>Feature sequence001 3277 1646 gene locus_tag LOCUS_00010 gene purH 3277 1646 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4D3 protein_id gnl|my_center|LOCUS_00010 4533 3418 gene locus_tag LOCUS_00020 gene proB 4533 3418 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJA8 protein_id gnl|my_center|LOCUS_00020 5036 4530 gene locus_tag LOCUS_00030 gene aroK-2 5036 4530 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728T1 protein_id gnl|my_center|LOCUS_00030 5677 5222 gene locus_tag LOCUS_00040 5677 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5976 7475 gene locus_tag LOCUS_00050 5976 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9203 7587 gene locus_tag LOCUS_00060 9203 7587 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBN4 protein_id gnl|my_center|LOCUS_00060 <10851 9265 gene locus_tag LOCUS_00070 <10851 9265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767250.1:glycosyl hydrolase family 88 >Feature sequence002 479 156 gene locus_tag LOCUS_00080 479 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 463 8772 gene locus_tag LOCUS_00090 463 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 >Feature sequence003 2416 1169 gene locus_tag LOCUS_00100 2416 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 3892 2567 gene locus_tag LOCUS_00110 3892 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 4612 4028 gene locus_tag LOCUS_00120 4612 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 5492 4806 gene locus_tag LOCUS_00130 5492 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 6728 5517 gene locus_tag LOCUS_00140 6728 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 7906 6773 gene locus_tag LOCUS_00150 7906 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 8824 8054 gene locus_tag LOCUS_00160 8824 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 <9609 9102 gene locus_tag LOCUS_00170 <9609 9102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z7E4:protein RecA >Feature sequence004 3019 5103 gene locus_tag LOCUS_00180 3019 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_00180 5487 5152 gene locus_tag LOCUS_00190 5487 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 5678 5484 gene locus_tag LOCUS_00200 5678 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 5881 6081 gene locus_tag LOCUS_00210 5881 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 6368 7492 gene locus_tag LOCUS_00220 gene dnaJ 6368 7492 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM96 protein_id gnl|my_center|LOCUS_00220 7527 8081 gene locus_tag LOCUS_00230 7527 8081 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_00230 8068 8316 gene locus_tag LOCUS_00240 8068 8316 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325406.1 protein_id gnl|my_center|LOCUS_00240 8319 9179 gene locus_tag LOCUS_00250 gene tyrA 8319 9179 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_00250 >Feature sequence005 3779 3369 gene locus_tag LOCUS_00260 gene rplL 3779 3369 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI01 protein_id gnl|my_center|LOCUS_00260 4517 4002 gene locus_tag LOCUS_00270 gene rplJ 4517 4002 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324458.1 protein_id gnl|my_center|LOCUS_00270 5211 4528 gene locus_tag LOCUS_00280 gene rplA 5211 4528 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI03 protein_id gnl|my_center|LOCUS_00280 5749 5321 gene locus_tag LOCUS_00290 gene rplK 5749 5321 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88YX0 protein_id gnl|my_center|LOCUS_00290 6611 5838 gene locus_tag LOCUS_00300 6611 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 6993 6595 gene locus_tag LOCUS_00310 6993 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 7418 7344 gene locus_tag LOCUS_t00010 7418 7344 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7633 7466 gene locus_tag LOCUS_00320 gene rpmG 7633 7466 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66217 protein_id gnl|my_center|LOCUS_00320 8898 7696 gene locus_tag LOCUS_00330 gene tuf 8898 7696 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ0 protein_id gnl|my_center|LOCUS_00330 >Feature sequence006 <1 654 gene locus_tag LOCUS_00340 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975508.1:UDP-N-acetyl-D-glucosamine dehydrogenase 902 2644 gene locus_tag LOCUS_00350 902 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 2641 3024 gene locus_tag LOCUS_00360 2641 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 3517 3035 gene locus_tag LOCUS_00370 3517 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 4900 3590 gene locus_tag LOCUS_00380 4900 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 6117 4897 gene locus_tag LOCUS_00390 6117 4897 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_00390 6215 7324 gene locus_tag LOCUS_00400 6215 7324 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122967.1 protein_id gnl|my_center|LOCUS_00400 >Feature sequence007 694 2574 gene locus_tag LOCUS_00410 694 2574 CDS product Na/Pi cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_00410 2730 4085 gene locus_tag LOCUS_00420 gene pfkA 2730 4085 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AD6 protein_id gnl|my_center|LOCUS_00420 7184 4305 gene locus_tag LOCUS_00430 gene uvrA 7184 4305 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180Q9 protein_id gnl|my_center|LOCUS_00430 >Feature sequence008 1680 754 gene locus_tag LOCUS_00440 1680 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 2625 1726 gene locus_tag LOCUS_00450 2625 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 3300 2773 gene locus_tag LOCUS_00460 3300 2773 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765089.1 protein_id gnl|my_center|LOCUS_00460 4948 3494 gene locus_tag LOCUS_00470 4948 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 5243 5821 gene locus_tag LOCUS_00480 5243 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 7182 5911 gene locus_tag LOCUS_00490 gene ahcY 7182 5911 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEG8 protein_id gnl|my_center|LOCUS_00490 >Feature sequence009 532 2001 gene locus_tag LOCUS_00500 532 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 1998 2999 gene locus_tag LOCUS_00510 1998 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 3043 3969 gene locus_tag LOCUS_00520 3043 3969 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_00520 4621 4175 gene locus_tag LOCUS_00530 gene gspG 4621 4175 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_00530 5124 4735 gene locus_tag LOCUS_00540 5124 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 5550 5149 gene locus_tag LOCUS_00550 5550 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 <6910 5684 gene locus_tag LOCUS_00560 <6910 5684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257164.1:protease >Feature sequence010 355 1767 gene locus_tag LOCUS_00570 355 1767 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WS5 protein_id gnl|my_center|LOCUS_00570 2271 1861 gene locus_tag LOCUS_00580 2271 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 2640 2284 gene locus_tag LOCUS_00590 gene rplS 2640 2284 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI13 protein_id gnl|my_center|LOCUS_00590 3378 2662 gene locus_tag LOCUS_00600 3378 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 3612 3400 gene locus_tag LOCUS_00610 3612 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 4043 5869 gene locus_tag LOCUS_00620 4043 5869 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268134.1 protein_id gnl|my_center|LOCUS_00620 <6592 5885 gene locus_tag LOCUS_00630 <6592 5885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763077.1:bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase >Feature sequence011 158 1714 gene locus_tag LOCUS_00640 gene metG 158 1714 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AW7 protein_id gnl|my_center|LOCUS_00640 1711 2097 gene locus_tag LOCUS_00650 1711 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 2109 2618 gene locus_tag LOCUS_00660 2109 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 2671 4899 gene locus_tag LOCUS_00670 2671 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 5418 4918 gene locus_tag LOCUS_00680 5418 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 6195 5587 gene locus_tag LOCUS_00690 gene clpP 6195 5587 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6Q5 protein_id gnl|my_center|LOCUS_00690 >Feature sequence012 1209 274 gene locus_tag LOCUS_00700 1209 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 1840 3255 gene locus_tag LOCUS_00710 gene dnaA 1840 3255 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81JD5 protein_id gnl|my_center|LOCUS_00710 3845 3354 gene locus_tag LOCUS_00720 gene aspG 3845 3354 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_00720 3953 4762 gene locus_tag LOCUS_00730 3953 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 5833 4766 gene locus_tag LOCUS_00740 5833 4766 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXK8 protein_id gnl|my_center|LOCUS_00740 >Feature sequence013 1521 247 gene locus_tag LOCUS_00750 1521 247 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121595.1 protein_id gnl|my_center|LOCUS_00750 2597 1572 gene locus_tag LOCUS_00760 2597 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 2698 3738 gene locus_tag LOCUS_00770 2698 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00770 3764 4276 gene locus_tag LOCUS_00780 3764 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00780 4478 5218 gene locus_tag LOCUS_00790 4478 5218 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326094.1 