061 672 2438 gene locus_tag LOCUS_06630 672 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 2798 4069 gene locus_tag LOCUS_06640 2798 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 4063 7080 gene locus_tag LOCUS_06650 4063 7080 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_06650 7116 7895 gene locus_tag LOCUS_06660 7116 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 7910 9553 gene locus_tag LOCUS_06670 7910 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 9553 10242 gene locus_tag LOCUS_06680 9553 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 10288 10701 gene locus_tag LOCUS_06690 10288 10701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 10711 11370 gene locus_tag LOCUS_06700 10711 11370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence0062 <1 1018 gene locus_tag LOCUS_06710 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113084.1:L-serine dehydratase 1461 1033 gene locus_tag LOCUS_06720 1461 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 2414 1458 gene locus_tag LOCUS_06730 2414 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098658.1 protein_id gnl|my_center|LOCUS_06730 2592 5972 gene locus_tag LOCUS_06740 2592 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 6121 6969 gene locus_tag LOCUS_06750 6121 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 6983 8515 gene locus_tag LOCUS_06760 6983 8515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 8589 9395 gene locus_tag LOCUS_06770 8589 9395 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816773.1 protein_id gnl|my_center|LOCUS_06770 10081 9392 gene locus_tag LOCUS_06780 10081 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 10818 10183 gene locus_tag LOCUS_06790 10818 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 <11572 10890 gene locus_tag LOCUS_06800 <11572 10890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KL13:putative transport protein >Feature sequence0063 2 460 gene locus_tag LOCUS_06810 2 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 1603 614 gene locus_tag LOCUS_06820 1603 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 2664 1615 gene locus_tag LOCUS_06830 2664 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3722 2700 gene locus_tag LOCUS_06840 3722 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 4777 3737 gene locus_tag LOCUS_06850 4777 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 5826 4801 gene locus_tag LOCUS_06860 5826 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 6119 9721 gene locus_tag LOCUS_06870 6119 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 11032 9740 gene locus_tag LOCUS_06880 11032 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence0064 1909 1403 gene locus_tag LOCUS_06890 1909 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 5586 2083 gene locus_tag LOCUS_06900 5586 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 6062 7852 gene locus_tag LOCUS_06910 6062 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 7812 9710 gene locus_tag LOCUS_06920 7812 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 9631 10446 gene locus_tag LOCUS_06930 9631 10446 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence0065 3856 2150 gene locus_tag LOCUS_06940 3856 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 5431 4073 gene locus_tag LOCUS_06950 5431 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 6045 7130 gene locus_tag LOCUS_06960 6045 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 7432 7118 gene locus_tag LOCUS_06970 7432 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 7733 7434 gene locus_tag LOCUS_06980 7733 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 7910 8782 gene locus_tag LOCUS_06990 gene ttcA 7910 8782 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KS29 protein_id gnl|my_center|LOCUS_06990 9626 8799 gene locus_tag LOCUS_07000 9626 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 9939 9631 gene locus_tag LOCUS_07010 9939 9631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence0066 2424 1066 gene locus_tag LOCUS_07020 2424 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 3125 5566 gene locus_tag LOCUS_07030 3125 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 6293 5724 gene locus_tag LOCUS_07040 6293 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 9111 6457 gene locus_tag LOCUS_07050 9111 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 10836 9637 gene locus_tag LOCUS_07060 10836 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence0067 90 590 gene locus_tag LOCUS_07070 90 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1989 613 gene locus_tag LOCUS_07080 1989 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 3641 2184 gene locus_tag LOCUS_07090 3641 2184 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122335.1 protein_id gnl|my_center|LOCUS_07090 4928 3687 gene locus_tag LOCUS_07100 4928 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 7344 5038 gene locus_tag LOCUS_07110 gene atsD 7344 5038 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_07110 7916 8500 gene locus_tag LOCUS_07120 7916 8500 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_07120 10440 8932 gene locus_tag LOCUS_07130 10440 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 11245 10607 gene locus_tag LOCUS_07140 11245 10607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence0068 2937 1522 gene locus_tag LOCUS_07150 2937 1522 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_07150 3975 3007 gene locus_tag LOCUS_07160 3975 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3863 4141 gene locus_tag LOCUS_07170 3863 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4131 4508 gene locus_tag LOCUS_07180 4131 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 5560 4535 gene locus_tag LOCUS_07190 5560 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 6266 5625 gene locus_tag LOCUS_07200 6266 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 7558 6398 gene locus_tag LOCUS_07210 7558 6398 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918034.1 protein_id gnl|my_center|LOCUS_07210 9369 7567 gene locus_tag LOCUS_07220 gene lepA2 9369 7567 CDS product elongation factor 4 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UE01 protein_id gnl|my_center|LOCUS_07220 9546 10268 gene locus_tag LOCUS_07230 9546 10268 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903333.1 protein_id gnl|my_center|LOCUS_07230 10617 10297 gene locus_tag LOCUS_07240 10617 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 <11201 10614 gene locus_tag LOCUS_07250 <11201 10614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461556.1:ferredoxin-type protein NapF >Feature sequence0069 1199 495 gene locus_tag LOCUS_07260 1199 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 1951 1520 gene locus_tag LOCUS_07270 1951 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 2212 2138 gene locus_tag LOCUS_t00090 2212 2138 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2357 2935 gene locus_tag LOCUS_07280 2357 2935 CDS product BioY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_07280 4620 3064 gene locus_tag LOCUS_07290 4620 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 7780 4820 gene locus_tag LOCUS_07300 7780 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 9377 8115 gene locus_tag LOCUS_07310 9377 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 9750 11003 gene locus_tag LOCUS_07320 9750 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence0070 3338 990 gene locus_tag LOCUS_07330 3338 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 4950 3367 gene locus_tag LOCUS_07340 4950 3367 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892598.1 protein_id gnl|my_center|LOCUS_07340 5335 6630 gene locus_tag LOCUS_07350 5335 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 6840 7724 gene locus_tag LOCUS_07360 6840 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 8127 7771 gene locus_tag LOCUS_07370 8127 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 8767 8312 gene locus_tag LOCUS_07380 8767 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 8981 9625 gene locus_tag LOCUS_07390 8981 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 10139 11047 gene locus_tag LOCUS_07400 10139 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence0071 5415 3094 gene locus_tag LOCUS_07410 5415 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 5802 6353 gene locus_tag LOCUS_07420 5802 6353 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194622.1 protein_id gnl|my_center|LOCUS_07420 8912 6456 gene locus_tag LOCUS_07430 8912 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 9972 9103 gene locus_tag LOCUS_07440 9972 9103 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704134.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence0072 1779 874 gene locus_tag LOCUS_07450 1779 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07450 2079 1783 gene locus_tag LOCUS_07460 2079 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07460 2954 2166 gene locus_tag LOCUS_07470 gene tatC 2954 2166 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIZ6 protein_id gnl|my_center|LOCUS_07470 4297 3077 gene locus_tag LOCUS_07480 4297 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4763 5389 gene locus_tag LOCUS_07490 gene coaE 4763 5389 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2K7 protein_id gnl|my_center|LOCUS_07490 5558 7024 gene locus_tag LOCUS_07500 gene rho 5558 7024 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748A7 protein_id gnl|my_center|LOCUS_07500 7589 7041 gene locus_tag LOCUS_07510 7589 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 8029 7646 gene locus_tag LOCUS_07520 8029 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 8491 8045 gene locus_tag LOCUS_07530 8491 8045 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538074.1 protein_id gnl|my_center|LOCUS_07530 8644 9183 gene locus_tag LOCUS_07540 8644 9183 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005346.1 protein_id gnl|my_center|LOCUS_07540 9280 9714 gene locus_tag LOCUS_07550 9280 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 9711 10046 gene locus_tag LOCUS_07560 9711 10046 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_07560 10510 10043 gene locus_tag LOCUS_07570 10510 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence0073 <1 1267 gene locus_tag LOCUS_07580 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74FR5:DNA polymerase 1373 1756 gene locus_tag LOCUS_07590 1373 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 3472 1787 gene locus_tag LOCUS_07600 3472 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 5473 3557 gene locus_tag LOCUS_07610 5473 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 5734 6750 gene locus_tag LOCUS_07620 5734 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 7956 6772 gene locus_tag LOCUS_07630 7956 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 9410 7953 gene locus_tag LOCUS_07640 9410 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 10637 9444 gene locus_tag LOCUS_07650 10637 9444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117732.1 protein_id gnl|my_center|LOCUS_07650 10911 10827 gene locus_tag LOCUS_t00100 10911 10827 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0074 125 1078 gene locus_tag LOCUS_07660 125 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 1075 2019 gene locus_tag LOCUS_07670 gene draG 1075 2019 CDS product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_07670 2213 2947 gene locus_tag LOCUS_07680 2213 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 3772 2960 gene locus_tag LOCUS_07690 gene nei 3772 2960 CDS product putative endonuclease 8 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86820 protein_id gnl|my_center|LOCUS_07690 8330 3759 gene locus_tag LOCUS_07700 8330 3759 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030438.1 protein_id gnl|my_center|LOCUS_07700 <10929 8335 gene locus_tag LOCUS_07710 <10929 8335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031513.1:glycosyl hydrolase >Feature sequence0075 <1 690 gene locus_tag LOCUS_07720 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2VFK6:magnesium transporter MgtE 936 1616 gene locus_tag LOCUS_07730 936 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 1585 2250 gene locus_tag LOCUS_07740 gene thiE 1585 2250 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDL8 protein_id gnl|my_center|LOCUS_07740 2247 4712 gene locus_tag LOCUS_07750 2247 4712 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592867.1 protein_id gnl|my_center|LOCUS_07750 4821 5027 gene locus_tag LOCUS_07760 4821 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 5322 6548 gene locus_tag LOCUS_07770 gene ribBA 5322 6548 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHZ1 protein_id gnl|my_center|LOCUS_07770 6718 6545 gene locus_tag LOCUS_07780 6718 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 6833 7390 gene locus_tag LOCUS_07790 6833 7390 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LN3 protein_id gnl|my_center|LOCUS_07790 7424 7900 gene locus_tag LOCUS_07800 7424 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 7918 8268 gene locus_tag LOCUS_07810 7918 8268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 8269 10032 gene locus_tag LOCUS_07820 8269 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 10036 10569 gene locus_tag LOCUS_07830 10036 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 10848 10585 gene locus_tag LOCUS_07840 10848 10585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence0076 261 1139 gene locus_tag LOCUS_07850 gene prpB 261 1139 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5E2 protein_id gnl|my_center|LOCUS_07850 1136 2278 gene locus_tag LOCUS_07860 1136 2278 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKI8 protein_id gnl|my_center|LOCUS_07860 2283 3731 gene locus_tag LOCUS_07870 gene prpD 2283 3731 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706120.1 protein_id gnl|my_center|LOCUS_07870 4033 4704 gene locus_tag LOCUS_07880 4033 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 6361 4625 gene locus_tag LOCUS_07890 6361 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 6635 7030 gene locus_tag LOCUS_07900 6635 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 7089 7928 gene locus_tag LOCUS_07910 7089 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 7925 8803 gene locus_tag LOCUS_07920 7925 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 8832 9626 gene locus_tag LOCUS_07930 8832 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 9650 10510 gene locus_tag LOCUS_07940 9650 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence0077 3186 2020 gene locus_tag LOCUS_07950 3186 2020 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402870.1 protein_id gnl|my_center|LOCUS_07950 4203 3277 gene locus_tag LOCUS_07960 4203 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 4455 6074 gene locus_tag LOCUS_07970 4455 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 6148 7557 gene locus_tag LOCUS_07980 6148 7557 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_07980 7594 8913 gene locus_tag LOCUS_07990 gene pfkA 7594 8913 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXU6 protein_id gnl|my_center|LOCUS_07990 9801 8956 gene locus_tag LOCUS_08000 9801 8956 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G02 protein_id gnl|my_center|LOCUS_08000 10680 9820 gene locus_tag LOCUS_08010 10680 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence0078 2901 259 gene locus_tag LOCUS_08020 2901 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 5061 2986 gene locus_tag LOCUS_08030 gene thrS 5061 2986 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56881 protein_id gnl|my_center|LOCUS_08030 5170 6231 gene locus_tag LOCUS_08040 5170 6231 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403161.1 protein_id gnl|my_center|LOCUS_08040 6345 8714 gene locus_tag LOCUS_08050 6345 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 10368 8722 gene locus_tag LOCUS_08060 10368 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence0079 1730 3790 gene locus_tag LOCUS_08070 1730 3790 CDS product DMSO reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459173.1 protein_id gnl|my_center|LOCUS_08070 3787 5166 gene locus_tag LOCUS_08080 3787 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5160 5756 gene locus_tag LOCUS_08090 5160 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703913.1 protein_id gnl|my_center|LOCUS_08090 5897 7585 gene locus_tag LOCUS_08100 5897 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 9229 7604 gene locus_tag LOCUS_08110 9229 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence0080 796 170 gene locus_tag LOCUS_08120 gene nqrD 796 170 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV6 protein_id gnl|my_center|LOCUS_08120 1594 812 gene locus_tag LOCUS_08130 gene nqrC 1594 812 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_08130 2813 1584 gene locus_tag LOCUS_08140 gene nqrB 2813 1584 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 protein_id gnl|my_center|LOCUS_08140 4196 2853 gene locus_tag LOCUS_08150 gene nqrA 4196 2853 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_08150 5605 4535 gene locus_tag LOCUS_08160 5605 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 6173 6739 gene locus_tag LOCUS_08170 6173 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 6783 7271 gene locus_tag LOCUS_08180 6783 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 7458 9935 gene locus_tag LOCUS_08190 7458 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 <10752 9941 gene locus_tag LOCUS_08200 <10752 9941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CY6:RecBCD enzyme subunit RecD >Feature sequence0081 1050 442 gene locus_tag LOCUS_08210 1050 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 1256 3445 gene locus_tag LOCUS_08220 1256 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 3563 3910 gene locus_tag LOCUS_08230 3563 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 4620 3907 gene locus_tag LOCUS_08240 4620 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 8507 4782 gene locus_tag LOCUS_08250 8507 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 8733 10289 gene locus_tag LOCUS_08260 8733 10289 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802003.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence0082 1281 901 gene locus_tag LOCUS_08270 1281 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1446 1850 gene locus_tag LOCUS_08280 1446 1850 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070485.1 protein_id gnl|my_center|LOCUS_08280 1847 2752 gene locus_tag LOCUS_08290 1847 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 2749 4200 gene locus_tag LOCUS_08300 2749 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 4304 5614 gene locus_tag LOCUS_08310 gene ndh 4304 5614 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932061.1 protein_id gnl|my_center|LOCUS_08310 5663 6484 gene locus_tag LOCUS_08320 5663 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 6753 10133 gene locus_tag LOCUS_08330 6753 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence0083 123 1133 gene locus_tag LOCUS_08340 123 1133 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122352.1 protein_id gnl|my_center|LOCUS_08340 1245 3164 gene locus_tag LOCUS_08350 1245 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_08350 3174 4337 gene locus_tag LOCUS_08360 3174 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 4391 4810 gene locus_tag LOCUS_08370 4391 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119515.1 protein_id gnl|my_center|LOCUS_08370 4844 5605 gene locus_tag LOCUS_08380 4844 5605 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527978.1 protein_id gnl|my_center|LOCUS_08380 6988 5654 gene locus_tag LOCUS_08390 6988 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 8375 7080 gene locus_tag LOCUS_08400 8375 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 8768 8496 gene locus_tag LOCUS_08410 8768 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 8707 9279 gene locus_tag LOCUS_08420 8707 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 10278 9304 gene locus_tag LOCUS_08430 10278 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_08430 10453 10379 gene locus_tag LOCUS_t00110 10453 10379 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0084 1671 781 gene locus_tag LOCUS_08440 gene hisG 1671 781 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_08440 2119 3201 gene locus_tag LOCUS_08450 2119 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267015.1 protein_id gnl|my_center|LOCUS_08450 3393 3854 gene locus_tag LOCUS_08460 3393 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 4449 3886 gene locus_tag LOCUS_08470 4449 3886 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229518.1 protein_id gnl|my_center|LOCUS_08470 4479 4943 gene locus_tag LOCUS_08480 4479 4943 CDS product UPF0403 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2G5 protein_id gnl|my_center|LOCUS_08480 5108 6238 gene locus_tag LOCUS_08490 gene mqnE 5108 6238 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SK48 protein_id gnl|my_center|LOCUS_08490 6235 7140 gene locus_tag LOCUS_08500 gene mqnA 6235 7140 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT25 protein_id gnl|my_center|LOCUS_08500 7137 8276 gene locus_tag LOCUS_08510 gene mqnC 7137 8276 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727U7 protein_id gnl|my_center|LOCUS_08510 8299 9087 gene locus_tag LOCUS_08520 8299 9087 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_08520 9087 10562 gene locus_tag LOCUS_08530 9087 10562 CDS product 2-hydroxymuconic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence0085 743 1558 gene locus_tag LOCUS_08540 743 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 1651 2298 gene locus_tag LOCUS_08550 1651 2298 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_08550 2763 2308 gene locus_tag LOCUS_08560 2763 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 2868 3809 gene locus_tag LOCUS_08570 2868 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 3815 5539 gene locus_tag LOCUS_08580 3815 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 6322 5615 gene locus_tag LOCUS_08590 6322 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 7459 6605 gene locus_tag LOCUS_08600 7459 6605 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_08600 7573 8781 gene locus_tag LOCUS_08610 7573 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 8974 9798 gene locus_tag LOCUS_08620 8974 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence0086 <1 1967 gene locus_tag LOCUS_08630 <1 1967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071716.1:periplasmic peptidase family S9 4274 1974 gene locus_tag LOCUS_08640 4274 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 4724 6412 gene locus_tag LOCUS_08650 4724 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 6655 7758 gene locus_tag LOCUS_08660 6655 7758 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_08660 7829 9763 gene locus_tag LOCUS_08670 7829 9763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence0087 835 371 gene locus_tag LOCUS_08680 gene ribH 835 371 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61723 protein_id gnl|my_center|LOCUS_08680 4489 1352 gene locus_tag LOCUS_08690 4489 1352 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403935.1 protein_id gnl|my_center|LOCUS_08690 8028 4486 gene locus_tag LOCUS_08700 8028 4486 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_08700 9416 8025 gene locus_tag LOCUS_08710 9416 8025 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence0088 1497 118 gene locus_tag LOCUS_08720 1497 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 2316 1534 gene locus_tag LOCUS_08730 2316 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 2751 2350 gene locus_tag LOCUS_08740 2751 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 2856 4697 gene locus_tag LOCUS_08750 2856 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 4809 6146 gene locus_tag LOCUS_08760 4809 6146 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118427.1 protein_id gnl|my_center|LOCUS_08760 6143 6961 gene locus_tag LOCUS_08770 6143 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 8380 6980 gene locus_tag LOCUS_08780 gene clsA 8380 6980 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63799 protein_id gnl|my_center|LOCUS_08780 9374 8511 gene locus_tag LOCUS_08790 9374 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902823.1 protein_id gnl|my_center|LOCUS_08790 10345 9371 gene locus_tag LOCUS_08800 10345 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence0089 <1 523 gene locus_tag LOCUS_08810 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q725V9:dihydroorotate dehydrogenase 520 1329 gene locus_tag LOCUS_08820 520 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1379 3976 gene locus_tag LOCUS_08830 gene secA 1379 3976 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DV4 protein_id gnl|my_center|LOCUS_08830 3949 5373 gene locus_tag LOCUS_08840 gene kdtA 3949 5373 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_08840 5370 6530 gene locus_tag LOCUS_08850 gene metK 5370 6530 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61946 protein_id gnl|my_center|LOCUS_08850 6652 7287 gene locus_tag LOCUS_08860 6652 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 7608 8204 gene locus_tag LOCUS_08870 7608 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 8288 8731 gene locus_tag LOCUS_08880 gene rplM 8288 8731 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6V8 protein_id gnl|my_center|LOCUS_08880 8809 9204 gene locus_tag LOCUS_08890 gene rpsI 8809 9204 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J12 protein_id gnl|my_center|LOCUS_08890 >Feature sequence0090 2738 75 gene locus_tag LOCUS_08900 2738 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 3618 2950 gene locus_tag LOCUS_08910 3618 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 4006 5253 gene locus_tag LOCUS_08920 4006 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 5250 6485 gene locus_tag LOCUS_08930 5250 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 6529 8886 gene locus_tag LOCUS_08940 6529 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 8983 10251 gene locus_tag LOCUS_08950 8983 10251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence0091 536 1066 gene locus_tag LOCUS_08960 536 1066 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z8 protein_id gnl|my_center|LOCUS_08960 1232 2338 gene locus_tag LOCUS_08970 1232 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 2335 3789 gene locus_tag LOCUS_08980 2335 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 4267 3803 gene locus_tag LOCUS_08990 4267 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 5601 4402 gene locus_tag LOCUS_09000 5601 4402 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887646.1 protein_id gnl|my_center|LOCUS_09000 7325 5598 gene locus_tag LOCUS_09010 7325 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 7529 7894 gene locus_tag LOCUS_09020 7529 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 8715 8026 gene locus_tag LOCUS_09030 8715 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 9281 8835 gene locus_tag LOCUS_09040 9281 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence0092 880 1092 gene locus_tag LOCUS_09050 880 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 1089 1619 gene locus_tag LOCUS_09060 1089 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1616 2047 gene locus_tag LOCUS_09070 1616 2047 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861737.1 protein_id gnl|my_center|LOCUS_09070 2188 2511 gene locus_tag LOCUS_09080 2188 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2529 2741 gene locus_tag LOCUS_09090 2529 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2758 3054 gene locus_tag LOCUS_09100 2758 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 3054 3329 gene locus_tag LOCUS_09110 3054 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3487 3825 gene locus_tag LOCUS_09120 3487 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3995 5371 gene locus_tag LOCUS_09130 3995 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 6722 8086 gene locus_tag LOCUS_09140 6722 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 8354 9697 gene locus_tag LOCUS_09150 8354 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence0093 2198 1788 gene locus_tag LOCUS_09160 2198 1788 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903023.1 protein_id gnl|my_center|LOCUS_09160 2600 2388 gene locus_tag LOCUS_09170 2600 2388 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_09170 3573 2896 gene locus_tag LOCUS_09180 3573 2896 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940859.1 protein_id gnl|my_center|LOCUS_09180 3701 4222 gene locus_tag LOCUS_09190 3701 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 4369 6594 gene locus_tag LOCUS_09200 gene icd 4369 6594 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038863.1 protein_id gnl|my_center|LOCUS_09200 7789 6629 gene locus_tag LOCUS_09210 7789 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117732.1 protein_id gnl|my_center|LOCUS_09210 8592 7786 gene locus_tag LOCUS_09220 8592 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence0094 2947 413 gene locus_tag LOCUS_09230 2947 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2946 3221 gene locus_tag LOCUS_09240 2946 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 3218 3745 gene locus_tag LOCUS_09250 3218 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328395.1 protein_id gnl|my_center|LOCUS_09250 4240 3848 gene locus_tag LOCUS_09260 gene atpC 4240 3848 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88UU4 protein_id gnl|my_center|LOCUS_09260 5655 4237 gene locus_tag LOCUS_09270 gene atpD 5655 4237 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2J5 protein_id gnl|my_center|LOCUS_09270 6635 5739 gene locus_tag LOCUS_09280 gene atpG 6635 5739 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2J4 protein_id gnl|my_center|LOCUS_09280 8191 6671 gene locus_tag LOCUS_09290 gene atpA 8191 6671 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFX7 protein_id gnl|my_center|LOCUS_09290 8873 8325 gene locus_tag LOCUS_09300 gene atpH 8873 8325 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RGY4 protein_id gnl|my_center|LOCUS_09300 9422 8895 gene locus_tag LOCUS_09310 gene atpF 9422 8895 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI20 protein_id gnl|my_center|LOCUS_09310 9755 9438 gene locus_tag LOCUS_09320 9755 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence0095 1639 275 gene locus_tag LOCUS_09330 1639 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2241 1636 gene locus_tag LOCUS_09340 2241 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2586 4043 gene locus_tag LOCUS_09350 2586 4043 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084306.1 protein_id gnl|my_center|LOCUS_09350 4147 8406 gene locus_tag LOCUS_09360 4147 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 9288 8419 gene locus_tag LOCUS_09370 9288 8419 CDS product deacetylase sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836183.1 protein_id gnl|my_center|LOCUS_09370 <10148 9285 gene locus_tag LOCUS_09380 <10148 9285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704560.1:putative glycosyltransferase >Feature sequence0096 3238 1406 gene locus_tag LOCUS_09390 3238 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 3355 5079 gene locus_tag LOCUS_09400 3355 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 5218 6822 gene locus_tag LOCUS_09410 5218 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 9594 6925 gene locus_tag LOCUS_09420 9594 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence0097 261 1991 gene locus_tag LOCUS_09430 261 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09430 1988 3151 gene locus_tag LOCUS_09440 1988 3151 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_09440 3279 5213 gene locus_tag LOCUS_09450 gene htpG 3279 5213 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61185 protein_id gnl|my_center|LOCUS_09450 5252 6826 gene locus_tag LOCUS_09460 5252 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 7072 9633 gene locus_tag LOCUS_09470 7072 9633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence0098 1737 892 gene locus_tag LOCUS_09480 gene yfiL 1737 892 CDS product putative ABC transporter ATP-binding protein YfiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94440 protein_id gnl|my_center|LOCUS_09480 2362 1742 gene locus_tag LOCUS_09490 2362 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2467 4227 gene locus_tag LOCUS_09500 2467 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 5789 4383 gene locus_tag LOCUS_09510 5789 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 6403 6855 gene locus_tag LOCUS_09520 gene yuxK 6403 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_09520 7023 7250 gene locus_tag LOCUS_09530 7023 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 7445 8095 gene locus_tag LOCUS_09540 7445 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 8901 8092 gene locus_tag LOCUS_09550 gene trmH 8901 8092 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970830.1 protein_id gnl|my_center|LOCUS_09550 9503 8898 gene locus_tag LOCUS_09560 9503 8898 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939708.1 protein_id gnl|my_center|LOCUS_09560 9666 10019 gene locus_tag LOCUS_09570 9666 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence0099 746 2131 gene locus_tag LOCUS_09580 746 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2176 2886 gene locus_tag LOCUS_09590 2176 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3410 2868 gene locus_tag LOCUS_09600 3410 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3700 7206 gene locus_tag LOCUS_09610 3700 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 8926 7301 gene locus_tag LOCUS_09620 8926 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence0100 1956 2495 gene locus_tag LOCUS_09630 gene outG 1956 2495 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817003.1 protein_id gnl|my_center|LOCUS_09630 3088 4809 gene locus_tag LOCUS_09640 3088 4809 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_09640 4818 6026 gene locus_tag LOCUS_09650 4818 6026 CDS product phytochrome sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_09650 6118 7788 gene locus_tag LOCUS_09660 6118 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 7805 8398 gene locus_tag LOCUS_09670 7805 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 8416 8967 gene locus_tag LOCUS_09680 8416 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence0101 590 51 gene locus_tag LOCUS_09690 590 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1159 587 gene locus_tag LOCUS_09700 1159 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2949 1156 gene locus_tag LOCUS_09710 2949 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 3434 2952 gene locus_tag LOCUS_09720 3434 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 3955 3434 gene locus_tag LOCUS_09730 3955 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 5181 3952 gene locus_tag LOCUS_09740 5181 3952 CDS product general secretion pathway protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938567.1 protein_id gnl|my_center|LOCUS_09740 6931 5210 gene locus_tag LOCUS_09750 6931 5210 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_09750 7341 6952 gene locus_tag LOCUS_09760 7341 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 7863 7462 gene locus_tag LOCUS_09770 7863 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 8308 9255 gene locus_tag LOCUS_09780 8308 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence0102 1498 2034 gene locus_tag LOCUS_09790 1498 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2651 2031 gene locus_tag LOCUS_09800 2651 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 3718 2648 gene locus_tag LOCUS_09810 3718 2648 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_09810 3880 4110 gene locus_tag LOCUS_09820 3880 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4154 5356 gene locus_tag LOCUS_09830 gene rtcB 4154 5356 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX85 protein_id gnl|my_center|LOCUS_09830 6723 5401 gene locus_tag LOCUS_09840 6723 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 7690 6908 gene locus_tag LOCUS_09850 7690 6908 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_09850 8812 7703 gene locus_tag LOCUS_09860 8812 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 9663 8809 gene locus_tag LOCUS_09870 gene hbdA 9663 8809 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence0103 589 350 gene locus_tag LOCUS_09880 589 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 552 2588 gene locus_tag LOCUS_09890 552 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 2789 3466 gene locus_tag LOCUS_09900 2789 3466 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_09900 3608 5362 gene locus_tag LOCUS_09910 3608 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 5590 6876 gene locus_tag LOCUS_09920 5590 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 6999 7220 gene locus_tag LOCUS_09930 6999 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 8406 7321 gene locus_tag LOCUS_09940 8406 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 8766 9347 gene locus_tag LOCUS_09950 8766 9347 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence0104 1721 21 gene locus_tag LOCUS_09960 1721 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 3973 1718 gene locus_tag LOCUS_09970 3973 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 5186 4065 gene locus_tag LOCUS_09980 5186 4065 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_09980 5866 5183 gene locus_tag LOCUS_09990 5866 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 6107 6796 gene locus_tag LOCUS_10000 gene aqpZ 6107 6796 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MQ5 protein_id gnl|my_center|LOCUS_10000 6873 7763 gene locus_tag LOCUS_10010 6873 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 8672 7857 gene locus_tag LOCUS_10020 8672 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 9138 9062 gene locus_tag LOCUS_t00120 9138 9062 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0105 1530 301 gene locus_tag LOCUS_10030 1530 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1629 2915 gene locus_tag LOCUS_10040 1629 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 3162 3632 gene locus_tag LOCUS_10050 3162 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 3637 4395 gene locus_tag LOCUS_10060 3637 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4397 6145 gene locus_tag LOCUS_10070 4397 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 6392 7147 gene locus_tag LOCUS_10080 6392 7147 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327495.1 protein_id gnl|my_center|LOCUS_10080 7159 9042 gene locus_tag LOCUS_10090 7159 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence0106 3097 272 gene locus_tag LOCUS_10100 3097 272 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_10100 4805 3204 gene locus_tag LOCUS_10110 4805 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 5988 4963 gene locus_tag LOCUS_10120 gene thiF 5988 4963 CDS product sulfur carrier protein ThiS adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31619 protein_id gnl|my_center|LOCUS_10120 6877 6002 gene locus_tag LOCUS_10130 6877 6002 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256602.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence0107 7276 1355 gene locus_tag LOCUS_10140 7276 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 7409 8548 gene locus_tag LOCUS_10150 7409 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence0108 542 1885 gene locus_tag LOCUS_10160 542 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_10160 2723 1914 gene locus_tag LOCUS_10170 2723 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10170 2987 2817 gene locus_tag LOCUS_10180 2987 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10180 4295 3003 gene locus_tag LOCUS_10190 4295 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 4442 5017 gene locus_tag LOCUS_10200 4442 5017 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_10200 5014 8832 gene locus_tag LOCUS_10210 5014 8832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence0109 1224 2108 gene locus_tag LOCUS_10220 1224 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 2328 3194 gene locus_tag LOCUS_10230 gene wzm 2328 3194 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RJ0 protein_id gnl|my_center|LOCUS_10230 3202 4455 gene locus_tag LOCUS_10240 gene tagH 3202 4455 CDS product teichoic acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_10240 4523 6388 gene locus_tag LOCUS_10250 4523 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 6385 7533 gene locus_tag LOCUS_10260 6385 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 7719 9092 gene locus_tag LOCUS_10270 7719 9092 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence0110 126 569 gene locus_tag LOCUS_10280 126 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 714 1514 gene locus_tag LOCUS_10290 714 1514 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090743.1 protein_id gnl|my_center|LOCUS_10290 1527 1922 gene locus_tag LOCUS_10300 1527 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1951 2382 gene locus_tag LOCUS_10310 1951 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085641.1 protein_id gnl|my_center|LOCUS_10310 2402 2854 gene locus_tag LOCUS_10320 2402 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 2998 3288 gene locus_tag LOCUS_10330 2998 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 3299 3628 gene locus_tag LOCUS_10340 3299 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3643 4635 gene locus_tag LOCUS_10350 3643 4635 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 protein_id gnl|my_center|LOCUS_10350 4649 4957 gene locus_tag LOCUS_10360 4649 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 5123 5425 gene locus_tag LOCUS_10370 5123 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 5482 6267 gene locus_tag LOCUS_10380 5482 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 6318 6992 gene locus_tag LOCUS_10390 6318 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 7024 7434 gene locus_tag LOCUS_10400 7024 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 7498 7887 gene locus_tag LOCUS_10410 7498 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 7887 8183 gene locus_tag LOCUS_10420 7887 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 8180 8695 gene locus_tag LOCUS_10430 8180 8695 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110142.1 protein_id gnl|my_center|LOCUS_10430 8800 9159 gene locus_tag LOCUS_10440 8800 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_10440 9169 9438 gene locus_tag LOCUS_10450 9169 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence0111 3256 2675 gene locus_tag LOCUS_10460 3256 2675 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_10460 3760 3443 gene locus_tag LOCUS_10470 3760 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 4358 3873 gene locus_tag LOCUS_10480 4358 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975131.1 protein_id gnl|my_center|LOCUS_10480 5782 4448 gene locus_tag LOCUS_10490 5782 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 7508 5799 gene locus_tag LOCUS_10500 7508 5799 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_10500 8916 7522 gene locus_tag LOCUS_10510 8916 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 9523 9041 gene locus_tag LOCUS_10520 gene rimP 9523 9041 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62KK7 protein_id gnl|my_center|LOCUS_10520 >Feature sequence0112 2518 416 gene locus_tag LOCUS_10530 gene yuxL 2518 416 CDS product putative peptidase YuxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39839 protein_id gnl|my_center|LOCUS_10530 2830 4128 gene locus_tag LOCUS_10540 2830 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 5420 4125 gene locus_tag LOCUS_10550 5420 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5908 5528 gene locus_tag LOCUS_10560 5908 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 6053 8680 gene locus_tag LOCUS_10570 6053 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence0113 3387 961 gene locus_tag LOCUS_10580 3387 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 3776 3387 gene locus_tag LOCUS_10590 3776 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 4793 3981 gene locus_tag LOCUS_10600 4793 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 5692 4793 gene locus_tag LOCUS_10610 5692 4793 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626569.1 protein_id gnl|my_center|LOCUS_10610 6360 5689 gene locus_tag LOCUS_10620 gene nth 6360 5689 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_10620 7235 6426 gene locus_tag LOCUS_10630 7235 6426 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU05 protein_id gnl|my_center|LOCUS_10630 7384 8193 gene locus_tag LOCUS_10640 7384 8193 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_10640 >Feature sequence0114 416 1876 gene locus_tag LOCUS_10650 416 1876 CDS product peptidoglycan lytic exotransglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPK5 protein_id gnl|my_center|LOCUS_10650 2981 2112 gene locus_tag LOCUS_10660 2981 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 3529 2978 gene locus_tag LOCUS_10670 3529 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 4148 3612 gene locus_tag LOCUS_10680 4148 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 4398 5189 gene locus_tag LOCUS_10690 4398 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 6243 5233 gene locus_tag LOCUS_10700 6243 5233 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330332.1 protein_id gnl|my_center|LOCUS_10700 9132 6298 gene locus_tag LOCUS_10710 9132 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence0115 3893 1767 gene locus_tag LOCUS_10720 3893 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 6084 3973 gene locus_tag LOCUS_10730 6084 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 8276 6144 gene locus_tag LOCUS_10740 8276 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 8652 8897 gene locus_tag LOCUS_10750 8652 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence0116 <1 1832 gene locus_tag LOCUS_10760 <1 1832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120924.1:membrane protein 1942 4353 gene locus_tag LOCUS_10770 1942 4353 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122099.1 protein_id gnl|my_center|LOCUS_10770 4350 8666 gene locus_tag LOCUS_10780 4350 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence0117 50 1363 gene locus_tag LOCUS_10790 gene folC 50 1363 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141076.1 protein_id gnl|my_center|LOCUS_10790 2441 1410 gene locus_tag LOCUS_10800 2441 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2659 2734 gene locus_tag LOCUS_t00130 2659 2734 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3936 2797 gene locus_tag LOCUS_10810 3936 2797 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_10810 4110 7046 gene locus_tag LOCUS_10820 gene valS 4110 7046 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL27 protein_id gnl|my_center|LOCUS_10820 7096 8367 gene locus_tag LOCUS_10830 gene sat 7096 8367 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CR03 protein_id gnl|my_center|LOCUS_10830 >Feature sequence0118 2876 2235 gene locus_tag LOCUS_10840 2876 2235 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123848.1 protein_id gnl|my_center|LOCUS_10840 4152 3169 gene locus_tag LOCUS_10850 4152 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4694 6112 gene locus_tag LOCUS_10860 4694 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 6397 7572 gene locus_tag LOCUS_10870 6397 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 8874 7603 gene locus_tag LOCUS_10880 8874 7603 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence0119 2698 881 gene locus_tag LOCUS_10890 2698 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 4587 2881 gene locus_tag LOCUS_10900 4587 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 5171 4650 gene locus_tag LOCUS_10910 5171 4650 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 protein_id gnl|my_center|LOCUS_10910 5902 5168 gene locus_tag LOCUS_10920 5902 5168 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403528.1 protein_id gnl|my_center|LOCUS_10920 6015 8819 gene locus_tag LOCUS_10930 gene alaS 6015 8819 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG04 protein_id gnl|my_center|LOCUS_10930 >Feature sequence0120 196 975 gene locus_tag LOCUS_10940 gene map 196 975 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG27 protein_id gnl|my_center|LOCUS_10940 1162 1374 gene locus_tag LOCUS_10950 gene infA 1162 1374 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WSB2 protein_id gnl|my_center|LOCUS_10950 1639 2022 gene locus_tag LOCUS_10960 gene rpsM 1639 2022 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5U9 protein_id gnl|my_center|LOCUS_10960 2117 2497 gene locus_tag LOCUS_10970 gene rpsK 2117 2497 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC6 protein_id gnl|my_center|LOCUS_10970 2652 3278 gene locus_tag LOCUS_10980 gene rpsD 2652 3278 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG23 protein_id gnl|my_center|LOCUS_10980 3301 4308 gene locus_tag LOCUS_10990 gene rpoA 3301 4308 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC5 protein_id gnl|my_center|LOCUS_10990 4346 4759 gene locus_tag LOCUS_11000 4346 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 8380 4910 gene locus_tag LOCUS_11010 8380 4910 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB7 protein_id gnl|my_center|LOCUS_11010 >Feature sequence0121 570 1880 gene locus_tag LOCUS_11020 570 1880 CDS product dihydropyrimidine dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_11020 1920 3413 gene locus_tag LOCUS_11030 gene mmsA 1920 3413 CDS product methylmalonate-semialdehyde dehydrogenase [acylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28810 protein_id gnl|my_center|LOCUS_11030 3444 4835 gene locus_tag LOCUS_11040 gene dht 3444 4835 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140243.1 protein_id gnl|my_center|LOCUS_11040 4832 5404 gene locus_tag LOCUS_11050 gene yjhQ 4832 5404 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123139.1 protein_id gnl|my_center|LOCUS_11050 5445 5789 gene locus_tag LOCUS_11060 5445 5789 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313912.1 protein_id gnl|my_center|LOCUS_11060 6122 5802 gene locus_tag LOCUS_11070 6122 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_11070 6377 6141 gene locus_tag LOCUS_11080 6377 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 6598 6374 gene locus_tag LOCUS_11090 6598 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 7997 6906 gene locus_tag LOCUS_11100 7997 6906 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence0122 118 1206 gene locus_tag LOCUS_11110 118 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1316 1678 gene locus_tag LOCUS_11120 1316 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1957 2520 gene locus_tag LOCUS_11130 1957 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703843.1 protein_id gnl|my_center|LOCUS_11130 2527 2898 gene locus_tag LOCUS_11140 2527 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 3715 2990 gene locus_tag LOCUS_11150 3715 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 3696 3905 gene locus_tag LOCUS_11160 3696 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 4410 3946 gene locus_tag LOCUS_11170 4410 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 5008 4349 gene locus_tag LOCUS_11180 5008 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 5797 5150 gene locus_tag LOCUS_11190 5797 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 6036 6392 gene locus_tag LOCUS_11200 6036 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 6406 6861 gene locus_tag LOCUS_11210 6406 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 6858 7427 gene locus_tag LOCUS_11220 6858 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 7859 7548 gene locus_tag LOCUS_11230 7859 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 8593 7856 gene locus_tag LOCUS_11240 8593 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 8814 8593 gene locus_tag LOCUS_11250 8814 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence0123 <1 3138 gene locus_tag LOCUS_11260 <1 3138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0WIL0:chondroitin sulfate ABC lyase 3397 3173 