protein_id gnl|my_center|LOCUS_00790 6246 5308 gene locus_tag LOCUS_00800 6246 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 >Feature sequence014 46 3231 gene locus_tag LOCUS_00810 46 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 3379 4653 gene locus_tag LOCUS_00820 3379 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 4744 4893 gene locus_tag LOCUS_00830 4744 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 >Feature sequence015 1146 1775 gene locus_tag LOCUS_00840 1146 1775 CDS product sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_00840 1739 2677 gene locus_tag LOCUS_00850 1739 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 2749 3030 gene locus_tag LOCUS_00860 2749 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 4767 2953 gene locus_tag LOCUS_00870 4767 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 5506 4826 gene locus_tag LOCUS_00880 5506 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 >Feature sequence016 2223 541 gene locus_tag LOCUS_00890 2223 541 CDS product Tat pathway signal sequence inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109362.1 protein_id gnl|my_center|LOCUS_00890 4137 2410 gene locus_tag LOCUS_00900 4137 2410 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107895.1 protein_id gnl|my_center|LOCUS_00900 >Feature sequence017 855 974 gene locus_tag LOCUS_00910 855 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 2496 1351 gene locus_tag LOCUS_00920 2496 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 2660 3115 gene locus_tag LOCUS_00930 2660 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 3108 3584 gene locus_tag LOCUS_00940 3108 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 4202 3585 gene locus_tag LOCUS_00950 gene aat 4202 3585 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJT7 protein_id gnl|my_center|LOCUS_00950 4401 5303 gene locus_tag LOCUS_00960 4401 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 >Feature sequence018 1546 323 gene locus_tag LOCUS_00970 1546 323 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941337.1 protein_id gnl|my_center|LOCUS_00970 2205 1648 gene locus_tag LOCUS_00980 2205 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 3916 2798 gene locus_tag LOCUS_00990 3916 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 3994 4230 gene locus_tag LOCUS_01000 3994 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 5016 4303 gene locus_tag LOCUS_01010 5016 4303 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_01010 >Feature sequence019 <1 3446 gene locus_tag LOCUS_01020 <1 3446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122409.1:9-O-acetylesterase >Feature sequence020 846 1268 gene locus_tag LOCUS_01030 846 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 1268 2506 gene locus_tag LOCUS_01040 gene iscS 1268 2506 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S28 protein_id gnl|my_center|LOCUS_01040 2594 3064 gene locus_tag LOCUS_01050 gene iscU 2594 3064 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57074 protein_id gnl|my_center|LOCUS_01050 3066 3425 gene locus_tag LOCUS_01060 3066 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 3441 3911 gene locus_tag LOCUS_01070 gene rnhA 3441 3911 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UU3 protein_id gnl|my_center|LOCUS_01070 <5753 3959 gene locus_tag LOCUS_01080 <5753 3959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021597.1:DNA topoisomerase VI subunit B >Feature sequence021 1 357 gene locus_tag LOCUS_01090 1 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 542 778 gene locus_tag LOCUS_01100 gene acpP 542 778 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY2 protein_id gnl|my_center|LOCUS_01100 872 2122 gene locus_tag LOCUS_01110 gene fabF 872 2122 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY0 protein_id gnl|my_center|LOCUS_01110 4384 2390 gene locus_tag LOCUS_01120 4384 2390 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007748760.1 protein_id gnl|my_center|LOCUS_01120 4450 4683 gene locus_tag LOCUS_01130 4450 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 <5731 4694 gene locus_tag LOCUS_01140 <5731 4694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938513.1:MATE family efflux transporter >Feature sequence022 <1 1303 gene locus_tag LOCUS_01150 <1 1303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q00512:type II secretion system protein E 1315 2613 gene locus_tag LOCUS_01160 1315 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 4518 3487 gene locus_tag LOCUS_01170 4518 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 >Feature sequence023 <1 664 gene locus_tag LOCUS_01180 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3HKN7:2-dehydro-3-deoxyphosphooctonate aldolase 925 1317 gene locus_tag LOCUS_01190 925 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 2318 1362 gene locus_tag LOCUS_01200 2318 1362 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707869.1 protein_id gnl|my_center|LOCUS_01200 2437 3720 gene locus_tag LOCUS_01210 2437 3720 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_01210 4068 3805 gene locus_tag LOCUS_01220 gene rpmE2 4068 3805 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JU1 protein_id gnl|my_center|LOCUS_01220 4220 4133 gene locus_tag LOCUS_t00020 4220 4133 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence024 772 2088 gene locus_tag LOCUS_01230 772 2088 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120681.1 protein_id gnl|my_center|LOCUS_01230 2102 4471 gene locus_tag LOCUS_01240 2102 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 >Feature sequence025 2012 870 gene locus_tag LOCUS_01250 2012 870 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_01250 3040 2015 gene locus_tag LOCUS_01260 gene yacI 3040 2015 CDS product protein-arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV3 protein_id gnl|my_center|LOCUS_01260 3669 3040 gene locus_tag LOCUS_01270 3669 3040 CDS product excinuclease Uvr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357604.1 protein_id gnl|my_center|LOCUS_01270 4857 3730 gene locus_tag LOCUS_01280 4857 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 5250 4966 gene locus_tag LOCUS_01290 5250 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 5534 5247 gene locus_tag LOCUS_01300 5534 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 >Feature sequence026 <1 1260 gene locus_tag LOCUS_01310 <1 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URX8:phosphoribosylformylglycinamidine synthase subunit PurL 1395 1847 gene locus_tag LOCUS_01320 gene usp-2 1395 1847 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E46 protein_id gnl|my_center|LOCUS_01320 3264 1849 gene locus_tag LOCUS_01330 3264 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 4254 3274 gene locus_tag LOCUS_01340 4254 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_01340 5356 4265 gene locus_tag LOCUS_01350 5356 4265 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945802.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence027 169 843 gene locus_tag LOCUS_01360 169 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 3183 850 gene locus_tag LOCUS_01370 3183 850 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGX9 protein_id gnl|my_center|LOCUS_01370 3749 3276 gene locus_tag LOCUS_01380 3749 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 4559 3762 gene locus_tag LOCUS_01390 4559 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 >Feature sequence028 942 22 gene locus_tag LOCUS_01400 942 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 1615 935 gene locus_tag LOCUS_01410 1615 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 1797 1612 gene locus_tag LOCUS_01420 1797 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 2777 1797 gene locus_tag LOCUS_01430 2777 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 3654 2890 gene locus_tag LOCUS_01440 3654 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 4438 3635 gene locus_tag LOCUS_01450 4438 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 <5260 4476 gene locus_tag LOCUS_01460 <5260 4476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392090.1:NAD+ synthase >Feature sequence029 499 1236 gene locus_tag LOCUS_01470 499 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 1671 1237 gene locus_tag LOCUS_01480 1671 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 3250 1661 gene locus_tag LOCUS_01490 3250 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 3773 3240 gene locus_tag LOCUS_01500 3773 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_01500 >Feature sequence030 863 441 gene locus_tag LOCUS_01510 863 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 2718 874 gene locus_tag LOCUS_01520 2718 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 3335 2766 gene locus_tag LOCUS_01530 gene sigK 3335 2766 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316410.1 protein_id gnl|my_center|LOCUS_01530 4479 3433 gene locus_tag LOCUS_01540 gene mtnA 4479 3433 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF90 protein_id gnl|my_center|LOCUS_01540 4632 4811 gene locus_tag LOCUS_01550 gene csrA 4632 4811 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG38 protein_id gnl|my_center|LOCUS_01550 >Feature sequence031 <1 1248 gene locus_tag LOCUS_01560 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119046.1:NADH-dependent dehydrogenase 1258 2685 gene locus_tag LOCUS_01570 1258 2685 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_01570 2703 3704 gene locus_tag LOCUS_01580 2703 3704 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020204.1 protein_id gnl|my_center|LOCUS_01580 3825 4177 gene locus_tag LOCUS_tm00010 3825 4177 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence032 2096 1092 gene locus_tag LOCUS_01590 2096 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 3347 2106 gene locus_tag LOCUS_01600 3347 2106 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_01600 3525 4961 gene locus_tag LOCUS_01610 gene miaB 3525 4961 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLW0 protein_id gnl|my_center|LOCUS_01610 >Feature sequence033 1594 365 gene locus_tag LOCUS_01620 1594 365 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_01620 1726 3009 gene locus_tag LOCUS_01630 1726 3009 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022607.1 protein_id gnl|my_center|LOCUS_01630 3029 3706 gene locus_tag LOCUS_01640 3029 3706 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942483.1 protein_id gnl|my_center|LOCUS_01640 4175 3885 gene locus_tag LOCUS_01650 4175 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 >Feature sequence034 1075 2037 gene locus_tag LOCUS_01660 1075 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 3365 2130 gene locus_tag LOCUS_01670 3365 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 <5006 3918 gene locus_tag LOCUS_01680 <5006 3918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941243.1:pyruvate, phosphate dikinase >Feature sequence035 403 1356 gene locus_tag LOCUS_01690 gene htrB 403 1356 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121326.1 protein_id gnl|my_center|LOCUS_01690 1547 2233 gene locus_tag LOCUS_01700 1547 2233 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478827.1 protein_id gnl|my_center|LOCUS_01700 3074 2274 gene locus_tag LOCUS_01710 3074 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 4360 3077 gene locus_tag LOCUS_01720 gene proA 4360 3077 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN73 protein_id gnl|my_center|LOCUS_01720 4519 4594 gene locus_tag LOCUS_t00030 4519 4594 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence036 1127 870 gene locus_tag LOCUS_01730 1127 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 3028 1124 gene locus_tag LOCUS_01740 gene dxs 3028 1124 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIB9 protein_id gnl|my_center|LOCUS_01740 3964 3074 gene locus_tag LOCUS_01750 gene ispA 3964 3074 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525142.1 protein_id gnl|my_center|LOCUS_01750 4182 4385 gene locus_tag LOCUS_01760 4182 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 >Feature sequence037 358 909 gene locus_tag LOCUS_01770 358 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01770 922 1770 gene locus_tag LOCUS_01780 922 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01780 1736 2620 gene locus_tag LOCUS_01790 gene murB 1736 2620 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK77 protein_id gnl|my_center|LOCUS_01790 2661 3581 gene locus_tag LOCUS_01800 gene ddlB 2661 3581 CDS product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9G7 protein_id gnl|my_center|LOCUS_01800 3591 4622 gene locus_tag LOCUS_01810 3591 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 >Feature sequence038 2962 80 gene locus_tag LOCUS_01820 gene mfd 2962 80 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQN7 protein_id gnl|my_center|LOCUS_01820 4056 2968 gene locus_tag LOCUS_01830 gene queA 4056 2968 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019178.1 protein_id gnl|my_center|LOCUS_01830 >Feature sequence039 <1 827 gene locus_tag LOCUS_01840 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UP75:phenylalanine--tRNA ligase alpha subunit 932 2491 gene locus_tag LOCUS_01850 gene guaA 932 2491 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFS3 protein_id gnl|my_center|LOCUS_01850 <4843 2561 gene locus_tag LOCUS_01860 <4843 2561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89FI4:histidine kinase >Feature sequence040 1881 2534 gene locus_tag LOCUS_01870 gene rhaD 1881 2534 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88S52 protein_id gnl|my_center|LOCUS_01870 2655 3362 gene locus_tag LOCUS_01880 2655 3362 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416112.1 protein_id gnl|my_center|LOCUS_01880 4117 3374 gene locus_tag LOCUS_01890 4117 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 >Feature sequence041 919 1776 gene locus_tag LOCUS_01900 919 1776 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_01900 1808 2854 gene locus_tag LOCUS_01910 1808 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 2873 4645 gene locus_tag LOCUS_01920 2873 4645 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_01920 >Feature sequence042 1808 996 gene locus_tag LOCUS_01930 1808 996 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141322.1 protein_id gnl|my_center|LOCUS_01930 4054 1808 gene locus_tag LOCUS_01940 4054 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 <4796 4110 gene locus_tag LOCUS_01950 <4796 4110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865292.1:[FeFe] hydrogenase H-cluster radical SAM maturase HydG >Feature sequence043 2705 1512 gene locus_tag LOCUS_01960 2705 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 3712 2729 gene locus_tag LOCUS_01970 gene hldD 3712 2729 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIA5 protein_id gnl|my_center|LOCUS_01970 >Feature sequence044 2018 969 gene locus_tag LOCUS_01980 gene tsaD 2018 969 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CP0 protein_id gnl|my_center|LOCUS_01980 <4593 2128 gene locus_tag LOCUS_01990 <4593 2128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UQV4:chromosome partition protein Smc >Feature sequence045 2519 354 gene locus_tag LOCUS_02000 2519 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 3099 2614 gene locus_tag LOCUS_02010 3099 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 3681 3289 gene locus_tag LOCUS_02020 3681 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 >Feature sequence046 2114 105 gene locus_tag LOCUS_02030 2114 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 2427 3311 gene locus_tag LOCUS_02040 gene ilvE 2427 3311 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_02040 3768 3379 gene locus_tag LOCUS_02050 3768 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 >Feature sequence047 786 433 gene locus_tag LOCUS_02060 786 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 878 1396 gene locus_tag LOCUS_02070 878 1396 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 protein_id gnl|my_center|LOCUS_02070 1399 2199 gene locus_tag LOCUS_02080 1399 2199 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191253.1 protein_id gnl|my_center|LOCUS_02080 2374 2292 gene locus_tag LOCUS_t00040 2374 2292 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2727 3611 gene locus_tag LOCUS_02090 gene rsmA 2727 3611 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIR4 protein_id gnl|my_center|LOCUS_02090 >Feature sequence048 1936 1322 gene locus_tag LOCUS_02100 1936 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142945.1 protein_id gnl|my_center|LOCUS_02100 3975 2140 gene locus_tag LOCUS_02110 3975 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_02110 >Feature sequence049 <1 1037 gene locus_tag LOCUS_02120 <1 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942899.1:3-deoxy-D-manno-octulosonic acid transferase 1201 2820 gene locus_tag LOCUS_02130 gene hcp 1201 2820 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7H3 protein_id gnl|my_center|LOCUS_02130 <4425 3089 gene locus_tag LOCUS_02140 <4425 3089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DA3:histidine kinase >Feature sequence050 677 231 gene locus_tag LOCUS_02150 gene rplO 677 231 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y447 protein_id gnl|my_center|LOCUS_02150 1186 674 gene locus_tag LOCUS_02160 gene rpsE 1186 674 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN03 protein_id gnl|my_center|LOCUS_02160 1564 1199 gene locus_tag LOCUS_02170 gene rplR 1564 1199 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPP2 protein_id gnl|my_center|LOCUS_02170 2242 1676 gene locus_tag LOCUS_02180 gene rplF 2242 1676 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46786 protein_id gnl|my_center|LOCUS_02180 2659 2261 gene locus_tag LOCUS_02190 gene rpsH 2659 2261 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MSZ6 protein_id gnl|my_center|LOCUS_02190 2857 2672 gene locus_tag LOCUS_02200 gene rpsZ 2857 2672 CDS product 30S ribosomal protein S14 type Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PLY4 protein_id gnl|my_center|LOCUS_02200 3413 2868 gene locus_tag LOCUS_02210 gene rplE 3413 2868 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_02210 3761 3426 gene locus_tag LOCUS_02220 gene rplX 3761 3426 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CI78 protein_id gnl|my_center|LOCUS_02220 4150 3761 gene locus_tag LOCUS_02230 gene rplN 4150 3761 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN10 protein_id gnl|my_center|LOCUS_02230 >Feature sequence051 <1 741 gene locus_tag LOCUS_02240 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q56307:beta-galactosidase 769 1491 gene locus_tag LOCUS_02250 gene lolD2 769 1491 CDS product lipoprotein-releasing system ATP-binding protein LolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPK3 protein_id gnl|my_center|LOCUS_02250 1631 4171 gene locus_tag LOCUS_02260 1631 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 >Feature sequence052 1260 559 gene locus_tag LOCUS_02270 gene queC 1260 559 