gene locus_tag LOCUS_11270 3397 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 3496 5127 gene locus_tag LOCUS_11280 3496 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 5159 7810 gene locus_tag LOCUS_11290 5159 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 <8967 7807 gene locus_tag LOCUS_11300 <8967 7807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403153.1:sodium:solute symporter >Feature sequence0124 485 1561 gene locus_tag LOCUS_11310 485 1561 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYT3 protein_id gnl|my_center|LOCUS_11310 1549 2352 gene locus_tag LOCUS_11320 1549 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3886 2354 gene locus_tag LOCUS_11330 3886 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 6938 3993 gene locus_tag LOCUS_11340 6938 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 7500 6859 gene locus_tag LOCUS_11350 7500 6859 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123524.1 protein_id gnl|my_center|LOCUS_11350 8029 7616 gene locus_tag LOCUS_11360 8029 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 8367 8795 gene locus_tag LOCUS_11370 8367 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence0125 3067 1061 gene locus_tag LOCUS_11380 3067 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 3264 3485 gene locus_tag LOCUS_11390 3264 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 4745 3507 gene locus_tag LOCUS_11400 gene queG 4745 3507 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCT7 protein_id gnl|my_center|LOCUS_11400 4935 7874 gene locus_tag LOCUS_11410 4935 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence0126 1957 1352 gene locus_tag LOCUS_11420 gene atpD 1957 1352 CDS product ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_11420 3323 1992 gene locus_tag LOCUS_11430 gene atpB 3323 1992 CDS product V-type ATP synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51120 protein_id gnl|my_center|LOCUS_11430 4914 3472 gene locus_tag LOCUS_11440 4914 3472 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 protein_id gnl|my_center|LOCUS_11440 6572 5262 gene locus_tag LOCUS_11450 6572 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 8256 7075 gene locus_tag LOCUS_11460 gene iscS 8256 7075 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_11460 <8857 8253 gene locus_tag LOCUS_11470 <8857 8253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120685.1:squalene--hopene cyclase >Feature sequence0127 <1 1498 gene locus_tag LOCUS_11480 <1 1498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065100.1:peptide transporter 4519 1604 gene locus_tag LOCUS_11490 4519 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 6205 4670 gene locus_tag LOCUS_11500 6205 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 8681 6252 gene locus_tag LOCUS_11510 8681 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence0128 322 2163 gene locus_tag LOCUS_11520 322 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 3611 2334 gene locus_tag LOCUS_11530 3611 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 3922 5010 gene locus_tag LOCUS_11540 3922 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 5288 6901 gene locus_tag LOCUS_11550 5288 6901 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_11550 7198 6914 gene locus_tag LOCUS_11560 7198 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence0129 1217 684 gene locus_tag LOCUS_11570 1217 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 2971 1304 gene locus_tag LOCUS_11580 2971 1304 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121514.1 protein_id gnl|my_center|LOCUS_11580 3587 3066 gene locus_tag LOCUS_tm00010 3587 3066 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3141 3066 gene locus_tag LOCUS_t00140 3141 3066 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4402 5538 gene locus_tag LOCUS_11590 4402 5538 CDS product Rossman fold protein, TIGR00730 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122653.1 protein_id gnl|my_center|LOCUS_11590 6643 5513 gene locus_tag LOCUS_11600 6643 5513 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_11600 6918 7964 gene locus_tag LOCUS_11610 6918 7964 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence0130 1557 466 gene locus_tag LOCUS_11620 1557 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1840 2433 gene locus_tag LOCUS_11630 1840 2433 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_11630 2430 4781 gene locus_tag LOCUS_11640 2430 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 5200 4850 gene locus_tag LOCUS_11650 5200 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5255 5632 gene locus_tag LOCUS_11660 5255 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 5805 6083 gene locus_tag LOCUS_11670 5805 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_11670 7712 6096 gene locus_tag LOCUS_11680 7712 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence0131 966 187 gene locus_tag LOCUS_11690 gene mntA 966 187 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_11690 1976 963 gene locus_tag LOCUS_11700 gene mtsA 1976 963 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123738.1 protein_id gnl|my_center|LOCUS_11700 2114 2791 gene locus_tag LOCUS_11710 2114 2791 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728504.1 protein_id gnl|my_center|LOCUS_11710 3025 2822 gene locus_tag LOCUS_11720 3025 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2939 4189 gene locus_tag LOCUS_11730 gene gdhA 2939 4189 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAX7 protein_id gnl|my_center|LOCUS_11730 4208 4573 gene locus_tag LOCUS_11740 4208 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 5993 4629 gene locus_tag LOCUS_11750 5993 4629 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_11750 <8782 6053 gene locus_tag LOCUS_11760 <8782 6053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118165.1:N-acetylglucosamine-6-phosphate deacetylase >Feature sequence0132 <1 899 gene locus_tag LOCUS_11770 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942289.1:energy-dependent translational throttle protein EttA 1206 2207 gene locus_tag LOCUS_11780 1206 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 2294 2962 gene locus_tag LOCUS_11790 2294 2962 CDS product putative RNA polymerase sigma E protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_145450.2 protein_id gnl|my_center|LOCUS_11790 2959 3783 gene locus_tag LOCUS_11800 2959 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 3797 5053 gene locus_tag LOCUS_11810 3797 5053 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_11810 5050 5850 gene locus_tag LOCUS_11820 5050 5850 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942965.1 protein_id gnl|my_center|LOCUS_11820 5891 7162 gene locus_tag LOCUS_11830 5891 7162 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_11830 7159 7953 gene locus_tag LOCUS_11840 7159 7953 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence0133 3700 1967 gene locus_tag LOCUS_11850 3700 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 3606 4046 gene locus_tag LOCUS_11860 3606 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 4092 5132 gene locus_tag LOCUS_11870 4092 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 5521 5811 gene locus_tag LOCUS_11880 5521 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 5817 6152 gene locus_tag LOCUS_11890 5817 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 7131 6181 gene locus_tag LOCUS_11900 7131 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 8053 7193 gene locus_tag LOCUS_11910 8053 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence0134 1816 188 gene locus_tag LOCUS_11920 1816 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2027 3208 gene locus_tag LOCUS_11930 2027 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 5311 3284 gene locus_tag LOCUS_11940 5311 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 5539 6516 gene locus_tag LOCUS_11950 5539 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 7301 6534 gene locus_tag LOCUS_11960 7301 6534 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688976.1 protein_id gnl|my_center|LOCUS_11960 7544 8041 gene locus_tag LOCUS_11970 gene purE 7544 8041 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKX9 protein_id gnl|my_center|LOCUS_11970 >Feature sequence0135 2 919 gene locus_tag LOCUS_11980 2 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1023 1811 gene locus_tag LOCUS_11990 1023 1811 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462425.1 protein_id gnl|my_center|LOCUS_11990 1818 2450 gene locus_tag LOCUS_12000 1818 2450 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_12000 3656 2580 gene locus_tag LOCUS_12010 gene nrdB 3656 2580 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MK81 protein_id gnl|my_center|LOCUS_12010 6739 3854 gene locus_tag LOCUS_12020 gene nrdA 6739 3854 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MCP2 protein_id gnl|my_center|LOCUS_12020 >Feature sequence0136 360 1724 gene locus_tag LOCUS_12030 360 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1721 2206 gene locus_tag LOCUS_12040 gene ruvC 1721 2206 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIH6 protein_id gnl|my_center|LOCUS_12040 3553 2234 gene locus_tag LOCUS_12050 3553 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3683 4087 gene locus_tag LOCUS_12060 3683 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 4084 4974 gene locus_tag LOCUS_12070 4084 4974 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_12070 4971 5819 gene locus_tag LOCUS_12080 4971 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 5914 6297 gene locus_tag LOCUS_12090 5914 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 7249 7584 gene locus_tag LOCUS_12100 7249 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 7984 7793 gene locus_tag LOCUS_12110 7984 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence0137 <1 1187 gene locus_tag LOCUS_12120 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919501.1:nucleoside permease 1209 2669 gene locus_tag LOCUS_12130 1209 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2669 5314 gene locus_tag LOCUS_12140 2669 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 7771 5324 gene locus_tag LOCUS_12150 7771 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence0138 2 928 gene locus_tag LOCUS_12160 2 928 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_12160 925 1989 gene locus_tag LOCUS_12170 925 1989 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTQ8 protein_id gnl|my_center|LOCUS_12170 2968 1973 gene locus_tag LOCUS_12180 gene acdS 2968 1973 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62CE3 protein_id gnl|my_center|LOCUS_12180 3109 3276 gene locus_tag LOCUS_12190 3109 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 3405 3860 gene locus_tag LOCUS_12200 3405 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 4117 3857 gene locus_tag LOCUS_12210 4117 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 4011 5213 gene locus_tag LOCUS_12220 4011 5213 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_12220 5210 7174 gene locus_tag LOCUS_12230 5210 7174 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_12230 7563 7240 gene locus_tag LOCUS_12240 7563 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 8448 7579 gene locus_tag LOCUS_12250 8448 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence0139 897 1673 gene locus_tag LOCUS_12260 897 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3355 1760 gene locus_tag LOCUS_12270 3355 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 5293 3461 gene locus_tag LOCUS_12280 5293 3461 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070554.1 protein_id gnl|my_center|LOCUS_12280 5703 6866 gene locus_tag LOCUS_12290 5703 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 7774 6863 gene locus_tag LOCUS_12300 7774 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence0140 2743 3294 gene locus_tag LOCUS_12310 2743 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 3382 4932 gene locus_tag LOCUS_12320 3382 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 5442 4942 gene locus_tag LOCUS_12330 5442 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_12330 5664 7682 gene locus_tag LOCUS_12340 5664 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 <8619 7782 gene locus_tag LOCUS_12350 <8619 7782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001011124.1:membrane protein >Feature sequence0141 395 1597 gene locus_tag LOCUS_12360 395 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 2533 1703 gene locus_tag LOCUS_12370 2533 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 2716 3174 gene locus_tag LOCUS_12380 2716 3174 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403946.1 protein_id gnl|my_center|LOCUS_12380 3282 4646 gene locus_tag LOCUS_12390 3282 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 6368 4614 gene locus_tag LOCUS_12400 6368 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 6986 6522 gene locus_tag LOCUS_12410 6986 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 7150 8058 gene locus_tag LOCUS_12420 7150 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence0142 <1 1581 gene locus_tag LOCUS_12430 <1 1581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000017465.1:sigma-54-dependent Fis family transcriptional regulator 1930 4419 gene locus_tag LOCUS_12440 1930 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 4558 5409 gene locus_tag LOCUS_12450 4558 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 5603 6685 gene locus_tag LOCUS_12460 gene ycf84 5603 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 protein_id gnl|my_center|LOCUS_12460 6705 7769 gene locus_tag LOCUS_12470 6705 7769 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933214.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence0143 3861 5234 gene locus_tag LOCUS_12480 3861 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 7245 5260 gene locus_tag LOCUS_12490 7245 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence0144 415 2184 gene locus_tag LOCUS_12500 415 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2420 3247 gene locus_tag LOCUS_12510 gene fliC 2420 3247 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748G4 protein_id gnl|my_center|LOCUS_12510 3433 4263 gene locus_tag LOCUS_12520 gene fliC 3433 4263 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748G4 protein_id gnl|my_center|LOCUS_12520 4388 5737 gene locus_tag LOCUS_12530 gene fliD 4388 5737 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748G5 protein_id gnl|my_center|LOCUS_12530 5761 6147 gene locus_tag LOCUS_12540 gene fliS 5761 6147 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ65 protein_id gnl|my_center|LOCUS_12540 6161 6535 gene locus_tag LOCUS_12550 6161 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 <8508 6551 gene locus_tag LOCUS_12560 <8508 6551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257612.1:glycosyl transferase >Feature sequence0145 167 2212 gene locus_tag LOCUS_12570 167 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2253 4022 gene locus_tag LOCUS_12580 2253 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 4223 5197 gene locus_tag LOCUS_12590 4223 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 5190 6425 gene locus_tag LOCUS_12600 5190 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 6816 6541 gene locus_tag LOCUS_12610 6816 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 7509 7952 gene locus_tag LOCUS_12620 7509 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 8384 8088 gene locus_tag LOCUS_12630 8384 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence0146 616 2823 gene locus_tag LOCUS_12640 616 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 4914 2839 gene locus_tag LOCUS_12650 4914 2839 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKI1 protein_id gnl|my_center|LOCUS_12650 5376 6011 gene locus_tag LOCUS_12660 5376 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719782.1 protein_id gnl|my_center|LOCUS_12660 6008 7441 gene locus_tag LOCUS_12670 6008 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence0147 3 467 gene locus_tag LOCUS_12680 3 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 603 2537 gene locus_tag LOCUS_12690 603 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 3345 2560 gene locus_tag LOCUS_12700 3345 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 5302 3500 gene locus_tag LOCUS_12710 5302 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 5510 6244 gene locus_tag LOCUS_12720 5510 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 6653 6216 gene locus_tag LOCUS_12730 6653 6216 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888350.1 protein_id gnl|my_center|LOCUS_12730 7001 7249 gene locus_tag LOCUS_12740 7001 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545791.1 protein_id gnl|my_center|LOCUS_12740 7678 7292 gene locus_tag LOCUS_12750 7678 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 8187 7807 gene locus_tag LOCUS_12760 8187 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence0148 1137 2759 gene locus_tag LOCUS_12770 gene groL3 1137 2759 CDS product 60 kDa chaperonin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTY9 protein_id gnl|my_center|LOCUS_12770 2820 3107 gene locus_tag LOCUS_12780 gene groS1 2820 3107 CDS product 10 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM98 protein_id gnl|my_center|LOCUS_12780 3166 4782 gene locus_tag LOCUS_12790 gene groL 3166 4782 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJN3 protein_id gnl|my_center|LOCUS_12790 4932 6059 gene locus_tag LOCUS_12800 gene dnaJ 4932 6059 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R47 protein_id gnl|my_center|LOCUS_12800 6077 6655 gene locus_tag LOCUS_12810 6077 6655 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_12810 6657 6968 gene locus_tag LOCUS_12820 6657 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 6974 7198 gene locus_tag LOCUS_12830 6974 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 8093 7227 gene locus_tag LOCUS_12840 8093 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence0149 1845 730 gene locus_tag LOCUS_12850 1845 730 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933660.1 protein_id gnl|my_center|LOCUS_12850 4089 1987 gene locus_tag LOCUS_12860 4089 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 4526 4125 gene locus_tag LOCUS_12870 4526 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 5158 4523 gene locus_tag LOCUS_12880 5158 4523 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401355.1 protein_id gnl|my_center|LOCUS_12880 6463 5297 gene locus_tag LOCUS_12890 6463 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 7307 6630 gene locus_tag LOCUS_12900 7307 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121005.1 protein_id gnl|my_center|LOCUS_12900 7448 7960 gene locus_tag LOCUS_12910 7448 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence0150 2024 1158 gene locus_tag LOCUS_12920 2024 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3795 1975 gene locus_tag LOCUS_12930 3795 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 5006 3813 gene locus_tag LOCUS_12940 5006 3813 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122552.1 protein_id gnl|my_center|LOCUS_12940 5953 5024 gene locus_tag LOCUS_12950 5953 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 6324 5950 gene locus_tag LOCUS_12960 6324 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 7508 6321 gene locus_tag LOCUS_12970 7508 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_12970 7872 7495 gene locus_tag LOCUS_12980 gene gcvH 7872 7495 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ04 protein_id gnl|my_center|LOCUS_12980 >Feature sequence0151 1496 498 gene locus_tag LOCUS_12990 1496 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1606 4347 gene locus_tag LOCUS_13000 1606 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 4469 4672 gene locus_tag LOCUS_13010 4469 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 4806 7049 gene locus_tag LOCUS_13020 4806 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence0152 2079 1144 gene locus_tag LOCUS_13030 2079 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 2302 3969 gene locus_tag LOCUS_13040 gene aslA 2302 3969 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122345.1 protein_id gnl|my_center|LOCUS_13040 3979 4674 gene locus_tag LOCUS_13050 3979 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 5812 4694 gene locus_tag LOCUS_13060 5812 4694 CDS product 4,5-dihydroxyphthalate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038796.1 protein_id gnl|my_center|LOCUS_13060 7515 5812 gene locus_tag LOCUS_13070 7515 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence0153 531 154 gene locus_tag LOCUS_13080 531 154 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919513.1 protein_id gnl|my_center|LOCUS_13080 1292 753 gene locus_tag LOCUS_13090 1292 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1791 1360 gene locus_tag LOCUS_13100 1791 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1915 2730 gene locus_tag LOCUS_13110 1915 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_13110 2727 4025 gene locus_tag LOCUS_13120 2727 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 4115 4600 gene locus_tag LOCUS_13130 4115 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 5177 4665 gene locus_tag LOCUS_13140 gene folA 5177 4665 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_13140 5979 5185 gene locus_tag LOCUS_13150 gene thyA 5979 5185 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G35 protein_id gnl|my_center|LOCUS_13150 6212 7639 gene locus_tag LOCUS_13160 6212 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_13160 <8166 7645 gene locus_tag LOCUS_13170 <8166 7645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730493.1:nitrilase >Feature sequence0154 550 816 gene locus_tag LOCUS_13180 gene rpmE2 550 816 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_13180 971 1372 gene locus_tag LOCUS_13190 971 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1769 1380 gene locus_tag LOCUS_13200 gene groS1 1769 1380 CDS product chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545317.1 protein_id gnl|my_center|LOCUS_13200 1829 4495 gene locus_tag LOCUS_13210 1829 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 6183 4528 gene locus_tag LOCUS_13220 6183 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 6866 6180 gene locus_tag LOCUS_13230 6866 6180 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392988.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence0155 2461 1262 gene locus_tag LOCUS_13240 2461 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3851 3234 gene locus_tag LOCUS_13250 3851 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 6618 3922 gene locus_tag LOCUS_13260 6618 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 7363 6692 gene locus_tag LOCUS_13270 7363 6692 CDS product putative RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701990.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence0156 2072 414 gene locus_tag LOCUS_13280 2072 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 4153 2459 gene locus_tag LOCUS_13290 4153 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 7892 4179 gene locus_tag LOCUS_13300 7892 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence0157 2583 2008 gene locus_tag LOCUS_13310 2583 2008 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_13310 2767 3075 gene locus_tag LOCUS_13320 2767 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3084 3962 gene locus_tag LOCUS_13330 3084 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 4017 5213 gene locus_tag LOCUS_13340 4017 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 5621 5235 gene locus_tag LOCUS_13350 5621 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 6154 5657 gene locus_tag LOCUS_13360 6154 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 6502 6248 gene locus_tag LOCUS_13370 6502 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090162.1 protein_id gnl|my_center|LOCUS_13370 7158 6499 gene locus_tag LOCUS_13380 gene cpcT1 7158 6499 CDS product chromophore lyase CpcT/CpeT 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNH3 protein_id gnl|my_center|LOCUS_13380 7291 7932 gene locus_tag LOCUS_13390 7291 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence0158 3001 101 gene locus_tag LOCUS_13400 3001 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 4836 3070 gene locus_tag LOCUS_13410 4836 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 5513 5055 gene locus_tag LOCUS_13420 5513 5055 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_13420 5692 6792 gene locus_tag LOCUS_13430 5692 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence0159 883 497 gene locus_tag LOCUS_13440 883 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1184 3244 gene locus_tag LOCUS_13450 1184 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 3346 4092 gene locus_tag LOCUS_13460 3346 4092 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119458.1 protein_id gnl|my_center|LOCUS_13460 4430 4140 gene locus_tag LOCUS_13470 4430 4140 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118393.1 protein_id gnl|my_center|LOCUS_13470 5493 4477 gene locus_tag LOCUS_13480 5493 4477 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104356.1 protein_id gnl|my_center|LOCUS_13480 5634 6002 gene locus_tag LOCUS_13490 5634 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 7876 6113 gene locus_tag LOCUS_13500 7876 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence0160 137 556 gene locus_tag LOCUS_13510 gene yphP 137 556 CDS product UPF0403 protein YphP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54170 protein_id gnl|my_center|LOCUS_13510 558 836 gene locus_tag LOCUS_13520 558 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1246 1695 gene locus_tag LOCUS_13530 1246 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1972 4239 gene locus_tag LOCUS_13540 1972 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 4957 4202 gene locus_tag LOCUS_13550 4957 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942024.1 protein_id gnl|my_center|LOCUS_13550 7170 5095 gene locus_tag LOCUS_13560 7170 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 7706 7167 gene locus_tag LOCUS_13570 7706 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence0161 411 1928 gene locus_tag LOCUS_13580 411 1928 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884432.1 protein_id gnl|my_center|LOCUS_13580 2164 1934 gene locus_tag LOCUS_13590 2164 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 2358 4535 gene locus_tag LOCUS_13600 2358 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 6257 4566 gene locus_tag LOCUS_13610 6257 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence0162 4426 491 gene locus_tag LOCUS_13620 4426 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 4676 4600 gene locus_tag LOCUS_t00150 4676 4600 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4997 5599 gene locus_tag LOCUS_13630 4997 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 protein_id gnl|my_center|LOCUS_13630 5634 6485 gene locus_tag LOCUS_13640 gene uppP 5634 6485 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B8W3 protein_id gnl|my_center|LOCUS_13640 >Feature sequence0163 <1 707 gene locus_tag LOCUS_13650 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389322.1:Na(+)/H(+) antiporter subunit D 764 2485 gene locus_tag LOCUS_13660 764 2485 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804353.1 protein_id gnl|my_center|LOCUS_13660 3187 2705 gene locus_tag LOCUS_13670 3187 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 3119 4513 gene locus_tag LOCUS_13680 3119 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 4574 6199 gene locus_tag LOCUS_13690 4574 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence0164 1613 864 gene locus_tag LOCUS_13700 1613 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 2047 3219 gene locus_tag LOCUS_13710 2047 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 3324 4001 gene locus_tag LOCUS_13720 3324 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 5100 3982 gene locus_tag LOCUS_13730 gene menC 5100 3982 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ9 protein_id gnl|my_center|LOCUS_13730 5972 5097 gene locus_tag LOCUS_13740 5972 5097 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228258.1 protein_id gnl|my_center|LOCUS_13740 <7965 5969 gene locus_tag LOCUS_13750 <7965 5969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124155.1:O-linked GlcNAc transferase >Feature sequence0165 3910 1481 gene locus_tag LOCUS_13760 3910 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 4391 3918 gene locus_tag LOCUS_13770 4391 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 4634 6091 gene locus_tag LOCUS_13780 4634 6091 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_13780 6571 6107 gene locus_tag LOCUS_13790 6571 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence0166 1564 2199 gene locus_tag LOCUS_13800 1564 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2471 7099 gene locus_tag LOCUS_13810 2471 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence0167 580 1113 gene locus_tag LOCUS_13820 580 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1126 2556 gene locus_tag LOCUS_13830 1126 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 2558 4819 gene locus_tag LOCUS_13840 2558 4819 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_13840 4849 7725 gene locus_tag LOCUS_13850 4849 7725 CDS product NHLP family bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence0168 3007 443 gene locus_tag LOCUS_13860 3007 443 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706532.1 protein_id gnl|my_center|LOCUS_13860 3547 3011 gene locus_tag LOCUS_13870 3547 3011 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_13870 3691 4209 gene locus_tag LOCUS_13880 3691 4209 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123878.1 protein_id gnl|my_center|LOCUS_13880 4206 5930 gene locus_tag LOCUS_13890 4206 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 6056 6514 gene locus_tag LOCUS_13900 6056 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706123.1 protein_id gnl|my_center|LOCUS_13900 6518 7726 gene locus_tag LOCUS_13910 6518 7726 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence0169 1061 3490 gene locus_tag LOCUS_13920 1061 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 3491 4141 gene locus_tag LOCUS_13930 3491 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 4230 6029 gene locus_tag LOCUS_13940 gene recN 4230 6029 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L2 protein_id gnl|my_center|LOCUS_13940 6026 7669 gene locus_tag LOCUS_13950 6026 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence0170 70 465 gene locus_tag LOCUS_13960 70 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 527 1003 gene locus_tag LOCUS_13970 527 1003 CDS product flagellar hook capping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392298.1 protein_id gnl|my_center|LOCUS_13970 1016 2923 gene locus_tag LOCUS_13980 1016 2923 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6B8 protein_id gnl|my_center|LOCUS_13980 3087 3983 gene locus_tag LOCUS_13990 3087 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3980 4180 gene locus_tag LOCUS_14000 3980 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 4467 5189 gene locus_tag LOCUS_14010 4467 5189 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EQ7 protein_id gnl|my_center|LOCUS_14010 5292 6080 gene locus_tag LOCUS_14020 gene flgG 5292 6080 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546478.1 protein_id gnl|my_center|LOCUS_14020 6090 7121 gene locus_tag LOCUS_14030 6090 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 7118 7738 gene locus_tag LOCUS_14040 gene flgH 7118 7738 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F4 protein_id gnl|my_center|LOCUS_14040 >Feature sequence0171 2888 2649 gene locus_tag LOCUS_14050 2888 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3077 2898 gene locus_tag LOCUS_14060 3077 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 5807 3177 gene locus_tag LOCUS_14070 5807 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 <7884 5892 gene locus_tag LOCUS_14080 <7884 5892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122586.1:oxidoreductase >Feature sequence0172 402 477 gene locus_tag LOCUS_t00160 402 477 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 503 1657 gene locus_tag LOCUS_14090 503 1657 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DR9 protein_id gnl|my_center|LOCUS_14090 1871 2683 gene locus_tag LOCUS_14100 gene rnc 1871 2683 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGZ7 protein_id gnl|my_center|LOCUS_14100 2680 4137 gene locus_tag LOCUS_14110 2680 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_14110 4134 7418 gene locus_tag LOCUS_14120 gene mfd 4134 7418 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQN7 protein_id gnl|my_center|LOCUS_14120 >Feature sequence0173 1730 225 gene locus_tag LOCUS_14130 1730 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 3343 2072 gene locus_tag LOCUS_14140 3343 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 3575 4885 gene locus_tag LOCUS_14150 3575 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 4954 6192 gene locus_tag LOCUS_14160 gene pepT 4954 6192 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KND3 protein_id gnl|my_center|LOCUS_14160 6189 6857 gene locus_tag LOCUS_14170 6189 6857 CDS product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525154.1 protein_id gnl|my_center|LOCUS_14170 7133 6870 gene locus_tag LOCUS_14180 7133 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 <7877 7163 gene locus_tag LOCUS_14190 <7877 7163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083225.1:NADH oxidase >Feature sequence0174 181 696 gene locus_tag LOCUS_14200 gene isiB 181 696 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNU5 protein_id gnl|my_center|LOCUS_14200 2220 724 gene locus_tag LOCUS_14210 2220 724 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938166.1 protein_id gnl|my_center|LOCUS_14210 4584 2323 gene locus_tag LOCUS_14220 4584 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5182 4577 gene locus_tag LOCUS_14230 5182 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5297 5794 gene locus_tag LOCUS_14240 gene rpoE5 5297 5794 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92U31 protein_id gnl|my_center|LOCUS_14240 5797 6306 gene locus_tag LOCUS_14250 5797 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 6335 7246 gene locus_tag LOCUS_14260 6335 7246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence0175 670 1902 gene locus_tag LOCUS_14270 670 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529707.1 protein_id gnl|my_center|LOCUS_14270 3276 1933 gene locus_tag LOCUS_14280 3276 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 4889 3357 gene locus_tag LOCUS_14290 4889 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 5374 4889 gene locus_tag LOCUS_14300 5374 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 6915 5497 gene locus_tag LOCUS_14310 6915 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence0176 832 1593 gene locus_tag LOCUS_14320 832 1593 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968042.1 protein_id gnl|my_center|LOCUS_14320 1594 2373 gene locus_tag LOCUS_14330 gene ubiG 1594 2373 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHQ9 protein_id gnl|my_center|LOCUS_14330 2829 2512 gene locus_tag LOCUS_14340 2829 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 5311 2936 gene locus_tag LOCUS_14350 5311 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 5886 5323 gene locus_tag LOCUS_14360 5886 5323 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966541.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence0177 123 1226 gene locus_tag LOCUS_14370 123 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1638 1429 gene locus_tag LOCUS_14380 1638 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1894 3357 gene locus_tag LOCUS_14390 1894 3357 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_14390 3376 4461 gene locus_tag LOCUS_14400 3376 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_14400 4464 5315 gene locus_tag LOCUS_14410 4464 5315 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403958.1 protein_id gnl|my_center|LOCUS_14410 6094 5522 gene locus_tag LOCUS_14420 6094 5522 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_14420 6287 7762 gene locus_tag LOCUS_14430 6287 7762 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence0178 762 427 gene locus_tag LOCUS_14440 762 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1097 4342 gene locus_tag LOCUS_14450 1097 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 6459 4414 gene locus_tag LOCUS_14460 6459 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141838.1 protein_id gnl|my_center|LOCUS_14460 7097 6606 gene locus_tag LOCUS_14470 7097 6606 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968485.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence0179 316 1437 gene locus_tag LOCUS_14480 gene aroC 316 1437 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_14480 4941 1450 gene locus_tag LOCUS_14490 4941 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 5542 5042 gene locus_tag LOCUS_14500 5542 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 6177 5539 gene locus_tag LOCUS_14510 6177 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 6830 6210 gene locus_tag LOCUS_14520 6830 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence0180 <1 1779 gene locus_tag LOCUS_14530 <1 1779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119728.1:collagen-binding protein 2484 1813 gene locus_tag LOCUS_14540 2484 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14540 3297 2662 gene locus_tag LOCUS_14550 3297 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14550 3453 3989 gene locus_tag LOCUS_14560 3453 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4086 5420 gene locus_tag LOCUS_14570 4086 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 5527 6156 gene locus_tag LOCUS_14580 5527 6156 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW63 protein_id gnl|my_center|LOCUS_14580 6239 6928 gene locus_tag LOCUS_14590 6239 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 7632 6925 gene locus_tag LOCUS_14600 7632 6925 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529238.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence0181 118 897 gene locus_tag LOCUS_14610 gene yabD 118 897 CDS product putative metal-dependent hydrolase YabD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37545 protein_id gnl|my_center|LOCUS_14610 1729 1001 gene locus_tag LOCUS_14620 1729 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 2921 1797 gene locus_tag LOCUS_14630 2921 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 4195 2960 gene locus_tag LOCUS_14640 gene pilC 4195 2960 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_14640 5951 4230 gene locus_tag LOCUS_14650 gene pilB 5951 4230 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_14650 7073 5955 gene locus_tag LOCUS_14660 gene pilT-4 7073 5955 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence0182 21 1433 gene locus_tag LOCUS_14670 21 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2550 1516 gene locus_tag LOCUS_14680 2550 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 3492 2758 gene locus_tag LOCUS_14690 3492 2758 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121044.1 protein_id gnl|my_center|LOCUS_14690 4490 3489 gene locus_tag LOCUS_14700 4490 3489 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119557.1 protein_id gnl|my_center|LOCUS_14700 5298 4648 gene locus_tag LOCUS_14710 5298 4648 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 transl_except (pos:complement(5047..5049),aa:Sec) note codon on position 84 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_14710 6422 5319 gene locus_tag LOCUS_14720 6422 5319 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_14720 7024 6581 gene locus_tag LOCUS_14730 7024 6581 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459573.1 protein_id gnl|my_center|LOCUS_14730 7334 7017 gene locus_tag LOCUS_14740 gene ydzA 7334 7017 CDS product putative membrane protein YdzA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31485 protein_id gnl|my_center|LOCUS_14740 >Feature sequence0183 609 289 gene locus_tag LOCUS_14750 609 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 896 606 gene locus_tag LOCUS_14760 896 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2066 1107 gene locus_tag LOCUS_14770 2066 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 3708 2176 gene locus_tag LOCUS_14780 3708 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4207 3743 gene locus_tag LOCUS_14790 4207 3743 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146967.1 protein_id gnl|my_center|LOCUS_14790 4380 5012 gene locus_tag LOCUS_14800 4380 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 6441 5038 gene locus_tag LOCUS_14810 gene hslU 6441 5038 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG00 protein_id gnl|my_center|LOCUS_14810 7052 6438 gene locus_tag LOCUS_14820 7052 6438 CDS product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460420.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence0184 741 1430 gene locus_tag LOCUS_14830 741 1430 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098478.1 protein_id gnl|my_center|LOCUS_14830 1427 4357 gene locus_tag LOCUS_14840 1427 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 4365 4772 gene locus_tag LOCUS_14850 4365 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 5034 5864 gene locus_tag LOCUS_14860 5034 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229204.1 protein_id gnl|my_center|LOCUS_14860 6826 5951 gene locus_tag LOCUS_14870 6826 5951 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228665.1 protein_id gnl|my_center|LOCUS_14870 7039 7305 gene locus_tag LOCUS_14880 7039 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence0185 2878 1850 gene locus_tag LOCUS_14890 gene hpnA 2878 1850 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_14890 3914 2913 gene locus_tag LOCUS_14900 gene hpnH 3914 2913 CDS product hopanoid biosynthesis associated radical SAM protein HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_14900 3936 5258 gene locus_tag LOCUS_14910 3936 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 5255 6535 gene locus_tag LOCUS_14920 5255 6535 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_14920 6548 7333 gene locus_tag LOCUS_14930 6548 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence0186 2162 783 gene locus_tag LOCUS_14940 2162 783 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_14940 2329 3225 gene locus_tag LOCUS_14950 2329 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 3303 5306 gene locus_tag LOCUS_14960 3303 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 7251 5263 gene locus_tag LOCUS_14970 gene mutL 7251 5263 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ3 protein_id gnl|my_center|LOCUS_14970 >Feature sequence0187 2430 103 gene locus_tag LOCUS_14980 gene katG 2430 103 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUW9 protein_id gnl|my_center|LOCUS_14980 2631 3548 gene locus_tag LOCUS_14990 2631 3548 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_14990 5273 3564 gene locus_tag LOCUS_15000 5273 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 5778 5464 gene locus_tag LOCUS_15010 5778 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 5914 5838 gene locus_tag LOCUS_t00170 5914 5838 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6284 5892 gene locus_tag LOCUS_15020 6284 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence0188 1434 2048 gene locus_tag LOCUS_15030 1434 2048 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_15030 2045 4657 gene locus_tag LOCUS_15040 2045 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 4862 6259 gene locus_tag LOCUS_15050 4862 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence0189 <1 912 gene locus_tag LOCUS_15060 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P61667:DNA mismatch repair protein MutS 909 2045 gene locus_tag LOCUS_15070 909 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2542 2081 gene locus_tag LOCUS_15080 2542 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4350 2575 gene locus_tag LOCUS_15090 4350 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 5051 4347 gene locus_tag LOCUS_15100 5051 4347 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143132.1 protein_id gnl|my_center|LOCUS_15100 6333 5065 gene locus_tag LOCUS_15110 6333 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 <7565 6365 gene locus_tag LOCUS_15120 <7565 6365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072227.1:marine proteobacterial sortase target protein >Feature sequence0190 1742 174 gene locus_tag LOCUS_15130 1742 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1876 2406 gene locus_tag LOCUS_15140 1876 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814545.1 protein_id gnl|my_center|LOCUS_15140 2433 2699 gene locus_tag LOCUS_15150 2433 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089416.1 protein_id gnl|my_center|LOCUS_15150 2726 3133 gene locus_tag LOCUS_15160 2726 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 3130 3639 gene locus_tag LOCUS_15170 3130 3639 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707283.1 protein_id gnl|my_center|LOCUS_15170 4975 3686 gene locus_tag LOCUS_15180 4975 3686 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020227.1 protein_id gnl|my_center|LOCUS_15180 7554 5065 gene locus_tag LOCUS_15190 gene acrB 7554 5065 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123071.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence0191 4849 1223 gene locus_tag LOCUS_15200 gene recB 4849 1223 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDI1 protein_id gnl|my_center|LOCUS_15200 <7558 4846 gene locus_tag LOCUS_15210 <7558 4846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CY8:RecBCD enzyme subunit RecC >Feature sequence0192 3 125 gene locus_tag LOCUS_15220 3 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 275 1594 gene locus_tag LOCUS_15230 275 1594 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZD9 protein_id gnl|my_center|LOCUS_15230 1635 2450 gene locus_tag LOCUS_15240 gene deoD 1635 2450 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE80 protein_id gnl|my_center|LOCUS_15240 2503 2715 gene locus_tag LOCUS_15250 2503 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 2833 3594 gene locus_tag LOCUS_15260 2833 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 3607 6048 gene locus_tag LOCUS_15270 3607 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 6045 7535 gene locus_tag LOCUS_15280 6045 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence0193 482 3361 gene locus_tag LOCUS_15290 482 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 6186 3367 gene locus_tag LOCUS_15300 6186 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 6825 6190 gene locus_tag LOCUS_15310 6825 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 7195 7497 gene locus_tag LOCUS_15320 7195 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence0194 1739 690 gene locus_tag LOCUS_15330 1739 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3710 1860 gene locus_tag LOCUS_15340 3710 1860 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_15340 4513 4244 gene locus_tag LOCUS_15350 4513 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 5593 4616 gene locus_tag LOCUS_15360 5593 4616 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_15360 5720 6652 gene locus_tag LOCUS_15370 gene ku 5720 6652 CDS product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAQ2 protein_id gnl|my_center|LOCUS_15370 >Feature sequence0195 387 1454 gene locus_tag LOCUS_15380 387 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1657 1451 gene locus_tag LOCUS_15390 1657 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1560 2543 gene locus_tag LOCUS_15400 1560 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 3273 4301 gene locus_tag LOCUS_15410 3273 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 4730 5803 gene locus_tag LOCUS_15420 4730 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 6063 6422 gene locus_tag LOCUS_15430 6063 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 6419 6946 gene locus_tag LOCUS_15440 6419 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence0196 2245 1457 gene locus_tag LOCUS_15450 2245 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120872.1 protein_id gnl|my_center|LOCUS_15450 2736 2242 gene locus_tag LOCUS_15460 2736 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 4178 2733 gene locus_tag LOCUS_15470 4178 2733 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_15470 4811 4191 gene locus_tag LOCUS_15480 4811 4191 CDS product cytochrome CBB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120870.1 protein_id gnl|my_center|LOCUS_15480 4972 4811 gene locus_tag LOCUS_15490 4972 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 7277 4989 gene locus_tag LOCUS_15500 7277 4989 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120869.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence0197 334 146 gene locus_tag LOCUS_15510 334 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15510 1858 380 gene locus_tag LOCUS_15520 1858 380 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15520 2159 3226 gene locus_tag LOCUS_15530 2159 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 3433 5229 gene locus_tag LOCUS_15540 3433 5229 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085400.1 protein_id gnl|my_center|LOCUS_15540 6010 5249 gene locus_tag LOCUS_15550 6010 5249 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947852.1 protein_id gnl|my_center|LOCUS_15550 6935 6225 gene locus_tag LOCUS_15560 6935 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942024.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence0198 1505 2557 gene locus_tag LOCUS_15570 1505 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 2833 5565 gene locus_tag LOCUS_15580 2833 5565 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_15580 6604 5588 gene locus_tag LOCUS_15590 6604 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 7106 6612 gene locus_tag LOCUS_15600 7106 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence0199 218 3259 gene locus_tag LOCUS_15610 218 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 3806 3270 gene locus_tag LOCUS_15620 3806 3270 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_15620 7152 3931 gene locus_tag LOCUS_15630 7152 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143578.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence0200 <1 636 gene locus_tag LOCUS_15640 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004537542.1:O-methyltransferase 1263 652 gene locus_tag LOCUS_15650 1263 652 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989890.1 protein_id gnl|my_center|LOCUS_15650 2519 1407 gene locus_tag LOCUS_15660 2519 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 4568 2733 gene locus_tag LOCUS_15670 4568 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 4925 6979 gene locus_tag LOCUS_15680 4925 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence0201 1949 3760 gene locus_tag LOCUS_15690 1949 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3757 6384 gene locus_tag LOCUS_15700 3757 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence0202 1220 804 gene locus_tag LOCUS_15710 1220 804 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_15710 1513 1217 gene locus_tag LOCUS_15720 1513 1217 CDS product PAAR motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941651.1 protein_id gnl|my_center|LOCUS_15720 2166 1525 gene locus_tag LOCUS_15730 2166 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3275 2166 gene locus_tag LOCUS_15740 3275 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3921 3268 gene locus_tag LOCUS_15750 3921 3268 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_15750 4275 3925 gene locus_tag LOCUS_15760 4275 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 5390 5022 gene locus_tag LOCUS_15770 5390 5022 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_15770 5649 5452 gene locus_tag LOCUS_15780 5649 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941645.1 protein_id gnl|my_center|LOCUS_15780 6029 5646 gene locus_tag LOCUS_15790 6029 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_15790 6491 6051 gene locus_tag LOCUS_15800 6491 6051 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_15800 7208 6516 gene locus_tag LOCUS_15810 7208 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence0203 2287 386 gene locus_tag LOCUS_15820 2287 386 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_15820 2805 2329 gene locus_tag LOCUS_15830 2805 2329 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480622.1 protein_id gnl|my_center|LOCUS_15830 3074 4816 gene locus_tag LOCUS_15840 3074 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 5066 4860 gene locus_tag LOCUS_15850 5066 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence0204 1030 425 gene locus_tag LOCUS_15860 1030 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1087 1911 gene locus_tag LOCUS_15870 1087 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 3504 1921 gene locus_tag LOCUS_15880 3504 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3785 5764 gene locus_tag LOCUS_15890 3785 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 6447 5824 gene locus_tag LOCUS_15900 6447 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence0205 80 1132 gene locus_tag LOCUS_15910 gene batA 80 1132 CDS product aerotolerance regulator BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_15910 1132 2184 gene locus_tag LOCUS_15920 1132 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 2196 4478 gene locus_tag LOCUS_15930 2196 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 4478 6364 gene locus_tag LOCUS_15940 4478 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 6361 7230 gene locus_tag LOCUS_15950 6361 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence0206 455 1690 gene locus_tag LOCUS_15960 455 1690 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_15960 1694 2428 gene locus_tag LOCUS_15970 1694 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2438 3169 gene locus_tag LOCUS_15980 2438 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 3166 4557 gene locus_tag LOCUS_15990 3166 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 6254 4551 gene locus_tag LOCUS_16000 6254 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence0207 1317 427 gene locus_tag LOCUS_16010 1317 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 3551 1734 gene locus_tag LOCUS_16020 3551 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 4224 3694 gene locus_tag LOCUS_16030 4224 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076326.1 protein_id gnl|my_center|LOCUS_16030 5057 4221 gene locus_tag LOCUS_16040 5057 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 5179 6090 gene locus_tag LOCUS_16050 gene phnD 5179 6090 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707869.1 protein_id gnl|my_center|LOCUS_16050 6142 6918 gene locus_tag LOCUS_16060 gene phnC 6142 6918 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQT6 protein_id gnl|my_center|LOCUS_16060 >Feature sequence0208 2383 1265 gene locus_tag LOCUS_16070 2383 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 3186 2401 gene locus_tag LOCUS_16080 3186 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 3381 4277 gene locus_tag LOCUS_16090 3381 4277 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403980.1 protein_id gnl|my_center|LOCUS_16090 4317 5864 gene locus_tag LOCUS_16100 4317 5864 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_16100 5864 6799 gene locus_tag LOCUS_16110 5864 6799 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403982.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence0209 4487 1080 gene locus_tag LOCUS_16120 4487 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_16120 4643 6262 gene locus_tag LOCUS_16130 4643 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 6370 6738 gene locus_tag LOCUS_16140 6370 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence0210 12 3155 gene locus_tag LOCUS_16150 gene kefA 12 3155 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120603.1 protein_id gnl|my_center|LOCUS_16150 3152 4594 gene locus_tag LOCUS_16160 3152 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 4761 5081 gene locus_tag LOCUS_16170 4761 5081 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_16170 <7292 5301 gene locus_tag LOCUS_16180 <7292 5301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WHM1:aconitate hydratase >Feature sequence0211 644 2497 gene locus_tag LOCUS_16190 644 2497 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH3 protein_id gnl|my_center|LOCUS_16190 2595 3863 gene locus_tag LOCUS_16200 2595 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 5226 3871 gene locus_tag LOCUS_16210 5226 3871 CDS product LPS biosynthesis protein RfbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118881.1 protein_id gnl|my_center|LOCUS_16210 6588 5236 gene locus_tag LOCUS_16220 6588 5236 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259590.1 protein_id gnl|my_center|LOCUS_16220 <7289 6625 gene locus_tag LOCUS_16230 <7289 6625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943707.1:RNA methyltransferase >Feature sequence0212 223 660 gene locus_tag LOCUS_16240 223 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 760 1608 gene locus_tag LOCUS_16250 760 1608 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391687.1 protein_id gnl|my_center|LOCUS_16250 1605 3644 gene locus_tag LOCUS_16260 1605 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 3641 6454 gene locus_tag LOCUS_16270 3641 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence0213 1060 4548 gene locus_tag LOCUS_16280 1060 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142223.1 protein_id gnl|my_center|LOCUS_16280 4545 6272 gene locus_tag LOCUS_16290 4545 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 6269 6919 gene locus_tag LOCUS_16300 6269 6919 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence0214 2866 1868 gene locus_tag LOCUS_16310 2866 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3432 4658 gene locus_tag LOCUS_16320 3432 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 4759 5295 gene locus_tag LOCUS_16330 4759 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 5292 7166 gene locus_tag LOCUS_16340 5292 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence0215 109 990 gene locus_tag LOCUS_16350 109 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1084 1686 gene locus_tag LOCUS_16360 1084 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1739 2323 gene locus_tag LOCUS_16370 1739 2323 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_16370 2320 5184 gene locus_tag LOCUS_16380 2320 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 6132 5302 gene locus_tag LOCUS_16390 gene whiG 6132 5302 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFV6 protein_id gnl|my_center|LOCUS_16390 <7224 6598 gene locus_tag LOCUS_16400 <7224 6598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876951.1:peptidyl-prolyl cis-trans isomerase >Feature sequence0216 1635 4421 gene locus_tag LOCUS_16410 1635 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 4521 5132 gene locus_tag LOCUS_16420 4521 5132 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence0217 1676 474 gene locus_tag LOCUS_16430 1676 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2595 1924 gene locus_tag LOCUS_16440 2595 1924 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIT1 protein_id gnl|my_center|LOCUS_16440 3805 2900 gene locus_tag LOCUS_16450 3805 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 4371 3865 gene locus_tag LOCUS_16460 4371 3865 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227518.1 protein_id gnl|my_center|LOCUS_16460 4717 4364 gene locus_tag LOCUS_16470 4717 4364 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223065.1 protein_id gnl|my_center|LOCUS_16470 4928 5818 gene locus_tag LOCUS_16480 4928 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence0218 <1 1606 gene locus_tag LOCUS_16490 <1 1606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121573.1:NADH-dependent oxidoreductase 2011 3024 gene locus_tag LOCUS_16500 2011 3024 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_16500 3021 4613 gene locus_tag LOCUS_16510 3021 4613 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143047.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence0219 <1 1068 gene locus_tag LOCUS_16520 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478902.1:multidrug transporter AcrB 2001 1075 gene locus_tag LOCUS_16530 2001 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552088.1 protein_id gnl|my_center|LOCUS_16530 3234 2032 gene locus_tag LOCUS_16540 3234 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 3358 4338 gene locus_tag LOCUS_16550 3358 4338 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969434.1 protein_id gnl|my_center|LOCUS_16550 4362 5339 gene locus_tag LOCUS_16560 4362 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122330.1 protein_id gnl|my_center|LOCUS_16560 5341 5892 gene locus_tag LOCUS_16570 5341 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969436.1 protein_id gnl|my_center|LOCUS_16570 5886 6881 gene locus_tag LOCUS_16580 5886 6881 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122332.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence0220 2299 878 gene locus_tag LOCUS_16590 2299 878 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927297.1 protein_id gnl|my_center|LOCUS_16590 3174 2296 gene locus_tag LOCUS_16600 3174 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 4661 3234 gene locus_tag LOCUS_16610 4661 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 6275 4812 gene locus_tag LOCUS_16620 6275 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence0221 1247 1498 gene locus_tag LOCUS_16630 1247 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1896 3506 gene locus_tag LOCUS_16640 1896 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 3710 6049 gene locus_tag LOCUS_16650 3710 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence0222 1399 641 gene locus_tag LOCUS_16660 gene ttg2A 1399 641 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_16660 2213 1413 gene locus_tag LOCUS_16670 gene ttg2B 2213 1413 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147518.1 protein_id gnl|my_center|LOCUS_16670 3693 2239 gene locus_tag LOCUS_16680 3693 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942546.1 protein_id gnl|my_center|LOCUS_16680 4006 4860 gene locus_tag LOCUS_16690 4006 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 4857 5309 gene locus_tag LOCUS_16700 gene dtd 4857 5309 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE39 protein_id gnl|my_center|LOCUS_16700 5651 5478 gene locus_tag LOCUS_16710 5651 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 6902 6027 gene locus_tag LOCUS_16720 6902 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence0223 370 446 gene locus_tag LOCUS_t00180 370 446 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 537 962 gene locus_tag LOCUS_16730 537 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1027 1557 gene locus_tag LOCUS_16740 gene nusG 1027 1557 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0S4 protein_id gnl|my_center|LOCUS_16740 1606 2028 gene locus_tag LOCUS_16750 gene rplK 1606 2028 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WST2 protein_id gnl|my_center|LOCUS_16750 2042 2725 gene locus_tag LOCUS_16760 gene rplA 2042 2725 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI03 protein_id gnl|my_center|LOCUS_16760 2751 3290 gene locus_tag LOCUS_16770 gene rplJ 2751 3290 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324458.1 protein_id gnl|my_center|LOCUS_16770 3460 3873 gene locus_tag LOCUS_16780 gene rplL 3460 3873 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1Q4 protein_id gnl|my_center|LOCUS_16780 >Feature sequence0224 2426 576 gene locus_tag LOCUS_16790 2426 576 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_16790 2966 2439 gene locus_tag LOCUS_16800 2966 2439 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_16800 3322 3053 gene locus_tag LOCUS_16810 3322 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3484 4947 gene locus_tag LOCUS_16820 3484 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_16820 <7083 4952 gene locus_tag LOCUS_16830 <7083 4952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266720.1:glycosyl transferase >Feature sequence0225 54 1391 gene locus_tag LOCUS_16840 54 1391 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_16840 1521 4295 gene locus_tag LOCUS_16850 1521 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 5334 4264 gene locus_tag LOCUS_16860 5334 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence0226 2055 52 gene locus_tag LOCUS_16870 2055 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2278 2697 gene locus_tag LOCUS_16880 2278 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 2709 4664 gene locus_tag LOCUS_16890 2709 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 5755 4775 gene locus_tag LOCUS_16900 5755 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 6356 5868 gene locus_tag LOCUS_16910 6356 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 <7077 6353 gene locus_tag LOCUS_16920 <7077 6353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974005.1:dehydrogenase >Feature sequence0227 <1 1286 gene locus_tag LOCUS_16930 <1 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065100.1:peptide transporter 1374 3110 gene locus_tag LOCUS_16940 1374 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3162 3881 gene locus_tag LOCUS_16950 3162 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 4673 3882 gene locus_tag LOCUS_16960 4673 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 6328 4934 gene locus_tag LOCUS_16970 6328 4934 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIP0 protein_id gnl|my_center|LOCUS_16970 >Feature sequence0228 2418 238 gene locus_tag LOCUS_16980 2418 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 4683 2461 gene locus_tag LOCUS_16990 gene plpD 4683 2461 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_16990 6406 4766 gene locus_tag LOCUS_17000 6406 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027266.1 protein_id gnl|my_center|LOCUS_17000 <7043 6530 gene locus_tag LOCUS_17010 <7043 6530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403490.1:oxidoreductase >Feature sequence0229 426 2063 gene locus_tag LOCUS_17020 gene nadE 426 2063 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_17020 2232 2825 gene locus_tag LOCUS_17030 2232 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2969 3379 gene locus_tag LOCUS_17040 2969 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 3636 4682 gene locus_tag LOCUS_17050 3636 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 4816 5844 gene locus_tag LOCUS_17060 4816 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence0230 1713 856 gene locus_tag LOCUS_17070 1713 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 2773 1739 gene locus_tag LOCUS_17080 2773 1739 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_17080 2865 4331 gene locus_tag LOCUS_17090 2865 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 4414 5574 gene locus_tag LOCUS_17100 4414 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence0231 4252 2204 gene locus_tag LOCUS_17110 4252 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 4386 5084 gene locus_tag LOCUS_17120 4386 5084 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF39 protein_id gnl|my_center|LOCUS_17120 >Feature sequence0232 895 2403 gene locus_tag LOCUS_17130 gene rpdD 895 2403 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF51 protein_id gnl|my_center|LOCUS_17130 2442 3392 gene locus_tag LOCUS_17140 2442 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3389 4153 gene locus_tag LOCUS_17150 gene ubiE 3389 4153 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122034.1 protein_id gnl|my_center|LOCUS_17150 5682 4069 gene locus_tag LOCUS_17160 5682 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 6122 5811 gene locus_tag LOCUS_17170 6122 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence0233 426 22 gene locus_tag LOCUS_17180 426 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072996.1 protein_id gnl|my_center|LOCUS_17180 1710 616 gene locus_tag LOCUS_17190 gene ychF 1710 616 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEV1 protein_id gnl|my_center|LOCUS_17190 1982 4096 gene locus_tag LOCUS_17200 1982 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 4893 4111 gene locus_tag LOCUS_17210 gene trpA 4893 4111 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIU0 protein_id gnl|my_center|LOCUS_17210 6200 4890 gene locus_tag LOCUS_17220 6200 4890 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064422.1 protein_id gnl|my_center|LOCUS_17220 6832 6197 gene locus_tag LOCUS_17230 gene trpF 6832 6197 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence0234 604 873 gene locus_tag LOCUS_17240 gene rpsT 604 873 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y4B9 protein_id gnl|my_center|LOCUS_17240 2364 1006 gene locus_tag LOCUS_17250 gene nhaD 2364 1006 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022705.1 protein_id gnl|my_center|LOCUS_17250 4382 2478 gene locus_tag LOCUS_17260 4382 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 6048 4537 gene locus_tag LOCUS_17270 6048 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 <6947 6326 gene locus_tag LOCUS_17280 <6947 6326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87R77:peptidylprolyl isomerase >Feature sequence0235 <1 2808 gene locus_tag LOCUS_17290 <1 2808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118002.1:protein kinase 2868 3749 gene locus_tag LOCUS_17300 2868 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3852 5465 gene locus_tag LOCUS_17310 3852 5465 CDS product D-glutamate deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384301.1 protein_id gnl|my_center|LOCUS_17310 <6939 5548 gene locus_tag LOCUS_17320 <6939 5548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EBT8:tricorn protease >Feature sequence0236 3 1061 gene locus_tag LOCUS_17330 3 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1223 1921 gene locus_tag LOCUS_17340 1223 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 2384 1944 gene locus_tag LOCUS_17350 2384 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 3975 2602 gene locus_tag LOCUS_17360 3975 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4271 5977 gene locus_tag LOCUS_17370 4271 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 6078 6731 gene locus_tag LOCUS_17380 6078 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence0237 1209 1742 gene locus_tag LOCUS_17390 gene sigH 1209 1742 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121971.1 protein_id gnl|my_center|LOCUS_17390 1739 2194 gene locus_tag LOCUS_17400 1739 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2199 3458 gene locus_tag LOCUS_17410 2199 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 4013 3468 gene locus_tag LOCUS_17420 4013 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 4197 4940 gene locus_tag LOCUS_17430 4197 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 5396 4950 gene locus_tag LOCUS_17440 5396 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 6267 5404 gene locus_tag LOCUS_17450 6267 5404 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9Y9 protein_id gnl|my_center|LOCUS_17450 >Feature sequence0238 199 1170 gene locus_tag LOCUS_17460 199 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2606 1569 gene locus_tag LOCUS_17470 2606 1569 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_17470 4984 2696 gene locus_tag LOCUS_17480 4984 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 5730 4981 gene locus_tag LOCUS_17490 5730 4981 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence0239 1966 185 gene locus_tag LOCUS_17500 1966 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2321 3034 gene locus_tag LOCUS_17510 2321 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3031 3336 gene locus_tag LOCUS_17520 3031 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 3341 5308 gene locus_tag LOCUS_17530 3341 5308 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029758.1 protein_id gnl|my_center|LOCUS_17530 5316 6851 gene locus_tag LOCUS_17540 5316 6851 CDS product NADH:ubiquinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969262.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence0240 2132 5563 gene locus_tag LOCUS_17550 2132 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence0241 261 2381 gene locus_tag LOCUS_17560 261 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 2597 2977 gene locus_tag LOCUS_17570 2597 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993823.1 protein_id gnl|my_center|LOCUS_17570 4142 3066 gene locus_tag LOCUS_17580 4142 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 5248 4271 gene locus_tag LOCUS_17590 5248 4271 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031003.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence0242 3366 1768 gene locus_tag LOCUS_17600 3366 1768 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123565.1 protein_id gnl|my_center|LOCUS_17600 5037 3475 gene locus_tag LOCUS_17610 5037 3475 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266304.1 protein_id gnl|my_center|LOCUS_17610 5197 5952 gene locus_tag LOCUS_17620 5197 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence0243 <1 1319 gene locus_tag LOCUS_17630 <1 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070563.1:type II secretion system protein GspD 1441 2109 gene locus_tag LOCUS_17640 1441 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392092.1 protein_id gnl|my_center|LOCUS_17640 2540 4183 gene locus_tag LOCUS_17650 gene rne 2540 4183 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328924.1 protein_id gnl|my_center|LOCUS_17650 4272 4625 gene locus_tag LOCUS_17660 4272 4625 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460896.1 protein_id gnl|my_center|LOCUS_17660 4654 4905 gene locus_tag LOCUS_17670 gene rpmA 4654 4905 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPR5 protein_id gnl|my_center|LOCUS_17670 4999 6048 gene locus_tag LOCUS_17680 gene obg 4999 6048 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ65 protein_id gnl|my_center|LOCUS_17680 >Feature sequence0244 234 803 gene locus_tag LOCUS_17690 234 803 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_17690 810 3101 gene locus_tag LOCUS_17700 810 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 3190 3705 gene locus_tag LOCUS_17710 3190 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 4972 3713 gene locus_tag LOCUS_17720 4972 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence0245 2312 1362 gene locus_tag LOCUS_17730 2312 1362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246818.1 protein_id gnl|my_center|LOCUS_17730 3043 2297 gene locus_tag LOCUS_17740 3043 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 4158 3094 gene locus_tag LOCUS_17750 4158 3094 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706453.1 protein_id gnl|my_center|LOCUS_17750 5074 4244 gene locus_tag LOCUS_17760 5074 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 5914 5135 gene locus_tag LOCUS_17770 5914 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence0246 <1 1415 gene locus_tag LOCUS_17780 <1 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118661.1:D-aminoacylase 2971 1535 gene locus_tag LOCUS_17790 2971 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 5329 3290 gene locus_tag LOCUS_17800 5329 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 6000 5440 gene locus_tag LOCUS_17810 6000 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence0247 174 905 gene locus_tag LOCUS_17820 174 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 954 1619 gene locus_tag LOCUS_17830 954 1619 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ43 protein_id gnl|my_center|LOCUS_17830 3200 1647 gene locus_tag LOCUS_17840 3200 1647 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_17840 3427 4764 gene locus_tag LOCUS_17850 3427 4764 CDS product malate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338924.1 protein_id gnl|my_center|LOCUS_17850 6274 4775 gene locus_tag LOCUS_17860 gene yehZ 6274 4775 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035422.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence0248 2476 1286 gene locus_tag LOCUS_17870 2476 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2698 4572 gene locus_tag LOCUS_17880 2698 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence0249 5 1210 gene locus_tag LOCUS_17890 5 1210 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709669.1 protein_id gnl|my_center|LOCUS_17890 2858 1434 gene locus_tag LOCUS_17900 2858 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 3914 3096 gene locus_tag LOCUS_17910 3914 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 <6740 3911 gene locus_tag LOCUS_17920 <6740 3911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941349.1:transporter >Feature sequence0250 481 2031 gene locus_tag LOCUS_17930 481 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2138 3466 gene locus_tag LOCUS_17940 2138 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5583 3457 gene locus_tag LOCUS_17950 5583 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence0251 115 1344 gene locus_tag LOCUS_17960 gene mntB 115 1344 CDS product manganese ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_17960 1349 2500 gene locus_tag LOCUS_17970 gene mntB 1349 2500 CDS product manganese ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123735.1 protein_id gnl|my_center|LOCUS_17970 3019 2684 gene locus_tag LOCUS_17980 3019 2684 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144135.1 protein_id gnl|my_center|LOCUS_17980 5112 3016 gene locus_tag LOCUS_17990 5112 3016 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_17990 5492 5109 gene locus_tag LOCUS_18000 5492 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 6589 5489 gene locus_tag LOCUS_18010 6589 5489 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKJ7 protein_id gnl|my_center|LOCUS_18010 >Feature sequence0252 475 3165 gene locus_tag LOCUS_18020 475 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 3752 3195 gene locus_tag LOCUS_18030 3752 3195 CDS product farnesyl cysteine carboxyl-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969325.1 protein_id gnl|my_center|LOCUS_18030 3922 6081 gene locus_tag LOCUS_18040 3922 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 6255 6674 gene locus_tag LOCUS_18050 6255 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence0253 547 215 gene locus_tag LOCUS_18060 547 215 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6E2 protein_id gnl|my_center|LOCUS_18060 3164 531 gene locus_tag LOCUS_18070 3164 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 3401 4699 gene locus_tag LOCUS_18080 3401 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 4870 5280 gene locus_tag LOCUS_18090 4870 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence0254 608 1636 gene locus_tag LOCUS_18100 608 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1680 3197 gene locus_tag LOCUS_18110 1680 3197 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_18110 4999 3242 gene locus_tag LOCUS_18120 4999 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 <6701 5292 gene locus_tag LOCUS_18130 <6701 5292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074150.1:peptidase S9 >Feature sequence0255 2692 1601 gene locus_tag LOCUS_18140 gene carA 2692 1601 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK41 protein_id gnl|my_center|LOCUS_18140 4190 2796 gene locus_tag LOCUS_18150 4190 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_18150 4105 4296 gene locus_tag LOCUS_18160 4105 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 4353 4619 gene locus_tag LOCUS_18170 4353 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence0256 96 866 gene locus_tag LOCUS_18180 96 866 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_18180 2528 879 gene locus_tag LOCUS_18190 2528 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2657 4279 gene locus_tag LOCUS_18200 2657 4279 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 protein_id gnl|my_center|LOCUS_18200 4276 5136 gene locus_tag LOCUS_18210 4276 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 5152 5463 gene locus_tag LOCUS_18220 5152 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 5694 6587 gene locus_tag LOCUS_18230 5694 6587 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence0257 3071 1641 gene locus_tag LOCUS_18240 3071 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3637 3173 gene locus_tag LOCUS_18250 3637 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 4137 3700 gene locus_tag LOCUS_18260 4137 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 <6640 4286 gene locus_tag LOCUS_18270 <6640 4286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704238.1:type I restriction-modification system, restriction (R) subunit >Feature sequence0258 <1 682 gene locus_tag LOCUS_18280 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YG56:ribose-phosphate pyrophosphokinase 749 1351 gene locus_tag LOCUS_18290 gene rplY 749 1351 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKU9 protein_id gnl|my_center|LOCUS_18290 1389 2027 gene locus_tag LOCUS_18300 1389 2027 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814896.1 protein_id gnl|my_center|LOCUS_18300 2179 2733 gene locus_tag LOCUS_18310 2179 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2802 3029 gene locus_tag LOCUS_18320 2802 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 3145 3666 gene locus_tag LOCUS_18330 3145 3666 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_18330 3751 5100 gene locus_tag LOCUS_18340 gene dnaC 3751 5100 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAG8 protein_id gnl|my_center|LOCUS_18340 >Feature sequence0259 2174 888 gene locus_tag LOCUS_18350 2174 888 CDS product restriction endonuclease S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368421.1 protein_id gnl|my_center|LOCUS_18350 4477 2171 gene locus_tag LOCUS_18360 4477 2171 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704240.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence0260 94 663 gene locus_tag LOCUS_18370 94 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1029 2351 gene locus_tag LOCUS_18380 gene lpxC/fabZ 1029 2351 CDS product bifunctional enzyme LpxC/FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBX0 protein_id gnl|my_center|LOCUS_18380 2495 3298 gene locus_tag LOCUS_18390 gene lpxA 2495 3298 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI00 protein_id gnl|my_center|LOCUS_18390 3295 4326 gene locus_tag LOCUS_18400 gene gnnA 3295 4326 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_18400 5496 4342 gene locus_tag LOCUS_18410 gene lpxB 5496 4342 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT9 protein_id gnl|my_center|LOCUS_18410 >Feature sequence0261 2309 3052 gene locus_tag LOCUS_18420 2309 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 <6611 3095 gene locus_tag LOCUS_18430 <6611 3095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943962.1:histidine kinase >Feature sequence0262 11 1834 gene locus_tag LOCUS_18440 11 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2571 1984 gene locus_tag LOCUS_18450 2571 1984 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_18450 2739 4925 gene locus_tag LOCUS_18460 2739 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence0263 <1 979 gene locus_tag LOCUS_18470 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705033.1:putative arylsulfatase AtsA 2869 1070 gene locus_tag LOCUS_18480 2869 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 4178 2934 gene locus_tag LOCUS_18490 gene cheB1 4178 2934 CDS product chemotaxis response regulator protein-glutamate methylesterase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX18 protein_id gnl|my_center|LOCUS_18490 5062 4190 gene locus_tag LOCUS_18500 5062 4190 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 protein_id gnl|my_center|LOCUS_18500 5499 5059 gene locus_tag LOCUS_18510 gene cheW-2 5499 5059 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_18510 <6523 5496 gene locus_tag LOCUS_18520 <6523 5496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083225.1:ATPase >Feature sequence0264 1157 1549 gene locus_tag LOCUS_18530 1157 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920811.1 protein_id gnl|my_center|LOCUS_18530 1701 2285 gene locus_tag LOCUS_18540 1701 2285 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_18540 2282 4999 gene locus_tag LOCUS_18550 2282 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 5167 6363 gene locus_tag LOCUS_18560 5167 6363 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731361.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence0265 <1 580 gene locus_tag LOCUS_18570 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730646.1:glutamate synthase 838 2202 gene locus_tag LOCUS_18580 838 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2597 2331 gene locus_tag LOCUS_18590 2597 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 2932 3822 gene locus_tag LOCUS_18600 gene ddg 2932 3822 CDS product lipid A biosynthesis palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210042.1 protein_id gnl|my_center|LOCUS_18600 5950 3968 gene locus_tag LOCUS_18610 5950 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence0266 2 517 gene locus_tag LOCUS_18620 2 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 514 1524 gene locus_tag LOCUS_18630 514 1524 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 protein_id gnl|my_center|LOCUS_18630 2492 1605 gene locus_tag LOCUS_18640 gene folD 2492 1605 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNB2 protein_id gnl|my_center|LOCUS_18640 2583 3548 gene locus_tag LOCUS_18650 gene glpG 2583 3548 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145885.1 protein_id gnl|my_center|LOCUS_18650 3579 4511 gene locus_tag LOCUS_18660 3579 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence0267 1697 3220 gene locus_tag LOCUS_18670 1697 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 3306 4640 gene locus_tag LOCUS_18680 3306 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence0268 <1 1733 gene locus_tag LOCUS_18690 <1 1733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776786.1:arylsulfatase 3630 1747 gene locus_tag LOCUS_18700 3630 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 4354 3746 gene locus_tag LOCUS_18710 4354 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence0269 2 340 gene locus_tag LOCUS_18720 2 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2313 388 gene locus_tag LOCUS_18730 2313 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 4817 2343 gene locus_tag LOCUS_18740 4817 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 5095 6069 gene locus_tag LOCUS_18750 5095 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence0270 1992 172 gene locus_tag LOCUS_18760 1992 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 4022 2139 gene locus_tag LOCUS_18770 4022 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 4612 4019 gene locus_tag LOCUS_18780 gene rpoE 4612 4019 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence0271 1295 2227 gene locus_tag LOCUS_18790 1295 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2477 2884 gene locus_tag LOCUS_18800 2477 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3116 5164 gene locus_tag LOCUS_18810 3116 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence0272 2191 1436 gene locus_tag LOCUS_18820 gene kdsB 2191 1436 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBF7 protein_id gnl|my_center|LOCUS_18820 2723 2193 gene locus_tag LOCUS_18830 2723 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 3004 3576 gene locus_tag LOCUS_18840 3004 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 3590 4324 gene locus_tag LOCUS_18850 3590 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 4523 5431 gene locus_tag LOCUS_18860 4523 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 <6425 5701 gene locus_tag LOCUS_18870 <6425 5701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403955.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence0273 1942 386 gene locus_tag LOCUS_18880 1942 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 3147 2479 gene locus_tag LOCUS_18890 3147 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 3467 3144 gene locus_tag LOCUS_18900 3467 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 3384 3665 gene locus_tag LOCUS_18910 3384 3665 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 protein_id gnl|my_center|LOCUS_18910 3662 4141 gene locus_tag LOCUS_18920 3662 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4138 4581 gene locus_tag LOCUS_18930 4138 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 6042 4606 gene locus_tag LOCUS_18940 6042 4606 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence0274 348 3146 gene locus_tag LOCUS_18950 348 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 4370 3147 gene locus_tag LOCUS_18960 4370 3147 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_18960 4449 5672 gene locus_tag LOCUS_18970 4449 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence0275 231 422 gene locus_tag LOCUS_18980 231 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 2309 441 gene locus_tag LOCUS_18990 gene mnmG 2309 441 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Q4 protein_id gnl|my_center|LOCUS_18990 5043 2458 gene locus_tag LOCUS_19000 5043 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence0276 <1 2510 gene locus_tag LOCUS_19010 <1 2510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460676.1:aminomethyltransferase 5789 2595 gene locus_tag LOCUS_19020 5789 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence0277 3669 487 gene locus_tag LOCUS_19030 gene mexF 3669 487 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122351.1 protein_id gnl|my_center|LOCUS_19030 4823 3666 gene locus_tag LOCUS_19040 4823 3666 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940505.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence0278 1122 199 gene locus_tag LOCUS_19050 1122 199 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531489.1 protein_id gnl|my_center|LOCUS_19050 2126 1146 gene locus_tag LOCUS_19060 2126 1146 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195868.1 protein_id gnl|my_center|LOCUS_19060 4658 2370 gene locus_tag LOCUS_19070 4658 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 4800 5210 gene locus_tag LOCUS_19080 4800 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence0279 2708 3826 gene locus_tag LOCUS_19090 2708 3826 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_19090 3975 4376 gene locus_tag LOCUS_19100 3975 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence0280 1441 1923 gene locus_tag LOCUS_19110 1441 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2868 1951 gene locus_tag LOCUS_19120 2868 1951 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404765.1 protein_id gnl|my_center|LOCUS_19120 2828 4321 gene locus_tag LOCUS_19130 2828 4321 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124107.1 protein_id gnl|my_center|LOCUS_19130 4326 5993 gene locus_tag LOCUS_19140 4326 5993 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339023.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence0281 1226 1840 gene locus_tag LOCUS_19150 1226 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2530 2312 gene locus_tag LOCUS_19160 2530 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 5057 2904 gene locus_tag LOCUS_19170 5057 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 5359 6096 gene locus_tag LOCUS_19180 gene pepE 5359 6096 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93RZ5 protein_id gnl|my_center|LOCUS_19180 >Feature sequence0282 3941 2820 gene locus_tag LOCUS_19190 3941 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 4186 4809 gene locus_tag LOCUS_19200 4186 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence0283 1603 296 gene locus_tag LOCUS_19210 1603 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2108 2632 gene locus_tag LOCUS_19220 2108 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2734 4869 gene locus_tag LOCUS_19230 2734 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 4937 6109 gene locus_tag LOCUS_19240 4937 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence0284 109 840 gene locus_tag LOCUS_19250 109 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530131.1 protein_id gnl|my_center|LOCUS_19250 1306 860 gene locus_tag LOCUS_19260 1306 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1938 1303 gene locus_tag LOCUS_19270 1938 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2671 2087 gene locus_tag LOCUS_19280 2671 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2855 6214 gene locus_tag LOCUS_19290 2855 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 >Feature sequence0285 2225 840 gene locus_tag LOCUS_19300 2225 840 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310733.1 protein_id gnl|my_center|LOCUS_19300 4027 2225 gene locus_tag LOCUS_19310 4027 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence0286 1798 911 gene locus_tag LOCUS_19320 1798 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2733 1879 gene locus_tag LOCUS_19330 2733 1879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_19330 3536 3610 gene locus_tag LOCUS_t00190 3536 3610 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3699 6065 gene locus_tag LOCUS_19340 3699 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence0287 7 1641 gene locus_tag LOCUS_19350 7 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2179 5040 gene locus_tag LOCUS_19360 2179 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 >Feature sequence0288 2471 4828 gene locus_tag LOCUS_19370 2471 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057920.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence0289 2 364 gene locus_tag LOCUS_19380 2 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 1214 378 gene locus_tag LOCUS_19390 1214 378 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_19390 1496 1230 gene locus_tag LOCUS_19400 1496 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 1991 4276 gene locus_tag LOCUS_19410 1991 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 4460 4750 gene locus_tag LOCUS_19420 4460 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 <6206 4781 gene locus_tag LOCUS_19430 <6206 4781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224968.1:non-ribosomal peptide synthetase >Feature sequence0290 2813 1176 gene locus_tag LOCUS_19440 gene hyfR 2813 1176 CDS product hydrogenase-4 transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122367.1 protein_id gnl|my_center|LOCUS_19440 3019 3723 gene locus_tag LOCUS_19450 3019 3723 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797789.1 protein_id gnl|my_center|LOCUS_19450 3813 4853 gene locus_tag LOCUS_19460 3813 4853 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122363.1 protein_id gnl|my_center|LOCUS_19460 4890 5549 gene locus_tag LOCUS_19470 4890 5549 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529397.1 protein_id gnl|my_center|LOCUS_19470 <6200 5579 gene locus_tag LOCUS_19480 <6200 5579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338705.1:saccharopine dehydrogenase >Feature sequence0291 1368 565 gene locus_tag LOCUS_19490 gene cobB1 1368 565 CDS product NAD-dependent protein deacetylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LY4 protein_id gnl|my_center|LOCUS_19490 2369 1365 gene locus_tag LOCUS_19500 2369 1365 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_19500 5519 2427 gene locus_tag LOCUS_19510 5519 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence0292 1304 915 gene locus_tag LOCUS_19520 1304 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121288.1 protein_id gnl|my_center|LOCUS_19520 1460 2326 gene locus_tag LOCUS_19530 1460 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 4306 2345 gene locus_tag LOCUS_19540 4306 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence0293 436 1608 gene locus_tag LOCUS_19550 gene celE 436 1608 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_19550 1593 3947 gene locus_tag LOCUS_19560 1593 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence0294 4289 1146 gene locus_tag LOCUS_19570 4289 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 4550 5803 gene locus_tag LOCUS_19580 4550 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence0295 <1 678 gene locus_tag LOCUS_19590 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000868621.1:glycosyl transferase 910 821 gene locus_tag LOCUS_t00200 910 821 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1430 930 gene locus_tag LOCUS_19600 gene tadA 1430 930 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIP0 protein_id gnl|my_center|LOCUS_19600 1606 1530 gene locus_tag LOCUS_t00210 1606 1530 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2507 1752 gene locus_tag LOCUS_19610 2507 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 3896 2592 gene locus_tag LOCUS_19620 3896 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 4384 3899 gene locus_tag LOCUS_19630 4384 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence0296 467 1981 gene locus_tag LOCUS_19640 467 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2020 2970 gene locus_tag LOCUS_19650 2020 2970 CDS product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404319.1 protein_id gnl|my_center|LOCUS_19650 3472 2990 gene locus_tag LOCUS_19660 3472 2990 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_19660 3600 3980 gene locus_tag LOCUS_19670 3600 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 5182 3944 gene locus_tag LOCUS_19680 5182 3944 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966040.1 protein_id gnl|my_center|LOCUS_19680 <6108 5179 gene locus_tag LOCUS_19690 <6108 5179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226592.1:argininosuccinate lyase >Feature sequence0297 879 4040 gene locus_tag LOCUS_19700 879 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 4167 5216 gene locus_tag LOCUS_19710 4167 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 5227 5580 gene locus_tag LOCUS_19720 5227 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence0298 186 1430 gene locus_tag LOCUS_19730 gene kbl 186 1430 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3V0 protein_id gnl|my_center|LOCUS_19730 1443 2252 gene locus_tag LOCUS_19740 1443 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_19740 2701 2267 gene locus_tag LOCUS_19750 2701 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2835 3752 gene locus_tag LOCUS_19760 2835 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 3749 5329 gene locus_tag LOCUS_19770 3749 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence0299 208 594 gene locus_tag LOCUS_19780 208 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 572 973 gene locus_tag LOCUS_19790 572 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1422 1012 gene locus_tag LOCUS_19800 1422 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 1750 3606 gene locus_tag LOCUS_19810 1750 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 3606 4901 gene locus_tag LOCUS_19820 3606 4901 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122959.1 protein_id gnl|my_center|LOCUS_19820 4904 5578 gene locus_tag LOCUS_19830 4904 5578 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022370.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence0300 <1 986 gene locus_tag LOCUS_19840 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122223.1:deoxyribodipyrimidine photo-lyase 1062 1487 gene locus_tag LOCUS_19850 1062 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2582 1590 gene locus_tag LOCUS_19860 2582 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 4017 2683 gene locus_tag LOCUS_19870 4017 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 4777 4064 gene locus_tag LOCUS_19880 4777 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 5280 4774 gene locus_tag LOCUS_19890 5280 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 <6047 5305 gene locus_tag LOCUS_19900 <6047 5305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263910.1:mechanosensitive ion channel protein >Feature sequence0301 811 320 gene locus_tag LOCUS_19910 811 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 protein_id gnl|my_center|LOCUS_19910 1684 1265 gene locus_tag LOCUS_19920 1684 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1736 2404 gene locus_tag LOCUS_19930 1736 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2841 2987 gene locus_tag LOCUS_19940 2841 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 3433 4707 gene locus_tag LOCUS_19950 3433 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence0302 113 541 gene locus_tag LOCUS_19960 113 541 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272725.1 protein_id gnl|my_center|LOCUS_19960 684 1070 gene locus_tag LOCUS_19970 684 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1325 2353 gene locus_tag LOCUS_19980 1325 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 4854 2713 gene locus_tag LOCUS_19990 4854 2713 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_19990 5792 4851 gene locus_tag LOCUS_20000 5792 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence0303 <1 2165 gene locus_tag LOCUS_20010 <1 2165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030954.1:MFS transporter 2259 3860 gene locus_tag LOCUS_20020 2259 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 4832 3894 gene locus_tag LOCUS_20030 4832 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence0304 1899 1126 gene locus_tag LOCUS_20040 1899 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2069 2686 gene locus_tag LOCUS_20050 2069 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2696 3070 gene locus_tag LOCUS_20060 2696 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 5172 3079 gene locus_tag LOCUS_20070 5172 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence0305 588 2531 gene locus_tag LOCUS_20080 588 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675225.1 protein_id gnl|my_center|LOCUS_20080 2543 4510 gene locus_tag LOCUS_20090 2543 4510 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037137.1 protein_id gnl|my_center|LOCUS_20090 <5936 4542 gene locus_tag LOCUS_20100 <5936 4542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120414.1:aryl-sulfate sulfohydrolase >Feature sequence0306 <1 1239 gene locus_tag LOCUS_20110 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868766.1:peptide ABC transporter substrate-binding protein 2372 1236 gene locus_tag LOCUS_20120 2372 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 4105 2369 gene locus_tag LOCUS_20130 4105 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 5389 4202 gene locus_tag LOCUS_20140 5389 4202 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393486.1 protein_id gnl|my_center|LOCUS_20140 <5917 5386 gene locus_tag LOCUS_20150 <5917 5386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CI0:homoserine dehydrogenase >Feature sequence0307 2319 3155 gene locus_tag LOCUS_20160 2319 3155 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KM60 protein_id gnl|my_center|LOCUS_20160 3879 3163 gene locus_tag LOCUS_20170 3879 3163 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975742.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence0308 545 2443 gene locus_tag LOCUS_20180 545 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 3313 2579 gene locus_tag LOCUS_20190 3313 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 4239 3310 gene locus_tag LOCUS_20200 gene soj 4239 3310 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37522 protein_id gnl|my_center|LOCUS_20200 4773 5231 gene locus_tag LOCUS_20210 4773 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence0309 597 1265 gene locus_tag LOCUS_20220 597 1265 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949128.1 protein_id gnl|my_center|LOCUS_20220 1342 1749 gene locus_tag LOCUS_20230 1342 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1763 4123 gene locus_tag LOCUS_20240 1763 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 4253 4837 gene locus_tag LOCUS_20250 4253 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_20250 4904 5311 gene locus_tag LOCUS_20260 4904 5311 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036527.