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW9 protein_id gnl|my_center|LOCUS_02270 3620 1293 gene locus_tag LOCUS_02280 gene priA 3620 1293 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFQ0 protein_id gnl|my_center|LOCUS_02280 <4379 3652 gene locus_tag LOCUS_02290 <4379 3652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545106.1:2-hydroxyglutaryl-CoA dehydratase activator >Feature sequence053 2984 969 gene locus_tag LOCUS_02300 gene pheT 2984 969 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP77 protein_id gnl|my_center|LOCUS_02300 3339 4094 gene locus_tag LOCUS_02310 3339 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 >Feature sequence054 2496 3830 gene locus_tag LOCUS_02320 gene dnaA 2496 3830 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q839Z5 protein_id gnl|my_center|LOCUS_02320 >Feature sequence055 <1 1277 gene locus_tag LOCUS_02330 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UK64:argininosuccinate lyase 1457 2524 gene locus_tag LOCUS_02340 gene lpxD 1457 2524 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW8 protein_id gnl|my_center|LOCUS_02340 2521 4179 gene locus_tag LOCUS_02350 2521 4179 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023977.1 protein_id gnl|my_center|LOCUS_02350 >Feature sequence056 <1 663 gene locus_tag LOCUS_02360 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022974.1:12,18-didecarboxysiroheme deacetylase 719 1447 gene locus_tag LOCUS_02370 719 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 2938 1688 gene locus_tag LOCUS_02380 2938 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 4100 3180 gene locus_tag LOCUS_02390 4100 3180 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122966.1 protein_id gnl|my_center|LOCUS_02390 >Feature sequence057 1428 595 gene locus_tag LOCUS_02400 1428 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 2319 1564 gene locus_tag LOCUS_02410 2319 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 2696 2316 gene locus_tag LOCUS_02420 2696 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 4255 2696 gene locus_tag LOCUS_02430 4255 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 >Feature sequence058 1194 1661 gene locus_tag LOCUS_02440 1194 1661 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880874.1 protein_id gnl|my_center|LOCUS_02440 1658 3970 gene locus_tag LOCUS_02450 1658 3970 CDS product putative membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54101 protein_id gnl|my_center|LOCUS_02450 >Feature sequence059 936 1604 gene locus_tag LOCUS_02460 936 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 1601 3100 gene locus_tag LOCUS_02470 1601 3100 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_02470 >Feature sequence060 739 17 gene locus_tag LOCUS_02480 739 17 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_02480 1410 736 gene locus_tag LOCUS_02490 gene cmk1 1410 736 CDS product cytidylate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43892 protein_id gnl|my_center|LOCUS_02490 1522 1608 gene locus_tag LOCUS_t00050 1522 1608 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3128 1725 gene locus_tag LOCUS_02500 gene oadB 3128 1725 CDS product putative oxaloacetate decarboxylase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTU5 protein_id gnl|my_center|LOCUS_02500 <4218 3185 gene locus_tag LOCUS_02510 <4218 3185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932515.1:oxaloacetate decarboxylase subunit alpha >Feature sequence061 809 141 gene locus_tag LOCUS_02520 809 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 1916 834 gene locus_tag LOCUS_02530 gene rpoA 1916 834 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC5 protein_id gnl|my_center|LOCUS_02530 2693 2070 gene locus_tag LOCUS_02540 gene rpsD 2693 2070 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80373 protein_id gnl|my_center|LOCUS_02540 3191 2820 gene locus_tag LOCUS_02550 gene rpsK 3191 2820 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFS4 protein_id gnl|my_center|LOCUS_02550 3577 3194 gene locus_tag LOCUS_02560 gene rpsM 3577 3194 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY2 protein_id gnl|my_center|LOCUS_02560 >Feature sequence062 1963 1604 gene locus_tag LOCUS_02570 1963 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 >Feature sequence063 2263 1202 gene locus_tag LOCUS_02580 gene mnmA 2263 1202 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A22 protein_id gnl|my_center|LOCUS_02580 2841 2503 gene locus_tag LOCUS_02590 2841 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 3707 2853 gene locus_tag LOCUS_02600 3707 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 4106 3933 gene locus_tag LOCUS_02610 4106 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 >Feature sequence064 2642 1149 gene locus_tag LOCUS_02620 2642 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 >Feature sequence065 2160 1954 gene locus_tag LOCUS_02630 2160 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 2264 3217 gene locus_tag LOCUS_02640 2264 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 3445 3747 gene locus_tag LOCUS_02650 3445 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 >Feature sequence066 1491 1342 gene locus_tag LOCUS_02660 1491 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 1787 3301 gene locus_tag LOCUS_02670 1787 3301 CDS product UPF0371 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYM2 protein_id gnl|my_center|LOCUS_02670 >Feature sequence067 1450 398 gene locus_tag LOCUS_02680 1450 398 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_02680 2188 1499 gene locus_tag LOCUS_02690 2188 1499 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_02690 3105 2326 gene locus_tag LOCUS_02700 3105 2326 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_02700 3904 3197 gene locus_tag LOCUS_02710 3904 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 >Feature sequence068 1890 751 gene locus_tag LOCUS_02720 1890 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 3038 1887 gene locus_tag LOCUS_02730 gene xylR 3038 1887 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338851.1 protein_id gnl|my_center|LOCUS_02730 3247 4005 gene locus_tag LOCUS_02740 3247 4005 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_02740 >Feature sequence069 2011 536 gene locus_tag LOCUS_02750 gene arsA 2011 536 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_02750 3676 2144 gene locus_tag LOCUS_02760 3676 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 >Feature sequence070 80 643 gene locus_tag LOCUS_02770 80 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 731 1438 gene locus_tag LOCUS_02780 731 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 1461 2342 gene locus_tag LOCUS_02790 1461 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_02790 2345 2923 gene locus_tag LOCUS_02800 gene gmk 2345 2923 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ7 protein_id gnl|my_center|LOCUS_02800 2968 3198 gene locus_tag LOCUS_02810 2968 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 3294 3899 gene locus_tag LOCUS_02820 3294 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 >Feature sequence071 231 1688 gene locus_tag LOCUS_02830 gene der 231 1688 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URJ8 protein_id gnl|my_center|LOCUS_02830 3171 2587 gene locus_tag LOCUS_02840 3171 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 3950 3360 gene locus_tag LOCUS_02850 3950 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 >Feature sequence072 1871 456 gene locus_tag LOCUS_02860 1871 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 3197 1887 gene locus_tag LOCUS_02870 3197 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 >Feature sequence073 >Feature sequence074 3886 953 gene locus_tag LOCUS_02880 3886 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 >Feature sequence075 1884 466 gene locus_tag LOCUS_02890 gene uxaC 1884 466 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIC6 protein_id gnl|my_center|LOCUS_02890 3357 1897 gene locus_tag LOCUS_02900 3357 1897 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P10 protein_id gnl|my_center|LOCUS_02900 <3951 3433 gene locus_tag LOCUS_02910 <3951 3433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZU94:pyrophosphate--fructose 6-phosphate 1-phosphotransferase >Feature sequence076 417 124 gene locus_tag LOCUS_02920 417 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 1093 494 gene locus_tag LOCUS_02930 1093 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 1370 2002 gene locus_tag LOCUS_02940 1370 2002 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_02940 2350 2985 gene locus_tag LOCUS_02950 2350 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02950 >Feature sequence077 268 1317 gene locus_tag LOCUS_02960 268 1317 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_02960 1330 1968 gene locus_tag LOCUS_02970 1330 1968 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379064.1 protein_id gnl|my_center|LOCUS_02970 1961 3472 gene locus_tag LOCUS_02980 1961 3472 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887996.1 protein_id gnl|my_center|LOCUS_02980 >Feature sequence078 758 234 gene locus_tag LOCUS_02990 758 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 2125 3393 gene locus_tag LOCUS_03000 2125 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 >Feature sequence079 <1 1747 gene locus_tag LOCUS_03010 <1 1747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333785.1:B12-binding domain-containing radical SAM protein 1744 2250 gene locus_tag LOCUS_03020 1744 2250 