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence0310 1589 312 gene locus_tag LOCUS_20270 gene aroA 1589 312 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW43 protein_id gnl|my_center|LOCUS_20270 1778 2686 gene locus_tag LOCUS_20280 gene purC 1778 2686 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFN3 protein_id gnl|my_center|LOCUS_20280 2760 3812 gene locus_tag LOCUS_20290 gene mtnA 2760 3812 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKL8 protein_id gnl|my_center|LOCUS_20290 4667 3879 gene locus_tag LOCUS_20300 4667 3879 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGT9 protein_id gnl|my_center|LOCUS_20300 4973 5152 gene locus_tag LOCUS_20310 4973 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 5730 5332 gene locus_tag LOCUS_20320 5730 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence0311 2032 3471 gene locus_tag LOCUS_20330 2032 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 <5878 3478 gene locus_tag LOCUS_20340 <5878 3478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123669.1:serine/threonine protein kinase >Feature sequence0312 349 1746 gene locus_tag LOCUS_20350 349 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 1880 3910 gene locus_tag LOCUS_20360 gene mutS2 1880 3910 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHS6 protein_id gnl|my_center|LOCUS_20360 4036 4111 gene locus_tag LOCUS_t00220 4036 4111 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4355 4439 gene locus_tag LOCUS_t00230 4355 4439 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4539 4610 gene locus_tag LOCUS_t00240 4539 4610 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4639 4713 gene locus_tag LOCUS_t00250 4639 4713 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0313 2534 762 gene locus_tag LOCUS_20370 gene ftsI 2534 762 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_20370 3253 2831 gene locus_tag LOCUS_20380 3253 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 3441 4229 gene locus_tag LOCUS_20390 3441 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 4814 4368 gene locus_tag LOCUS_20400 gene mraZ 4814 4368 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CSX8 protein_id gnl|my_center|LOCUS_20400 >Feature sequence0314 53 1201 gene locus_tag LOCUS_20410 53 1201 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_20410 1330 2739 gene locus_tag LOCUS_20420 1330 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 4724 2760 gene locus_tag LOCUS_20430 4724 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence0315 314 1078 gene locus_tag LOCUS_20440 314 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_20440 2438 1110 gene locus_tag LOCUS_20450 2438 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2680 3813 gene locus_tag LOCUS_20460 2680 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 5058 3844 gene locus_tag LOCUS_20470 5058 3844 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence0316 1933 3765 gene locus_tag LOCUS_20480 1933 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 3810 5654 gene locus_tag LOCUS_20490 3810 5654 CDS product putative Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59825 protein_id gnl|my_center|LOCUS_20490 >Feature sequence0317 439 960 gene locus_tag LOCUS_20500 439 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2520 982 gene locus_tag LOCUS_20510 2520 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 3393 2677 gene locus_tag LOCUS_20520 3393 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3648 4685 gene locus_tag LOCUS_20530 3648 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence0318 2407 3945 gene locus_tag LOCUS_20540 2407 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 4019 5650 gene locus_tag LOCUS_20550 4019 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence0319 46 1581 gene locus_tag LOCUS_20560 46 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 1751 1578 gene locus_tag LOCUS_20570 1751 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 1916 3688 gene locus_tag LOCUS_20580 1916 3688 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_20580 3734 4126 gene locus_tag LOCUS_20590 3734 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 4172 4432 gene locus_tag LOCUS_20600 4172 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 4503 4775 gene locus_tag LOCUS_20610 4503 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 4802 5653 gene locus_tag LOCUS_20620 4802 5653 CDS product lysine biosynthesis enzyme LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence0320 <1 1552 gene locus_tag LOCUS_20630 <1 1552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000810500.1:sucrose phosphorylase 1570 1869 gene locus_tag LOCUS_20640 1570 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816062.1 protein_id gnl|my_center|LOCUS_20640 1996 2544 gene locus_tag LOCUS_20650 1996 2544 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2S2 protein_id gnl|my_center|LOCUS_20650 2583 5381 gene locus_tag LOCUS_20660 2583 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence0321 3222 1885 gene locus_tag LOCUS_20670 3222 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence0322 1634 3055 gene locus_tag LOCUS_20680 1634 3055 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_20680 3286 4041 gene locus_tag LOCUS_20690 3286 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 4038 4556 gene locus_tag LOCUS_20700 4038 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 4549 5256 gene locus_tag LOCUS_20710 4549 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence0323 121 1053 gene locus_tag LOCUS_20720 121 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 1072 1341 gene locus_tag LOCUS_20730 gene fliQ 1072 1341 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420339.1 protein_id gnl|my_center|LOCUS_20730 1346 2125 gene locus_tag LOCUS_20740 gene fliR 1346 2125 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR19 protein_id gnl|my_center|LOCUS_20740 2141 3226 gene locus_tag LOCUS_20750 2141 3226 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870058.1 protein_id gnl|my_center|LOCUS_20750 3223 5331 gene locus_tag LOCUS_20760 3223 5331 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870057.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence0324 1917 2360 gene locus_tag LOCUS_20770 1917 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 2513 4174 gene locus_tag LOCUS_20780 2513 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence0325 1483 3201 gene locus_tag LOCUS_20790 1483 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 5485 3179 gene locus_tag LOCUS_20800 5485 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 5808 5581 gene locus_tag LOCUS_20810 5808 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence0326 <1 1900 gene locus_tag LOCUS_20820 <1 1900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TJ3:tricorn protease 2291 1947 gene locus_tag LOCUS_20830 2291 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2574 4997 gene locus_tag LOCUS_20840 2574 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence0327 <1 880 gene locus_tag LOCUS_20850 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887184.1:pilus assembly protein CpaC 1473 1817 gene locus_tag LOCUS_20860 1473 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124019.1 protein_id gnl|my_center|LOCUS_20860 1976 2410 gene locus_tag LOCUS_20870 1976 2410 CDS product type 4 prepilin peptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124020.1 protein_id gnl|my_center|LOCUS_20870 2394 3374 gene locus_tag LOCUS_20880 2394 3374 CDS product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124021.1 protein_id gnl|my_center|LOCUS_20880 3387 4460 gene locus_tag LOCUS_20890 3387 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence0328 2583 3638 gene locus_tag LOCUS_20900 2583 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 4073 3660 gene locus_tag LOCUS_20910 4073 3660 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_20910 4272 4499 gene locus_tag LOCUS_20920 4272 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence0329 2344 1427 gene locus_tag LOCUS_20930 2344 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 3237 2347 gene locus_tag LOCUS_20940 3237 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 5231 3945 gene locus_tag LOCUS_20950 5231 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence0330 3827 1602 gene locus_tag LOCUS_20960 3827 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 4006 3824 gene locus_tag LOCUS_20970 4006 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 4324 4022 gene locus_tag LOCUS_20980 4324 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 5309 4509 gene locus_tag LOCUS_20990 5309 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 >Feature sequence0331 1817 1332 gene locus_tag LOCUS_21000 1817 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2965 1814 gene locus_tag LOCUS_21010 2965 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 5105 2970 gene locus_tag LOCUS_21020 5105 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 <5736 5102 gene locus_tag LOCUS_21030 <5736 5102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122798.1:membrane protein >Feature sequence0332 2653 1730 gene locus_tag LOCUS_21040 2653 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 4178 2967 gene locus_tag LOCUS_21050 4178 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 4764 4318 gene locus_tag LOCUS_21060 4764 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence0333 1351 626 gene locus_tag LOCUS_21070 1351 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2259 1348 gene locus_tag LOCUS_21080 gene hemC 2259 1348 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46355 protein_id gnl|my_center|LOCUS_21080 3584 2256 gene locus_tag LOCUS_21090 gene hemA 3584 2256 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72C23 protein_id gnl|my_center|LOCUS_21090 4413 3586 gene locus_tag LOCUS_21100 4413 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 4543 5589 gene locus_tag LOCUS_21110 gene hemH 4543 5589 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RH3 protein_id gnl|my_center|LOCUS_21110 >Feature sequence0334 <1 715 gene locus_tag LOCUS_21120 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7ULJ4:polyphosphate kinase 2274 712 gene locus_tag LOCUS_21130 2274 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 2496 3098 gene locus_tag LOCUS_21140 2496 3098 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066656.1 protein_id gnl|my_center|LOCUS_21140 3187 4101 gene locus_tag LOCUS_21150 3187 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence0335 321 1274 gene locus_tag LOCUS_21160 321 1274 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_21160 2131 1316 gene locus_tag LOCUS_21170 2131 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3761 2238 gene locus_tag LOCUS_21180 gene sigA 3761 2238 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQG1 protein_id gnl|my_center|LOCUS_21180 4153 5253 gene locus_tag LOCUS_21190 4153 5253 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC70 protein_id gnl|my_center|LOCUS_21190 5684 5286 gene locus_tag LOCUS_21200 5684 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence0336 2551 551 gene locus_tag LOCUS_21210 2551 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 3225 2554 gene locus_tag LOCUS_21220 3225 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3734 3273 gene locus_tag LOCUS_21230 3734 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence0337 664 1431 gene locus_tag LOCUS_21240 664 1431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_21240 1419 3113 gene locus_tag LOCUS_21250 1419 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 5175 3136 gene locus_tag LOCUS_21260 5175 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence0338 647 2398 gene locus_tag LOCUS_21270 647 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2423 3373 gene locus_tag LOCUS_21280 2423 3373 CDS product voltage-gated potassium channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584156.1 protein_id gnl|my_center|LOCUS_21280 3417 4040 gene locus_tag LOCUS_21290 3417 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 4855 4037 gene locus_tag LOCUS_21300 4855 4037 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964972.1 protein_id gnl|my_center|LOCUS_21300 <5668 4852 gene locus_tag LOCUS_21310 <5668 4852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257764.1:aminotransferase >Feature sequence0339 <1 878 gene locus_tag LOCUS_21320 <1 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459120.1:acetyl-coenzyme A synthetase 883 1185 gene locus_tag LOCUS_21330 883 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 1909 1202 gene locus_tag LOCUS_21340 1909 1202 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_21340 3240 1969 gene locus_tag LOCUS_21350 3240 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 protein_id gnl|my_center|LOCUS_21350 4969 3314 gene locus_tag LOCUS_21360 4969 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence0340 1018 728 gene locus_tag LOCUS_21370 1018 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2296 1034 gene locus_tag LOCUS_21380 2296 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123852.1 protein_id gnl|my_center|LOCUS_21380 3531 2293 gene locus_tag LOCUS_21390 3531 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 4941 3559 gene locus_tag LOCUS_21400 4941 3559 CDS product polysulfide reductase chain C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_21400 <5656 4919 gene locus_tag LOCUS_21410 <5656 4919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123849.1:molybdopterin oxidoreductase >Feature sequence0341 767 123 gene locus_tag LOCUS_21420 767 123 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_21420 2806 809 gene locus_tag LOCUS_21430 2806 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 2971 3486 gene locus_tag LOCUS_21440 2971 3486 CDS product 7,8-dihydro-8-oxoguanine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980098.1 protein_id gnl|my_center|LOCUS_21440 3659 3961 gene locus_tag LOCUS_21450 3659 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence0342 1715 57 gene locus_tag LOCUS_21460 1715 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2225 3211 gene locus_tag LOCUS_21470 2225 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 4787 3273 gene locus_tag LOCUS_21480 4787 3273 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259590.1 protein_id gnl|my_center|LOCUS_21480 <5641 4771 gene locus_tag LOCUS_21490 <5641 4771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965624.1:glycosyl transferase >Feature sequence0343 2152 1625 gene locus_tag LOCUS_21500 2152 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2334 5135 gene locus_tag LOCUS_21510 2334 5135 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBV3 protein_id gnl|my_center|LOCUS_21510 >Feature sequence0344 960 190 gene locus_tag LOCUS_21520 960 190 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119176.1 protein_id gnl|my_center|LOCUS_21520 1076 1504 gene locus_tag LOCUS_21530 1076 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 1501 2685 gene locus_tag LOCUS_21540 1501 2685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941337.1 protein_id gnl|my_center|LOCUS_21540 2682 3350 gene locus_tag LOCUS_21550 gene lolD 2682 3350 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61481 protein_id gnl|my_center|LOCUS_21550 3407 4723 gene locus_tag LOCUS_21560 3407 4723 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404741.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence0345 1543 887 gene locus_tag LOCUS_21570 1543 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2735 1692 gene locus_tag LOCUS_21580 gene korB 2735 1692 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121170.1 protein_id gnl|my_center|LOCUS_21580 4594 2741 gene locus_tag LOCUS_21590 4594 2741 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030783.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence0346 475 2667 gene locus_tag LOCUS_21600 475 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 2759 3223 gene locus_tag LOCUS_21610 2759 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 3238 3732 gene locus_tag LOCUS_21620 3238 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 4538 4341 gene locus_tag LOCUS_21630 4538 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 <5590 4626 gene locus_tag LOCUS_21640 <5590 4626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118417.1:serine/threonine protein kinase >Feature sequence0347 2459 537 gene locus_tag LOCUS_21650 2459 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2734 4104 gene locus_tag LOCUS_21660 2734 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 4145 4453 gene locus_tag LOCUS_21670 4145 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 protein_id gnl|my_center|LOCUS_21670 <5579 4468 gene locus_tag LOCUS_21680 <5579 4468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119651.1:sodium:proline symporter >Feature sequence0348 3 278 gene locus_tag LOCUS_21690 3 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 367 741 gene locus_tag LOCUS_21700 367 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 769 1995 gene locus_tag LOCUS_21710 769 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 3297 2176 gene locus_tag LOCUS_21720 3297 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence0349 829 2496 gene locus_tag LOCUS_21730 829 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3406 5193 gene locus_tag LOCUS_21740 3406 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence0350 761 474 gene locus_tag LOCUS_21750 761 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2112 808 gene locus_tag LOCUS_21760 2112 808 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_21760 2688 2284 gene locus_tag LOCUS_21770 2688 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 3944 2760 gene locus_tag LOCUS_21780 3944 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 4486 3941 gene locus_tag LOCUS_21790 4486 3941 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UV68 protein_id gnl|my_center|LOCUS_21790 5395 4598 gene locus_tag LOCUS_21800 5395 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence0351 330 509 gene locus_tag LOCUS_21810 gene rpmF 330 509 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS3 protein_id gnl|my_center|LOCUS_21810 514 1719 gene locus_tag LOCUS_21820 gene plsX 514 1719 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CS5 protein_id gnl|my_center|LOCUS_21820 1786 2748 gene locus_tag LOCUS_21830 gene fabD 1786 2748 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97DA5 protein_id gnl|my_center|LOCUS_21830 2745 3497 gene locus_tag LOCUS_21840 2745 3497 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_21840 3585 3902 gene locus_tag LOCUS_21850 3585 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 3906 5144 gene locus_tag LOCUS_21860 gene fabF 3906 5144 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY0 protein_id gnl|my_center|LOCUS_21860 >Feature sequence0352 <1 810 gene locus_tag LOCUS_21870 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933690.1:threonine synthase 907 1146 gene locus_tag LOCUS_21880 907 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1597 1121 gene locus_tag LOCUS_21890 1597 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 1644 2093 gene locus_tag LOCUS_21900 1644 2093 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813571.1 protein_id gnl|my_center|LOCUS_21900 4389 2479 gene locus_tag LOCUS_21910 4389 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence0353 1227 706 gene locus_tag LOCUS_21920 1227 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2669 1224 gene locus_tag LOCUS_21930 2669 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 3751 2696 gene locus_tag LOCUS_21940 gene mreB-1 3751 2696 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_21940 4387 4172 gene locus_tag LOCUS_21950 4387 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 5259 4414 gene locus_tag LOCUS_21960 5259 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence0354 1752 3086 gene locus_tag LOCUS_21970 1752 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 3108 4364 gene locus_tag LOCUS_21980 3108 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence0355 1464 1252 gene locus_tag LOCUS_21990 1464 1252 CDS product ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325922.1 protein_id gnl|my_center|LOCUS_21990 1694 3445 gene locus_tag LOCUS_22000 1694 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 3667 4740 gene locus_tag LOCUS_22010 3667 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence0356 762 322 gene locus_tag LOCUS_22020 762 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1681 767 gene locus_tag LOCUS_22030 1681 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_22030 2720 1650 gene locus_tag LOCUS_22040 gene moxR 2720 1650 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_22040 5038 2777 gene locus_tag LOCUS_22050 5038 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence0357 772 2034 gene locus_tag LOCUS_22060 772 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 3579 2053 gene locus_tag LOCUS_22070 3579 2053 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_22070 3786 5384 gene locus_tag LOCUS_22080 3786 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence0358 1308 775 gene locus_tag LOCUS_22090 1308 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 1511 3055 gene locus_tag LOCUS_22100 1511 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 <5417 3156 gene locus_tag LOCUS_22110 <5417 3156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120525.1:serine/threonine protein kinase >Feature sequence0359 <1 1473 gene locus_tag LOCUS_22120 <1 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000202873.1:ATP-dependent DNA helicase RecQ 2268 1519 gene locus_tag LOCUS_22130 2268 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 4564 2288 gene locus_tag LOCUS_22140 4564 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 4677 5267 gene locus_tag LOCUS_22150 4677 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 >Feature sequence0360 1710 1525 gene locus_tag LOCUS_22160 1710 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 3057 1843 gene locus_tag LOCUS_22170 3057 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_22170 4441 3044 gene locus_tag LOCUS_22180 4441 3044 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_22180 4931 4476 gene locus_tag LOCUS_22190 4931 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 5224 4928 gene locus_tag LOCUS_22200 5224 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence0361 <5378 3047 gene locus_tag LOCUS_22210 <5378 3047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072023.1:acriflavin resistance protein >Feature sequence0362 2933 1917 gene locus_tag LOCUS_22220 gene ddlA 2933 1917 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_22220 4075 2939 gene locus_tag LOCUS_22230 4075 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124130.1 protein_id gnl|my_center|LOCUS_22230 4868 4176 gene locus_tag LOCUS_22240 4868 4176 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence0363 <1 1899 gene locus_tag LOCUS_22250 <1 1899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase 2047 3831 gene locus_tag LOCUS_22260 2047 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence0364 568 1491 gene locus_tag LOCUS_22270 568 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 1635 2468 gene locus_tag LOCUS_22280 1635 2468 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389061.1 protein_id gnl|my_center|LOCUS_22280 3831 2629 gene locus_tag LOCUS_22290 3831 2629 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_22290 5041 3836 gene locus_tag LOCUS_22300 5041 3836 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence0365 92 832 gene locus_tag LOCUS_22310 92 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 994 845 gene locus_tag LOCUS_22320 994 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 1414 1154 gene locus_tag LOCUS_22330 1414 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22330 1634 1506 gene locus_tag LOCUS_22340 1634 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2253 2690 gene locus_tag LOCUS_22350 2253 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 3161 4195 gene locus_tag LOCUS_22360 3161 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 4745 4317 gene locus_tag LOCUS_22370 4745 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence0366 875 1435 gene locus_tag LOCUS_22380 875 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1449 2051 gene locus_tag LOCUS_22390 1449 2051 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_22390 3974 2076 gene locus_tag LOCUS_22400 3974 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 3973 4662 gene locus_tag LOCUS_22410 3973 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 <5357 4706 gene locus_tag LOCUS_22420 <5357 4706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TJ3:tricorn protease >Feature sequence0367 2670 1318 gene locus_tag LOCUS_22430 2670 1318 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_22430 2929 4926 gene locus_tag LOCUS_22440 2929 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 5194 4931 gene locus_tag LOCUS_22450 5194 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence0368 <1 1817 gene locus_tag LOCUS_22460 <1 1817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KG27:DNA gyrase subunit A 2606 1842 gene locus_tag LOCUS_22470 2606 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 4573 2618 gene locus_tag LOCUS_22480 4573 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence0369 160 1293 gene locus_tag LOCUS_22490 160 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 2000 1347 gene locus_tag LOCUS_22500 2000 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2281 2925 gene locus_tag LOCUS_22510 2281 2925 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188734.1 protein_id gnl|my_center|LOCUS_22510 4389 2971 gene locus_tag LOCUS_22520 4389 2971 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038532.1 protein_id gnl|my_center|LOCUS_22520 4929 4507 gene locus_tag LOCUS_22530 4929 4507 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282526.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence0370 <1 1541 gene locus_tag LOCUS_22540 <1 1541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067720.1:alpha/beta hydrolase 3667 1637 gene locus_tag LOCUS_22550 3667 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence0371 845 1867 gene locus_tag LOCUS_22560 gene ruvB 845 1867 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650B4 protein_id gnl|my_center|LOCUS_22560 1953 3125 gene locus_tag LOCUS_22570 1953 3125 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943259.1 protein_id gnl|my_center|LOCUS_22570 3153 4289 gene locus_tag LOCUS_22580 gene tgt 3153 4289 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183P1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence0372 560 2536 gene locus_tag LOCUS_22590 560 2536 CDS product acetoacetate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 protein_id gnl|my_center|LOCUS_22590 3473 2508 gene locus_tag LOCUS_22600 3473 2508 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931679.1 protein_id gnl|my_center|LOCUS_22600 <5339 3473 gene locus_tag LOCUS_22610 <5339 3473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776786.1:arylsulfatase >Feature sequence0373 412 1008 gene locus_tag LOCUS_22620 412 1008 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_22620 1219 2196 gene locus_tag LOCUS_22630 1219 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2646 2224 gene locus_tag LOCUS_22640 2646 2224 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089880.1 protein_id gnl|my_center|LOCUS_22640 2727 3560 gene locus_tag LOCUS_22650 gene dapF 2727 3560 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK34 protein_id gnl|my_center|LOCUS_22650 3560 5146 gene locus_tag LOCUS_22660 3560 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence0374 1197 1685 gene locus_tag LOCUS_22670 1197 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 4107 1723 gene locus_tag LOCUS_22680 4107 1723 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_22680 5293 4115 gene locus_tag LOCUS_22690 5293 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence0375 1597 809 gene locus_tag LOCUS_22700 1597 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3956 1677 gene locus_tag LOCUS_22710 3956 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 4552 3953 gene locus_tag LOCUS_22720 4552 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 4722 5270 gene locus_tag LOCUS_22730 4722 5270 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992764.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence0376 606 1973 gene locus_tag LOCUS_22740 gene ykoK 606 1973 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM21 protein_id gnl|my_center|LOCUS_22740 2580 1978 gene locus_tag LOCUS_22750 2580 1978 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_22750 3383 2670 gene locus_tag LOCUS_22760 3383 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence0377 23 1336 gene locus_tag LOCUS_22770 23 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 1417 2601 gene locus_tag LOCUS_22780 1417 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 3939 2653 gene locus_tag LOCUS_22790 gene clpX 3939 2653 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI1 protein_id gnl|my_center|LOCUS_22790 4605 3946 gene locus_tag LOCUS_22800 gene clpP 4605 3946 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA83 protein_id gnl|my_center|LOCUS_22800 >Feature sequence0378 2607 1372 gene locus_tag LOCUS_22810 2607 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 3323 2748 gene locus_tag LOCUS_22820 gene sigW 3323 2748 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYY2 protein_id gnl|my_center|LOCUS_22820 5272 3512 gene locus_tag LOCUS_22830 gene ggt 5272 3512 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083412.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence0379 864 544 gene locus_tag LOCUS_22840 864 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 1253 3922 gene locus_tag LOCUS_22850 1253 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 3919 4572 gene locus_tag LOCUS_22860 3919 4572 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028149.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence0380 3363 1324 gene locus_tag LOCUS_22870 3363 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3618 4679 gene locus_tag LOCUS_22880 3618 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 4835 5107 gene locus_tag LOCUS_22890 4835 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence0381 <1 844 gene locus_tag LOCUS_22900 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121935.1:cytochrome c biogenesis protein 859 2712 gene locus_tag LOCUS_22910 859 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22910 4056 2761 gene locus_tag LOCUS_22920 4056 2761 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259590.1 protein_id gnl|my_center|LOCUS_22920 5029 4067 gene locus_tag LOCUS_22930 gene rfbN 5029 4067 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence0382 1189 41 gene locus_tag LOCUS_22940 gene murG 1189 41 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFT4 protein_id gnl|my_center|LOCUS_22940 2370 1186 gene locus_tag LOCUS_22950 2370 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 3538 2399 gene locus_tag LOCUS_22960 3538 2399 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_22960 4649 3543 gene locus_tag LOCUS_22970 gene mraY 4649 3543 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU1 protein_id gnl|my_center|LOCUS_22970 <5284 4646 gene locus_tag LOCUS_22980 <5284 4646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228423.1:UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate--D-alanyl-D-alanine ligase >Feature sequence0383 371 1306 gene locus_tag LOCUS_22990 371 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 4501 1331 gene locus_tag LOCUS_23000 gene ileS 4501 1331 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D3M4 protein_id gnl|my_center|LOCUS_23000 >Feature sequence0384 178 1641 gene locus_tag LOCUS_23010 178 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 2164 1694 gene locus_tag LOCUS_23020 2164 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2676 2164 gene locus_tag LOCUS_23030 2676 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 3057 2698 gene locus_tag LOCUS_23040 3057 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 3542 4408 gene locus_tag LOCUS_23050 3542 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence0385 1460 849 gene locus_tag LOCUS_23060 1460 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227753.1 protein_id gnl|my_center|LOCUS_23060 2886 1468 gene locus_tag LOCUS_23070 2886 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 3985 2918 gene locus_tag LOCUS_23080 3985 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 4290 3982 gene locus_tag LOCUS_23090 4290 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 >Feature sequence0386 381 1523 gene locus_tag LOCUS_23100 381 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 1520 2194 gene locus_tag LOCUS_23110 1520 2194 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_23110 2769 2212 gene locus_tag LOCUS_23120 2769 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 3708 2878 gene locus_tag LOCUS_23130 3708 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 3745 4239 gene locus_tag LOCUS_23140 gene tpx 3745 4239 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KED5 protein_id gnl|my_center|LOCUS_23140 >Feature sequence0387 1446 1117 gene locus_tag LOCUS_23150 1446 1117 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_23150 1969 1520 gene locus_tag LOCUS_23160 1969 1520 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_23160 3225 1969 gene locus_tag LOCUS_23170 3225 1969 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_23170 4560 3238 gene locus_tag LOCUS_23180 gene sufD 4560 3238 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404137.1 protein_id gnl|my_center|LOCUS_23180 <5250 4610 gene locus_tag LOCUS_23190 <5250 4610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141371.1:ABC transporter ATP-binding protein >Feature sequence0388 2 289 gene locus_tag LOCUS_23200 2 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 481 3405 gene locus_tag LOCUS_23210 481 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence0389 1434 358 gene locus_tag LOCUS_23220 1434 358 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_23220 1982 1434 gene locus_tag LOCUS_23230 gene lrp 1982 1434 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807296.1 protein_id gnl|my_center|LOCUS_23230 3431 2187 gene locus_tag LOCUS_23240 3431 2187 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67355 protein_id gnl|my_center|LOCUS_23240 4105 3431 gene locus_tag LOCUS_23250 4105 3431 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937674.1 protein_id gnl|my_center|LOCUS_23250 4670 4248 gene locus_tag LOCUS_23260 4670 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23260 >Feature sequence0390 80 1288 gene locus_tag LOCUS_23270 80 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 1335 3188 gene locus_tag LOCUS_23280 1335 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 4814 3210 gene locus_tag LOCUS_23290 4814 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140595.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence0391 2095 3903 gene locus_tag LOCUS_23300 2095 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3965 5146 gene locus_tag LOCUS_23310 3965 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence0392 <1 576 gene locus_tag LOCUS_23320 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385794.1:peptidase M20 573 1952 gene locus_tag LOCUS_23330 573 1952 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_23330 3467 2007 gene locus_tag LOCUS_23340 gene purF 3467 2007 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC02 protein_id gnl|my_center|LOCUS_23340 4337 3510 gene locus_tag LOCUS_23350 4337 3510 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_23350 <5195 4328 gene locus_tag LOCUS_23360 <5195 4328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123135.1:membrane protein >Feature sequence0393 897 1598 gene locus_tag LOCUS_23370 897 1598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083291.1 protein_id gnl|my_center|LOCUS_23370 1595 2839 gene locus_tag LOCUS_23380 1595 2839 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884049.1 protein_id gnl|my_center|LOCUS_23380 2836 4608 gene locus_tag LOCUS_23390 2836 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence0394 1359 1715 gene locus_tag LOCUS_23400 1359 1715 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 protein_id gnl|my_center|LOCUS_23400 1722 2198 gene locus_tag LOCUS_23410 1722 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704106.1 protein_id gnl|my_center|LOCUS_23410 2226 2768 gene locus_tag LOCUS_23420 2226 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 2948 4291 gene locus_tag LOCUS_23430 2948 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence0395 2256 1987 gene locus_tag LOCUS_23440 gene rpsO 2256 1987 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018328.1 protein_id gnl|my_center|LOCUS_23440 2812 2360 gene locus_tag LOCUS_23450 2812 2360 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y1N2 protein_id gnl|my_center|LOCUS_23450 2968 4191 gene locus_tag LOCUS_23460 2968 4191 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356901.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence0396 1091 81 gene locus_tag LOCUS_23470 1091 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 2647 1220 gene locus_tag LOCUS_23480 2647 1220 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHK0 protein_id gnl|my_center|LOCUS_23480 3948 2653 gene locus_tag LOCUS_23490 3948 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence0397 735 19 gene locus_tag LOCUS_23500 735 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1946 732 gene locus_tag LOCUS_23510 1946 732 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230328.1 protein_id gnl|my_center|LOCUS_23510 2076 2696 gene locus_tag LOCUS_23520 2076 2696 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226468.1 protein_id gnl|my_center|LOCUS_23520 2748 3575 gene locus_tag LOCUS_23530 2748 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 4302 3580 gene locus_tag LOCUS_23540 4302 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence0398 1038 460 gene locus_tag LOCUS_23550 1038 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 1529 1035 gene locus_tag LOCUS_23560 gene nuoB 1529 1035 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA7 protein_id gnl|my_center|LOCUS_23560 1888 1520 gene locus_tag LOCUS_23570 1888 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2152 3531 gene locus_tag LOCUS_23580 2152 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence0399 <1 621 gene locus_tag LOCUS_23590 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021597.1:DNA topoisomerase VI subunit B 618 1700 gene locus_tag LOCUS_23600 618 1700 CDS product DNA topoisomerase VI subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869868.1 protein_id gnl|my_center|LOCUS_23600 1709 4171 gene locus_tag LOCUS_23610 1709 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 <5169 4195 gene locus_tag LOCUS_23620 <5169 4195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18BK6:aminotransferase >Feature sequence0400 2008 2982 gene locus_tag LOCUS_23630 2008 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 3096 3815 gene locus_tag LOCUS_23640 3096 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 4709 3825 gene locus_tag LOCUS_23650 4709 3825 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence0401 1225 3699 gene locus_tag LOCUS_23660 gene pepN 1225 3699 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_23660 4547 3651 gene locus_tag LOCUS_23670 4547 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 <5157 4567 gene locus_tag LOCUS_23680 <5157 4567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002387410.1:zinc ABC transporter substrate-binding protein AdcA >Feature sequence0402 419 865 gene locus_tag LOCUS_23690 gene atpK 419 865 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871651.1 protein_id gnl|my_center|LOCUS_23690 885 1544 gene locus_tag LOCUS_23700 885 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1555 2217 gene locus_tag LOCUS_23710 1555 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2198 3982 gene locus_tag LOCUS_23720 gene atpA 2198 3982 CDS product V-type ATP synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73M28 protein_id gnl|my_center|LOCUS_23720 4860 3979 gene locus_tag LOCUS_23730 4860 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence0403 679 305 gene locus_tag LOCUS_23740 679 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1512 676 gene locus_tag LOCUS_23750 gene lgt 1512 676 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W5 protein_id gnl|my_center|LOCUS_23750 2867 1509 gene locus_tag LOCUS_23760 2867 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 3062 3805 gene locus_tag LOCUS_23770 3062 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 3923 4411 gene locus_tag LOCUS_23780 3923 4411 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_23780 <5145 4428 gene locus_tag LOCUS_23790 <5145 4428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942482.1:ATP-dependent helicase HrpB >Feature sequence0404 234 1064 gene locus_tag LOCUS_23800 234 1064 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_23800 1271 1501 gene locus_tag LOCUS_23810 1271 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2806 1571 gene locus_tag LOCUS_23820 2806 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 4134 2998 gene locus_tag LOCUS_23830 4134 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence0405 1679 3643 gene locus_tag LOCUS_23840 1679 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 4296 3814 gene locus_tag LOCUS_23850 4296 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence0406 2155 1325 gene locus_tag LOCUS_23860 2155 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 2427 3368 gene locus_tag LOCUS_23870 2427 3368 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_23870 3417 4826 gene locus_tag LOCUS_23880 3417 4826 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879521.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence0407 2257 2994 gene locus_tag LOCUS_23890 2257 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 3173 4150 gene locus_tag LOCUS_23900 3173 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence0408 1420 1650 gene locus_tag LOCUS_23910 1420 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 1726 2463 gene locus_tag LOCUS_23920 1726 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 2501 2971 gene locus_tag LOCUS_23930 2501 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_23930 3133 4716 gene locus_tag LOCUS_23940 3133 4716 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262022.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence0409 2333 1587 gene locus_tag LOCUS_23950 2333 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 3000 2350 gene locus_tag LOCUS_23960 3000 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence0410 227 135 gene locus_tag LOCUS_t00260 227 135 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 643 1785 gene locus_tag LOCUS_23970 643 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 1802 2425 gene locus_tag LOCUS_23980 1802 2425 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122839.1 protein_id gnl|my_center|LOCUS_23980 2985 2482 gene locus_tag LOCUS_23990 2985 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 3172 4071 gene locus_tag LOCUS_24000 3172 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence0411 367 454 gene locus_tag LOCUS_t00270 367 454 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4281 568 gene locus_tag LOCUS_24010 4281 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence0412 1291 1494 gene locus_tag LOCUS_24020 1291 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2981 1653 gene locus_tag LOCUS_24030 gene der 2981 1653 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URJ8 protein_id gnl|my_center|LOCUS_24030 3160 4401 gene locus_tag LOCUS_24040 3160 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence0413 4 168 gene locus_tag LOCUS_24050 4 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 165 1100 gene locus_tag LOCUS_24060 gene argF 165 1100 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP74 protein_id gnl|my_center|LOCUS_24060 3811 1127 gene locus_tag LOCUS_24070 3811 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 4096 4902 gene locus_tag LOCUS_24080 4096 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence0414 <1 777 gene locus_tag LOCUS_24090 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RX36:glycogen operon protein GlgX homolog 774 3011 gene locus_tag LOCUS_24100 gene glgB 774 3011 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0G8 protein_id gnl|my_center|LOCUS_24100 >Feature sequence0415 160 843 gene locus_tag LOCUS_24110 160 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 3132 850 gene locus_tag LOCUS_24120 3132 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence0416 1699 767 gene locus_tag LOCUS_24130 gene glpQ 1699 767 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211490.1 protein_id gnl|my_center|LOCUS_24130 1859 2902 gene locus_tag LOCUS_24140 1859 2902 CDS product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946884.1 protein_id gnl|my_center|LOCUS_24140 3089 2889 gene locus_tag LOCUS_24150 3089 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 3865 3086 gene locus_tag LOCUS_24160 3865 3086 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878463.1 protein_id gnl|my_center|LOCUS_24160 5052 3862 gene locus_tag LOCUS_24170 5052 3862 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_24170 >Feature sequence0417 1980 697 gene locus_tag LOCUS_24180 1980 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601282.1 protein_id gnl|my_center|LOCUS_24180 3254 1992 gene locus_tag LOCUS_24190 gene glgC 3254 1992 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SMC1 protein_id gnl|my_center|LOCUS_24190 4714 3251 gene locus_tag LOCUS_24200 gene glgA 4714 3251 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPY2 protein_id gnl|my_center|LOCUS_24200 >Feature sequence0418 <1 938 gene locus_tag LOCUS_24210 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973125.1:methyltransferase 1717 1013 gene locus_tag LOCUS_24220 1717 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 4160 1986 gene locus_tag LOCUS_24230 gene ptrB 4160 1986 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038594.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence0419 795 1343 gene locus_tag LOCUS_24240 gene haaO 795 1343 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_24240 1394 3394 gene locus_tag LOCUS_24250 1394 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 3391 3906 gene locus_tag LOCUS_24260 3391 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence0420 58 2778 gene locus_tag LOCUS_24270 58 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2784 2936 gene locus_tag LOCUS_24280 2784 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence0421 1607 4231 gene locus_tag LOCUS_24290 1607 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence0422 824 1531 gene locus_tag LOCUS_24300 824 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2849 1521 gene locus_tag LOCUS_24310 2849 1521 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_24310 4754 2979 gene locus_tag LOCUS_24320 4754 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence0423 <1 1822 gene locus_tag LOCUS_24330 <1 1822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795983.1:peptidase S9 3968 1827 gene locus_tag LOCUS_24340 3968 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 >Feature sequence0424 2326 1238 gene locus_tag LOCUS_24350 2326 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2661 4652 gene locus_tag LOCUS_24360 2661 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence0425 2394 826 gene locus_tag LOCUS_24370 2394 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 3365 2451 gene locus_tag LOCUS_24380 3365 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 3757 3362 gene locus_tag LOCUS_24390 3757 3362 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975124.1 protein_id gnl|my_center|LOCUS_24390 <4990 3833 gene locus_tag LOCUS_24400 <4990 3833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118364.1:Na(+)/H(+) antiporter subunit D >Feature sequence0426 51 2066 gene locus_tag LOCUS_24410 51 2066 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_24410 3396 2092 gene locus_tag LOCUS_24420 3396 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24420 >Feature sequence0427 2855 675 gene locus_tag LOCUS_24430 2855 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence0428 499 849 gene locus_tag LOCUS_24440 499 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 846 1400 gene locus_tag LOCUS_24450 846 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1397 2044 gene locus_tag LOCUS_24460 1397 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2041 2487 gene locus_tag LOCUS_24470 2041 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2607 3641 gene locus_tag LOCUS_24480 2607 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 3840 4331 gene locus_tag LOCUS_24490 3840 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence0429 3140 246 gene locus_tag LOCUS_24500 3140 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 3328 4053 gene locus_tag LOCUS_24510 3328 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence0430 1234 3225 gene locus_tag LOCUS_24520 1234 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence0431 33 767 gene locus_tag LOCUS_24530 33 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 764 1480 gene locus_tag LOCUS_24540 764 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2219 3769 gene locus_tag LOCUS_24550 gene rny 2219 3769 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I38 protein_id gnl|my_center|LOCUS_24550 3928 4731 gene locus_tag LOCUS_24560 3928 4731 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence0432 1006 1206 gene locus_tag LOCUS_24570 1006 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 1844 1203 gene locus_tag LOCUS_24580 1844 1203 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021989.1 protein_id gnl|my_center|LOCUS_24580 2790 1849 gene locus_tag LOCUS_24590 2790 1849 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390103.1 protein_id gnl|my_center|LOCUS_24590 2948 4267 gene locus_tag LOCUS_24600 2948 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 >Feature sequence0433 <1 645 gene locus_tag LOCUS_24610 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D7Q5:adenosylhomocysteinase 1340 690 gene locus_tag LOCUS_24620 1340 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 1798 1337 gene locus_tag LOCUS_24630 1798 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 3527 1980 gene locus_tag LOCUS_24640 3527 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 4045 3659 gene locus_tag LOCUS_24650 4045 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228643.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence0434 1473 694 gene locus_tag LOCUS_24660 1473 694 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYL8 protein_id gnl|my_center|LOCUS_24660 2540 1470 gene locus_tag LOCUS_24670 2540 1470 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028963.1 protein_id gnl|my_center|LOCUS_24670 3363 2530 gene locus_tag LOCUS_24680 3363 2530 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876512.1 protein_id gnl|my_center|LOCUS_24680 4231 3416 gene locus_tag LOCUS_24690 gene pyrH 4231 3416 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZM1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence0435 3926 1320 gene locus_tag LOCUS_24700 3926 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence0436 381 58 gene locus_tag LOCUS_24710 381 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 571 1017 gene locus_tag LOCUS_24720 571 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 1981 1115 gene locus_tag LOCUS_24730 1981 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 3300 2527 gene locus_tag LOCUS_24740 3300 2527 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257980.1 protein_id gnl|my_center|LOCUS_24740 4789 3386 gene locus_tag LOCUS_24750 4789 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence0437 1177 275 gene locus_tag LOCUS_24760 1177 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1834 1241 gene locus_tag LOCUS_24770 1834 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 3136 1841 gene locus_tag LOCUS_24780 3136 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 3963 3085 gene locus_tag LOCUS_24790 3963 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 <4915 4148 gene locus_tag LOCUS_24800 <4915 4148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392000.1:amidohydrolase >Feature sequence0438 756 1529 gene locus_tag LOCUS_24810 756 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 1653 3017 gene locus_tag LOCUS_24820 gene dapE 1653 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123589.1 protein_id gnl|my_center|LOCUS_24820 3299 4078 gene locus_tag LOCUS_24830 3299 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 4096 4821 gene locus_tag LOCUS_24840 4096 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence0439 <1 1270 gene locus_tag LOCUS_24850 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943968.1:histidine kinase 1490 3745 gene locus_tag LOCUS_24860 1490 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 <4911 3820 gene locus_tag LOCUS_24870 <4911 3820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068619.1:MFS transporter >Feature sequence0440 899 303 gene locus_tag LOCUS_24880 899 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 3991 983 gene locus_tag LOCUS_24890 gene glyQS 3991 983 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CE22 protein_id gnl|my_center|LOCUS_24890 >Feature sequence0441 <1 1162 gene locus_tag LOCUS_24900 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GH6:glutamine--fructose-6-phosphate aminotransferase [isomerizing] 1168 2475 gene locus_tag LOCUS_24910 1168 2475 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_24910 2549 3520 gene locus_tag LOCUS_24920 2549 3520 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_24920 3556 4530 gene locus_tag LOCUS_24930 3556 4530 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901998.1 protein_id gnl|my_center|LOCUS_24930 >Feature sequence0442 529 74 gene locus_tag LOCUS_24940 529 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 1620 529 gene locus_tag LOCUS_24950 1620 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2470 1772 gene locus_tag LOCUS_24960 2470 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 3427 2576 gene locus_tag LOCUS_24970 3427 2576 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731540.1 protein_id gnl|my_center|LOCUS_24970 3573 3938 gene locus_tag LOCUS_24980 3573 3938 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122372.1 protein_id gnl|my_center|LOCUS_24980 4540 3935 gene locus_tag LOCUS_24990 4540 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence0443 3576 1318 gene locus_tag LOCUS_25000 3576 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 <4901 3576 gene locus_tag LOCUS_25010 <4901 3576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941555.1:serine protease >Feature sequence0444 <1 1348 gene locus_tag LOCUS_25020 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028580.1:acetyl/propionyl-CoA carboxylase subunit alpha 1352 1855 gene locus_tag LOCUS_25030 1352 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 3986 1896 gene locus_tag LOCUS_25040 3986 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence0445 2350 1160 gene locus_tag LOCUS_25050 gene bamB 2350 1160 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4P5 protein_id gnl|my_center|LOCUS_25050 3672 2350 gene locus_tag LOCUS_25060 3672 2350 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence0446 1896 610 gene locus_tag LOCUS_25070 1896 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 3341 1893 gene locus_tag LOCUS_25080 3341 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 3931 3338 gene locus_tag LOCUS_25090 gene hisB 3931 3338 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A1 protein_id gnl|my_center|LOCUS_25090 <4860 3931 gene locus_tag LOCUS_25100 <4860 3931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404962.1:haloacid dehalogenase >Feature sequence0447 516 2339 gene locus_tag LOCUS_25110 516 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence0448 864 2387 gene locus_tag LOCUS_25120 864 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 3192 2404 gene locus_tag LOCUS_25130 3192 2404 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707810.1 protein_id gnl|my_center|LOCUS_25130 3677 4198 gene locus_tag LOCUS_25140 3677 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence0449 1705 4596 gene locus_tag LOCUS_25150 1705 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 >Feature sequence0450 1578 610 gene locus_tag LOCUS_25160 1578 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2173 1571 gene locus_tag LOCUS_25170 2173 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883573.1 protein_id gnl|my_center|LOCUS_25170 2639 2208 gene locus_tag LOCUS_25180 2639 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2852 4705 gene locus_tag LOCUS_25190 2852 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 >Feature sequence0451 2990 774 gene locus_tag LOCUS_25200 2990 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 3824 2994 gene locus_tag LOCUS_25210 3824 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 <4826 4007 gene locus_tag LOCUS_25220 <4826 4007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001079544.1:cytochrome-c peroxidase >Feature sequence0452 2002 1256 gene locus_tag LOCUS_25230 2002 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 2878 2120 gene locus_tag LOCUS_25240 2878 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 3769 2960 gene locus_tag LOCUS_25250 3769 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 4413 3940 gene locus_tag LOCUS_25260 4413 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 >Feature sequence0453 212 1357 gene locus_tag LOCUS_25270 212 1357 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119834.1 protein_id gnl|my_center|LOCUS_25270 1354 2547 gene locus_tag LOCUS_25280 1354 2547 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119840.1 protein_id gnl|my_center|LOCUS_25280 2586 3140 gene locus_tag LOCUS_25290 2586 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119839.1 protein_id gnl|my_center|LOCUS_25290 3235 4173 gene locus_tag LOCUS_25300 3235 4173 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338430.1 protein_id gnl|my_center|LOCUS_25300 <4820 4187 gene locus_tag LOCUS_25310 <4820 4187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038655.1:oxidoreductase >Feature sequence0454 1526 444 gene locus_tag LOCUS_25320 1526 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 4273 1523 gene locus_tag LOCUS_25330 4273 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence0455 824 915 gene locus_tag LOCUS_t00280 824 915 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1581 1075 gene locus_tag LOCUS_25340 1581 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2537 1578 gene locus_tag LOCUS_25350 2537 1578 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403827.1 protein_id gnl|my_center|LOCUS_25350 4223 2922 gene locus_tag LOCUS_25360 4223 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 >Feature sequence0456 <1 510 gene locus_tag LOCUS_25370 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EJ66:protein HflC 3616 512 gene locus_tag LOCUS_25380 3616 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence0457 >Feature sequence0458 <1 1862 gene locus_tag LOCUS_25390 <1 1862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070533.1:metal transporter 1005 1081 gene locus_tag LOCUS_t00290 1005 1081 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0459 295 3801 gene locus_tag LOCUS_25400 gene metH 295 3801 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUW9 protein_id gnl|my_center|LOCUS_25400 4071 3907 gene locus_tag LOCUS_25410 4071 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence0460 1863 829 gene locus_tag LOCUS_25420 1863 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2420 3121 gene locus_tag LOCUS_25430 2420 3121 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_25430 4789 3143 gene locus_tag LOCUS_25440 4789 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence0461 781 1212 gene locus_tag LOCUS_25450 781 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1961 1206 gene locus_tag LOCUS_25460 1961 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2895 1975 gene locus_tag LOCUS_25470 2895 1975 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_25470 4703 2973 gene locus_tag LOCUS_25480 4703 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence0462 1261 2220 gene locus_tag LOCUS_25490 1261 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 2207 3430 gene locus_tag LOCUS_25500 2207 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 4635 3475 gene locus_tag LOCUS_25510 gene galK 4635 3475 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLP4 protein_id gnl|my_center|LOCUS_25510 >Feature sequence0463 <1 1238 gene locus_tag LOCUS_25520 <1 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223609.1:ATPase 1257 2453 gene locus_tag LOCUS_25530 gene sbcD 1257 2453 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT45 protein_id gnl|my_center|LOCUS_25530 >Feature sequence0464 <1 596 gene locus_tag LOCUS_25540 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123902.1:type IV fimbrial assembly protein PilB 633 1778 gene locus_tag LOCUS_25550 gene pilC 633 1778 CDS product pilus biosynthesis protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_25550 1821 3386 gene locus_tag LOCUS_25560 1821 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 3537 4103 gene locus_tag LOCUS_25570 3537 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 >Feature sequence0465 1856 714 gene locus_tag LOCUS_25580 1856 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 2194 3294 gene locus_tag LOCUS_25590 2194 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence0466 317 778 gene locus_tag LOCUS_25600 317 778 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895547.1 protein_id gnl|my_center|LOCUS_25600 822 2018 gene locus_tag LOCUS_25610 822 2018 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974634.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence0467 1014 334 gene locus_tag LOCUS_25620 1014 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 1347 1928 gene locus_tag LOCUS_25630 1347 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 1943 2368 gene locus_tag LOCUS_25640 1943 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 2561 2797 gene locus_tag LOCUS_25650 2561 2797 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887863.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence0468 1444 1025 gene locus_tag LOCUS_25660 1444 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 1559 3652 gene locus_tag LOCUS_25670 1559 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 3764 4372 gene locus_tag LOCUS_25680 gene drga 3764 4372 CDS product reductase DrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence0469 4166 2808 gene locus_tag LOCUS_25690 4166 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence0470 1771 491 gene locus_tag LOCUS_25700 1771 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2293 2670 gene locus_tag LOCUS_25710 2293 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 3090 4076 gene locus_tag LOCUS_25720 3090 4076 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence0471 1673 159 gene locus_tag LOCUS_25730 gene proS 1673 159 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ7 protein_id gnl|my_center|LOCUS_25730 2690 1974 gene locus_tag LOCUS_25740 2690 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2946 4187 gene locus_tag LOCUS_25750 2946 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25750 >Feature sequence0472 1268 2461 gene locus_tag LOCUS_25760 1268 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 3824 2547 gene locus_tag LOCUS_25770 3824 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence0473 855 3137 gene locus_tag LOCUS_25780 855 3137 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_25780 4298 3408 gene locus_tag LOCUS_25790 4298 3408 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933862.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence0474 205 789 gene locus_tag LOCUS_25800 205 789 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_25800 2726 864 gene locus_tag LOCUS_25810 2726 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 4695 3073 gene locus_tag LOCUS_25820 4695 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence0475 <1 792 gene locus_tag LOCUS_25830 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P71051:putative tyrosine-protein kinase YveL 1917 1183 gene locus_tag LOCUS_25840 1917 1183 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249636.1 protein_id gnl|my_center|LOCUS_25840 2633 1914 gene locus_tag LOCUS_25850 2633 1914 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_25850 3376 2753 gene locus_tag LOCUS_25860 gene pdxH 3376 2753 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S544 protein_id gnl|my_center|LOCUS_25860 3460 4443 gene locus_tag LOCUS_25870 3460 4443 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972130.1 protein_id gnl|my_center|LOCUS_25870 >Feature sequence0476 <1 843 gene locus_tag LOCUS_25880 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258470.1:stage II sporulation protein E 849 1196 gene locus_tag LOCUS_25890 849 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 1359 2615 gene locus_tag LOCUS_25900 1359 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 2612 3838 gene locus_tag LOCUS_25910 2612 3838 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027473.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence0477 <1 977 gene locus_tag LOCUS_25920 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937687.1:sulfatase 974 2137 gene locus_tag LOCUS_25930 974 2137 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_25930 3050 2166 gene locus_tag LOCUS_25940 3050 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25940 >Feature sequence0478 1068 493 gene locus_tag LOCUS_25950 1068 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 2302 1115 gene locus_tag LOCUS_25960 gene thrC 2302 1115 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 protein_id gnl|my_center|LOCUS_25960 2415 3128 gene locus_tag LOCUS_25970 2415 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 <4719 3220 gene locus_tag LOCUS_25980 <4719 3220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZ66:adenine deaminase >Feature sequence0479 <1 1000 gene locus_tag LOCUS_25990 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404944.1:acetylornithine carbamoyltransferase 991 1944 gene locus_tag LOCUS_26000 991 1944 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878775.1 protein_id gnl|my_center|LOCUS_26000 1970 3085 gene locus_tag LOCUS_26010 1970 3085 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404946.1 protein_id gnl|my_center|LOCUS_26010 3082 4263 gene locus_tag LOCUS_26020 gene argH 3082 4263 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404947.1 protein_id gnl|my_center|LOCUS_26020 >Feature sequence0480 3676 3751 gene locus_tag LOCUS_t00300 3676 3751 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0481 949 341 gene locus_tag LOCUS_26030 949 341 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085798.1 protein_id gnl|my_center|LOCUS_26030 3781 1313 gene locus_tag LOCUS_26040 gene tex 3781 1313 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence0482 2814 685 gene locus_tag LOCUS_26050 2814 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 3608 3009 gene locus_tag LOCUS_26060 3608 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 3821 3648 gene locus_tag LOCUS_26070 3821 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 <4683 4084 gene locus_tag LOCUS_26080 <4683 4084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P336:phosphoenolpyruvate carboxylase >Feature sequence0483 412 122 gene locus_tag LOCUS_26090 412 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 1545 409 gene locus_tag LOCUS_26100 1545 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1864 1586 gene locus_tag LOCUS_26110 1864 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 2029 3339 gene locus_tag LOCUS_26120 gene hisD 2029 3339 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGV8 protein_id gnl|my_center|LOCUS_26120 >Feature sequence0484 373 1209 gene locus_tag LOCUS_26130 373 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 1243 1578 gene locus_tag LOCUS_26140 1243 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 1575 2129 gene locus_tag LOCUS_26150 1575 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2126 2350 gene locus_tag LOCUS_26160 2126 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 2347 2586 gene locus_tag LOCUS_26170 2347 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 2583 2969 gene locus_tag LOCUS_26180 2583 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 >Feature sequence0485 801 199 gene locus_tag LOCUS_26190 801 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 1220 1474 gene locus_tag LOCUS_26200 1220 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 1623 1967 gene locus_tag LOCUS_26210 gene arsR 1623 1967 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915472.1 protein_id gnl|my_center|LOCUS_26210 2018 2470 gene locus_tag LOCUS_26220 2018 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 3296 2478 gene locus_tag LOCUS_26230 3296 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 3808 3314 gene locus_tag LOCUS_26240 3808 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence0486 2087 435 gene locus_tag LOCUS_26250 2087 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence0487 <1 1587 gene locus_tag LOCUS_26260 <1 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918093.1:potassium transporter 1628 3343 gene locus_tag LOCUS_26270 gene trxB 1628 3343 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118394.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence0488 1084 848 gene locus_tag LOCUS_26280 1084 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 2746 1391 gene locus_tag LOCUS_26290 2746 1391 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339253.1 protein_id gnl|my_center|LOCUS_26290 3456 2743 gene locus_tag LOCUS_26300 3456 2743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974037.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence0489 913 446 gene locus_tag LOCUS_26310 gene argR 913 446 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI21 protein_id gnl|my_center|LOCUS_26310 1627 1079 gene locus_tag LOCUS_26320 1627 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 1817 2656 gene locus_tag LOCUS_26330 1817 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 2664 3518 gene locus_tag LOCUS_26340 2664 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence0490 287 598 gene locus_tag LOCUS_26350 287 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 3351 550 gene locus_tag LOCUS_26360 3351 550 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_26360 4238 3351 gene locus_tag LOCUS_26370 4238 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence0491 2096 1383 gene locus_tag LOCUS_26380 2096 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 3748 2093 gene locus_tag LOCUS_26390 gene pgm 3748 2093 CDS product phosphoglucomutase, alpha-D-glucose phosphate-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_26390 >Feature sequence0492 339 175 gene locus_tag LOCUS_26400 339 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 735 490 gene locus_tag LOCUS_26410 735 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 952 2262 gene locus_tag LOCUS_26420 952 2262 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 protein_id gnl|my_center|LOCUS_26420 4027 2303 gene locus_tag LOCUS_26430 4027 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 4269 4193 gene locus_tag LOCUS_t00310 4269 4193 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0493 1469 3592 gene locus_tag LOCUS_26440 1469 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 3688 4014 gene locus_tag LOCUS_26450 3688 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 4047 4595 gene locus_tag LOCUS_26460 gene rmlC 4047 4595 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU21 protein_id gnl|my_center|LOCUS_26460 >Feature sequence0494 1477 515 gene locus_tag LOCUS_26470 1477 515 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_26470 1720 2925 gene locus_tag LOCUS_26480 1720 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 2987 3448 gene locus_tag LOCUS_26490 2987 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 3655 4320 gene locus_tag LOCUS_26500 gene rplC 3655 4320 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG47 protein_id gnl|my_center|LOCUS_26500 >Feature sequence0495 40 894 gene locus_tag LOCUS_26510 40 894 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_26510 939 1952 gene locus_tag LOCUS_26520 939 1952 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_26520 1992 2687 gene locus_tag LOCUS_26530 1992 2687 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence0496 1555 809 gene locus_tag LOCUS_26540 1555 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 2994 1567 gene locus_tag LOCUS_26550 2994 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_26550 <4597 2991 gene locus_tag LOCUS_26560 <4597 2991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021196.1:oligosaccharyl transferase, archaeosortase A system-associated >Feature sequence0497 1814 2335 gene locus_tag LOCUS_26570 1814 2335 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E2 protein_id gnl|my_center|LOCUS_26570 2599 2680 gene locus_tag LOCUS_t00320 2599 2680 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3188 3982 gene locus_tag LOCUS_26580 3188 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence0498 1798 758 gene locus_tag LOCUS_26590 1798 758 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_26590 2637 1795 gene locus_tag LOCUS_26600 gene sgaU 2637 1795 CDS product hexulose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_26600 2883 4259 gene locus_tag LOCUS_26610 2883 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence0499 1984 704 gene locus_tag LOCUS_26620 1984 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 3900 2026 gene locus_tag LOCUS_26630 3900 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 <4590 3992 gene locus_tag LOCUS_26640 <4590 3992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RK16:putative dual-specificity RNA methyltransferase RlmN >Feature sequence0500 2601 1372 gene locus_tag LOCUS_26650 2601 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393752.1 protein_id gnl|my_center|LOCUS_26650 3483 2623 gene locus_tag LOCUS_26660 3483 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002348716.1 protein_id gnl|my_center|LOCUS_26660 4494 3568 gene locus_tag LOCUS_26670 4494 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence0501 1052 513 gene locus_tag LOCUS_26680 1052 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 2098 1088 gene locus_tag LOCUS_26690 gene moaA 2098 1088 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39757 protein_id gnl|my_center|LOCUS_26690 2248 2844 gene locus_tag LOCUS_26700 2248 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 3569 2841 gene locus_tag LOCUS_26710 3569 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 4060 3584 gene locus_tag LOCUS_26720 4060 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 >Feature sequence0502 1659 508 gene locus_tag LOCUS_26730 1659 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 3116 2001 gene locus_tag LOCUS_26740 3116 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 3730 3122 gene locus_tag LOCUS_26750 3730 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 3898 3731 gene locus_tag LOCUS_26760 3898 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 4252 3908 gene locus_tag LOCUS_26770 4252 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 >Feature sequence0503 1136 2056 gene locus_tag LOCUS_26780 1136 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 3523 2087 gene locus_tag LOCUS_26790 gene nrfA 3523 2087 CDS product cytochrome c-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJN5 protein_id gnl|my_center|LOCUS_26790 4023 3520 gene locus_tag LOCUS_26800 4023 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence0504 729 355 gene locus_tag LOCUS_26810 729 355 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404728.1 protein_id gnl|my_center|LOCUS_26810 815 2302 gene locus_tag LOCUS_26820 gene ids 815 2302 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123097.1 protein_id gnl|my_center|LOCUS_26820 2299 3624 gene locus_tag LOCUS_26830 2299 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence0505 793 2235 gene locus_tag LOCUS_26840 793 2235 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067535.1 protein_id gnl|my_center|LOCUS_26840 2232 3710 gene locus_tag LOCUS_26850 2232 3710 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_26850 3697 4515 gene locus_tag LOCUS_26860 3697 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence0506 <1 743 gene locus_tag LOCUS_26870 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123616.1:integrase 776 692 gene locus_tag LOCUS_t00330 776 692 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 996 921 gene locus_tag LOCUS_t00340 996 921 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1210 1134 gene locus_tag LOCUS_t00350 1210 1134 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1432 2841 gene locus_tag LOCUS_26880 1432 2841 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403878.1 protein_id gnl|my_center|LOCUS_26880 2926 4122 gene locus_tag LOCUS_26890 gene metB 2926 4122 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence0507 <1 3541 gene locus_tag LOCUS_26900 <1 3541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:cation transporter 3538 4458 gene locus_tag LOCUS_26910 3538 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 >Feature sequence0508 627 1826 gene locus_tag LOCUS_26920 627 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 3459 1936 gene locus_tag LOCUS_26930 3459 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 4333 3776 gene locus_tag LOCUS_26940 4333 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 >Feature sequence0509 410 2002 gene locus_tag LOCUS_26950 410 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 2191 4077 gene locus_tag LOCUS_26960 2191 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence0510 44 433 gene locus_tag LOCUS_26970 44 433 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_26970 1324 512 gene locus_tag LOCUS_26980 1324 512 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870955.1 protein_id gnl|my_center|LOCUS_26980 3891 1390 gene locus_tag LOCUS_26990 3891 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence0511 <1 2843 gene locus_tag LOCUS_27000 <1 2843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_313317.1:invasin 3901 2936 gene locus_tag LOCUS_27010 3901 2936 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528379.1 protein_id gnl|my_center|LOCUS_27010 <4513 3898 gene locus_tag LOCUS_27020 <4513 3898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RDI1:ribose import ATP-binding protein RbsA 2 >Feature sequence0512 <1 546 gene locus_tag LOCUS_27030 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P96716:tyrosine-protein kinase YwqD 1864 554 gene locus_tag LOCUS_27040 1864 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 2369 3166 gene locus_tag LOCUS_27050 2369 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence0513 1506 3068 gene locus_tag LOCUS_27060 1506 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 3584 4450 gene locus_tag LOCUS_27070 3584 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence0514 230 982 gene locus_tag LOCUS_27080 230 982 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387954.1 protein_id gnl|my_center|LOCUS_27080 4322 942 gene locus_tag LOCUS_27090 gene czcA 4322 942 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_27090 >Feature sequence0515 873 2414 gene locus_tag LOCUS_27100 873 2414 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_27100 2566 3195 gene locus_tag LOCUS_27110 2566 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 3204 4016 gene locus_tag LOCUS_27120 3204 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence0516 665 291 gene locus_tag LOCUS_27130 665 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 785 1594 gene locus_tag LOCUS_27140 785 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_27140 1714 3468 gene locus_tag LOCUS_27150 1714 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 <4477 3472 gene locus_tag LOCUS_27160 <4477 3472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894906.1:esterase >Feature sequence0517 1663 3309 gene locus_tag LOCUS_27170 1663 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 3388 3476 gene locus_tag LOCUS_t00360 3388 3476 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3524 4252 gene locus_tag LOCUS_27180 3524 4252 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987003.1 protein_id gnl|my_center|LOCUS_27180 >Feature sequence0518 1245 379 gene locus_tag LOCUS_27190 1245 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 1338 1709 gene locus_tag LOCUS_27200 1338 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 2301 1726 gene locus_tag LOCUS_27210 2301 1726 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_27210 3952 2315 gene locus_tag LOCUS_27220 gene pruA 3952 2315 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_27220 >Feature sequence0519 136 951 gene locus_tag LOCUS_27230 136 951 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706605.1 protein_id gnl|my_center|LOCUS_27230 1797 979 gene locus_tag LOCUS_27240 1797 979 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_27240 2474 1794 gene locus_tag LOCUS_27250 2474 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 3133 2471 gene locus_tag LOCUS_27260 3133 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 <4466 3191 gene locus_tag LOCUS_27270 <4466 3191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087545.1:threonine synthase >Feature sequence0520 402 1589 gene locus_tag LOCUS_27280 402 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 4107 1612 gene locus_tag LOCUS_27290 4107 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence0521 226 1038 gene locus_tag LOCUS_27300 226 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 1057 1911 gene locus_tag LOCUS_27310 1057 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 2584 1922 gene locus_tag LOCUS_27320 2584 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 3234 2581 gene locus_tag LOCUS_27330 gene tupB 3234 2581 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943339.1 protein_id gnl|my_center|LOCUS_27330 4073 3234 gene locus_tag LOCUS_27340 4073 3234 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence0522 866 1327 gene locus_tag LOCUS_27350 866 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 3973 1355 gene locus_tag LOCUS_27360 3973 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence0523 853 74 gene locus_tag LOCUS_27370 853 74 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390243.1 protein_id gnl|my_center|LOCUS_27370 966 1367 gene locus_tag LOCUS_27380 966 1367 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227906.1 protein_id gnl|my_center|LOCUS_27380 1423 2616 gene locus_tag LOCUS_27390 1423 2616 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968121.1 protein_id gnl|my_center|LOCUS_27390 2616 4202 gene locus_tag LOCUS_27400 2616 4202 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence0524 2807 1800 gene locus_tag LOCUS_27410 2807 1800 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944069.1 protein_id gnl|my_center|LOCUS_27410 3289 2804 gene locus_tag LOCUS_27420 3289 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 3799 3293 gene locus_tag LOCUS_27430 3799 3293 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989435.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence0525 891 1499 gene locus_tag LOCUS_27440 891 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2578 1496 gene locus_tag LOCUS_27450 gene moxR 2578 1496 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_27450 3842 2781 gene locus_tag LOCUS_27460 3842 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 4388 3972 gene locus_tag LOCUS_27470 4388 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence0526 282 3284 gene locus_tag LOCUS_27480 282 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 3378 3965 gene locus_tag LOCUS_27490 3378 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence0527 406 1467 gene locus_tag LOCUS_27500 406 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_27500 2672 1491 gene locus_tag LOCUS_27510 2672 1491 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_27510 3358 2771 gene locus_tag LOCUS_27520 3358 2771 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 protein_id gnl|my_center|LOCUS_27520 >Feature sequence0528 1258 419 gene locus_tag LOCUS_27530 1258 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 1848 1396 gene locus_tag LOCUS_27540 1848 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 2507 1848 gene locus_tag LOCUS_27550 2507 1848 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119950.1 protein_id gnl|my_center|LOCUS_27550 3939 2551 gene locus_tag LOCUS_27560 3939 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence0529 <1 1565 gene locus_tag LOCUS_27570 <1 1565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109891.1:methicillin resistance mecR1 protein 1696 2094 gene locus_tag LOCUS_27580 1696 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 2842 2108 gene locus_tag LOCUS_27590 2842 2108 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269401.1 protein_id gnl|my_center|LOCUS_27590 2875 3708 gene locus_tag LOCUS_27600 2875 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 <4417 3718 gene locus_tag LOCUS_27610 <4417 3718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003414506.1:DNA-damage-inducible protein DinF >Feature sequence0530 1585 29 gene locus_tag LOCUS_27620 1585 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 2655 1738 gene locus_tag LOCUS_27630 2655 1738 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920800.1 protein_id gnl|my_center|LOCUS_27630 3475 2675 gene locus_tag LOCUS_27640 gene yibA 3475 2675 CDS product protein YibA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ADK6 protein_id gnl|my_center|LOCUS_27640 3905 3501 gene locus_tag LOCUS_27650 3905 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence0531 1280 288 gene locus_tag LOCUS_27660 1280 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 2345 1515 gene locus_tag LOCUS_27670 2345 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 3924 2455 gene locus_tag LOCUS_27680 3924 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence0532 1544 891 gene locus_tag LOCUS_27690 gene gph-2 1544 891 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN24 protein_id gnl|my_center|LOCUS_27690 1968 1597 gene locus_tag LOCUS_27700 1968 1597 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390954.1 protein_id gnl|my_center|LOCUS_27700 4256 1977 gene locus_tag LOCUS_27710 4256 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27710 >Feature sequence0533 <1 1560 gene locus_tag LOCUS_27720 <1 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1VE87:selenide, water dikinase 2281 1520 gene locus_tag LOCUS_27730 2281 1520 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143646.1 protein_id gnl|my_center|LOCUS_27730 2426 3664 gene locus_tag LOCUS_27740 2426 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_27740 <4403 3675 gene locus_tag LOCUS_27750 <4403 3675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121659.1:sulfatase >Feature sequence0534 1857 2336 gene locus_tag LOCUS_27760 1857 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2443 3495 gene locus_tag LOCUS_27770 2443 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 4226 3489 gene locus_tag LOCUS_27780 4226 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence0535 2160 805 gene locus_tag LOCUS_27790 2160 805 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_27790 2291 2896 gene locus_tag LOCUS_27800 gene gmhA 2291 2896 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR43 protein_id gnl|my_center|LOCUS_27800 3987 2974 gene locus_tag LOCUS_27810 3987 2974 CDS product peptidoglycan bridge formation protein FemAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_27810 4385 4050 gene locus_tag LOCUS_27820 4385 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence0536 3549 1396 gene locus_tag LOCUS_27830 gene fadJ 3549 1396 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MM3 protein_id gnl|my_center|LOCUS_27830 <4386 3546 gene locus_tag LOCUS_27840 <4386 3546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810114.1:acetyl-CoA acetyltransferase >Feature sequence0537 >Feature sequence0538 <1 768 gene locus_tag LOCUS_27850 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868883.1:dimethylargininase 1277 765 gene locus_tag LOCUS_27860 1277 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence0539 1791 22 gene locus_tag LOCUS_27870 1791 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2608 2012 gene locus_tag LOCUS_27880 2608 2012 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_27880 2741 3427 gene locus_tag LOCUS_27890 2741 3427 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974444.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence0540 1197 1640 gene locus_tag LOCUS_27900 1197 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 1630 2544 gene locus_tag LOCUS_27910 1630 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 2541 3932 gene locus_tag LOCUS_27920 2541 3932 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_27920 4275 3991 gene locus_tag LOCUS_27930 4275 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 >Feature sequence0541 100 3702 gene locus_tag LOCUS_27940 100 3702 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071882.1 protein_id gnl|my_center|LOCUS_27940 <4353 3730 gene locus_tag LOCUS_27950 <4353 3730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P62457:histidinol dehydrogenase >Feature sequence0542 659 2836 gene locus_tag LOCUS_27960 659 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 2847 3935 gene locus_tag LOCUS_27970 2847 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 >Feature sequence0543 624 3350 gene locus_tag LOCUS_27980 624 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 <4337 3372 gene locus_tag LOCUS_27990 <4337 3372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228470.1:ATP-dependent DNA helicase RecQ >Feature sequence0544 <1 708 gene locus_tag LOCUS_28000 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BE1:catalase-peroxidase 2113 818 gene locus_tag LOCUS_28010 2113 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 2643 2164 gene locus_tag LOCUS_28020 2643 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 3922 2687 gene locus_tag LOCUS_28030 3922 2687 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403884.1 protein_id gnl|my_center|LOCUS_28030 >Feature sequence0545 3 515 gene locus_tag LOCUS_28040 3 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 553 2121 gene locus_tag LOCUS_28050 gene glpA 553 2121 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_28050 2912 2109 gene locus_tag LOCUS_28060 2912 2109 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_28060 3945 2986 gene locus_tag LOCUS_28070 3945 2986 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_28070 >Feature sequence0546 94 651 gene locus_tag LOCUS_28080 94 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146506.1 protein_id gnl|my_center|LOCUS_28080 648 1823 gene locus_tag LOCUS_28090 648 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 1951 2853 gene locus_tag LOCUS_28100 1951 2853 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_28100 2902 3519 gene locus_tag LOCUS_28110 2902 3519 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJJ7 protein_id gnl|my_center|LOCUS_28110 >Feature sequence0547 48 1217 gene locus_tag LOCUS_28120 48 1217 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973447.1 protein_id gnl|my_center|LOCUS_28120 3684 1249 gene locus_tag LOCUS_28130 3684 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 4318 3920 gene locus_tag LOCUS_28140 4318 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 >Feature sequence0548 3144 811 gene locus_tag LOCUS_28150 3144 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 >Feature sequence0549 1471 347 gene locus_tag LOCUS_28160 1471 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121577.1 protein_id gnl|my_center|LOCUS_28160 1594 2277 gene locus_tag LOCUS_28170 1594 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894347.1 protein_id gnl|my_center|LOCUS_28170 2312 3331 gene locus_tag LOCUS_28180 2312 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence0550 306 64 gene locus_tag LOCUS_28190 306 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 659 441 gene locus_tag LOCUS_28200 659 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 1094 729 gene locus_tag LOCUS_28210 1094 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 1415 1110 gene locus_tag LOCUS_28220 1415 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 2619 1420 gene locus_tag LOCUS_28230 2619 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 4107 2734 gene locus_tag LOCUS_28240 4107 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence0551 1639 293 gene locus_tag LOCUS_28250 1639 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 1845 2819 gene locus_tag LOCUS_28260 1845 2819 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 protein_id gnl|my_center|LOCUS_28260 2816 3616 gene locus_tag LOCUS_28270 2816 3616 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122379.1 protein_id gnl|my_center|LOCUS_28270 >Feature sequence0552 <1 984 gene locus_tag LOCUS_28280 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I450:ribonuclease D >Feature sequence0553 2867 2709 gene locus_tag LOCUS_28290 2867 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 3372 2911 gene locus_tag LOCUS_28300 3372 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 3895 3410 gene locus_tag LOCUS_28310 3895 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 >Feature sequence0554 873 2429 gene locus_tag LOCUS_28320 873 2429 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_28320 2540 2992 gene locus_tag LOCUS_28330 gene moaC 2540 2992 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKA8 protein_id gnl|my_center|LOCUS_28330 3145 3621 gene locus_tag LOCUS_28340 3145 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 >Feature sequence0555 <1 1044 gene locus_tag LOCUS_28350 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931784.1:glycosyl hydrolase 1516 1022 gene locus_tag LOCUS_28360 1516 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 2013 1666 gene locus_tag LOCUS_28370 2013 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 2257 2826 gene locus_tag LOCUS_28380 2257 2826 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_28380 3008 2823 gene locus_tag LOCUS_28390 3008 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 3317 3036 gene locus_tag LOCUS_28400 3317 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 >Feature sequence0556 390 1991 gene locus_tag LOCUS_28410 390 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 <4253 2046 gene locus_tag LOCUS_28420 <4253 2046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943566.1:cytochrome c >Feature sequence0557 61 777 gene locus_tag LOCUS_28430 61 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 1827 805 gene locus_tag LOCUS_28440 1827 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 3616 1931 gene locus_tag LOCUS_28450 3616 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 >Feature sequence0558 2637 4043 gene locus_tag LOCUS_28460 2637 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence0559 1811 495 gene locus_tag LOCUS_28470 1811 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 2015 2335 gene locus_tag LOCUS_28480 2015 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 2467 2844 gene locus_tag LOCUS_28490 2467 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3427 2954 gene locus_tag LOCUS_28500 3427 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence0560 1628 465 gene locus_tag LOCUS_28510 1628 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 1712 2455 gene locus_tag LOCUS_28520 1712 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 3312 2491 gene locus_tag LOCUS_28530 3312 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3649 3434 gene locus_tag LOCUS_28540 3649 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 4049 3801 gene locus_tag LOCUS_28550 4049 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence0561 167 559 gene locus_tag LOCUS_28560 167 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 727 2397 gene locus_tag LOCUS_28570 727 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence0562 114 407 gene locus_tag LOCUS_28580 114 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 774 1076 gene locus_tag LOCUS_28590 774 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 1084 1575 gene locus_tag LOCUS_28600 1084 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 1581 3491 gene locus_tag LOCUS_28610 1581 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 3504 4121 gene locus_tag LOCUS_28620 3504 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 >Feature sequence0563 742 365 gene locus_tag LOCUS_28630 742 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 1923 847 gene locus_tag LOCUS_28640 1923 847 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_28640 2772 1936 gene locus_tag LOCUS_28650 2772 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 2962 4062 gene locus_tag LOCUS_28660 2962 4062 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121142.1 protein_id gnl|my_center|LOCUS_28660 >Feature sequence0564 >Feature sequence0565 1557 82 gene locus_tag LOCUS_28670 1557 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 3021 1735 gene locus_tag LOCUS_28680 3021 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 >Feature sequence0566 2199 502 gene locus_tag LOCUS_28690 2199 502 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_28690 <4225 2196 gene locus_tag LOCUS_28700 <4225 2196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E083:UvrABC system protein A >Feature sequence0567 >Feature sequence0568 1955 729 gene locus_tag LOCUS_28710 1955 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 2260 3561 gene locus_tag LOCUS_28720 2260 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 3942 3577 gene locus_tag LOCUS_28730 3942 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 >Feature sequence0569 1098 1832 gene locus_tag LOCUS_28740 1098 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 3096 1855 gene locus_tag LOCUS_28750 3096 1855 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142595.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence0570 >Feature sequence0571 <1 991 gene locus_tag LOCUS_28760 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405364.1:asparaginase 3430 1007 gene locus_tag LOCUS_28770 3430 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 <4187 3576 gene locus_tag LOCUS_28780 <4187 3576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940822.1:twitching motility protein PilT >Feature sequence0572 >Feature sequence0573 <1 1557 gene locus_tag LOCUS_28790 <1 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257612.1:glycosyl transferase 1629 2786 gene locus_tag LOCUS_28800 1629 2786 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_28800 >Feature sequence0574 3826 2177 gene locus_tag LOCUS_28810 3826 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence0575 <1 1070 gene locus_tag LOCUS_28820 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728359.1:MFS transporter 1103 1600 gene locus_tag LOCUS_28830 1103 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 1998 1627 gene locus_tag LOCUS_28840 1998 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 3438 2200 gene locus_tag LOCUS_28850 3438 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 >Feature sequence0576 2600 1896 gene locus_tag LOCUS_28860 2600 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 2837 4027 gene locus_tag LOCUS_28870 2837 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 >Feature sequence0577 688 131 gene locus_tag LOCUS_28880 gene orn 688 131 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS7 protein_id gnl|my_center|LOCUS_28880 1142 741 gene locus_tag LOCUS_28890 1142 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 2737 1205 gene locus_tag LOCUS_28900 2737 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28900 <4151 2734 gene locus_tag LOCUS_28910 <4151 2734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389628.1:PAS domain-containing sensor histidine kinase >Feature sequence0578 3302 2070 gene locus_tag LOCUS_28920 3302 2070 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871002.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence0579 541 1242 gene locus_tag LOCUS_28930 541 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 1358 1681 gene locus_tag LOCUS_28940 1358 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 3596 1695 gene locus_tag LOCUS_28950 3596 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence0580 3 836 gene locus_tag LOCUS_28960 3 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 2504 990 gene locus_tag LOCUS_28970 2504 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 2868 2566 gene locus_tag LOCUS_28980 2868 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 3770 2997 gene locus_tag LOCUS_28990 3770 2997 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256704.1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence0581 481 2127 gene locus_tag LOCUS_29000 481 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 <4124 2135 gene locus_tag LOCUS_29010 <4124 2135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084771.1:peptidase >Feature sequence0582 808 356 gene locus_tag LOCUS_29020 808 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 1181 2440 gene locus_tag LOCUS_29030 1181 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 2753 3073 gene locus_tag LOCUS_29040 2753 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 3270 3731 gene locus_tag LOCUS_29050 gene rpiB 3270 3731 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120716.1 protein_id gnl|my_center|LOCUS_29050 >Feature sequence0583 3895 1280 gene locus_tag LOCUS_29060 3895 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence0584 >Feature sequence0585 787 1791 gene locus_tag LOCUS_29070 787 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 2227 3807 gene locus_tag LOCUS_29080 2227 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 >Feature sequence0586 222 1262 gene locus_tag LOCUS_29090 222 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 1594 1268 gene locus_tag LOCUS_29100 1594 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 3727 1667 gene locus_tag LOCUS_29110 3727 1667 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence0587 >Feature sequence0588 634 1332 gene locus_tag LOCUS_29120 634 1332 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969324.1 protein_id gnl|my_center|LOCUS_29120 1936 1298 gene locus_tag LOCUS_29130 1936 1298 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941355.