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870450.1 protein_id gnl|my_center|LOCUS_03020 2480 2716 gene locus_tag LOCUS_03030 2480 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 3190 2735 gene locus_tag LOCUS_03040 3190 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 >Feature sequence080 1943 939 gene locus_tag LOCUS_03050 1943 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 3018 2332 gene locus_tag LOCUS_03060 3018 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 3685 2996 gene locus_tag LOCUS_03070 3685 2996 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_03070 3924 3682 gene locus_tag LOCUS_03080 3924 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence081 1283 282 gene locus_tag LOCUS_03090 1283 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 1569 1384 gene locus_tag LOCUS_03100 1569 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 1709 2578 gene locus_tag LOCUS_03110 gene zupT 1709 2578 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GP0 protein_id gnl|my_center|LOCUS_03110 2704 3006 gene locus_tag LOCUS_03120 2704 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 3490 3795 gene locus_tag LOCUS_03130 3490 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence082 280 1473 gene locus_tag LOCUS_03140 gene xylR 280 1473 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338851.1 protein_id gnl|my_center|LOCUS_03140 1531 2544 gene locus_tag LOCUS_03150 gene galE 1531 2544 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071815.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence083 1528 194 gene locus_tag LOCUS_03160 gene slr0309 1528 194 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118415.1 protein_id gnl|my_center|LOCUS_03160 1951 1586 gene locus_tag LOCUS_03170 1951 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 2785 2234 gene locus_tag LOCUS_03180 gene rplI 2785 2234 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKV4 protein_id gnl|my_center|LOCUS_03180 3059 2805 gene locus_tag LOCUS_03190 gene rpsR 3059 2805 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181R4 protein_id gnl|my_center|LOCUS_03190 3669 3124 gene locus_tag LOCUS_03200 3669 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 >Feature sequence084 2684 432 gene locus_tag LOCUS_03210 2684 432 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388680.1 protein_id gnl|my_center|LOCUS_03210 <3790 2771 gene locus_tag LOCUS_03220 <3790 2771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119131.1:glycosidase >Feature sequence085 >Feature sequence086 289 1719 gene locus_tag LOCUS_03230 289 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 >Feature sequence087 931 14 gene locus_tag LOCUS_03240 931 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 >Feature sequence088 <1 3673 gene locus_tag LOCUS_03250 <1 3673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118422.1:general secretion pathway protein GspD >Feature sequence089 524 1567 gene locus_tag LOCUS_03260 gene moxR 524 1567 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_03260 1603 2550 gene locus_tag LOCUS_03270 1603 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_03270 >Feature sequence090 <1 714 gene locus_tag LOCUS_03280 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942254.1:RND transporter 788 1723 gene locus_tag LOCUS_03290 788 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 <3738 2441 gene locus_tag LOCUS_03300 <3738 2441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Y4I4:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence091 2013 3212 gene locus_tag LOCUS_03310 2013 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 >Feature sequence092 35 3178 gene locus_tag LOCUS_03320 35 3178 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence093 1268 138 gene locus_tag LOCUS_03330 1268 138 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785425.1 protein_id gnl|my_center|LOCUS_03330 2263 1286 gene locus_tag LOCUS_03340 gene trpS 2263 1286 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1Z8 protein_id gnl|my_center|LOCUS_03340 3617 2343 gene locus_tag LOCUS_03350 gene murA 3617 2343 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726D3 protein_id gnl|my_center|LOCUS_03350 >Feature sequence094 2159 1056 gene locus_tag LOCUS_03360 2159 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764776.1 protein_id gnl|my_center|LOCUS_03360 2983 2180 gene locus_tag LOCUS_03370 2983 2180 CDS product ubiquinone biosynthesis protein UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933409.1 protein_id gnl|my_center|LOCUS_03370 >Feature sequence095 1117 2253 gene locus_tag LOCUS_03380 1117 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 2632 3318 gene locus_tag LOCUS_03390 2632 3318 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence096 1633 1139 gene locus_tag LOCUS_03400 1633 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 2859 1843 gene locus_tag LOCUS_03410 gene nqrF 2859 1843 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJ92 protein_id gnl|my_center|LOCUS_03410 3427 2843 gene locus_tag LOCUS_03420 3427 2843 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_03420 >Feature sequence097 2563 296 gene locus_tag LOCUS_03430 2563 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 <3674 3078 gene locus_tag LOCUS_03440 <3674 3078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118653.1:iduronate-2-sulfatase >Feature sequence098 1210 428 gene locus_tag LOCUS_03450 gene truA 1210 428 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EL1 protein_id gnl|my_center|LOCUS_03450 1683 1207 gene locus_tag LOCUS_03460 gene tadA 1683 1207 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MGL9 protein_id gnl|my_center|LOCUS_03460 1857 1687 gene locus_tag LOCUS_03470 1857 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 2100 1888 gene locus_tag LOCUS_03480 2100 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 3229 2315 gene locus_tag LOCUS_03490 gene rnfB 3229 2315 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355995.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence099 >Feature sequence100 2082 220 gene locus_tag LOCUS_03500 2082 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 2527 2204 gene locus_tag LOCUS_03510 2527 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816325.1 protein_id gnl|my_center|LOCUS_03510 3525 2524 gene locus_tag LOCUS_03520 gene ahbD 3525 2524 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_03520 >Feature sequence101 2854 1352 gene locus_tag LOCUS_03530 2854 1352 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202061.1 protein_id gnl|my_center|LOCUS_03530 >Feature sequence102 767 354 gene locus_tag LOCUS_03540 767 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 1476 742 gene locus_tag LOCUS_03550 1476 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 2359 1556 gene locus_tag LOCUS_03560 2359 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence103 >Feature sequence104 107 787 gene locus_tag LOCUS_03570 107 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 903 2282 gene locus_tag LOCUS_03580 903 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 2288 3202 gene locus_tag LOCUS_03590 2288 3202 CDS product cobalamin synthesis protein P47K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974948.1 protein_id gnl|my_center|LOCUS_03590 >Feature sequence105 619 29 gene locus_tag LOCUS_03600 619 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 757 1848 gene locus_tag LOCUS_03610 gene purM 757 1848 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HE4 protein_id gnl|my_center|LOCUS_03610 1916 3124 gene locus_tag LOCUS_03620 gene carA 1916 3124 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP3 protein_id gnl|my_center|LOCUS_03620 >Feature sequence106 979 491 gene locus_tag LOCUS_03630 979 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 1503 976 gene locus_tag LOCUS_03640 1503 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 2024 1500 gene locus_tag LOCUS_03650 2024 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 2663 2055 gene locus_tag LOCUS_03660 2663 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 3115 2726 gene locus_tag LOCUS_03670 3115 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 3340 3265 gene locus_tag LOCUS_t00060 3340 3265 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence107 914 114 gene locus_tag LOCUS_03680 914 114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_03680 2047 917 gene locus_tag LOCUS_03690 2047 917 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_03690 2113 2574 gene locus_tag LOCUS_03700 2113 2574 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_03700 2567 3016 gene locus_tag LOCUS_03710 2567 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 >Feature sequence108 <1 976 gene locus_tag LOCUS_03720 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785073.1:glycoside hydrolase family 36 1085 1414 gene locus_tag LOCUS_03730 gene trxA 1085 1414 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBF6 protein_id gnl|my_center|LOCUS_03730 >Feature sequence109 1514 930 gene locus_tag LOCUS_03740 1514 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 2110 1541 gene locus_tag LOCUS_03750 2110 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 >Feature sequence110 994 1176 gene locus_tag LOCUS_03760 994 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 1190 2071 gene locus_tag LOCUS_03770 gene xerD 1190 2071 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAJ8 protein_id gnl|my_center|LOCUS_03770 2461 2979 gene locus_tag LOCUS_03780 2461 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 >Feature sequence111 >Feature sequence112 <1 936 gene locus_tag LOCUS_03790 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038153.1:xylanase 1006 2439 gene locus_tag LOCUS_03800 gene arsA 1006 2439 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_03800 <3486 2477 gene locus_tag LOCUS_03810 <3486 2477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255987.1:glycosyl transferase family 1 >Feature sequence113 345 1385 gene locus_tag LOCUS_03820 345 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 2444 1485 gene locus_tag LOCUS_03830 2444 1485 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 protein_id gnl|my_center|LOCUS_03830 >Feature sequence114 <1 1353 gene locus_tag LOCUS_03840 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206613.1:heme-binding protein 1388 2956 gene locus_tag LOCUS_03850 1388 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 >Feature sequence115 365 141 gene locus_tag LOCUS_03860 365 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 1352 513 gene locus_tag LOCUS_03870 gene dapF 1352 513 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FS5 protein_id gnl|my_center|LOCUS_03870 2261 1470 gene locus_tag LOCUS_03880 gene whiG 2261 1470 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFV6 protein_id gnl|my_center|LOCUS_03880 >Feature sequence116 2 571 gene locus_tag LOCUS_03890 2 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 578 1636 gene locus_tag LOCUS_03900 gene rfaF 578 1636 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_03900 1638 2225 gene locus_tag LOCUS_03910 1638 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 2227 2784 gene locus_tag LOCUS_03920 2227 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence117 353 1018 gene locus_tag LOCUS_03930 353 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2743 1022 gene locus_tag LOCUS_03940 2743 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 >Feature sequence118 2469 1198 gene locus_tag LOCUS_03950 2469 1198 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808246.1 protein_id gnl|my_center|LOCUS_03950 <3424 2632 gene locus_tag LOCUS_03960 <3424 2632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804069.1:oxidoreductase >Feature sequence119 426 1364 gene locus_tag LOCUS_03970 426 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 1418 2635 gene locus_tag LOCUS_03980 1418 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 >Feature sequence120 167 829 gene locus_tag LOCUS_03990 167 829 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 protein_id gnl|my_center|LOCUS_03990 857 1366 gene locus_tag LOCUS_04000 857 1366 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_04000 1388 2602 gene locus_tag LOCUS_04010 gene roO 1388 2602 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940443.1 protein_id gnl|my_center|LOCUS_04010 2642 2800 gene locus_tag LOCUS_04020 2642 2800 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIZ1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence121 109 1590 gene locus_tag LOCUS_04030 109 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 1615 2781 gene locus_tag LOCUS_04040 1615 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 >Feature sequence122 >Feature sequence123 1418 666 gene locus_tag LOCUS_04050 1418 666 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URR4 protein_id gnl|my_center|LOCUS_04050 1615 3144 gene locus_tag LOCUS_04060 1615 3144 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence124 <1 788 gene locus_tag LOCUS_04070 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000200035.1:uracil-DNA glycosylase <3337 1655 gene locus_tag LOCUS_04080 <3337 1655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_233035.2:hemolysin >Feature sequence125 1675 2145 gene locus_tag LOCUS_04090 1675 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 2352 3038 gene locus_tag LOCUS_04100 2352 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence126 2574 2092 gene locus_tag LOCUS_04110 2574 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 <3314 2597 gene locus_tag LOCUS_04120 <3314 2597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942139.1:type II secretion system protein F >Feature sequence127 1591 1088 gene locus_tag LOCUS_04130 1591 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2389 1670 gene locus_tag LOCUS_04140 2389 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 >Feature sequence128 1805 2635 gene locus_tag LOCUS_04150 gene sgaU 1805 2635 CDS product hexulose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_04150 >Feature sequence129 1889 456 gene locus_tag LOCUS_04160 1889 456 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_04160 2130 2987 gene locus_tag LOCUS_04170 2130 2987 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence130 940 1416 gene locus_tag LOCUS_04180 940 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 1686 2576 gene locus_tag LOCUS_04190 gene rsmH 1686 2576 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK87 protein_id gnl|my_center|LOCUS_04190 >Feature sequence131 <1 664 gene locus_tag LOCUS_04200 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C44:segregation and condensation protein B 661 1836 gene locus_tag LOCUS_04210 661 1836 CDS product TIGR00299 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460167.1 protein_id gnl|my_center|LOCUS_04210 1833 3017 gene locus_tag LOCUS_04220 1833 3017 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_04220 >Feature sequence132 201 980 gene locus_tag LOCUS_04230 gene pfaS 201 980 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121938.1 protein_id gnl|my_center|LOCUS_04230 1095 2492 gene locus_tag LOCUS_04240 gene pgi 1095 2492 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFP0 protein_id gnl|my_center|LOCUS_04240 2720 2574 gene locus_tag LOCUS_04250 2720 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 <3301 2765 gene locus_tag LOCUS_04260 <3301 2765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118925.1:phosphatase >Feature sequence133 1793 2887 gene locus_tag LOCUS_04270 1793 2887 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546845.1 protein_id gnl|my_center|LOCUS_04270 >Feature sequence134 1254 2801 gene locus_tag LOCUS_04280 1254 2801 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122594.1 protein_id gnl|my_center|LOCUS_04280 >Feature sequence135 1283 243 gene locus_tag LOCUS_04290 gene ispG 1283 243 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D60 protein_id gnl|my_center|LOCUS_04290 2763 1597 gene locus_tag LOCUS_04300 2763 1597 CDS product monosaccharide-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258151.1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence136 <1 715 gene locus_tag LOCUS_04310 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939054.1:aspartate ammonia-lyase 723 1949 gene locus_tag LOCUS_04320 723 1949 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939056.1 protein_id gnl|my_center|LOCUS_04320 2052 2633 gene locus_tag LOCUS_04330 2052 2633 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393271.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence137 599 1585 gene locus_tag LOCUS_04340 599 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 1974 3200 gene locus_tag LOCUS_04350 1974 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence138 116 44 gene locus_tag LOCUS_t00070 116 44 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1889 792 gene locus_tag LOCUS_04360 gene dnaN 1889 792 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKK1 protein_id gnl|my_center|LOCUS_04360 >Feature sequence139 8 1240 gene locus_tag LOCUS_04370 8 1240 CDS product phage head-tail adapter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764572.1 protein_id gnl|my_center|LOCUS_04370 2822 1422 gene locus_tag LOCUS_04380 gene arsA 2822 1422 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_04380 >Feature sequence140 582 1874 gene locus_tag LOCUS_04390 582 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 1876 2442 gene locus_tag LOCUS_04400 1876 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 2959 2513 gene locus_tag LOCUS_04410 2959 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 >Feature sequence141 >Feature sequence142 176 610 gene locus_tag LOCUS_04420 176 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 613 3018 gene locus_tag LOCUS_04430 gene lon-3 613 3018 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747S2 protein_id gnl|my_center|LOCUS_04430 >Feature sequence143 1633 845 gene locus_tag LOCUS_04440 1633 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 2906 1689 gene locus_tag LOCUS_04450 2906 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 3196 2903 gene locus_tag LOCUS_04460 3196 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 >Feature sequence144 26 2017 gene locus_tag LOCUS_04470 26 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence145 1736 339 gene locus_tag LOCUS_04480 1736 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 2728 1733 gene locus_tag LOCUS_04490 2728 1733 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496363.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence146 37 1221 gene locus_tag LOCUS_04500 37 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 2661 1291 gene locus_tag LOCUS_04510 2661 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 >Feature sequence147 1070 36 gene locus_tag LOCUS_04520 1070 36 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_04520 2410 1073 gene locus_tag LOCUS_04530 2410 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 >Feature sequence148 <1 802 gene locus_tag LOCUS_04540 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330716.1:general secretion pathway protein GspE 909 1298 gene locus_tag LOCUS_04550 909 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 2184 1363 gene locus_tag LOCUS_04560 2184 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 2319 2606 gene locus_tag LOCUS_04570 gene arsR 2319 2606 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426919.