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence0589 514 1656 gene locus_tag LOCUS_29140 gene dinB 514 1656 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USY7 protein_id gnl|my_center|LOCUS_29140 1784 3007 gene locus_tag LOCUS_29150 1784 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence0590 2698 368 gene locus_tag LOCUS_29160 2698 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 >Feature sequence0591 975 1565 gene locus_tag LOCUS_29170 975 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence0592 2379 781 gene locus_tag LOCUS_29180 2379 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 3862 2606 gene locus_tag LOCUS_29190 3862 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence0593 2014 992 gene locus_tag LOCUS_29200 2014 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 2272 3414 gene locus_tag LOCUS_29210 2272 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence0594 1100 1654 gene locus_tag LOCUS_29220 1100 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 2065 1667 gene locus_tag LOCUS_29230 2065 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 3056 2154 gene locus_tag LOCUS_29240 3056 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016290.1 protein_id gnl|my_center|LOCUS_29240 3526 3056 gene locus_tag LOCUS_29250 3526 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 4079 3558 gene locus_tag LOCUS_29260 4079 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 >Feature sequence0595 635 2155 gene locus_tag LOCUS_29270 gene prfC 635 2155 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGL0 protein_id gnl|my_center|LOCUS_29270 2872 2201 gene locus_tag LOCUS_29280 2872 2201 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878130.1 protein_id gnl|my_center|LOCUS_29280 3570 2875 gene locus_tag LOCUS_29290 3570 2875 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_29290 >Feature sequence0596 602 2776 gene locus_tag LOCUS_29300 602 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 2895 3182 gene locus_tag LOCUS_29310 2895 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence0597 624 199 gene locus_tag LOCUS_29320 624 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 985 659 gene locus_tag LOCUS_29330 985 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 1550 3388 gene locus_tag LOCUS_29340 gene uup 1550 3388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120247.1 protein_id gnl|my_center|LOCUS_29340 <4049 3396 gene locus_tag LOCUS_29350 <4049 3396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039071.1:phosphonate ABC transporter, permease protein PhnE >Feature sequence0598 131 757 gene locus_tag LOCUS_29360 131 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 2711 777 gene locus_tag LOCUS_29370 gene speA 2711 777 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE10 protein_id gnl|my_center|LOCUS_29370 2989 3612 gene locus_tag LOCUS_29380 gene yceI 2989 3612 CDS product protein YceI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NAT2 protein_id gnl|my_center|LOCUS_29380 3609 4037 gene locus_tag LOCUS_29390 3609 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence0599 1802 2791 gene locus_tag LOCUS_29400 1802 2791 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_29400 2832 3749 gene locus_tag LOCUS_29410 2832 3749 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_29410 >Feature sequence0600 985 1058 gene locus_tag LOCUS_t00370 985 1058 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1127 2032 gene locus_tag LOCUS_29420 1127 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 2162 3112 gene locus_tag LOCUS_29430 2162 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324266.1 protein_id gnl|my_center|LOCUS_29430 >Feature sequence0601 2874 2365 gene locus_tag LOCUS_29440 2874 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 3843 3001 gene locus_tag LOCUS_29450 3843 3001 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798627.1 protein_id gnl|my_center|LOCUS_29450 >Feature sequence0602 <1 573 gene locus_tag LOCUS_29460 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797168.1:peptidase S41 579 2471 gene locus_tag LOCUS_29470 579 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 2523 3335 gene locus_tag LOCUS_29480 gene pcm 2523 3335 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0T1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence0603 2456 411 gene locus_tag LOCUS_29490 2456 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 2976 2524 gene locus_tag LOCUS_29500 2976 2524 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYA4 protein_id gnl|my_center|LOCUS_29500 >Feature sequence0604 1247 2698 gene locus_tag LOCUS_29510 1247 2698 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919394.1 protein_id gnl|my_center|LOCUS_29510 2716 3201 gene locus_tag LOCUS_29520 2716 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence0605 <1 953 gene locus_tag LOCUS_29530 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388623.1:peptidase C14 964 1866 gene locus_tag LOCUS_29540 964 1866 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006686.1 protein_id gnl|my_center|LOCUS_29540 1906 2955 gene locus_tag LOCUS_29550 1906 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_29550 >Feature sequence0606 458 2257 gene locus_tag LOCUS_29560 458 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence0607 3388 2759 gene locus_tag LOCUS_29570 gene sigG 3388 2759 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123035.1 protein_id gnl|my_center|LOCUS_29570 >Feature sequence0608 929 372 gene locus_tag LOCUS_29580 929 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 1529 966 gene locus_tag LOCUS_29590 gene gmk 1529 966 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G813 protein_id gnl|my_center|LOCUS_29590 2555 1560 gene locus_tag LOCUS_29600 2555 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416240.1 protein_id gnl|my_center|LOCUS_29600 2950 2552 gene locus_tag LOCUS_29610 2950 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 3785 3006 gene locus_tag LOCUS_29620 gene tpiA 3785 3006 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96744 protein_id gnl|my_center|LOCUS_29620 >Feature sequence0609 2356 1781 gene locus_tag LOCUS_29630 2356 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29630 >Feature sequence0610 1745 945 gene locus_tag LOCUS_29640 1745 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 3432 1747 gene locus_tag LOCUS_29650 3432 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence0611 <1 2266 gene locus_tag LOCUS_29660 <1 2266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000482297.1:bacillolysin 3935 2376 gene locus_tag LOCUS_29670 3935 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence0612 1079 282 gene locus_tag LOCUS_29680 1079 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 2044 1196 gene locus_tag LOCUS_29690 2044 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 3103 2090 gene locus_tag LOCUS_29700 3103 2090 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968518.1 protein_id gnl|my_center|LOCUS_29700 3389 3114 gene locus_tag LOCUS_29710 3389 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 >Feature sequence0613 1235 105 gene locus_tag LOCUS_29720 1235 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 >Feature sequence0614 >Feature sequence0615 327 1493 gene locus_tag LOCUS_29730 327 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 1478 3196 gene locus_tag LOCUS_29740 1478 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 >Feature sequence0616 498 145 gene locus_tag LOCUS_29750 498 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 1414 581 gene locus_tag LOCUS_29760 1414 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 2016 1411 gene locus_tag LOCUS_29770 2016 1411 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 protein_id gnl|my_center|LOCUS_29770 2258 3355 gene locus_tag LOCUS_29780 2258 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 >Feature sequence0617 >Feature sequence0618 38 1054 gene locus_tag LOCUS_29790 38 1054 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065100.1 protein_id gnl|my_center|LOCUS_29790 1867 1064 gene locus_tag LOCUS_29800 1867 1064 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_29800 2045 2299 gene locus_tag LOCUS_29810 2045 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326599.1 protein_id gnl|my_center|LOCUS_29810 2334 3143 gene locus_tag LOCUS_29820 2334 3143 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_29820 >Feature sequence0619 <1 990 gene locus_tag LOCUS_29830 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942461.1:UDP-glucose 6-dehydrogenase 1866 1054 gene locus_tag LOCUS_29840 1866 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 2468 1863 gene locus_tag LOCUS_29850 2468 1863 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_29850 3328 2699 gene locus_tag LOCUS_29860 3328 2699 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977603.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence0620 755 1450 gene locus_tag LOCUS_29870 755 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 2333 1464 gene locus_tag LOCUS_29880 2333 1464 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_29880 2572 3813 gene locus_tag LOCUS_29890 2572 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142896.1 protein_id gnl|my_center|LOCUS_29890 >Feature sequence0621 986 216 gene locus_tag LOCUS_29900 gene rgpCc 986 216 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A0G3 protein_id gnl|my_center|LOCUS_29900 2059 971 gene locus_tag LOCUS_29910 2059 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 2995 2063 gene locus_tag LOCUS_29920 2995 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 3910 3119 gene locus_tag LOCUS_29930 3910 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence0622 1513 245 gene locus_tag LOCUS_29940 1513 245 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228311.1 protein_id gnl|my_center|LOCUS_29940 1761 2174 gene locus_tag LOCUS_29950 1761 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 2171 2506 gene locus_tag LOCUS_29960 2171 2506 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384980.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence0623 883 3207 gene locus_tag LOCUS_29970 gene polB 883 3207 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2L1 protein_id gnl|my_center|LOCUS_29970 3906 3265 gene locus_tag LOCUS_29980 3906 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 >Feature sequence0624 <1 805 gene locus_tag LOCUS_29990 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117794.1:sugar phosphate isomerase 802 1653 gene locus_tag LOCUS_30000 802 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123438.1 protein_id gnl|my_center|LOCUS_30000 1660 3105 gene locus_tag LOCUS_30010 1660 3105 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_30010 <3892 3126 gene locus_tag LOCUS_30020 <3892 3126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O32188:putative siderophore transport system ATP-binding protein YusV >Feature sequence0625 866 3745 gene locus_tag LOCUS_30030 866 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 >Feature sequence0626 670 870 gene locus_tag LOCUS_30040 670 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 997 2739 gene locus_tag LOCUS_30050 997 2739 CDS product type I secretion outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958458.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence0627 1245 2696 gene locus_tag LOCUS_30060 1245 2696 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_30060 >Feature sequence0628 1453 2298 gene locus_tag LOCUS_30070 gene pyrK 1453 2298 CDS product dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB8 protein_id gnl|my_center|LOCUS_30070 2305 3276 gene locus_tag LOCUS_30080 gene yrbG 2305 3276 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence0629 <1 695 gene locus_tag LOCUS_30090 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869470.1:sodium:calcium symporter 840 1388 gene locus_tag LOCUS_30100 840 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1501 2817 gene locus_tag LOCUS_30110 gene asnS 1501 2817 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E184 protein_id gnl|my_center|LOCUS_30110 >Feature sequence0630 1399 581 gene locus_tag LOCUS_30120 1399 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 <3864 1542 gene locus_tag LOCUS_30130 <3864 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942027.1:serine hydrolase >Feature sequence0631 1669 2430 gene locus_tag LOCUS_30140 1669 2430 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416945.1 protein_id gnl|my_center|LOCUS_30140 3560 2478 gene locus_tag LOCUS_30150 3560 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 >Feature sequence0632 3731 2793 gene locus_tag LOCUS_30160 3731 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_30160 >Feature sequence0633 140 514 gene locus_tag LOCUS_30170 140 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 638 1918 gene locus_tag LOCUS_30180 638 1918 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_30180 1930 2700 gene locus_tag LOCUS_30190 gene recO 1930 2700 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EBQ6 protein_id gnl|my_center|LOCUS_30190 >Feature sequence0634 >Feature sequence0635 2040 2597 gene locus_tag LOCUS_30200 gene sigW 2040 2597 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_30200 2597 3190 gene locus_tag LOCUS_30210 2597 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 >Feature sequence0636 2003 84 gene locus_tag LOCUS_30220 2003 84 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_30220 3113 2043 gene locus_tag LOCUS_30230 3113 2043 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_30230 <3855 3171 gene locus_tag LOCUS_30240 <3855 3171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121265.1:glycosyl transferase family 1 >Feature sequence0637 479 892 gene locus_tag LOCUS_30250 479 892 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_30250 >Feature sequence0638 2251 1415 gene locus_tag LOCUS_30260 2251 1415 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_30260 >Feature sequence0639 2351 822 gene locus_tag LOCUS_30270 2351 822 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381397.1 protein_id gnl|my_center|LOCUS_30270 2743 2369 gene locus_tag LOCUS_30280 2743 2369 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_30280 3018 2740 gene locus_tag LOCUS_30290 3018 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 >Feature sequence0640 >Feature sequence0641 495 866 gene locus_tag LOCUS_30300 495 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 1462 881 gene locus_tag LOCUS_30310 1462 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 3134 1512 gene locus_tag LOCUS_30320 3134 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 >Feature sequence0642 496 888 gene locus_tag LOCUS_30330 496 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 1469 954 gene locus_tag LOCUS_30340 1469 954 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B710 protein_id gnl|my_center|LOCUS_30340 1715 3535 gene locus_tag LOCUS_30350 1715 3535 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_30350 >Feature sequence0643 <1 666 gene locus_tag LOCUS_30360 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227903.1:enoyl-CoA hydratase 2079 682 gene locus_tag LOCUS_30370 gene sthA 2079 682 CDS product putative soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66007 protein_id gnl|my_center|LOCUS_30370 2951 2109 gene locus_tag LOCUS_30380 2951 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 <3833 3093 gene locus_tag LOCUS_30390 <3833 3093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920502.1:glutaminyl-peptide cyclotransferase >Feature sequence0644 <1 1007 gene locus_tag LOCUS_30400 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5I4J3:translation initiation factor IF-2 1019 1510 gene locus_tag LOCUS_30410 1019 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 2981 1527 gene locus_tag LOCUS_30420 gene gltX 2981 1527 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPT0 protein_id gnl|my_center|LOCUS_30420 3771 3184 gene locus_tag LOCUS_30430 3771 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 >Feature sequence0645 1551 679 gene locus_tag LOCUS_30440 1551 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 1841 2506 gene locus_tag LOCUS_30450 1841 2506 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_30450 3716 2529 gene locus_tag LOCUS_30460 3716 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 >Feature sequence0646 >Feature sequence0647 235 1245 gene locus_tag LOCUS_30470 235 1245 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_30470 1242 2840 gene locus_tag LOCUS_30480 1242 2840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229128.1 protein_id gnl|my_center|LOCUS_30480 3778 2843 gene locus_tag LOCUS_30490 3778 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 >Feature sequence0648 690 2138 gene locus_tag LOCUS_30500 690 2138 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_30500 2675 2151 gene locus_tag LOCUS_30510 2675 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence0649 2866 1340 gene locus_tag LOCUS_30520 2866 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 >Feature sequence0650 1746 337 gene locus_tag LOCUS_30530 gene aspA 1746 337 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902984.1 protein_id gnl|my_center|LOCUS_30530 2528 1878 gene locus_tag LOCUS_30540 2528 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 2849 2616 gene locus_tag LOCUS_30550 2849 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 >Feature sequence0651 1416 784 gene locus_tag LOCUS_30560 1416 784 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259156.1 protein_id gnl|my_center|LOCUS_30560 2087 1413 gene locus_tag LOCUS_30570 2087 1413 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_30570 2515 2099 gene locus_tag LOCUS_30580 2515 2099 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771057.1 protein_id gnl|my_center|LOCUS_30580 3065 2526 gene locus_tag LOCUS_30590 3065 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 <3810 3176 gene locus_tag LOCUS_30600 <3810 3176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87UX8:proline iminopeptidase >Feature sequence0652 <1 717 gene locus_tag LOCUS_30610 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326746.1:serine/threonine protein kinase 818 2506 gene locus_tag LOCUS_30620 gene glnS 818 2506 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX42 protein_id gnl|my_center|LOCUS_30620 >Feature sequence0653 1939 1178 gene locus_tag LOCUS_30630 1939 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 2083 3462 gene locus_tag LOCUS_30640 2083 3462 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727955.1 protein_id gnl|my_center|LOCUS_30640 >Feature sequence0654 226 570 gene locus_tag LOCUS_30650 226 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 554 925 gene locus_tag LOCUS_30660 554 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 1394 927 gene locus_tag LOCUS_30670 1394 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 1887 1399 gene locus_tag LOCUS_30680 1887 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence0655 1610 1206 gene locus_tag LOCUS_30690 1610 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 1802 3376 gene locus_tag LOCUS_30700 1802 3376 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943658.1 protein_id gnl|my_center|LOCUS_30700 >Feature sequence0656 922 2511 gene locus_tag LOCUS_30710 gene rpdD 922 2511 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF51 protein_id gnl|my_center|LOCUS_30710 2768 3604 gene locus_tag LOCUS_30720 2768 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 >Feature sequence0657 552 2318 gene locus_tag LOCUS_30730 552 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 2333 2986 gene locus_tag LOCUS_30740 2333 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 >Feature sequence0658 2351 978 gene locus_tag LOCUS_30750 2351 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 2508 3458 gene locus_tag LOCUS_30760 2508 3458 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947351.1 protein_id gnl|my_center|LOCUS_30760 >Feature sequence0659 335 1429 gene locus_tag LOCUS_30770 335 1429 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462714.1 protein_id gnl|my_center|LOCUS_30770 1688 2674 gene locus_tag LOCUS_30780 1688 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 2689 3483 gene locus_tag LOCUS_30790 2689 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 >Feature sequence0660 1030 1209 gene locus_tag LOCUS_30800 1030 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 1439 2383 gene locus_tag LOCUS_30810 1439 2383 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940332.1 protein_id gnl|my_center|LOCUS_30810 2984 2373 gene locus_tag LOCUS_30820 2984 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 >Feature sequence0661 2007 94 gene locus_tag LOCUS_30830 2007 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 2770 2012 gene locus_tag LOCUS_30840 2770 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 >Feature sequence0662 1448 879 gene locus_tag LOCUS_30850 1448 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 1615 2604 gene locus_tag LOCUS_30860 1615 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 3320 2658 gene locus_tag LOCUS_30870 3320 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 >Feature sequence0663 676 1263 gene locus_tag LOCUS_30880 676 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 1260 2855 gene locus_tag LOCUS_30890 1260 2855 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785070.1 protein_id gnl|my_center|LOCUS_30890 >Feature sequence0664 277 987 gene locus_tag LOCUS_30900 277 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 1394 1029 gene locus_tag LOCUS_30910 1394 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 protein_id gnl|my_center|LOCUS_30910 2418 1501 gene locus_tag LOCUS_30920 2418 1501 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708509.1 protein_id gnl|my_center|LOCUS_30920 3149 2415 gene locus_tag LOCUS_30930 3149 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 >Feature sequence0665 723 1469 gene locus_tag LOCUS_30940 723 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 1516 3069 gene locus_tag LOCUS_30950 1516 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence0666 2 394 gene locus_tag LOCUS_30960 2 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 378 1370 gene locus_tag LOCUS_30970 gene murB 378 1370 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK77 protein_id gnl|my_center|LOCUS_30970 1769 2032 gene locus_tag LOCUS_30980 1769 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 2169 3218 gene locus_tag LOCUS_30990 2169 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 >Feature sequence0667 1775 1005 gene locus_tag LOCUS_31000 1775 1005 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119404.1 protein_id gnl|my_center|LOCUS_31000 1880 3385 gene locus_tag LOCUS_31010 1880 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 >Feature sequence0668 2837 1248 gene locus_tag LOCUS_31020 2837 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 <3727 2920 gene locus_tag LOCUS_31030 <3727 2920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390231.1:ATPase/protein kinase >Feature sequence0669 <1 532 gene locus_tag LOCUS_31040 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064421.1:nitrilase 2509 596 gene locus_tag LOCUS_31050 2509 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 >Feature sequence0670 1580 162 gene locus_tag LOCUS_31060 1580 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 3352 1589 gene locus_tag LOCUS_31070 3352 1589 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785160.1 protein_id gnl|my_center|LOCUS_31070 >Feature sequence0671 445 2229 gene locus_tag LOCUS_31080 gene phoR 445 2229 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_31080 2388 3362 gene locus_tag LOCUS_31090 2388 3362 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269390.1 protein_id gnl|my_center|LOCUS_31090 >Feature sequence0672 <1 1140 gene locus_tag LOCUS_31100 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74D56:aspartate--tRNA(Asp/Asn) ligase 1301 1501 gene locus_tag LOCUS_31110 gene rpmI 1301 1501 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6L6 protein_id gnl|my_center|LOCUS_31110 1613 1969 gene locus_tag LOCUS_31120 gene rplT 1613 1969 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728R8 protein_id gnl|my_center|LOCUS_31120 2092 3114 gene locus_tag LOCUS_31130 gene pheS 2092 3114 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYR3 protein_id gnl|my_center|LOCUS_31130 >Feature sequence0673 2501 2743 gene locus_tag LOCUS_31140 2501 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 >Feature sequence0674 <1 817 gene locus_tag LOCUS_31150 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544969.1:phosphomannomutase 886 1524 gene locus_tag LOCUS_31160 886 1524 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704586.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence0675 279 851 gene locus_tag LOCUS_31170 279 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 1280 864 gene locus_tag LOCUS_31180 1280 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 1603 2763 gene locus_tag LOCUS_31190 gene sucC 1603 2763 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPH5 protein_id gnl|my_center|LOCUS_31190 2789 3661 gene locus_tag LOCUS_31200 gene sucD 2789 3661 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80865 protein_id gnl|my_center|LOCUS_31200 >Feature sequence0676 2002 2826 gene locus_tag LOCUS_31210 2002 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 >Feature sequence0677 <1 526 gene locus_tag LOCUS_31220 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UQV4:chromosome partition protein Smc 2068 593 gene locus_tag LOCUS_31230 2068 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 2601 2068 gene locus_tag LOCUS_31240 2601 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 3234 2644 gene locus_tag LOCUS_31250 3234 2644 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_31250 >Feature sequence0678 <1 1049 gene locus_tag LOCUS_31260 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963739.1:thiol:disulfide interchange protein DsbD 1496 1092 gene locus_tag LOCUS_31270 1496 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 2542 1724 gene locus_tag LOCUS_31280 gene ybxI 2542 1724 CDS product putative beta-lactamase YbxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54427 protein_id gnl|my_center|LOCUS_31280 >Feature sequence0679 250 11 gene locus_tag LOCUS_31290 250 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 1912 410 gene locus_tag LOCUS_31300 1912 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 2390 1983 gene locus_tag LOCUS_31310 2390 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 2526 3140 gene locus_tag LOCUS_31320 2526 3140 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_31320 3157 3657 gene locus_tag LOCUS_31330 3157 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence0680 641 1105 gene locus_tag LOCUS_31340 641 1105 CDS product DUF1579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230343.1 protein_id gnl|my_center|LOCUS_31340 1135 2193 gene locus_tag LOCUS_31350 1135 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 2174 2605 gene locus_tag LOCUS_31360 2174 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 3107 2622 gene locus_tag LOCUS_31370 3107 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 <3685 3104 gene locus_tag LOCUS_31380 <3685 3104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000937111.1:carbon starvation protein A >Feature sequence0681 2415 847 gene locus_tag LOCUS_31390 2415 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 >Feature sequence0682 2295 487 gene locus_tag LOCUS_31400 2295 487 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119431.1 protein_id gnl|my_center|LOCUS_31400 2814 2353 gene locus_tag LOCUS_31410 2814 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 <3664 2811 gene locus_tag LOCUS_31420 <3664 2811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:oxidoreductase >Feature sequence0683 1476 742 gene locus_tag LOCUS_31430 1476 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 2252 1473 gene locus_tag LOCUS_31440 2252 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 3663 2434 gene locus_tag LOCUS_31450 3663 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 >Feature sequence0684 >Feature sequence0685 >Feature sequence0686 >Feature sequence0687 2162 657 gene locus_tag LOCUS_31460 2162 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 >Feature sequence0688 1232 438 gene locus_tag LOCUS_31470 1232 438 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_31470 2135 1383 gene locus_tag LOCUS_31480 2135 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 3080 2355 gene locus_tag LOCUS_31490 3080 2355 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122745.1 protein_id gnl|my_center|LOCUS_31490 >Feature sequence0689 428 1099 gene locus_tag LOCUS_31500 428 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 2272 1124 gene locus_tag LOCUS_31510 2272 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123327.1 protein_id gnl|my_center|LOCUS_31510 3017 2277 gene locus_tag LOCUS_31520 3017 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence0690 <1 654 gene locus_tag LOCUS_31530 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142010.1:acetyl-CoA carboxylase biotin carboxylase subunit 722 1648 gene locus_tag LOCUS_31540 722 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 1933 2886 gene locus_tag LOCUS_31550 1933 2886 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405412.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence0691 447 1073 gene locus_tag LOCUS_31560 447 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 2788 1100 gene locus_tag LOCUS_31570 2788 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 >Feature sequence0692 >Feature sequence0693 1060 2694 gene locus_tag LOCUS_31580 1060 2694 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_31580 >Feature sequence0694 1002 82 gene locus_tag LOCUS_31590 1002 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 1427 2572 gene locus_tag LOCUS_31600 1427 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 >Feature sequence0695 822 2102 gene locus_tag LOCUS_31610 822 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 2216 2824 gene locus_tag LOCUS_31620 2216 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 >Feature sequence0696 >Feature sequence0697 <1 1130 gene locus_tag LOCUS_31630 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920957.1:FAD-dependent oxidoreductase 1165 1362 gene locus_tag LOCUS_31640 1165 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 1402 1761 gene locus_tag LOCUS_31650 1402 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 2150 1773 gene locus_tag LOCUS_31660 2150 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence0698 1687 1310 gene locus_tag LOCUS_31670 1687 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 2295 1894 gene locus_tag LOCUS_31680 2295 1894 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_31680 2540 2917 gene locus_tag LOCUS_31690 2540 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 2914 3105 gene locus_tag LOCUS_31700 2914 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 >Feature sequence0699 7 1317 gene locus_tag LOCUS_31710 7 1317 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_31710 1314 2675 gene locus_tag LOCUS_31720 1314 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 >Feature sequence0700 57 1541 gene locus_tag LOCUS_31730 57 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 1825 1628 gene locus_tag LOCUS_31740 1825 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 2924 2001 gene locus_tag LOCUS_31750 2924 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 >Feature sequence0701 1973 462 gene locus_tag LOCUS_31760 gene paaK 1973 462 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVI7 protein_id gnl|my_center|LOCUS_31760 2126 2036 gene locus_tag LOCUS_t00380 2126 2036 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0702 >Feature sequence0703 1974 1015 gene locus_tag LOCUS_31770 gene accA 1974 1015 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTY7 protein_id gnl|my_center|LOCUS_31770 >Feature sequence0704 1084 1656 gene locus_tag LOCUS_31780 1084 1656 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_31780 1653 2507 gene locus_tag LOCUS_31790 1653 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31790 >Feature sequence0705 >Feature sequence0706 <1 1201 gene locus_tag LOCUS_31800 <1 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89C25:UPF0313 protein 1239 3092 gene locus_tag LOCUS_31810 1239 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 >Feature sequence0707 1802 270 gene locus_tag LOCUS_31820 gene merA 1802 270 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_31820 2572 1799 gene locus_tag LOCUS_31830 2572 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 <3545 2706 gene locus_tag LOCUS_31840 <3545 2706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIE0:aminotransferase >Feature sequence0708 629 42 gene locus_tag LOCUS_31850 629 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 >Feature sequence0709 630 103 gene locus_tag LOCUS_31860 630 103 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 protein_id gnl|my_center|LOCUS_31860 1558 593 gene locus_tag LOCUS_31870 gene thiL 1558 593 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPP0 protein_id gnl|my_center|LOCUS_31870 2069 1578 gene locus_tag LOCUS_31880 gene lepB 2069 1578 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711896.1 protein_id gnl|my_center|LOCUS_31880 2632 2072 gene locus_tag LOCUS_31890 gene thiE2 2632 2072 CDS product putative thiamine-phosphate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67378 protein_id gnl|my_center|LOCUS_31890 <3544 2719 gene locus_tag LOCUS_31900 <3544 2719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121186.1:UDP-N-acetylhexosamine pyrophosphorylase >Feature sequence0710 1828 689 gene locus_tag LOCUS_31910 1828 689 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_31910 2759 1899 gene locus_tag LOCUS_31920 gene hbd 2759 1899 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538869.1 protein_id gnl|my_center|LOCUS_31920 <3541 2800 gene locus_tag LOCUS_31930 <3541 2800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P45359:acetyl-CoA acetyltransferase >Feature sequence0711 2364 691 gene locus_tag LOCUS_31940 2364 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 <3534 2537 gene locus_tag LOCUS_31950 <3534 2537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118053.1:beta-lactam sensor/signal transducer >Feature sequence0712 381 1217 gene locus_tag LOCUS_31960 381 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 <3528 1344 gene locus_tag LOCUS_31970 <3528 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889560.1:methylamine utilization protein >Feature sequence0713 1537 3162 gene locus_tag LOCUS_31980 1537 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence0714 1859 1335 gene locus_tag LOCUS_31990 1859 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 2535 1924 gene locus_tag LOCUS_32000 2535 1924 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFZ5 protein_id gnl|my_center|LOCUS_32000 3502 2708 gene locus_tag LOCUS_32010 3502 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 >Feature sequence0715 <1 760 gene locus_tag LOCUS_32020 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q06065:acetoacetate metabolism regulatory protein AtoC 757 1119 gene locus_tag LOCUS_32030 757 1119 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKF3 protein_id gnl|my_center|LOCUS_32030 1124 1675 gene locus_tag LOCUS_32040 1124 1675 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKF2 protein_id gnl|my_center|LOCUS_32040 1573 1872 gene locus_tag LOCUS_32050 gene fliE 1573 1872 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G40 protein_id gnl|my_center|LOCUS_32050 1906 3441 gene locus_tag LOCUS_32060 gene fliF 1906 3441 CDS product flagellar M-ring protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537974.1 protein_id gnl|my_center|LOCUS_32060 >Feature sequence0716 61 792 gene locus_tag LOCUS_32070 61 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 941 2104 gene locus_tag LOCUS_32080 941 2104 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210864.1 protein_id gnl|my_center|LOCUS_32080 2149 3150 gene locus_tag LOCUS_32090 2149 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 >Feature sequence0717 1144 788 gene locus_tag LOCUS_32100 1144 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993823.1 protein_id gnl|my_center|LOCUS_32100 1718 1254 gene locus_tag LOCUS_32110 1718 1254 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968618.1 protein_id gnl|my_center|LOCUS_32110 2207 1788 gene locus_tag LOCUS_32120 2207 1788 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404035.1 protein_id gnl|my_center|LOCUS_32120 >Feature sequence0718 455 78 gene locus_tag LOCUS_32130 455 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 991 458 gene locus_tag LOCUS_32140 gene rpoE 991 458 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225197.1 protein_id gnl|my_center|LOCUS_32140 2721 1123 gene locus_tag LOCUS_32150 2721 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 3097 2684 gene locus_tag LOCUS_32160 3097 2684 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869889.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence0719 50 1972 gene locus_tag LOCUS_32170 50 1972 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226664.1 protein_id gnl|my_center|LOCUS_32170 >Feature sequence0720 <1 551 gene locus_tag LOCUS_32180 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010927066.1:alcohol dehydrogenase 776 3244 gene locus_tag LOCUS_32190 776 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 >Feature sequence0721 780 1832 gene locus_tag LOCUS_32200 780 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 1871 2092 gene locus_tag LOCUS_32210 1871 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 3361 2231 gene locus_tag LOCUS_32220 3361 2231 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_32220 >Feature sequence0722 659 1210 gene locus_tag LOCUS_32230 659 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 1194 1817 gene locus_tag LOCUS_32240 1194 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 1814 2509 gene locus_tag LOCUS_32250 1814 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 >Feature sequence0723 121 405 gene locus_tag LOCUS_32260 gene gatC 121 405 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DX0 protein_id gnl|my_center|LOCUS_32260 407 1906 gene locus_tag LOCUS_32270 gene gatA 407 1906 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGY4 protein_id gnl|my_center|LOCUS_32270 1903 3381 gene locus_tag LOCUS_32280 gene gatB 1903 3381 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66766 protein_id gnl|my_center|LOCUS_32280 >Feature sequence0724 357 3413 gene locus_tag LOCUS_32290 357 3413 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_32290 >Feature sequence0725 534 2213 gene locus_tag LOCUS_32300 534 2213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118217.1 protein_id gnl|my_center|LOCUS_32300 >Feature sequence0726 1667 1131 gene locus_tag LOCUS_32310 1667 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 1981 1667 gene locus_tag LOCUS_32320 1981 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32320 2290 2051 gene locus_tag LOCUS_32330 2290 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 <3446 2287 gene locus_tag LOCUS_32340 <3446 2287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P07788:spore coat protein A >Feature sequence0727 2467 1232 gene locus_tag LOCUS_32350 gene metB 2467 1232 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_32350 >Feature sequence0728 2851 1880 gene locus_tag LOCUS_32360 2851 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32360 <3429 2852 gene locus_tag LOCUS_32370 <3429 2852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122658.1:peptidase note possible pseudo, internal stop codon >Feature sequence0729 <1 671 gene locus_tag LOCUS_32380 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022027.1:ion transporter 1548 694 gene locus_tag LOCUS_32390 1548 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 3015 1816 gene locus_tag LOCUS_32400 3015 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_32400 >Feature sequence0730 2532 586 gene locus_tag LOCUS_32410 2532 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_32410 <3427 2837 gene locus_tag LOCUS_32420 <3427 2837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202942.1:peptidase S9 >Feature sequence0731 2879 150 gene locus_tag LOCUS_32430 2879 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 <3422 2876 gene locus_tag LOCUS_32440 <3422 2876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016598.1:peptidase ClpP >Feature sequence0732 3084 1366 gene locus_tag LOCUS_32450 3084 1366 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 protein_id gnl|my_center|LOCUS_32450 >Feature sequence0733 2661 730 gene locus_tag LOCUS_32460 2661 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence0734 1573 1175 gene locus_tag LOCUS_32470 1573 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 3351 1771 gene locus_tag LOCUS_32480 3351 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 >Feature sequence0735 919 1962 gene locus_tag LOCUS_32490 919 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 2012 3073 gene locus_tag LOCUS_32500 2012 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence0736 2624 1434 gene locus_tag LOCUS_32510 2624 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 >Feature sequence0737 1554 406 gene locus_tag LOCUS_32520 gene aspC 1554 406 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67781 protein_id gnl|my_center|LOCUS_32520 2690 1551 gene locus_tag LOCUS_32530 gene tyrA 2690 1551 CDS product T-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK33 protein_id gnl|my_center|LOCUS_32530 >Feature sequence0738 219 1670 gene locus_tag LOCUS_32540 219 1670 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903305.1 protein_id gnl|my_center|LOCUS_32540 1791 2288 gene locus_tag LOCUS_32550 1791 2288 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_32550 3284 2376 gene locus_tag LOCUS_32560 3284 2376 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_32560 >Feature sequence0739 476 1165 gene locus_tag LOCUS_32570 gene lolD 476 1165 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61481 protein_id gnl|my_center|LOCUS_32570 >Feature sequence0740 1726 125 gene locus_tag LOCUS_32580 1726 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143842.1 protein_id gnl|my_center|LOCUS_32580 1991 3235 gene locus_tag LOCUS_32590 1991 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 >Feature sequence0741 952 110 gene locus_tag LOCUS_32600 952 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 2464 953 gene locus_tag LOCUS_32610 2464 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 >Feature sequence0742 >Feature sequence0743 2842 1178 gene locus_tag LOCUS_32620 2842 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 <3366 2839 gene locus_tag LOCUS_32630 <3366 2839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255954.1:phosphomannomutase >Feature sequence0744 <1 656 gene locus_tag LOCUS_32640 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9CJX9:enoyl-[acyl-carrier-protein] reductase [NADH] 2195 669 gene locus_tag LOCUS_32650 2195 669 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_32650 <3364 2227 gene locus_tag LOCUS_32660 <3364 2227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459869.1:Trk system potassium transport protein TrkA >Feature sequence0745 1856 1266 gene locus_tag LOCUS_32670 1856 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 2412 1849 gene locus_tag LOCUS_32680 2412 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 >Feature sequence0746 163 1614 gene locus_tag LOCUS_32690 163 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 1607 2707 gene locus_tag LOCUS_32700 gene aroB 1607 2707 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI75 protein_id gnl|my_center|LOCUS_32700 >Feature sequence0747 <1 905 gene locus_tag LOCUS_32710 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531108.1:multidrug ABC transporter substrate-binding protein 898 1686 gene locus_tag LOCUS_32720 gene lolD 898 1686 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL7 protein_id gnl|my_center|LOCUS_32720 1683 2078 gene locus_tag LOCUS_32730 1683 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 2871 2176 gene locus_tag LOCUS_32740 2871 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 >Feature sequence0748 253 534 gene locus_tag LOCUS_32750 253 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 556 933 gene locus_tag LOCUS_32760 556 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 1689 955 gene locus_tag LOCUS_32770 1689 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 3170 1818 gene locus_tag LOCUS_32780 3170 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 >Feature sequence0749 >Feature sequence0750 1265 36 gene locus_tag LOCUS_32790 1265 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 1453 2301 gene locus_tag LOCUS_32800 1453 2301 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118316.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence0751 1249 722 gene locus_tag LOCUS_32810 1249 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 1784 1194 gene locus_tag LOCUS_32820 1784 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 >Feature sequence0752 1831 458 gene locus_tag LOCUS_32830 1831 458 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403661.1 protein_id gnl|my_center|LOCUS_32830 <3336 1984 gene locus_tag LOCUS_32840 <3336 1984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122247.1:fibrinogen-binding protein >Feature sequence0753 2024 717 gene locus_tag LOCUS_32850 2024 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 2200 2979 gene locus_tag LOCUS_32860 gene xthA1 2200 2979 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946386.1 protein_id gnl|my_center|LOCUS_32860 >Feature sequence0754 731 2851 gene locus_tag LOCUS_32870 gene pcrA 731 2851 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746V7 protein_id gnl|my_center|LOCUS_32870 >Feature sequence0755 260 3052 gene locus_tag LOCUS_32880 260 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 >Feature sequence0756 1341 547 gene locus_tag LOCUS_32890 1341 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258680.1 protein_id gnl|my_center|LOCUS_32890 1714 3093 gene locus_tag LOCUS_32900 1714 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 >Feature sequence0757 615 346 gene locus_tag LOCUS_32910 615 346 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_32910 1142 612 gene locus_tag LOCUS_32920 1142 612 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_32920 1660 3192 gene locus_tag LOCUS_32930 1660 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 >Feature sequence0758 2 1078 gene locus_tag LOCUS_32940 2 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 1252 2745 gene locus_tag LOCUS_32950 1252 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_32950 >Feature sequence0759 1848 487 gene locus_tag LOCUS_32960 gene pepQ 1848 487 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR8 protein_id gnl|my_center|LOCUS_32960 2485 2009 gene locus_tag LOCUS_32970 2485 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 2568 3215 gene locus_tag LOCUS_32980 2568 3215 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142521.1 protein_id gnl|my_center|LOCUS_32980 >Feature sequence0760 488 2554 gene locus_tag LOCUS_32990 488 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 2589 3302 gene locus_tag LOCUS_33000 2589 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 >Feature sequence0761 2656 1208 gene locus_tag LOCUS_33010 2656 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 >Feature sequence0762 1816 500 gene locus_tag LOCUS_33020 gene hemN 1816 500 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_33020 3009 1813 gene locus_tag LOCUS_33030 3009 1813 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_33030 >Feature sequence0763 <3296 2234 gene locus_tag LOCUS_33040 <3296 2234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RK07:riboflavin biosynthesis protein RibD >Feature sequence0764 2805 1090 gene locus_tag LOCUS_33050 gene ggtB 2805 1090 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_33050 >Feature sequence0765 1573 407 gene locus_tag LOCUS_33060 1573 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 <3286 1595 gene locus_tag LOCUS_33070 <3286 1595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118918.1:30S ribosomal protein S1 >Feature sequence0766 <1 796 gene locus_tag LOCUS_33080 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123667.1:serine/threonine protein kinase >Feature sequence0767 2433 1705 gene locus_tag LOCUS_33090 2433 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 >Feature sequence0768 721 2 gene locus_tag LOCUS_33100 721 2 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_33100 805 2085 gene locus_tag LOCUS_33110 805 2085 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 protein_id gnl|my_center|LOCUS_33110 >Feature sequence0769 1565 30 gene locus_tag LOCUS_33120 1565 30 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_33120 2056 1616 gene locus_tag LOCUS_33130 2056 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 2557 2066 gene locus_tag LOCUS_33140 2557 2066 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_33140 <3262 2554 gene locus_tag LOCUS_33150 <3262 2554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328224.1:cation:proton antiporter >Feature sequence0770 >Feature sequence0771 331 807 gene locus_tag LOCUS_33160 331 807 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084347.1 protein_id gnl|my_center|LOCUS_33160 804 2999 gene locus_tag LOCUS_33170 804 2999 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_33170 >Feature sequence0772 1933 128 gene locus_tag LOCUS_33180 1933 128 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_33180 3124 2093 gene locus_tag LOCUS_33190 3124 2093 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_33190 >Feature sequence0773 2255 1737 gene locus_tag LOCUS_33200 2255 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 >Feature sequence0774 <1 585 gene locus_tag LOCUS_33210 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P21777:ATP-dependent 6-phosphofructokinase 1 582 1256 gene locus_tag LOCUS_33220 582 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 1587 1429 gene locus_tag LOCUS_33230 1587 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 3167 1971 gene locus_tag LOCUS_33240 3167 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 >Feature sequence0775 808 38 gene locus_tag LOCUS_33250 808 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 1925 1179 gene locus_tag LOCUS_33260 1925 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 1821 2075 gene locus_tag LOCUS_33270 1821 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 2110 2334 gene locus_tag LOCUS_33280 2110 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 3033 2653 gene locus_tag LOCUS_33290 3033 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 >Feature sequence0776 190 2085 gene locus_tag LOCUS_33300 190 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 >Feature sequence0777 <1 1241 gene locus_tag LOCUS_33310 <1 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867156.1:sodium:proline symporter 1286 1978 gene locus_tag LOCUS_33320 1286 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 2099 2968 gene locus_tag LOCUS_33330 2099 2968 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228419.1 protein_id gnl|my_center|LOCUS_33330 >Feature sequence0778 669 2279 gene locus_tag LOCUS_33340 669 2279 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMH9 protein_id gnl|my_center|LOCUS_33340 2283 2912 gene locus_tag LOCUS_33350 2283 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 >Feature sequence0779 248 832 gene locus_tag LOCUS_33360 248 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 825 1388 gene locus_tag LOCUS_33370 gene rpoE 825 1388 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_33370 1623 2207 gene locus_tag LOCUS_33380 1623 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence0780 972 238 gene locus_tag LOCUS_33390 972 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 >Feature sequence0781 2641 1097 gene locus_tag LOCUS_33400 2641 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 2928 2638 gene locus_tag LOCUS_33410 2928 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 >Feature sequence0782 <1 856 gene locus_tag LOCUS_33420 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122335.1:carbohydrate porin 891 1952 gene locus_tag LOCUS_33430 891 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 2967 1975 gene locus_tag LOCUS_33440 2967 1975 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 protein_id gnl|my_center|LOCUS_33440 >Feature sequence0783 1809 1240 gene locus_tag LOCUS_33450 1809 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 2092 2541 gene locus_tag LOCUS_33460 2092 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 >Feature sequence0784 <1 813 gene locus_tag LOCUS_33470 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583060.1:anthranilate synthase component I 890 2494 gene locus_tag LOCUS_33480 gene trpGD 890 2494 CDS product bifunctional protein TrpGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q08654 protein_id gnl|my_center|LOCUS_33480 >Feature sequence0785 1704 805 gene locus_tag LOCUS_33490 gene xerC 1704 805 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQY6 protein_id gnl|my_center|LOCUS_33490 >Feature sequence0786 308 2095 gene locus_tag LOCUS_33500 308 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 >Feature sequence0787 2 307 gene locus_tag LOCUS_33510 2 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 417 1928 gene locus_tag LOCUS_33520 gene cysS 417 1928 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3T5 protein_id gnl|my_center|LOCUS_33520 >Feature sequence0788 1639 320 gene locus_tag LOCUS_33530 1639 