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence149 8 101 gene locus_tag LOCUS_t00080 8 101 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 177 1610 gene locus_tag LOCUS_04580 gene selA 177 1610 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61736 protein_id gnl|my_center|LOCUS_04580 >Feature sequence150 463 1479 gene locus_tag LOCUS_04590 463 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388678.1 protein_id gnl|my_center|LOCUS_04590 1603 2301 gene locus_tag LOCUS_04600 1603 2301 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060904.1 protein_id gnl|my_center|LOCUS_04600 >Feature sequence151 954 772 gene locus_tag LOCUS_04610 954 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 1194 2504 gene locus_tag LOCUS_04620 1194 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 2916 2506 gene locus_tag LOCUS_04630 2916 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 >Feature sequence152 1583 3112 gene locus_tag LOCUS_04640 gene rny 1583 3112 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B652 protein_id gnl|my_center|LOCUS_04640 >Feature sequence153 292 1131 gene locus_tag LOCUS_04650 gene nadK 292 1131 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWB8 protein_id gnl|my_center|LOCUS_04650 1879 1253 gene locus_tag LOCUS_04660 1879 1253 CDS product corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_04660 2874 2062 gene locus_tag LOCUS_04670 gene proC 2874 2062 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A0 protein_id gnl|my_center|LOCUS_04670 >Feature sequence154 1340 312 gene locus_tag LOCUS_04680 1340 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 2696 1488 gene locus_tag LOCUS_04690 gene pfp 2696 1488 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ41 protein_id gnl|my_center|LOCUS_04690 >Feature sequence155 74 334 gene locus_tag LOCUS_04700 74 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 538 1560 gene locus_tag LOCUS_04710 538 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence156 <1 2607 gene locus_tag LOCUS_04720 <1 2607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UP05:DNA mismatch repair protein MutS 3096 2731 gene locus_tag LOCUS_04730 3096 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 >Feature sequence157 >Feature sequence158 17 826 gene locus_tag LOCUS_04740 17 826 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_04740 823 1122 gene locus_tag LOCUS_04750 823 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 1119 2345 gene locus_tag LOCUS_04760 1119 2345 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_04760 2432 2505 gene locus_tag LOCUS_t00090 2432 2505 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2509 2585 gene locus_tag LOCUS_t00100 2509 2585 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence159 2151 484 gene locus_tag LOCUS_04770 2151 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 <3073 2224 gene locus_tag LOCUS_04780 <3073 2224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327113.1:phosphodiesterase >Feature sequence160 >Feature sequence161 42 1418 gene locus_tag LOCUS_04790 42 1418 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK22 protein_id gnl|my_center|LOCUS_04790 1442 1924 gene locus_tag LOCUS_04800 gene smpB 1442 1924 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9T6 protein_id gnl|my_center|LOCUS_04800 2077 2631 gene locus_tag LOCUS_04810 gene lemA 2077 2631 CDS product LemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989628.1 protein_id gnl|my_center|LOCUS_04810 >Feature sequence162 1186 2082 gene locus_tag LOCUS_04820 gene argB 1186 2082 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQZ8 protein_id gnl|my_center|LOCUS_04820 2085 3017 gene locus_tag LOCUS_04830 gene arcB 2085 3017 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB17 protein_id gnl|my_center|LOCUS_04830 >Feature sequence163 546 1967 gene locus_tag LOCUS_04840 546 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 2192 2548 gene locus_tag LOCUS_04850 2192 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 >Feature sequence164 2175 304 gene locus_tag LOCUS_04860 2175 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 >Feature sequence165 778 1512 gene locus_tag LOCUS_04870 gene phoP 778 1512 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence166 1555 368 gene locus_tag LOCUS_04880 1555 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 2863 1580 gene locus_tag LOCUS_04890 2863 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 >Feature sequence167 595 305 gene locus_tag LOCUS_04900 595 305 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461445.1 protein_id gnl|my_center|LOCUS_04900 819 2123 gene locus_tag LOCUS_04910 819 2123 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence168 2078 2845 gene locus_tag LOCUS_04920 gene phnP 2078 2845 CDS product metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475475.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence169 83 1468 gene locus_tag LOCUS_04930 gene acoL 83 1468 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CC1 protein_id gnl|my_center|LOCUS_04930 >Feature sequence170 1609 428 gene locus_tag LOCUS_04940 1609 428 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942829.1 protein_id gnl|my_center|LOCUS_04940 2301 2035 gene locus_tag LOCUS_04950 gene rpsT 2301 2035 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182G1 protein_id gnl|my_center|LOCUS_04950 >Feature sequence171 2892 1735 gene locus_tag LOCUS_04960 2892 1735 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_04960 >Feature sequence172 2026 1799 gene locus_tag LOCUS_04970 gene infA 2026 1799 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WSB2 protein_id gnl|my_center|LOCUS_04970 >Feature sequence173 778 257 gene locus_tag LOCUS_04980 gene lexA 778 257 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBD7 protein_id gnl|my_center|LOCUS_04980 <2932 1629 gene locus_tag LOCUS_04990 <2932 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124071.1:iduronate-2-sulfatase >Feature sequence174 28 1776 gene locus_tag LOCUS_05000 28 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 2921 1794 gene locus_tag LOCUS_05010 gene hflX 2921 1794 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD7 protein_id gnl|my_center|LOCUS_05010 >Feature sequence175 1758 502 gene locus_tag LOCUS_05020 1758 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 2365 1793 gene locus_tag LOCUS_05030 2365 1793 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGK7 protein_id gnl|my_center|LOCUS_05030 >Feature sequence176 742 1323 gene locus_tag LOCUS_05040 gene sigW 742 1323 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_05040 1410 1997 gene locus_tag LOCUS_05050 1410 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 1994 2767 gene locus_tag LOCUS_05060 1994 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence177 6 2123 gene locus_tag LOCUS_05070 gene clpC 6 2123 CDS product ATP-dependent Clp protease ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence178 1177 557 gene locus_tag LOCUS_05080 gene rex 1177 557 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW59 protein_id gnl|my_center|LOCUS_05080 2373 1468 gene locus_tag LOCUS_05090 2373 1468 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSJ5 protein_id gnl|my_center|LOCUS_05090 >Feature sequence179 3 719 gene locus_tag LOCUS_05100 3 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 1465 767 gene locus_tag LOCUS_05110 1465 767 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101003.1 protein_id gnl|my_center|LOCUS_05110 2260 1490 gene locus_tag LOCUS_05120 2260 1490 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409686.1 protein_id gnl|my_center|LOCUS_05120 <2884 2305 gene locus_tag LOCUS_05130 <2884 2305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000271588.1:MBL fold metallo-hydrolase >Feature sequence180 <1 530 gene locus_tag LOCUS_05140 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920753.1:nicotinate-nucleotide diphosphorylase (carboxylating) >Feature sequence181 <2876 2080 gene locus_tag LOCUS_05150 <2876 2080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KG43:1-deoxy-D-xylulose 5-phosphate reductoisomerase >Feature sequence182 >Feature sequence183 1307 717 gene locus_tag LOCUS_05160 1307 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05160 2135 1314 gene locus_tag LOCUS_05170 2135 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404562.