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 2323 1817 gene locus_tag LOCUS_33540 2323 1817 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_33540 >Feature sequence0789 2437 287 gene locus_tag LOCUS_33550 2437 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 3188 2559 gene locus_tag LOCUS_33560 3188 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 >Feature sequence0790 101 2362 gene locus_tag LOCUS_33570 101 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 >Feature sequence0791 1555 1250 gene locus_tag LOCUS_33580 gene rpsN 1555 1250 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GL8 protein_id gnl|my_center|LOCUS_33580 2743 1811 gene locus_tag LOCUS_33590 2743 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 >Feature sequence0792 1473 58 gene locus_tag LOCUS_33600 1473 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 3164 1470 gene locus_tag LOCUS_33610 3164 1470 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_33610 >Feature sequence0793 <1 676 gene locus_tag LOCUS_33620 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WD17:N-acetyl-gamma-glutamyl-phosphate reductase 690 1499 gene locus_tag LOCUS_33630 690 1499 CDS product putative acetylglutamate kinase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUG6 protein_id gnl|my_center|LOCUS_33630 1549 2772 gene locus_tag LOCUS_33640 gene argD 1549 2772 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB46 protein_id gnl|my_center|LOCUS_33640 >Feature sequence0794 1571 543 gene locus_tag LOCUS_33650 1571 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 >Feature sequence0795 <1 834 gene locus_tag LOCUS_33660 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258650.1:GTP-binding protein 901 2070 gene locus_tag LOCUS_33670 901 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_33670 2296 3009 gene locus_tag LOCUS_33680 2296 3009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_33680 >Feature sequence0796 1242 415 gene locus_tag LOCUS_33690 gene punA 1242 415 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ11 protein_id gnl|my_center|LOCUS_33690 >Feature sequence0797 576 1028 gene locus_tag LOCUS_33700 576 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 1260 1631 gene locus_tag LOCUS_33710 1260 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 >Feature sequence0798 1034 2584 gene locus_tag LOCUS_33720 gene lysS 1034 2584 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPU0 protein_id gnl|my_center|LOCUS_33720 >Feature sequence0799 >Feature sequence0800 1545 4 gene locus_tag LOCUS_33730 1545 4 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_33730 <3132 1542 gene locus_tag LOCUS_33740 <3132 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705254.1:acriflavine resistance protein B >Feature sequence0801 540 1577 gene locus_tag LOCUS_33750 540 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 <3131 1701 gene locus_tag LOCUS_33760 <3131 1701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123323.1:squalene--hopene cyclase >Feature sequence0802 586 344 gene locus_tag LOCUS_33770 586 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 1707 619 gene locus_tag LOCUS_33780 1707 619 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 protein_id gnl|my_center|LOCUS_33780 2035 1760 gene locus_tag LOCUS_33790 2035 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 2517 3092 gene locus_tag LOCUS_33800 2517 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 >Feature sequence0803 <1 1357 gene locus_tag LOCUS_33810 <1 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001883980.1:fimbrial protein 3101 1479 gene locus_tag LOCUS_33820 3101 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 >Feature sequence0804 958 2640 gene locus_tag LOCUS_33830 958 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 >Feature sequence0805 636 19 gene locus_tag LOCUS_33840 636 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 >Feature sequence0806 <1 1804 gene locus_tag LOCUS_33850 <1 1804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887549.1:hybrid sensor histidine kinase/response regulator 1954 2628 gene locus_tag LOCUS_33860 1954 2628 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339994.1 protein_id gnl|my_center|LOCUS_33860 >Feature sequence0807 <1 771 gene locus_tag LOCUS_33870 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8R5V9:peptide chain release factor 2 768 2315 gene locus_tag LOCUS_33880 gene purH 768 2315 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKJ8 protein_id gnl|my_center|LOCUS_33880 >Feature sequence0808 1389 2093 gene locus_tag LOCUS_33890 1389 2093 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_33890 >Feature sequence0809 2979 2269 gene locus_tag LOCUS_33900 2979 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 >Feature sequence0810 1615 1187 gene locus_tag LOCUS_33910 1615 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 2601 1615 gene locus_tag LOCUS_33920 2601 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970375.1 protein_id gnl|my_center|LOCUS_33920 >Feature sequence0811 1434 832 gene locus_tag LOCUS_33930 gene mcsA 1434 832 CDS product protein-arginine kinase activator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37569 protein_id gnl|my_center|LOCUS_33930 2996 1548 gene locus_tag LOCUS_33940 gene murD 2996 1548 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG75 protein_id gnl|my_center|LOCUS_33940 >Feature sequence0812 2353 977 gene locus_tag LOCUS_33950 2353 977 CDS product copper resistance-related lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 protein_id gnl|my_center|LOCUS_33950 2872 2435 gene locus_tag LOCUS_33960 2872 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 >Feature sequence0813 4 1488 gene locus_tag LOCUS_33970 4 1488 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640003.1 protein_id gnl|my_center|LOCUS_33970 1516 2121 gene locus_tag LOCUS_33980 1516 2121 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416599.1 protein_id gnl|my_center|LOCUS_33980 >Feature sequence0814 794 1564 gene locus_tag LOCUS_33990 794 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 1651 2478 gene locus_tag LOCUS_34000 1651 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 >Feature sequence0815 854 1141 gene locus_tag LOCUS_34010 854 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 2664 1177 gene locus_tag LOCUS_34020 2664 1177 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_34020 >Feature sequence0816 1051 62 gene locus_tag LOCUS_34030 1051 62 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUP0 protein_id gnl|my_center|LOCUS_34030 1372 1205 gene locus_tag LOCUS_34040 1372 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 2202 1588 gene locus_tag LOCUS_34050 2202 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 >Feature sequence0817 3 710 gene locus_tag LOCUS_34060 3 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 697 1188 gene locus_tag LOCUS_34070 697 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 1200 2612 gene locus_tag LOCUS_34080 1200 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 >Feature sequence0818 566 1750 gene locus_tag LOCUS_34090 566 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 1763 2737 gene locus_tag LOCUS_34100 1763 2737 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_34100 >Feature sequence0819 981 2972 gene locus_tag LOCUS_34110 981 2972 CDS product metal-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113075.1 protein_id gnl|my_center|LOCUS_34110 >Feature sequence0820 1964 1206 gene locus_tag LOCUS_34120 1964 1206 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532015.1 protein_id gnl|my_center|LOCUS_34120 2857 1961 gene locus_tag LOCUS_34130 gene rimK2 2857 1961 CDS product putative alpha-L-glutamate ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU3 protein_id gnl|my_center|LOCUS_34130 >Feature sequence0821 2391 454 gene locus_tag LOCUS_34140 gene fhlA 2391 454 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017465.1 protein_id gnl|my_center|LOCUS_34140 >Feature sequence0822 1662 1075 gene locus_tag LOCUS_34150 1662 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 >Feature sequence0823 1003 185 gene locus_tag LOCUS_34160 1003 185 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328804.1 protein_id gnl|my_center|LOCUS_34160 1181 2272 gene locus_tag LOCUS_34170 gene rlmN 1181 2272 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHU7 protein_id gnl|my_center|LOCUS_34170 2976 2260 gene locus_tag LOCUS_34180 2976 2260 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708255.1 protein_id gnl|my_center|LOCUS_34180 >Feature sequence0824 560 2011 gene locus_tag LOCUS_34190 560 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142973.1 protein_id gnl|my_center|LOCUS_34190 >Feature sequence0825 323 2563 gene locus_tag LOCUS_34200 323 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 >Feature sequence0826 181 1854 gene locus_tag LOCUS_34210 181 1854 CDS product general secretory pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941104.1 protein_id gnl|my_center|LOCUS_34210 1875 2969 gene locus_tag LOCUS_34220 gene pilT-3 1875 2969 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_34220 >Feature sequence0827 956 1891 gene locus_tag LOCUS_34230 956 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 >Feature sequence0828 1676 540 gene locus_tag LOCUS_34240 1676 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 <3027 1733 gene locus_tag LOCUS_34250 <3027 1733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B6E5:signal peptidase I >Feature sequence0829 <1 1159 gene locus_tag LOCUS_34260 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123369.1:serine/threonine protein kinase 1171 2907 gene locus_tag LOCUS_34270 1171 2907 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121439.1 protein_id gnl|my_center|LOCUS_34270 >Feature sequence0830 2063 1305 gene locus_tag LOCUS_34280 2063 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 >Feature sequence0831 1348 923 gene locus_tag LOCUS_34290 1348 923 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118054.1 protein_id gnl|my_center|LOCUS_34290 1675 1448 gene locus_tag LOCUS_34300 1675 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 1795 2547 gene locus_tag LOCUS_34310 1795 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 >Feature sequence0832 1828 1418 gene locus_tag LOCUS_34320 1828 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 2509 1865 gene locus_tag LOCUS_34330 2509 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 >Feature sequence0833 <1 2121 gene locus_tag LOCUS_34340 <1 2121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011069766.1:sulfatase >Feature sequence0834 594 1592 gene locus_tag LOCUS_34350 gene dusB 594 1592 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F5 protein_id gnl|my_center|LOCUS_34350 1911 2834 gene locus_tag LOCUS_34360 1911 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 >Feature sequence0835 105 2039 gene locus_tag LOCUS_34370 gene deaD-1 105 2039 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KET5 protein_id gnl|my_center|LOCUS_34370 >Feature sequence0836 >Feature sequence0837 <2997 2310 gene locus_tag LOCUS_34380 <2997 2310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123366.1:oxidoreductase >Feature sequence0838 462 1238 gene locus_tag LOCUS_34390 462 1238 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_34390 1235 2098 gene locus_tag LOCUS_34400 gene hbd 1235 2098 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52041 protein_id gnl|my_center|LOCUS_34400 2144 2935 gene locus_tag LOCUS_34410 2144 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34410 >Feature sequence0839 878 1816 gene locus_tag LOCUS_34420 878 1816 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257001.1 protein_id gnl|my_center|LOCUS_34420 1883 2791 gene locus_tag LOCUS_34430 gene gndA 1883 2791 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038537.1 protein_id gnl|my_center|LOCUS_34430 >Feature sequence0840 1434 439 gene locus_tag LOCUS_34440 1434 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 2728 1445 gene locus_tag LOCUS_34450 2728 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 >Feature sequence0841 >Feature sequence0842 1300 794 gene locus_tag LOCUS_34460 1300 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 1413 2483 gene locus_tag LOCUS_34470 1413 2483 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404470.1 protein_id gnl|my_center|LOCUS_34470 >Feature sequence0843 >Feature sequence0844 >Feature sequence0845 >Feature sequence0846 1795 455 gene locus_tag LOCUS_34480 gene kmo 1795 455 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_34480 <2938 1792 gene locus_tag LOCUS_34490 <2938 1792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PAD2:kynureninase >Feature sequence0847 244 747 gene locus_tag LOCUS_34500 244 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 744 1835 gene locus_tag LOCUS_34510 744 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 2117 2896 gene locus_tag LOCUS_34520 gene whiG 2117 2896 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFV6 protein_id gnl|my_center|LOCUS_34520 >Feature sequence0848 <1 544 gene locus_tag LOCUS_34530 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P50597:ribonuclease PH 571 1185 gene locus_tag LOCUS_34540 571 1185 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL39 protein_id gnl|my_center|LOCUS_34540 >Feature sequence0849 2276 471 gene locus_tag LOCUS_34550 2276 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 2772 2395 gene locus_tag LOCUS_34560 2772 2395 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSF7 protein_id gnl|my_center|LOCUS_34560 >Feature sequence0850 808 1725 gene locus_tag LOCUS_34570 808 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 2562 1669 gene locus_tag LOCUS_34580 2562 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 >Feature sequence0851 1486 1229 gene locus_tag LOCUS_34590 1486 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389323.1 protein_id gnl|my_center|LOCUS_34590 <2928 1483 gene locus_tag LOCUS_34600 <2928 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389324.1:cation:proton antiporter >Feature sequence0852 <1 2115 gene locus_tag LOCUS_34610 <1 2115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764318.1:9-O-acetylesterase >Feature sequence0853 >Feature sequence0854 <1 610 gene locus_tag LOCUS_34620 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942151.1:ABC transporter ATP-binding protein 1343 594 gene locus_tag LOCUS_34630 1343 594 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_34630 2920 1343 gene locus_tag LOCUS_34640 gene sdhA 2920 1343 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_34640 >Feature sequence0855 1688 2764 gene locus_tag LOCUS_34650 1688 2764 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405248.1 protein_id gnl|my_center|LOCUS_34650 >Feature sequence0856 1351 599 gene locus_tag LOCUS_34660 1351 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 1459 2016 gene locus_tag LOCUS_34670 1459 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 >Feature sequence0857 2046 88 gene locus_tag LOCUS_34680 2046 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 >Feature sequence0858 1779 484 gene locus_tag LOCUS_34690 1779 484 CDS product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_34690 1946 2701 gene locus_tag LOCUS_34700 1946 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence0859 2388 1618 gene locus_tag LOCUS_34710 2388 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 >Feature sequence0860 1214 456 gene locus_tag LOCUS_34720 1214 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 1970 1257 gene locus_tag LOCUS_34730 1970 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 >Feature sequence0861 1760 882 gene locus_tag LOCUS_34740 1760 882 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_34740 >Feature sequence0862 978 2348 gene locus_tag LOCUS_34750 978 2348 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_34750 <2892 2382 gene locus_tag LOCUS_34760 <2892 2382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119047.1:alcohol dehydrogenase >Feature sequence0863 1424 504 gene locus_tag LOCUS_34770 1424 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 1970 1647 gene locus_tag LOCUS_34780 1970 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 >Feature sequence0864 2044 1337 gene locus_tag LOCUS_34790 2044 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34790 >Feature sequence0865 <1 995 gene locus_tag LOCUS_34800 <1 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122048.1:two-component system sensor histidine kinase/response regulator 1133 1513 gene locus_tag LOCUS_34810 1133 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 2462 1563 gene locus_tag LOCUS_34820 gene fadM 2462 1563 CDS product proline dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32179 protein_id gnl|my_center|LOCUS_34820 >Feature sequence0866 598 245 gene locus_tag LOCUS_34830 598 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 981 778 gene locus_tag LOCUS_34840 981 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 1187 978 gene locus_tag LOCUS_34850 1187 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 1648 1184 gene locus_tag LOCUS_34860 1648 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 2574 1663 gene locus_tag LOCUS_34870 2574 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 2738 2571 gene locus_tag LOCUS_34880 2738 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 >Feature sequence0867 1294 476 gene locus_tag LOCUS_34890 1294 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 2147 1299 gene locus_tag LOCUS_34900 2147 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 >Feature sequence0868 500 1039 gene locus_tag LOCUS_34910 500 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 >Feature sequence0869 368 796 gene locus_tag LOCUS_34920 368 796 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887511.1 protein_id gnl|my_center|LOCUS_34920 1852 824 gene locus_tag LOCUS_34930 1852 824 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582430.1 protein_id gnl|my_center|LOCUS_34930 2775 1849 gene locus_tag LOCUS_34940 2775 1849 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G39 protein_id gnl|my_center|LOCUS_34940 >Feature sequence0870 >Feature sequence0871 <1 778 gene locus_tag LOCUS_34950 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1BA43:imidazolonepropionase 1367 780 gene locus_tag LOCUS_34960 1367 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 <2865 1345 gene locus_tag LOCUS_34970 <2865 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881258.1:N-methylhydantoinase B >Feature sequence0872 2 1009 gene locus_tag LOCUS_34980 2 1009 CDS product protein 3-oxoalanine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941563.1 protein_id gnl|my_center|LOCUS_34980 2530 1016 gene locus_tag LOCUS_34990 2530 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 >Feature sequence0873 1489 752 gene locus_tag LOCUS_35000 1489 752 CDS product large, multifunctional secreted protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384321.1 protein_id gnl|my_center|LOCUS_35000 1574 2836 gene locus_tag LOCUS_35010 1574 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 >Feature sequence0874 1525 104 gene locus_tag LOCUS_35020 1525 104 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259590.1 protein_id gnl|my_center|LOCUS_35020 2421 1522 gene locus_tag LOCUS_35030 2421 1522 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259591.1 protein_id gnl|my_center|LOCUS_35030 >Feature sequence0875 729 1610 gene locus_tag LOCUS_35040 729 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 >Feature sequence0876 2377 1184 gene locus_tag LOCUS_35050 2377 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 >Feature sequence0877 1037 1648 gene locus_tag LOCUS_35060 1037 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 >Feature sequence0878 2550 1879 gene locus_tag LOCUS_35070 2550 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 >Feature sequence0879 1204 2502 gene locus_tag LOCUS_35080 1204 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 >Feature sequence0880 1679 984 gene locus_tag LOCUS_35090 gene plsY 1679 984 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66905 protein_id gnl|my_center|LOCUS_35090 >Feature sequence0881 949 1338 gene locus_tag LOCUS_35100 949 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 1384 1929 gene locus_tag LOCUS_35110 gene mip 1384 1929 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULD6 protein_id gnl|my_center|LOCUS_35110 2008 2628 gene locus_tag LOCUS_35120 2008 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 >Feature sequence0882 490 882 gene locus_tag LOCUS_35130 490 882 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142971.1 protein_id gnl|my_center|LOCUS_35130 >Feature sequence0883 461 2212 gene locus_tag LOCUS_35140 461 2212 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119972.1 protein_id gnl|my_center|LOCUS_35140 >Feature sequence0884 1926 1153 gene locus_tag LOCUS_35150 gene lpxA 1926 1153 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPW4 protein_id gnl|my_center|LOCUS_35150 >Feature sequence0885 2477 354 gene locus_tag LOCUS_35160 2477 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 >Feature sequence0886 1288 416 gene locus_tag LOCUS_35170 1288 416 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFJ6 protein_id gnl|my_center|LOCUS_35170 1474 2436 gene locus_tag LOCUS_35180 1474 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 >Feature sequence0887 90 1064 gene locus_tag LOCUS_35190 90 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 1103 2071 gene locus_tag LOCUS_35200 1103 2071 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148598.1 protein_id gnl|my_center|LOCUS_35200 2199 2798 gene locus_tag LOCUS_35210 2199 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 >Feature sequence0888 687 469 gene locus_tag LOCUS_35220 687 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 1243 2172 gene locus_tag LOCUS_35230 gene xerD 1243 2172 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818Z7 protein_id gnl|my_center|LOCUS_35230 2811 2209 gene locus_tag LOCUS_35240 2811 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 >Feature sequence0889 >Feature sequence0890 1191 439 gene locus_tag LOCUS_35250 1191 439 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528783.1 protein_id gnl|my_center|LOCUS_35250 1586 1179 gene locus_tag LOCUS_35260 1586 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 1627 2247 gene locus_tag LOCUS_35270 1627 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 >Feature sequence0891 1070 1780 gene locus_tag LOCUS_35280 1070 1780 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120235.1 protein_id gnl|my_center|LOCUS_35280 1784 2461 gene locus_tag LOCUS_35290 1784 2461 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683351.1 protein_id gnl|my_center|LOCUS_35290 >Feature sequence0892 2131 980 gene locus_tag LOCUS_35300 2131 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 <2803 2258 gene locus_tag LOCUS_35310 <2803 2258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036331.1:DNA-3-methyladenine glycosylase >Feature sequence0893 2273 1380 gene locus_tag LOCUS_35320 2273 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 >Feature sequence0894 3 1175 gene locus_tag LOCUS_35330 3 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 1971 1267 gene locus_tag LOCUS_35340 1971 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 2172 1987 gene locus_tag LOCUS_35350 2172 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 2533 2459 gene locus_tag LOCUS_t00390 2533 2459 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0895 >Feature sequence0896 481 1170 gene locus_tag LOCUS_35360 481 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 1191 2054 gene locus_tag LOCUS_35370 1191 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 >Feature sequence0897 1353 715 gene locus_tag LOCUS_35380 1353 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 >Feature sequence0898 1329 2411 gene locus_tag LOCUS_35390 1329 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 >Feature sequence0899 423 875 gene locus_tag LOCUS_35400 423 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 889 1041 gene locus_tag LOCUS_35410 889 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 1034 1246 gene locus_tag LOCUS_35420 1034 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 1239 1544 gene locus_tag LOCUS_35430 1239 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 1718 2563 gene locus_tag LOCUS_35440 1718 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 >Feature sequence0900 >Feature sequence0901 1680 955 gene locus_tag LOCUS_35450 1680 955 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_35450 2212 1820 gene locus_tag LOCUS_35460 2212 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 2621 2199 gene locus_tag LOCUS_35470 2621 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 >Feature sequence0902 >Feature sequence0903 <1 1022 gene locus_tag LOCUS_35480 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34238:putative lipid II flippase MurJ 1046 1855 gene locus_tag LOCUS_35490 1046 1855 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870123.1 protein_id gnl|my_center|LOCUS_35490 >Feature sequence0904 1068 46 gene locus_tag LOCUS_35500 1068 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 1588 1842 gene locus_tag LOCUS_35510 1588 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 1876 2169 gene locus_tag LOCUS_35520 1876 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 >Feature sequence0905 38 490 gene locus_tag LOCUS_35530 38 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405426.1 protein_id gnl|my_center|LOCUS_35530 518 1336 gene locus_tag LOCUS_35540 gene yqjF 518 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54543 protein_id gnl|my_center|LOCUS_35540 1336 2130 gene locus_tag LOCUS_35550 1336 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 >Feature sequence0906 218 1147 gene locus_tag LOCUS_35560 218 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 1718 1173 gene locus_tag LOCUS_35570 1718 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 >Feature sequence0907 >Feature sequence0908 227 712 gene locus_tag LOCUS_35580 227 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 2139 703 gene locus_tag LOCUS_35590 2139 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 <2762 2136 gene locus_tag LOCUS_35600 <2762 2136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S010:transport permease protein >Feature sequence0909 1128 2417 gene locus_tag LOCUS_35610 1128 2417 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9R339 protein_id gnl|my_center|LOCUS_35610 >Feature sequence0910 1659 2084 gene locus_tag LOCUS_35620 gene blaI 1659 2084 CDS product penicillinase repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119729.1 protein_id gnl|my_center|LOCUS_35620 >Feature sequence0911 >Feature sequence0912 1199 405 gene locus_tag LOCUS_35630 1199 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 2154 1225 gene locus_tag LOCUS_35640 2154 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 >Feature sequence0913 371 1741 gene locus_tag LOCUS_35650 gene hemN 371 1741 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4J8 protein_id gnl|my_center|LOCUS_35650 >Feature sequence0914 1892 861 gene locus_tag LOCUS_35660 1892 861 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085057.1 protein_id gnl|my_center|LOCUS_35660 2694 1936 gene locus_tag LOCUS_35670 gene fabG1 2694 1936 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706496.1 protein_id gnl|my_center|LOCUS_35670 >Feature sequence0915 754 419 gene locus_tag LOCUS_35680 754 419 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969808.1 protein_id gnl|my_center|LOCUS_35680 870 1547 gene locus_tag LOCUS_35690 870 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141416.1 protein_id gnl|my_center|LOCUS_35690 1598 1963 gene locus_tag LOCUS_35700 1598 1963 CDS product DUF962 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206200.1 protein_id gnl|my_center|LOCUS_35700 2075 2527 gene locus_tag LOCUS_35710 2075 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 >Feature sequence0916 842 1011 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgaagccgccttcgccgcggcc >Feature sequence0917 2707 2264 gene locus_tag LOCUS_35720 gene nsrR 2707 2264 CDS product HTH-type transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ETF3 protein_id gnl|my_center|LOCUS_35720 >Feature sequence0918 2574 2137 gene locus_tag LOCUS_35730 2574 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 >Feature sequence0919 <1 777 gene locus_tag LOCUS_35740 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728989.1:alpha/beta hydrolase 1001 2404 gene locus_tag LOCUS_35750 1001 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 >Feature sequence0920 2727 1816 gene locus_tag LOCUS_35760 2727 1816 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546047.1 protein_id gnl|my_center|LOCUS_35760 >Feature sequence0921 1412 321 gene locus_tag LOCUS_35770 1412 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 <2720 1414 gene locus_tag LOCUS_35780 <2720 1414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889608.1:ABC transporter ATP-binding protein >Feature sequence0922 329 1786 gene locus_tag LOCUS_35790 329 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 >Feature sequence0923 2483 567 gene locus_tag LOCUS_35800 2483 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 >Feature sequence0924 1597 362 gene locus_tag LOCUS_35810 1597 362 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121117.1 protein_id gnl|my_center|LOCUS_35810 >Feature sequence0925 782 15 gene locus_tag LOCUS_35820 782 15 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_35820 1045 2013 gene locus_tag LOCUS_35830 1045 2013 CDS product 2-oxoisovalerate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257564.1 protein_id gnl|my_center|LOCUS_35830 >Feature sequence0926 1600 551 gene locus_tag LOCUS_35840 1600 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 1784 2110 gene locus_tag LOCUS_35850 1784 2110 CDS product divalent ion tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 protein_id gnl|my_center|LOCUS_35850 >Feature sequence0927 <1 1555 gene locus_tag LOCUS_35860 <1 1555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122437.1:cytochrome CBB3 2100 2174 gene locus_tag LOCUS_t00400 2100 2174 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0928 <2707 1626 gene locus_tag LOCUS_35870 <2707 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817433.1:alanine racemase >Feature sequence0929 774 1961 gene locus_tag LOCUS_35880 774 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 <2703 1963 gene locus_tag LOCUS_35890 <2703 1963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031512.1:glycosyl hydrolase >Feature sequence0930 >Feature sequence0931 2198 441 gene locus_tag LOCUS_35900 2198 441 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481540.1 protein_id gnl|my_center|LOCUS_35900 2689 2195 gene locus_tag LOCUS_35910 2689 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 >Feature sequence0932 2305 473 gene locus_tag LOCUS_35920 2305 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 >Feature sequence0933 1818 334 gene locus_tag LOCUS_35930 1818 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_35930 >Feature sequence0934 >Feature sequence0935 1717 1289 gene locus_tag LOCUS_35940 1717 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971103.1 protein_id gnl|my_center|LOCUS_35940 2218 1766 gene locus_tag LOCUS_35950 2218 1766 CDS product swarming motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145128.1 protein_id gnl|my_center|LOCUS_35950 >Feature sequence0936 <1 621 gene locus_tag LOCUS_35960 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Z6I8:UPF0061 protein YdiU 1951 632 gene locus_tag LOCUS_35970 gene hemL 1951 632 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHC8 protein_id gnl|my_center|LOCUS_35970 <2681 1960 gene locus_tag LOCUS_35980 <2681 1960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GV9:delta-aminolevulinic acid dehydratase >Feature sequence0937 1309 521 gene locus_tag LOCUS_35990 1309 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 <2681 1474 gene locus_tag LOCUS_36000 <2681 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022506.1:phycocyanobilin lyase >Feature sequence0938 2524 1868 gene locus_tag LOCUS_36010 2524 1868 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_36010 >Feature sequence0939 6 1736 gene locus_tag LOCUS_36020 6 1736 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869295.1 protein_id gnl|my_center|LOCUS_36020 <2677 1767 gene locus_tag LOCUS_36030 <2677 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405522.1:thioredoxin >Feature sequence0940 210 770 gene locus_tag LOCUS_36040 210 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 1476 778 gene locus_tag LOCUS_36050 1476 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090287.1 protein_id gnl|my_center|LOCUS_36050 1631 2206 gene locus_tag LOCUS_36060 gene rpoE 1631 2206 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231056.1 protein_id gnl|my_center|LOCUS_36060 2407 2658 gene locus_tag LOCUS_36070 2407 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 >Feature sequence0941 1919 1071 gene locus_tag LOCUS_36080 1919 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 >Feature sequence0942 1505 288 gene locus_tag LOCUS_36090 1505 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 <2674 1525 gene locus_tag LOCUS_36100 <2674 1525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765451.1:alginate O-acetyltransferase >Feature sequence0943 2 844 gene locus_tag LOCUS_36110 2 844 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007372648.1 protein_id gnl|my_center|LOCUS_36110 1823 933 gene locus_tag LOCUS_36120 gene parA 1823 933 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_36120 >Feature sequence0944 189 112 gene locus_tag LOCUS_t00410 189 112 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 386 311 gene locus_tag LOCUS_t00420 386 311 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1036 461 gene locus_tag LOCUS_36130 gene frr 1036 461 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTH0 protein_id gnl|my_center|LOCUS_36130 1791 1042 gene locus_tag LOCUS_36140 gene pyrH 1791 1042 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW2 protein_id gnl|my_center|LOCUS_36140 2387 1788 gene locus_tag LOCUS_36150 gene tsf 2387 1788 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61333 protein_id gnl|my_center|LOCUS_36150 >Feature sequence0945 1098 2507 gene locus_tag LOCUS_36160 1098 2507 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_36160 >Feature sequence0946 1387 278 gene locus_tag LOCUS_36170 gene degP 1387 278 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_36170 1808 1431 gene locus_tag LOCUS_36180 1808 1431 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173828.1 protein_id gnl|my_center|LOCUS_36180 >Feature sequence0947 272 1114 gene locus_tag LOCUS_36190 272 1114 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_36190 1111 1776 gene locus_tag LOCUS_36200 1111 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 1967 2374 gene locus_tag LOCUS_36210 1967 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 >Feature sequence0948 957 1571 gene locus_tag LOCUS_36220 957 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119745.1 protein_id gnl|my_center|LOCUS_36220 1568 2278 gene locus_tag LOCUS_36230 1568 2278 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082950.1 protein_id gnl|my_center|LOCUS_36230 >Feature sequence0949 120 1481 gene locus_tag LOCUS_36240 120 1481 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413541.1 protein_id gnl|my_center|LOCUS_36240 1478 2521 gene locus_tag LOCUS_36250 gene tsaD 1478 2521 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGJ3 protein_id gnl|my_center|LOCUS_36250 >Feature sequence0950 <1 712 gene locus_tag LOCUS_36260 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966001.1:thiamine ABC transporter substrate-binding protein 721 2421 gene locus_tag LOCUS_36270 gene argS 721 2421 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189Q7 protein_id gnl|my_center|LOCUS_36270 >Feature sequence0951 1411 2499 gene locus_tag LOCUS_36280 1411 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 >Feature sequence0952 <2647 731 gene locus_tag LOCUS_36290 <2647 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223771.1:alkaline phosphatase >Feature sequence0953 1773 754 gene locus_tag LOCUS_36300 1773 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 >Feature sequence0954 1584 628 gene locus_tag LOCUS_36310 gene ylyB 1584 628 CDS product putative RNA pseudouridine synthase YlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45480 protein_id gnl|my_center|LOCUS_36310 2204 1641 gene locus_tag LOCUS_36320 gene efp 2204 1641 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2U0 protein_id gnl|my_center|LOCUS_36320 >Feature sequence0955 345 1037 gene locus_tag LOCUS_36330 345 1037 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_36330 2079 1111 gene locus_tag LOCUS_36340 2079 1111 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_36340 >Feature sequence0956 908 177 gene locus_tag LOCUS_36350 908 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 979 2358 gene locus_tag LOCUS_36360 979 2358 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_36360 >Feature sequence0957 317 1489 gene locus_tag LOCUS_36370 317 1489 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210864.1 protein_id gnl|my_center|LOCUS_36370 >Feature sequence0958 1328 480 gene locus_tag LOCUS_36380 1328 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 >Feature sequence0959 1623 2057 gene locus_tag LOCUS_36390 1623 2057 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020192.1 protein_id gnl|my_center|LOCUS_36390 2061 2501 gene locus_tag LOCUS_36400 2061 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 >Feature sequence0960 435 2066 gene locus_tag LOCUS_36410 435 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 >Feature sequence0961 <2612 534 gene locus_tag LOCUS_36420 <2612 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255972.1:permease >Feature sequence0962 <1 778 gene locus_tag LOCUS_36430 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918440.1:alpha/beta hydrolase 2074 812 gene locus_tag LOCUS_36440 2074 812 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_36440 >Feature sequence0963 138 1151 gene locus_tag LOCUS_36450 138 1151 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761573.1 protein_id gnl|my_center|LOCUS_36450 1138 2007 gene locus_tag LOCUS_36460 1138 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 >Feature sequence0964 187 1509 gene locus_tag LOCUS_36470 187 1509 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_36470 2058 1519 gene locus_tag LOCUS_36480 2058 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 >Feature sequence0965 <1 1725 gene locus_tag LOCUS_36490 <1 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117992.1:arylsulfatase >Feature sequence0966 >Feature sequence0967 172 1203 gene locus_tag LOCUS_36500 172 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 1345 1929 gene locus_tag LOCUS_36510 1345 1929 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7S1 protein_id gnl|my_center|LOCUS_36510 >Feature sequence0968 857 1582 gene locus_tag LOCUS_36520 857 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 >Feature sequence0969 482 1852 gene locus_tag LOCUS_36530 482 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 2075 1758 gene locus_tag LOCUS_36540 2075 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 <2582 2072 gene locus_tag LOCUS_36550 <2582 2072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UJD8:1,4-dihydroxy-6-naphtoate synthase >Feature sequence0970 <2582 1908 gene locus_tag LOCUS_36560 <2582 1908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C44:segregation and condensation protein B >Feature sequence0971 1502 699 gene locus_tag LOCUS_36570 1502 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 <2582 1628 gene locus_tag LOCUS_36580 <2582 1628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480358.1:peptidase M11 >Feature sequence0972 >Feature sequence0973 >Feature sequence0974 974 771 gene locus_tag LOCUS_36590 974 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 1601 1011 gene locus_tag LOCUS_36600 1601 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 1741 2412 gene locus_tag LOCUS_36610 1741 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702134.1 protein_id gnl|my_center|LOCUS_36610 >Feature sequence0975 >Feature sequence0976 >Feature sequence0977 750 373 gene locus_tag LOCUS_36620 750 373 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_36620 >Feature sequence0978 <1 727 gene locus_tag LOCUS_36630 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338794.1:branched chain amino acid aminotransferase 724 1644 gene locus_tag LOCUS_36640 gene ilvE2 724 1644 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_36640 >Feature sequence0979 >Feature sequence0980 285 2174 gene locus_tag LOCUS_36650 285 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 >Feature sequence0981 1345 2043 gene locus_tag LOCUS_36660 gene tmk 1345 2043 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RY40 protein_id gnl|my_center|LOCUS_36660 >Feature sequence0982 1699 572 gene locus_tag LOCUS_36670 gene modC 1699 572 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4C1 protein_id gnl|my_center|LOCUS_36670 2358 1696 gene locus_tag LOCUS_36680 2358 1696 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553595.1 protein_id gnl|my_center|LOCUS_36680 >Feature sequence0983 >Feature sequence0984 <1 805 gene locus_tag LOCUS_36690 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404041.1:sodium:proton antiporter >Feature sequence0985 39 1547 gene locus_tag LOCUS_36700 39 1547 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870741.1 protein_id gnl|my_center|LOCUS_36700 1550 2077 gene locus_tag LOCUS_36710 1550 2077 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786452.1 protein_id gnl|my_center|LOCUS_36710 >Feature sequence0986 1371 277 gene locus_tag LOCUS_36720 gene serC 1371 277 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQL3 protein_id gnl|my_center|LOCUS_36720 1465 2418 gene locus_tag LOCUS_36730 gene truB 1465 2418 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI4 protein_id gnl|my_center|LOCUS_36730 >Feature sequence0987 <1 1403 gene locus_tag LOCUS_36740 <1 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGY4:glutamyl-tRNA(Gln) amidotransferase subunit A >Feature sequence0988 1 258 gene locus_tag LOCUS_36750 1 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 1202 432 gene locus_tag LOCUS_36760 1202 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 1343 2110 gene locus_tag LOCUS_36770 1343 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 >Feature sequence0989 1032 400 gene locus_tag LOCUS_36780 1032 400 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027853.1 protein_id gnl|my_center|LOCUS_36780 >Feature sequence0990 705 1739 gene locus_tag LOCUS_36790 705 1739 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405282.1 protein_id gnl|my_center|LOCUS_36790 >Feature sequence0991 <2521 60 gene locus_tag LOCUS_36800 <2521 60 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029781.1:ATP-binding protein >Feature sequence0992 135 410 gene locus_tag LOCUS_36810 135 410 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688640.1 protein_id gnl|my_center|LOCUS_36810 1533 376 gene locus_tag LOCUS_36820 gene mnmA 1533 376 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A22 protein_id gnl|my_center|LOCUS_36820 1697 2035 gene locus_tag LOCUS_36830 1697 2035 CDS product UPF0092 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67295 protein_id gnl|my_center|LOCUS_36830 >Feature sequence0993 621 2375 gene locus_tag LOCUS_36840 621 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 >Feature sequence0994 >Feature sequence0995 >Feature sequence0996 249 659 gene locus_tag LOCUS_36850 249 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 656 973 gene locus_tag LOCUS_36860 656 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 970 1389 gene locus_tag LOCUS_36870 970 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 1386 2189 gene locus_tag LOCUS_36880 1386 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 >Feature sequence0997 773 1954 gene locus_tag LOCUS_36890 gene gcdH 773 1954 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036619.1 protein_id gnl|my_center|LOCUS_36890 >Feature sequence0998 259 426 gene locus_tag LOCUS_36900 259 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 1916 423 gene locus_tag LOCUS_36910 1916 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 <2497 1913 gene locus_tag LOCUS_36920 <2497 1913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393637.1:phosphohydrolase >Feature sequence0999 <1 1317 gene locus_tag LOCUS_36930 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257386.1:polysaccharide biosynthesis protein 1390 2274 gene locus_tag LOCUS_36940 1390 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 >Feature sequence1000 1553 657 gene locus_tag LOCUS_36950 1553 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 2184 1633 gene locus_tag LOCUS_36960 2184 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 >Feature sequence1001 2135 1002 gene locus_tag LOCUS_36970 gene fadI 2135 1002 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207047.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36970 >Feature sequence1002 <2486 192 gene locus_tag LOCUS_36980 <2486 192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387755.1:glycosyl transferase >Feature sequence1003 >Feature sequence1004 434 36 gene locus_tag LOCUS_36990 434 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 1189 704 gene locus_tag LOCUS_37000 1189 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 1664 1203 gene locus_tag LOCUS_37010 1664 1203 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119077.1 protein_id gnl|my_center|LOCUS_37010 2412 1684 gene locus_tag LOCUS_37020 2412 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 >Feature sequence1005 246 1793 gene locus_tag LOCUS_37030 246 1793 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_37030 >Feature sequence1006 >Feature sequence1007 368 1534 gene locus_tag LOCUS_37040 368 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 <2471 1547 gene locus_tag LOCUS_37050 <2471 1547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122845.1:iduronate-2-sulfatase >Feature sequence1008 1307 357 gene locus_tag LOCUS_37060 1307 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 1846 1304 gene locus_tag LOCUS_37070 gene mogA 1846 1304 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707146.1 protein_id gnl|my_center|LOCUS_37070 >Feature sequence1009 1840 254 gene locus_tag LOCUS_37080 1840 254 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038609.1 protein_id gnl|my_center|LOCUS_37080 >Feature sequence1010 417 1424 gene locus_tag LOCUS_37090 417 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 1421 2434 gene locus_tag LOCUS_37100 gene hpnA 1421 2434 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_37100 >Feature sequence1011 105 311 gene locus_tag LOCUS_37110 105 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 358 951 gene locus_tag LOCUS_37120 358 951 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_37120 948 2237 gene locus_tag LOCUS_37130 948 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 >Feature sequence1012 746 93 gene locus_tag LOCUS_37140 746 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 1566 1072 gene locus_tag LOCUS_37150 1566 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 <2465 1733 gene locus_tag LOCUS_37160 <2465 1733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707249.1:MFS transporter >Feature sequence1013 113 1498 gene locus_tag LOCUS_37170 113 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 2248 1529 gene locus_tag LOCUS_37180 2248 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 >Feature sequence1014 <1 988 gene locus_tag LOCUS_37190 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803855.1:glycosyl transferase >Feature sequence1015 <1 1944 gene locus_tag LOCUS_37200 <1 1944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000017090.1:type II secretion system protein GspD 1956 2378 gene locus_tag LOCUS_37210 1956 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 >Feature sequence1016 1652 414 gene locus_tag LOCUS_37220 1652 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 >Feature sequence1017 442 1797 gene locus_tag LOCUS_37230 442 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 <2441 1862 gene locus_tag LOCUS_37240 <2441 1862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WI98:glucokinase >Feature sequence1018 2252 789 gene locus_tag LOCUS_37250 gene phr 2252 789 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_37250 >Feature sequence1019 272 772 gene locus_tag LOCUS_37260 272 772 CDS product bile-acid 7-alpha-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727083.1 protein_id gnl|my_center|LOCUS_37260 2073 982 gene locus_tag LOCUS_37270 2073 982 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941225.1 protein_id gnl|my_center|LOCUS_37270 >Feature sequence1020 1010 48 gene locus_tag LOCUS_37280 gene desC 1010 48 CDS product delta 9 acyl-lipid fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_37280 1672 1085 gene locus_tag LOCUS_37290 1672 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 2352 1669 gene locus_tag LOCUS_37300 2352 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 >Feature sequence1021 171 971 gene locus_tag LOCUS_37310 171 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 >Feature sequence1022 1613 699 gene locus_tag LOCUS_37320 gene ftsY 1613 699 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y693 protein_id gnl|my_center|LOCUS_37320 >Feature sequence1023 >Feature sequence1024 2037 619 gene locus_tag LOCUS_37330 gene arsA 2037 619 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_37330 >Feature sequence1025 >Feature sequence1026 216 833 gene locus_tag LOCUS_37340 216 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 906 2408 gene locus_tag LOCUS_37350 906 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 >Feature sequence1027 >Feature sequence1028 <2419 1728 gene locus_tag LOCUS_37360 <2419 1728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113858.1:ABC transporter permease >Feature sequence1029 1008 25 gene locus_tag LOCUS_37370 1008 25 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948238.1 protein_id gnl|my_center|LOCUS_37370 1379 1005 gene locus_tag LOCUS_37380 1379 1005 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948237.1 protein_id gnl|my_center|LOCUS_37380 <2414 1486 gene locus_tag LOCUS_37390 <2414 1486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118914.1:membrane protein >Feature sequence1030 783 565 gene locus_tag LOCUS_37400 783 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 1543 917 gene locus_tag LOCUS_37410 1543 917 CDS product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_37410 >Feature sequence1031 122 1699 gene locus_tag LOCUS_37420 gene hutH 122 1699 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCB3 protein_id gnl|my_center|LOCUS_37420 >Feature sequence1032 703 1002 gene locus_tag LOCUS_37430 703 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 1102 1491 gene locus_tag LOCUS_37440 1102 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 1795 1550 gene locus_tag LOCUS_37450 1795 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 <2407 1792 gene locus_tag LOCUS_37460 <2407 1792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_231920.2:thiamin biosynthesis lipoprotein ApbE >Feature sequence1033 <1 837 gene locus_tag LOCUS_37470 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122037.1:chalcone synthase 1456 812 gene locus_tag LOCUS_37480 1456 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 1803 1480 gene locus_tag LOCUS_37490 1803 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 <2404 1881 gene locus_tag LOCUS_37500 <2404 1881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P6F5:7-carboxy-7-deazaguanine synthase >Feature sequence1034 101 979 gene locus_tag LOCUS_37510 101 979 CDS product acetyl-lysine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_37510 1181 1008 gene locus_tag LOCUS_37520 1181 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 >Feature sequence1035 >Feature sequence1036 >Feature sequence1037 >Feature sequence1038 1568 213 gene locus_tag LOCUS_37530 1568 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 >Feature sequence1039 <1 2358 gene locus_tag LOCUS_37540 <1 2358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333876.1:AP endonuclease >Feature sequence1040 1526 387 gene locus_tag LOCUS_37550 1526 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 >Feature sequence1041 >Feature sequence1042 >Feature sequence1043 1454 18 gene locus_tag LOCUS_37560 1454 18 CDS product benzoyl-CoA oxygenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230333.1 protein_id gnl|my_center|LOCUS_37560 <2381 1456 gene locus_tag LOCUS_37570 <2381 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083900.1:benzoyl-CoA-dihydrodiol lyase >Feature sequence1044 1874 756 gene locus_tag LOCUS_37580 1874 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 >Feature sequence1045 >Feature sequence1046 1611 547 gene locus_tag LOCUS_37590 1611 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403233.1 protein_id gnl|my_center|LOCUS_37590 2312 1608 gene locus_tag LOCUS_37600 2312 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 >Feature sequence1047 649 290 gene locus_tag LOCUS_37610 649 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 1945 800 gene locus_tag LOCUS_37620 1945 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 >Feature sequence1048 >Feature sequence1049 89 1144 gene locus_tag LOCUS_37630 gene lpxK 89 1144 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW7 protein_id gnl|my_center|LOCUS_37630 >Feature sequence1050 373 969 gene locus_tag LOCUS_37640 373 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 >Feature sequence1051 185 1255 gene locus_tag LOCUS_37650 185 1255 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870414.1 protein_id gnl|my_center|LOCUS_37650 >Feature sequence1052 <1 884 gene locus_tag LOCUS_37660 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387716.1:glycosyl transferase group 1 881 1930 gene locus_tag LOCUS_37670 881 1930 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_37670 >Feature sequence1053 <1 1821 gene locus_tag LOCUS_37680 <1 1821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933466.1:cation acetate symporter >Feature sequence1054 >Feature sequence1055 172 849 gene locus_tag LOCUS_37690 172 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 >Feature sequence1056 <1 634 gene locus_tag LOCUS_37700 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081558.1:twitching motility protein PilT 1505 639 gene locus_tag LOCUS_37710 gene aroK 1505 639 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VG9 protein_id gnl|my_center|LOCUS_37710 >Feature sequence1057 >Feature sequence1058 <1 1509 gene locus_tag LOCUS_37720 <1 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003118645.1:helicase >Feature sequence1059 >Feature sequence1060 <1 501 gene locus_tag LOCUS_37730 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RI52:RNA polymerase sigma factor 491 1453 gene locus_tag LOCUS_37740 491 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 >Feature sequence1061 <1 1430 gene locus_tag LOCUS_37750 <1 1430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942151.1:ABC transporter ATP-binding protein <2322 1443 gene locus_tag LOCUS_37760 <2322 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87LU2:pyruvate dehydrogenase E1 component >Feature sequence1062 2067 1054 gene locus_tag LOCUS_37770 2067 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 >Feature sequence1063 >Feature sequence1064 83 1240 gene locus_tag LOCUS_37780 gene thiH 83 1240 CDS product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_37780 <2311 1297 gene locus_tag LOCUS_37790 <2311 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q746U5:transketolase >Feature sequence1065 >Feature sequence1066 682 296 gene locus_tag LOCUS_37800 gene gcvH 682 296 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I04 protein_id gnl|my_center|LOCUS_37800 1455 844 gene locus_tag LOCUS_37810 1455 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 >Feature sequence1067 827 420 gene locus_tag LOCUS_37820 827 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 1700 945 gene locus_tag LOCUS_37830 1700 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 protein_id gnl|my_center|LOCUS_37830 >Feature sequence1068 1118 2083 gene locus_tag LOCUS_37840 1118 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 >Feature sequence1069 1138 605 gene locus_tag LOCUS_37850 1138 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 1862 1368 gene locus_tag LOCUS_37860 1862 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 >Feature sequence1070 1296 601 gene locus_tag LOCUS_37870 1296 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882802.1 protein_id gnl|my_center|LOCUS_37870 >Feature sequence1071 1299 61 gene locus_tag LOCUS_37880 1299 61 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 protein_id gnl|my_center|LOCUS_37880 >Feature sequence1072 1417 479 gene locus_tag LOCUS_37890 1417 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 <2285 1414 gene locus_tag LOCUS_37900 <2285 1414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118373.1:serine/threonine protein kinase >Feature sequence1073 >Feature sequence1074 601 927 gene locus_tag LOCUS_37910 601 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 1085 2005 gene locus_tag LOCUS_37920 1085 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 >Feature sequence1075 114 764 gene locus_tag LOCUS_37930 114 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 1295 783 gene locus_tag LOCUS_37940 1295 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 <2277 1448 gene locus_tag LOCUS_37950 <2277 1448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RT44:nuclease SbcCD subunit C >Feature sequence1076 <1 647 gene locus_tag LOCUS_37960 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UTK8:L-aspartate oxidase 644 1945 gene locus_tag LOCUS_37970 gene hflX 644 1945 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD7 protein_id gnl|my_center|LOCUS_37970 >Feature sequence1077 1383 706 gene locus_tag LOCUS_37980 gene lexA 1383 706 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31080 protein_id gnl|my_center|LOCUS_37980 1666 1463 gene locus_tag LOCUS_37990 1666 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 >Feature sequence1078 200 1144 gene locus_tag LOCUS_38000 200 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 >Feature sequence1079 <1 942 gene locus_tag LOCUS_38010 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124025.1:type II secretion system protein E 935 1801 gene locus_tag LOCUS_38020 935 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 >Feature sequence1080 <2261 1569 gene locus_tag LOCUS_38030 <2261 1569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387879.1:type II secretion system protein E >Feature sequence1081 <2251 926 gene locus_tag LOCUS_38040 <2251 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256545.1:peptidase S8 >Feature sequence1082 >Feature sequence1083 272 24 gene locus_tag LOCUS_38050 272 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 1694 357 gene locus_tag LOCUS_38060 1694 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 2179 1964 gene locus_tag LOCUS_38070 2179 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 >Feature sequence1084 <1 841 gene locus_tag LOCUS_38080 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943148.1:SAM-dependent methyltransferase 1934 852 gene locus_tag LOCUS_38090 1934 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 >Feature sequence1085 734 994 gene locus_tag LOCUS_38100 734 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 >Feature sequence1086 818 453 gene locus_tag LOCUS_38110 818 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 961 1422 gene locus_tag LOCUS_38120 961 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 1439 1978 gene locus_tag LOCUS_38130 1439 1978 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_38130 >Feature sequence1087 >Feature sequence1088 <1 1566 gene locus_tag LOCUS_38140 <1 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943603.1:bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase >Feature sequence1089 <1 563 gene locus_tag LOCUS_38150 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080979.1:serine/threonine protein phosphatase 1115 594 gene locus_tag LOCUS_38160 1115 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 1167 1946 gene locus_tag LOCUS_38170 1167 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 >Feature sequence1090 394 1281 gene locus_tag LOCUS_38180 394 1281 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143847.1 protein_id gnl|my_center|LOCUS_38180 >Feature sequence1091 >Feature sequence1092 403 1371 gene locus_tag LOCUS_38190 gene trpS 403 1371 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RGA3 protein_id gnl|my_center|LOCUS_38190 >Feature sequence1093 <2226 471 gene locus_tag LOCUS_38200 <2226 471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_638281.2:glycosyl transferase family protein >Feature sequence1094 >Feature sequence1095 >Feature sequence1096 >Feature sequence1097 >Feature sequence1098 3 353 gene locus_tag LOCUS_38210 3 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 429 896 gene locus_tag LOCUS_38220 gene phnB 429 896 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_38220 1026 1571 gene locus_tag LOCUS_38230 1026 1571 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0J2 protein_id gnl|my_center|LOCUS_38230 >Feature sequence1099 3 1259 gene locus_tag LOCUS_38240 3 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 >Feature sequence1100 691 1545 gene locus_tag LOCUS_38250 691 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 >Feature sequence1101 1586 2035 gene locus_tag LOCUS_38260 1586 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 >Feature sequence1102 1036 1377 gene locus_tag LOCUS_38270 1036 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 1394 1693 gene locus_tag LOCUS_38280 1394 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 >Feature sequence1103 256 1593 gene locus_tag LOCUS_38290 gene rpoA 256 1593 CDS product RNA polymerase subunit alpha domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328259.1 protein_id gnl|my_center|LOCUS_38290 >Feature sequence1104 1096 2181 gene locus_tag LOCUS_38300 1096 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 >Feature sequence1105 >Feature sequence1106 344 778 gene locus_tag LOCUS_38310 344 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 985 1269 gene locus_tag LOCUS_38320 985 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 1266 1697 gene locus_tag LOCUS_38330 1266 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 >Feature sequence1107 <1 1603 gene locus_tag LOCUS_38340 <1 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528520.1:AMP-dependent synthetase >Feature sequence1108 <1 637 gene locus_tag LOCUS_38350 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72CK1:phosphoglucosamine mutase 634 1344 gene locus_tag LOCUS_38360 634 1344 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_38360 1759 1376 gene locus_tag LOCUS_38370 1759 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 >Feature sequence1109 <1 577 gene locus_tag LOCUS_38380 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943781.1:tRNA pseudouridine synthase TruC 1250 591 gene locus_tag LOCUS_38390 1250 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 >Feature sequence1110 1184 1450 gene locus_tag LOCUS_38400 1184 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 >Feature sequence1111 <1 645 gene locus_tag LOCUS_38410 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903082.1:acyl-CoA dehydrogenase 784 948 gene locus_tag LOCUS_38420 784 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 1003 1518 gene locus_tag LOCUS_38430 1003 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38430 >Feature sequence1112 58 468 gene locus_tag LOCUS_38440 58 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 465 1040 gene locus_tag LOCUS_38450 465 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 1279 2133 gene locus_tag LOCUS_38460 1279 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 >Feature sequence1113 1930 1304 gene locus_tag LOCUS_38470 1930 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 >Feature sequence1114 >Feature sequence1115 747 541 gene locus_tag LOCUS_38480 747 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 722 1069 gene locus_tag LOCUS_38490 722 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 1175 2176 gene locus_tag LOCUS_38500 1175 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 >Feature sequence1116 <1 747 gene locus_tag LOCUS_38510 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFD0:dihydroorotase 1424 735 gene locus_tag LOCUS_38520 gene gpmA 1424 735 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS43 protein_id gnl|my_center|LOCUS_38520 >Feature sequence1117 322 1725 gene locus_tag LOCUS_38530 322 1725 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_38530 >Feature sequence1118 1415 615 gene locus_tag LOCUS_38540 1415 615 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_38540 2041 1412 gene locus_tag LOCUS_38550 2041 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 >Feature sequence1119 <1 814 gene locus_tag LOCUS_38560 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027746.1:GntR family transcriptional regulator 852 1748 gene locus_tag LOCUS_38570 gene pdxS 852 1748 CDS product pyridoxal 5'-phosphate synthase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L286 protein_id gnl|my_center|LOCUS_38570 >Feature sequence1120 >Feature sequence1121 <1 740 gene locus_tag LOCUS_38580 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FNN7:tRNA modification GTPase MnmE 881 1747 gene locus_tag LOCUS_38590 gene pilD 881 1747 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BJ8 protein_id gnl|my_center|LOCUS_38590 >Feature sequence1122 <1 693 gene locus_tag LOCUS_38600 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S012:protoheme IX farnesyltransferase 1138 722 gene locus_tag LOCUS_38610 1138 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 >Feature sequence1123 <1 1105 gene locus_tag LOCUS_38620 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868784.1:aminobenzoyl-glutamate transporter >Feature sequence1124 >Feature sequence1125 122 1039 gene locus_tag LOCUS_38630 122 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 1578 1153 gene locus_tag LOCUS_38640 1578 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 >Feature sequence1126 1701 763 gene locus_tag LOCUS_38650 1701 763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 protein_id gnl|my_center|LOCUS_38650 >Feature sequence1127 <1 593 gene locus_tag LOCUS_38660 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJG7:inosine-5'-monophosphate dehydrogenase >Feature sequence1128 106 552 gene locus_tag LOCUS_38670 106 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 549 1028 gene locus_tag LOCUS_38680 549 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 1025 1234 gene locus_tag LOCUS_38690 1025 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 1231 1431 gene locus_tag LOCUS_38700 1231 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 1438 1602 gene locus_tag LOCUS_38710 1438 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 1599 1949 gene locus_tag LOCUS_38720 1599 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 >Feature sequence1129 <1 646 gene locus_tag LOCUS_38730 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KFQ8:transcription termination factor Rho >Feature sequence1130 >Feature sequence1131 712 1674 gene locus_tag LOCUS_38740 gene mdh 712 1674 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV34 protein_id gnl|my_center|LOCUS_38740 >Feature sequence1132 >Feature sequence1133 <1 758 gene locus_tag LOCUS_38750 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117886.1:alkylhalidase 785 1318 gene locus_tag LOCUS_38760 785 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 >Feature sequence1134 >Feature sequence1135 >Feature sequence1136 >Feature sequence1137 1787 441 gene locus_tag LOCUS_38770 gene atoC 1787 441 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121461.1 protein_id gnl|my_center|LOCUS_38770 >Feature sequence1138 <2125 1285 gene locus_tag LOCUS_38780 <2125 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_296359.1:xanthine dehydrogenase, N-terminal subunit >Feature sequence1139 201 1358 gene locus_tag LOCUS_38790 201 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403294.1 protein_id gnl|my_center|LOCUS_38790 <2121 1331 gene locus_tag LOCUS_38800 <2121 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392759.1:heme d1 biosynthesis radical SAM protein NirJ2 >Feature sequence1140 >Feature sequence1141 <1 625 gene locus_tag LOCUS_38810 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037742.1:cell envelope biogenesis protein TonB >Feature sequence1142 >Feature sequence1143 <1 1577 gene locus_tag LOCUS_38820 <1 1577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URX8:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence1144 2076 1426 gene locus_tag LOCUS_38830 2076 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 >Feature sequence1145 >Feature sequence1146 768 862 gene locus_tag LOCUS_t00430 768 862 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1147 1705 683 gene locus_tag LOCUS_38840 1705 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 >Feature sequence1148 <2099 287 gene locus_tag LOCUS_38850 <2099 287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918824.1:acylase >Feature sequence1149 1937 480 gene locus_tag LOCUS_38860 1937 480 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087506.1 protein_id gnl|my_center|LOCUS_38860 >Feature sequence1150 1754 474 gene locus_tag LOCUS_38870 1754 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 >Feature sequence1151 620 51 gene locus_tag LOCUS_38880 620 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 1537 632 gene locus_tag LOCUS_38890 1537 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 1875 1534 gene locus_tag LOCUS_38900 1875 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 >Feature sequence1152 <1 1291 gene locus_tag LOCUS_38910 <1 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482957.1:aminoacyl-histidine dipeptidase >Feature sequence1153 1365 2018 gene locus_tag LOCUS_38920 1365 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 >Feature sequence1154 859 236 gene locus_tag LOCUS_38930 859 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 1123 1647 gene locus_tag LOCUS_38940 1123 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 >Feature sequence1155 1335 409 gene locus_tag LOCUS_38950 1335 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 <2081 1344 gene locus_tag LOCUS_38960 <2081 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000129068.1:bacillithiol biosynthesis deacetylase BshB2 >Feature sequence1156 <1 823 gene locus_tag LOCUS_38970 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CT13:dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex 894 1973 gene locus_tag LOCUS_38980 gene pdhD 894 1973 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEJ5 protein_id gnl|my_center|LOCUS_38980 >Feature sequence1157 509 1219 gene locus_tag LOCUS_38990 509 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 >Feature sequence1158 >Feature sequence1159 847 476 gene locus_tag LOCUS_39000 847 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124019.1 protein_id gnl|my_center|LOCUS_39000 >Feature sequence1160 1437 964 gene locus_tag LOCUS_39010 1437 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 1660 1430 gene locus_tag LOCUS_39020 1660 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 >Feature sequence1161 140 517 gene locus_tag LOCUS_39030 140 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 664 2040 gene locus_tag LOCUS_39040 664 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 >Feature sequence1162 1893 256 gene locus_tag LOCUS_39050 gene lnt 1893 256 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_39050 >Feature sequence1163 874 1548 gene locus_tag LOCUS_39060 gene nth 874 1548 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE9 protein_id gnl|my_center|LOCUS_39060 >Feature sequence1164 >Feature sequence1165 716 1168 gene locus_tag LOCUS_39070 gene codA 716 1168 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038585.1 protein_id gnl|my_center|LOCUS_39070 <2061 1214 gene locus_tag LOCUS_39080 <2061 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073343.1:DUF5009 domain-containing protein >Feature sequence1166 >Feature sequence1167 1422 1168 gene locus_tag LOCUS_39090 1422 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 >Feature sequence1168 >Feature sequence1169 741 232 gene locus_tag LOCUS_39100 741 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 1553 738 gene locus_tag LOCUS_39110 gene trmD 1553 738 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEX4 protein_id gnl|my_center|LOCUS_39110 >Feature sequence1170 601 1509 gene locus_tag LOCUS_39120 601 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 1509 1955 gene locus_tag LOCUS_39130 1509 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 >Feature sequence1171 1743 1654 gene locus_tag LOCUS_t00440 1743 1654 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1172 1505 786 gene locus_tag LOCUS_39140 1505 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 >Feature sequence1173 <1 915 gene locus_tag LOCUS_39150 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085644.1:MexH family multidrug efflux RND transporter periplasmic adaptor subunit 912 2036 gene locus_tag LOCUS_39160 912 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 >Feature sequence1174 1794 1342 gene locus_tag LOCUS_39170 1794 1342 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_39170 2042 1815 gene locus_tag LOCUS_39180 2042 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 >Feature sequence1175 >Feature sequence1176 >Feature sequence1177 183 641 gene locus_tag LOCUS_39190 gene nrdR 183 641 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33661 protein_id gnl|my_center|LOCUS_39190 >Feature sequence1178 1923 1153 gene locus_tag LOCUS_39200 1923 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 >Feature sequence1179 631 326 gene locus_tag LOCUS_39210 gene groES1 631 326 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W1D4 protein_id gnl|my_center|LOCUS_39210 1035 634 gene locus_tag LOCUS_39220 1035 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 >Feature sequence1180 <1 1358 gene locus_tag LOCUS_39230 <1 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259590.1:glycosyl transferase family 1 >Feature sequence1181 >Feature sequence1182 >Feature sequence1183 >Feature sequence1184 >Feature sequence1185 129 728 gene locus_tag LOCUS_39240 gene pgsA 129 728 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46322 protein_id gnl|my_center|LOCUS_39240 712 1164 gene locus_tag LOCUS_39250 gene pgpA 712 1164 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932028.1 protein_id gnl|my_center|LOCUS_39250 >Feature sequence1186 117 1109 gene locus_tag LOCUS_39260 117 1109 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_39260 <2021 1111 gene locus_tag LOCUS_39270 <2021 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141901.1:metalloenzyme >Feature sequence1187 >Feature sequence1188 <1 872 gene locus_tag LOCUS_39280 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DU6:glutamate--tRNA ligase 1008 1083 gene locus_tag LOCUS_t00450 1008 1083 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1548 1141 gene locus_tag LOCUS_39290 1548 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 >Feature sequence1189 945 745 gene locus_tag LOCUS_39300 gene thiS 945 745 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_39300 <2018 987 gene locus_tag LOCUS_39310 <2018 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S1I3:phosphoenolpyruvate carboxykinase [ATP] 1 >Feature sequence1190 <1 757 gene locus_tag LOCUS_39320 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776226.1:amidohydrolase 763 2007 gene locus_tag LOCUS_39330 763 2007 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230159.1 protein_id gnl|my_center|LOCUS_39330 >Feature sequence1191 778 1401 gene locus_tag LOCUS_39340 778 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 1453 1830 gene locus_tag LOCUS_39350 1453 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 >Feature sequence1192 705 1730 gene locus_tag LOCUS_39360 705 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 >Feature sequence1193 >Feature sequence1194 294 1178 gene locus_tag LOCUS_39370 294 1178 CDS product SpeB arginase/agmatinase/formimionoglutamate hydrolase SpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706521.1 protein_id gnl|my_center|LOCUS_39370 >Feature sequence1195 >Feature sequence1196 435 680 gene locus_tag LOCUS_39380 gene moaD 435 680 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDC0 protein_id gnl|my_center|LOCUS_39380 733 1167 gene locus_tag LOCUS_39390 gene moaE 733 1167 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730722.1 protein_id gnl|my_center|LOCUS_39390 1174 1986 gene locus_tag LOCUS_39400 gene fmt 1174 1986 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAR0 protein_id gnl|my_center|LOCUS_39400 >Feature sequence1197 >Feature sequence1198 >Feature sequence1199 1840 1520 gene locus_tag LOCUS_39410 1840 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 >Feature sequence1200 1644 466 gene locus_tag LOCUS_39420 1644 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 >Feature sequence1201 >Feature sequence1202 >Feature sequence1203 1390 809 gene locus_tag LOCUS_39430 1390 809 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LN3 protein_id gnl|my_center|LOCUS_39430 1887 1417 gene locus_tag LOCUS_39440 1887 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 >Feature sequence1204 >Feature sequence1205 62 742 gene locus_tag LOCUS_39450 62 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 892 1578 gene locus_tag LOCUS_39460 892 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_39460 >Feature sequence1206 <1 715 gene locus_tag LOCUS_39470 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203283.1:dihydrofolate reductase 1156 728 gene locus_tag LOCUS_39480 1156 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 >Feature sequence1207 276 350 gene locus_tag LOCUS_t00460 276 350 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 784 548 gene locus_tag LOCUS_39490 784 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 1279 893 gene locus_tag LOCUS_39500 1279 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 <1974 1276 gene locus_tag LOCUS_39510 <1974 1276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P55639:putative integrase/recombinase y4rF >Feature sequence1208 25 1311 gene locus_tag LOCUS_39520 gene eno 25 1311 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCM4 protein_id gnl|my_center|LOCUS_39520 <1971 1339 gene locus_tag LOCUS_39530 <1971 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226719.1:oxidoreductase >Feature sequence1209 >Feature sequence1210 462 1877 gene locus_tag LOCUS_39540 462 1877 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259590.1 protein_id gnl|my_center|LOCUS_39540 >Feature sequence1211 823 1743 gene locus_tag LOCUS_39550 823 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 >Feature sequence1212 >Feature sequence1213 809 1423 gene locus_tag LOCUS_39560 809 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 1434 1868 gene locus_tag LOCUS_39570 1434 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 >Feature sequence1214 >Feature sequence1215 <1 757 gene locus_tag LOCUS_39580 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WNV5:DNA ligase B 1654 782 gene locus_tag LOCUS_39590 1654 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 >Feature sequence1216 >Feature sequence1217 >Feature sequence1218 >Feature sequence1219 <1 667 gene locus_tag LOCUS_39600 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812203.1:1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase >Feature sequence1220 1427 510 gene locus_tag LOCUS_39610 1427 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 >Feature sequence1221 1058 1807 gene locus_tag LOCUS_39620 1058 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 >Feature sequence1222 >Feature sequence1223 293 1663 gene locus_tag LOCUS_39630 293 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 >Feature sequence1224 1095 913 gene locus_tag LOCUS_39640 1095 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 1549 1268 gene locus_tag LOCUS_39650 1549 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 >Feature sequence1225 >Feature sequence1226 1252 1698 gene locus_tag LOCUS_39660 1252 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120443.1 protein_id gnl|my_center|LOCUS_39660 >Feature sequence1227 983 1465 gene locus_tag LOCUS_39670 983 1465 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_39670 >Feature sequence1228 >Feature sequence1229 1342 59 gene locus_tag LOCUS_39680 1342 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 <1932 1339 gene locus_tag LOCUS_39690 <1932 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259590.1:glycosyl transferase family 1 >Feature sequence1230 509 1684 gene locus_tag LOCUS_39700 gene iscS 509 1684 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_39700 >Feature sequence1231 <1 511 gene locus_tag LOCUS_39710 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938761.1:peptidase >Feature sequence1232 650 1261 gene locus_tag LOCUS_39720 650 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 >Feature sequence1233 >Feature sequence1234 1010 30 gene locus_tag LOCUS_39730 1010 30 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106521.1 protein_id gnl|my_center|LOCUS_39730 <1925 1022 gene locus_tag LOCUS_39740 <1925 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532461.1:Zn-dependent hydrolase >Feature sequence1235 >Feature sequence1236 <1 535 gene locus_tag LOCUS_39750 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123703.1:DNA-directed RNA polymerase sigma-70 factor >Feature sequence1237 1235 390 gene locus_tag LOCUS_39760 1235 390 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836184.1 protein_id gnl|my_center|LOCUS_39760 <1917 1284 gene locus_tag LOCUS_39770 <1917 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403656.1:serine hydrolase >Feature sequence1238 1915 725 gene locus_tag LOCUS_39780 1915 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 >Feature sequence1239 1258 680 gene locus_tag LOCUS_39790 1258 680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860736.1 protein_id gnl|my_center|LOCUS_39790 >Feature sequence1240 377 1534 gene locus_tag LOCUS_39800 377 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 >Feature sequence1241 1737 337 gene locus_tag LOCUS_39810 1737 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_39810 >Feature sequence1242 >Feature sequence1243 1006 1515 gene locus_tag LOCUS_39820 gene def 1006 1515 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63916 protein_id gnl|my_center|LOCUS_39820 >Feature sequence1244 342 67 gene locus_tag LOCUS_39830 342 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 842 339 gene locus_tag LOCUS_39840 842 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 >Feature sequence1245 <1 1056 gene locus_tag LOCUS_39850 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226913.1:pyruvate oxidase 1053 1868 gene locus_tag LOCUS_39860 1053 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 >Feature sequence1246 150 974 gene locus_tag LOCUS_39870 150 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 >Feature sequence1247 368 1168 gene locus_tag LOCUS_39880 gene yveL 368 1168 CDS product putative tyrosine-protein kinase YveL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71051 protein_id gnl|my_center|LOCUS_39880 >Feature sequence1248 <1900 873 gene locus_tag LOCUS_39890 <1900 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HIC9:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence1249 >Feature sequence1250 55 1413 gene locus_tag LOCUS_39900 gene xseA 55 1413 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJR3 protein_id gnl|my_center|LOCUS_39900 1410 1700 gene locus_tag LOCUS_39910 1410 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 >Feature sequence1251 >Feature sequence1252 >Feature sequence1253 510 1559 gene locus_tag LOCUS_39920 510 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 >Feature sequence1254 3 356 gene locus_tag LOCUS_39930 3 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 688 1437 gene locus_tag LOCUS_39940 gene whiG 688 1437 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17211 protein_id gnl|my_center|LOCUS_39940 1441 1698 gene locus_tag LOCUS_39950 1441 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 >Feature sequence1255 >Feature sequence1256 <1 1380 gene locus_tag LOCUS_39960 <1 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966604.1:amidohydrolase >Feature sequence1257 1152 403 gene locus_tag LOCUS_39970 1152 403 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_39970 1436 1149 gene locus_tag LOCUS_39980 1436 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 1714 1433 gene locus_tag LOCUS_39990 1714 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 >Feature sequence1258 171 1445 gene locus_tag LOCUS_40000 171 1445 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124024.1 protein_id gnl|my_center|LOCUS_40000 >Feature sequence1259 1202 663 gene locus_tag LOCUS_40010 gene rpsH 1202 663 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW29 protein_id gnl|my_center|LOCUS_40010 <1880 1379 gene locus_tag LOCUS_40020 <1880 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PAG7:ribonuclease R >Feature sequence1260 1 885 gene locus_tag LOCUS_40030 1 885 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5A4 protein_id gnl|my_center|LOCUS_40030 >Feature sequence1261 >Feature sequence1262 451 1071 gene locus_tag LOCUS_40040 451 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 >Feature sequence1263 1179 211 gene locus_tag LOCUS_40050 1179 211 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_40050 >Feature sequence1264 <1878 898 gene locus_tag LOCUS_40060 <1878 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228367.1:two-component sensor histidine kinase >Feature sequence1265 >Feature sequence1266 1308 226 gene locus_tag LOCUS_40070 1308 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 >Feature sequence1267 348 1790 gene locus_tag LOCUS_40080 348 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 >Feature sequence1268 1029 481 gene locus_tag LOCUS_40090 1029 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 <1866 1040 gene locus_tag LOCUS_40100 <1866 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250730.1:oligopeptide transporter, OPT family >Feature sequence1269 >Feature sequence1270 >Feature sequence1271 1759 797 gene locus_tag LOCUS_40110 1759 797 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390103.1 protein_id gnl|my_center|LOCUS_40110 >Feature sequence1272 <1858 1273 gene locus_tag LOCUS_40120 <1858 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83BY5:ATP-dependent zinc metalloprotease FtsH >Feature sequence1273 1238 156 gene locus_tag LOCUS_40130 1238 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 >Feature sequence1274 1034 438 gene locus_tag LOCUS_40140 1034 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 <1857 1064 gene locus_tag LOCUS_40150 <1857 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256769.1:mevalonate kinase >Feature sequence1275 82 1344 gene locus_tag LOCUS_40160 82 1344 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942352.1 protein_id gnl|my_center|LOCUS_40160 >Feature sequence1276 >Feature sequence1277 1556 66 gene locus_tag LOCUS_40170 1556 66 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_40170 1717 1782 gene locus_tag LOCUS_t00470 1717 1782 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1278 <1 779 gene locus_tag LOCUS_40180 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118565.1:SAM-dependent methyltransferase 776 1357 gene locus_tag LOCUS_40190 776 1357 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036053.1 protein_id gnl|my_center|LOCUS_40190 >Feature sequence1279 >Feature sequence1280 1326 1706 gene locus_tag LOCUS_40200 1326 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 >Feature sequence1281 316 1332 gene locus_tag LOCUS_40210 gene yfbL 316 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76482 protein_id gnl|my_center|LOCUS_40210 >Feature sequence1282 <1 1257 gene locus_tag LOCUS_40220 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976109.1:carbamoyltransferase 1337 1495 gene locus_tag LOCUS_40230 1337 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 >Feature sequence1283 >Feature sequence1284 <1 1089 gene locus_tag LOCUS_40240 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258599.1:stage II sporulation protein E >Feature sequence1285 1223 606 gene locus_tag LOCUS_40250 1223 606 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705587.1 protein_id gnl|my_center|LOCUS_40250 <1834 1273 gene locus_tag LOCUS_40260 <1834 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038388.1:serine/threonine protein kinase >Feature sequence1286 <1 1685 gene locus_tag LOCUS_40270 <1 1685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941985.1:RND transporter >Feature sequence1287 135 1253 gene locus_tag LOCUS_40280 135 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 <1830 1276 gene locus_tag LOCUS_40290 <1830 1276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403348.1:peptidase S9 >Feature sequence1288 >Feature sequence1289 >Feature sequence1290 734 1150 gene locus_tag LOCUS_40300 734 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 >Feature sequence1291 >Feature sequence1292 >Feature sequence1293 >Feature sequence1294 1816 434 gene locus_tag LOCUS_40310 1816 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 >Feature sequence1295 >Feature sequence1296 119 1603 gene locus_tag LOCUS_40320 gene mtlY 119 1603 CDS product xylulose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122708.1 protein_id gnl|my_center|LOCUS_40320 >Feature sequence1297 <1 649 gene locus_tag LOCUS_40330 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530227.1:UDP-N-acetyl-D-mannosaminuronic acid transferase >Feature sequence1298 >Feature sequence1299 685 362 gene locus_tag LOCUS_40340 685 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 >Feature sequence1300 >Feature sequence1301 1790 1545 gene locus_tag LOCUS_40350 1790 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 >Feature sequence1302 436 523 gene locus_tag LOCUS_t00480 436 523 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 549 1235 gene locus_tag LOCUS_40360 gene trmB 549 1235 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM56 protein_id gnl|my_center|LOCUS_40360 >Feature sequence1303 <1787 80 gene locus_tag LOCUS_40370 <1787 80 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E2J0:Lon protease >Feature sequence1304 272 895 gene locus_tag LOCUS_40380 272 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 >Feature sequence1305 1155 583 gene locus_tag LOCUS_40390 1155 583 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_40390 >Feature sequence1306 >Feature sequence1307 231 707 gene locus_tag LOCUS_40400 231 707 CDS product low molecular weight phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104559.1 protein_id gnl|my_center|LOCUS_40400 704 1663 gene locus_tag LOCUS_40410 704 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 >Feature sequence1308 1 516 gene locus_tag LOCUS_40420 1 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 513 1160 gene locus_tag LOCUS_40430 513 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122333.1 protein_id gnl|my_center|LOCUS_40430 >Feature sequence1309 >Feature sequence1310 >Feature sequence1311 >Feature sequence1312 1765 635 gene locus_tag LOCUS_40440 1765 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 >Feature sequence1313 562 846 gene locus_tag LOCUS_40450 562 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 843 1238 gene locus_tag LOCUS_40460 gene vapC 843 1238 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WE5 protein_id gnl|my_center|LOCUS_40460 <1762 1247 gene locus_tag LOCUS_40470 <1762 1247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RFW2:threonylcarbamoyl-AMP synthase >Feature sequence1314 >Feature sequence1315 7 1632 gene locus_tag LOCUS_40480 7 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 >Feature sequence1316 >Feature sequence1317 >Feature sequence1318 <1744 312 gene locus_tag LOCUS_40490 <1744 312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704563.1:putative coenzyme PQQ synthesis protein E PqqE >Feature sequence1319 <1743 795 gene locus_tag LOCUS_40500 <1743 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118005.1:serine/threonine protein kinase >Feature sequence1320 349 1536 gene locus_tag LOCUS_40510 349 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 >Feature sequence1321 1136 36 gene locus_tag LOCUS_40520 1136 36 CDS product L-lysine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947080.1 protein_id gnl|my_center|LOCUS_40520 >Feature sequence1322 640 101 gene locus_tag LOCUS_40530 640 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 1426 734 gene locus_tag LOCUS_40540 1426 734 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038753.1 protein_id gnl|my_center|LOCUS_40540 >Feature sequence1323 >Feature sequence1324 >Feature sequence1325 >Feature sequence1326 <1 886 gene locus_tag LOCUS_40550 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YKD3:Lon protease >Feature sequence1327 585 220 gene locus_tag LOCUS_40560 585 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265538.1 protein_id gnl|my_center|LOCUS_40560 >Feature sequence1328 >Feature sequence1329 227 1237 gene locus_tag LOCUS_40570 227 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 1228 1668 gene locus_tag LOCUS_40580 1228 1668 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017192.1 protein_id gnl|my_center|LOCUS_40580 >Feature sequence1330 >Feature sequence1331 >Feature sequence1332 >Feature sequence1333 <1 594 gene locus_tag LOCUS_40590 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329383.1:twitching motility protein PilT >Feature sequence1334 666 1430 gene locus_tag LOCUS_40600 666 1430 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_40600 >Feature sequence1335 <1 942 gene locus_tag LOCUS_40610 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257167.1:glycosyl transferase family 1 >Feature sequence1336 >Feature sequence1337 <1 550 gene locus_tag LOCUS_40620 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072024.1:RND transporter MFP subunit >Feature sequence1338 >Feature sequence1339 659 1531 gene locus_tag LOCUS_40630 659 1531 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_40630 >Feature sequence1340 <1703 669 gene locus_tag LOCUS_40640 <1703 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S550:DNA helicase >Feature sequence1341 1335 475 gene locus_tag LOCUS_40650 1335 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 >Feature sequence1342 >Feature sequence1343 1276 1584 gene locus_tag LOCUS_40660 1276 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 >Feature sequence1344 758 57 gene locus_tag LOCUS_40670 758 57 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G62 protein_id gnl|my_center|LOCUS_40670 >Feature sequence1345 <1 1530 gene locus_tag LOCUS_40680 <1 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031533.1:serine/threonine protein kinase >Feature sequence1346 241 1497 gene locus_tag LOCUS_40690 241 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 >Feature sequence1347 >Feature sequence1348 854 1678 gene locus_tag LOCUS_40700 854 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 >Feature sequence1349 >Feature sequence1350 1429 53 gene locus_tag LOCUS_40710 1429 53 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_40710 >Feature sequence1351 <1 756 gene locus_tag LOCUS_40720 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947081.1:aldehyde dehydrogenase >Feature sequence1352 1457 678 gene locus_tag LOCUS_40730 1457 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 >Feature sequence1353 18 785 gene locus_tag LOCUS_40740 18 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 >Feature sequence1354 1348 923 gene locus_tag LOCUS_40750 1348 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263497.1 protein_id gnl|my_center|LOCUS_40750 >Feature sequence1355 1107 820 gene locus_tag LOCUS_40760 1107 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 >Feature sequence1356 <1 518 gene locus_tag LOCUS_40770 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203832.1:peptidase 667 1587 gene locus_tag LOCUS_40780 667 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 >Feature sequence1357 122 925 gene locus_tag LOCUS_40790 122 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 >Feature sequence1358 >Feature sequence1359 <1666 788 gene locus_tag LOCUS_40800 <1666 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937909.1:ArsR family transcriptional regulator >Feature sequence1360 808 1476 gene locus_tag LOCUS_40810 808 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 >Feature sequence1361 >Feature sequence1362 <1 739 gene locus_tag LOCUS_40820 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72AW6:chaperone protein ClpB 1537 779 gene locus_tag LOCUS_40830 gene glpF 1537 779 CDS product putative glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1E3 protein_id gnl|my_center|LOCUS_40830 >Feature sequence1363 461 1330 gene locus_tag LOCUS_40840 461 1330 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_40840 1346 1576 gene locus_tag LOCUS_40850 1346 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 >Feature sequence1364 495 1037 gene locus_tag LOCUS_40860 495 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 >Feature sequence1365 <1 1640 gene locus_tag LOCUS_40870 <1 1640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943656.1:acyl-[ACP]--phospholipid O-acyltransferase >Feature sequence1366 421 1116 gene locus_tag LOCUS_40880 421 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40880 >Feature sequence1367 309 719 gene locus_tag LOCUS_40890 309 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 >Feature sequence1368 1199 588 gene locus_tag LOCUS_40900 1199 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 >Feature sequence1369 >Feature sequence1370 566 84 gene locus_tag LOCUS_40910 566 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 >Feature sequence1371 >Feature sequence1372 >Feature sequence1373 196 1611 gene locus_tag LOCUS_40920 gene degP 196 1611 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_40920 >Feature sequence1374 901 230 gene locus_tag LOCUS_40930 901 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 >Feature sequence1375 >Feature sequence1376 163 630 gene locus_tag LOCUS_40940 163 630 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_40940 627 1499 gene locus_tag LOCUS_40950 gene panC 627 1499 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM60 protein_id gnl|my_center|LOCUS_40950 >Feature sequence1377 1630 1133 gene locus_tag LOCUS_40960 1630 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 >Feature sequence1378 <1 1121 gene locus_tag LOCUS_40970 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530338.1:LysR family transcriptional regulator >Feature sequence1379 >Feature sequence1380 5 415 gene locus_tag LOCUS_40980 5 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 >Feature sequence1381 1472 729 gene locus_tag LOCUS_40990 1472 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 >Feature sequence1382 <1622 498 gene locus_tag LOCUS_41000 <1622 498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886312.1:phosphomannomutase >Feature sequence1383 <1 1489 gene locus_tag LOCUS_41010 <1 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024198.1:phycocyanobilin lyase >Feature sequence1384 <1621 340 gene locus_tag LOCUS_41020 <1621 340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O07610:long-chain-fatty-acid--CoA ligase >Feature sequence1385 <1620 622 gene locus_tag LOCUS_41030 <1620 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P61735:L-seryl-tRNA(Sec) selenium transferase >Feature sequence1386 >Feature sequence1387 >Feature sequence1388 31 933 gene locus_tag LOCUS_41040 31 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 >Feature sequence1389 >Feature sequence1390 >Feature sequence1391 219 1265 gene locus_tag LOCUS_41050 gene fbp1 219 1265 CDS product fructose-1,6-bisphosphatase class 1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2I3 protein_id gnl|my_center|LOCUS_41050 >Feature sequence1392 >Feature sequence1393 >Feature sequence1394 <1607 443 gene locus_tag LOCUS_41060 <1607 443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UN01:protein translocase subunit SecY >Feature sequence1395 82 1302 gene locus_tag LOCUS_41070 82 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 >Feature sequence1396 <1 1279 gene locus_tag LOCUS_41080 <1 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q56242:UvrABC system protein A >Feature sequence1397 892 308 gene locus_tag LOCUS_41090 892 308 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4S9 protein_id gnl|my_center|LOCUS_41090 1593 904 gene locus_tag LOCUS_41100 1593 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 >Feature sequence1398 >Feature sequence1399 >Feature sequence1400 1561 494 gene locus_tag LOCUS_41110 1561 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_41110 >Feature sequence1401 >Feature sequence1402 >Feature sequence1403 <1 615 gene locus_tag LOCUS_41120 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403626.1:6-phosphogluconolactonase >Feature sequence1404 <1572 970 gene locus_tag LOCUS_41130 <1572 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003569800.1:phosphomevalonate kinase >Feature sequence1405 187 14 gene locus_tag LOCUS_41140 187 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 369 1088 gene locus_tag LOCUS_41150 369 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 >Feature sequence1406 >Feature sequence1407 <1 745 gene locus_tag LOCUS_41160 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003644334.1:3-oxoacyl-ACP reductase 1451 1113 gene locus_tag LOCUS_41170 1451 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 >Feature sequence1408 >Feature sequence1409 >Feature sequence1410 165 1199 gene locus_tag LOCUS_41180 165 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 >Feature sequence1411 >Feature sequence1412 521 1306 gene locus_tag LOCUS_41190 521 1306 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259732.1 protein_id gnl|my_center|LOCUS_41190 >Feature sequence1413 <1 736 gene locus_tag LOCUS_41200 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E1Q7:methionine--tRNA ligase 1460 762 gene locus_tag LOCUS_41210 1460 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 >Feature sequence1414 311 1054 gene locus_tag LOCUS_41220 gene coaX 311 1054 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72F93 protein_id gnl|my_center|LOCUS_41220 >Feature sequence1415 >Feature sequence1416 1314 397 gene locus_tag LOCUS_41230 1314 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 >Feature sequence1417 >Feature sequence1418 >Feature sequence1419 <1531 587 gene locus_tag LOCUS_41240 <1531 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TJ3:tricorn protease >Feature sequence1420 >Feature sequence1421 <1524 64 gene locus_tag LOCUS_41250 <1524 64 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z6T0:putative periplasmic serine endoprotease DegP-like protein >Feature sequence1422 378 539 gene locus_tag LOCUS_41260 378 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 561 839 gene locus_tag LOCUS_41270 561 839 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723760.1 protein_id gnl|my_center|LOCUS_41270 <1523 928 gene locus_tag LOCUS_41280 <1523 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941192.1:TIGR02757 family protein >Feature sequence1423 <1516 538 gene locus_tag LOCUS_41290 <1516 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969697.1:MFS transporter >Feature sequence1424 >Feature sequence1425 <1 1274 gene locus_tag LOCUS_41300 <1 1274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107338.1:prolyl oligopeptidase >Feature sequence1426 1227 568 gene locus_tag LOCUS_41310 gene psd 1227 568 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTK9 protein_id gnl|my_center|LOCUS_41310 >Feature sequence1427 520 95 gene locus_tag LOCUS_41320 520 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_41320 >Feature sequence1428 1383 463 gene locus_tag LOCUS_41330 gene thrB 1383 463 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_41330