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence184 1766 144 gene locus_tag LOCUS_05180 1766 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 >Feature sequence185 >Feature sequence186 1628 330 gene locus_tag LOCUS_05190 gene eno 1628 330 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AR6 protein_id gnl|my_center|LOCUS_05190 2854 1766 gene locus_tag LOCUS_05200 2854 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence187 480 325 gene locus_tag LOCUS_05210 480 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 682 609 gene locus_tag LOCUS_t00110 682 609 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 872 2020 gene locus_tag LOCUS_05220 gene nadA 872 2020 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KWZ1 protein_id gnl|my_center|LOCUS_05220 2042 2368 gene locus_tag LOCUS_05230 2042 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence188 417 226 gene locus_tag LOCUS_05240 gene rpmC 417 226 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QG2 protein_id gnl|my_center|LOCUS_05240 855 436 gene locus_tag LOCUS_05250 gene rplP 855 436 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHW1 protein_id gnl|my_center|LOCUS_05250 1661 900 gene locus_tag LOCUS_05260 gene rpsC 1661 900 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN14 protein_id gnl|my_center|LOCUS_05260 1933 1661 gene locus_tag LOCUS_05270 gene rplV 1933 1661 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q839F9 protein_id gnl|my_center|LOCUS_05270 2327 2067 gene locus_tag LOCUS_05280 gene rpsS 2327 2067 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN16 protein_id gnl|my_center|LOCUS_05280 <2842 2343 gene locus_tag LOCUS_05290 <2842 2343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UN17:50S ribosomal protein L2 >Feature sequence189 >Feature sequence190 <1 822 gene locus_tag LOCUS_05300 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O86504:3-isopropylmalate dehydrogenase 838 2067 gene locus_tag LOCUS_05310 838 2067 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_05310 >Feature sequence191 586 53 gene locus_tag LOCUS_05320 586 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 1587 598 gene locus_tag LOCUS_05330 1587 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 1835 2578 gene locus_tag LOCUS_05340 1835 2578 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110504.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence192 967 2070 gene locus_tag LOCUS_05350 967 2070 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_05350 2148 2498 gene locus_tag LOCUS_05360 2148 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212737.1 protein_id gnl|my_center|LOCUS_05360 2745 2506 gene locus_tag LOCUS_05370 2745 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 >Feature sequence193 >Feature sequence194 2303 78 gene locus_tag LOCUS_05380 gene pnp 2303 78 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR95 protein_id gnl|my_center|LOCUS_05380 2649 2380 gene locus_tag LOCUS_05390 gene rpsO 2649 2380 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X165 protein_id gnl|my_center|LOCUS_05390 >Feature sequence195 203 793 gene locus_tag LOCUS_05400 gene hisB 203 793 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y411 protein_id gnl|my_center|LOCUS_05400 881 1192 gene locus_tag LOCUS_05410 881 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 1502 1212 gene locus_tag LOCUS_05420 1502 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 <2808 1530 gene locus_tag LOCUS_05430 <2808 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001212651.1:serine-type D-Ala-D-Ala carboxypeptidase >Feature sequence196 2453 213 gene locus_tag LOCUS_05440 2453 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence197 2381 1575 gene locus_tag LOCUS_05450 gene thiG 2381 1575 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US84 protein_id gnl|my_center|LOCUS_05450 >Feature sequence198 336 1397 gene locus_tag LOCUS_05460 336 1397 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_05460 2029 1853 gene locus_tag LOCUS_05470 2029 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence199 2458 347 gene locus_tag LOCUS_05480 2458 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 2797 2678 gene locus_tag LOCUS_05490 2797 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 >Feature sequence200 1098 508 gene locus_tag LOCUS_05500 1098 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence201 1301 1083 gene locus_tag LOCUS_05510 1301 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 1497 2243 gene locus_tag LOCUS_05520 gene birA 1497 2243 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC0 protein_id gnl|my_center|LOCUS_05520 >Feature sequence202 454 8 gene locus_tag LOCUS_05530 454 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 1227 451 gene locus_tag LOCUS_05540 1227 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2419 1220 gene locus_tag LOCUS_05550 2419 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence203 766 1299 gene locus_tag LOCUS_05560 gene def 766 1299 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5P6 protein_id gnl|my_center|LOCUS_05560 1302 2246 gene locus_tag LOCUS_05570 gene cysK 1302 2246 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32978 protein_id gnl|my_center|LOCUS_05570 >Feature sequence204 1 444 gene locus_tag LOCUS_05580 1 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 447 1640 gene locus_tag LOCUS_05590 gene bcpC 447 1640 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_868623.2 protein_id gnl|my_center|LOCUS_05590 >Feature sequence205 <1 1130 gene locus_tag LOCUS_05600 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7ULT2:release factor glutamine methyltransferase 1280 2623 gene locus_tag LOCUS_05610 1280 2623 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222955.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence206 1191 199 gene locus_tag LOCUS_05620 gene rpoD 1191 199 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118349.1 protein_id gnl|my_center|LOCUS_05620 >Feature sequence207 1103 129 gene locus_tag LOCUS_05630 1103 129 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106475.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence208 231 815 gene locus_tag LOCUS_05640 231 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1868 885 gene locus_tag LOCUS_05650 1868 885 CDS product putative PabA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57527 protein_id gnl|my_center|LOCUS_05650 1955 2530 gene locus_tag LOCUS_05660 1955 2530 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence209 1520 702 gene locus_tag LOCUS_05670 1520 702 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence210 1317 385 gene locus_tag LOCUS_05680 1317 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 1853 1314 gene locus_tag LOCUS_05690 1853 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence211 1513 662 gene locus_tag LOCUS_05700 gene thyA 1513 662 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D985 protein_id gnl|my_center|LOCUS_05700 1897 1613 gene locus_tag LOCUS_05710 1897 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 1896 2426 gene locus_tag LOCUS_05720 1896 2426 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence212 141 1586 gene locus_tag LOCUS_05730 141 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 2506 1661 gene locus_tag LOCUS_05740 2506 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 >Feature sequence213 1512 208 gene locus_tag LOCUS_05750 gene fabF 1512 208 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ1 protein_id gnl|my_center|LOCUS_05750 <2695 1509 gene locus_tag LOCUS_05760 <2695 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q81GL9:3-oxoacyl-[acyl-carrier-protein] synthase 2 >Feature sequence214 <1 739 gene locus_tag LOCUS_05770 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941823.1:ABC transporter ATP-binding protein 743 1912 gene locus_tag LOCUS_05780 743 1912 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119834.1 protein_id gnl|my_center|LOCUS_05780 >Feature sequence215 1971 697 gene locus_tag LOCUS_05790 1971 697 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123111.1 protein_id gnl|my_center|LOCUS_05790 <2684 1981 gene locus_tag LOCUS_05800 <2684 1981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123112.1:membrane protein >Feature sequence216 294 1343 gene locus_tag LOCUS_05810 gene lpxD 294 1343 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHC2 protein_id gnl|my_center|LOCUS_05810 1355 2662 gene locus_tag LOCUS_05820 1355 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence217 679 446 gene locus_tag LOCUS_05830 gene rpmA 679 446 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPR5 protein_id gnl|my_center|LOCUS_05830 953 1579 gene locus_tag LOCUS_05840 953 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 2676 1660 gene locus_tag LOCUS_05850 2676 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence218 439 1482 gene locus_tag LOCUS_05860 439 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence219 1324 1010 gene locus_tag LOCUS_05870 1324 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 <2670 1977 gene locus_tag LOCUS_05880 <2670 1977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392520.1:2-hydroxyglutaryl-CoA dehydratase >Feature sequence220 200 1714 gene locus_tag LOCUS_05890 gene istA 200 1714 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974233.1 protein_id gnl|my_center|LOCUS_05890 1711 2484 gene locus_tag LOCUS_05900 gene istB 1711 2484 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence221 646 948 gene locus_tag LOCUS_05910 646 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 1363 923 gene locus_tag LOCUS_05920 1363 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 1586 2284 gene locus_tag LOCUS_05930 1586 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 >Feature sequence222 <1 1139 gene locus_tag LOCUS_05940 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118066.1:arsenical-resistance protein 1191 2480 gene locus_tag LOCUS_05950 gene lysA 1191 2480 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GT7 protein_id gnl|my_center|LOCUS_05950 >Feature sequence223 >Feature sequence224 <1 972 gene locus_tag LOCUS_05960 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123590.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB 2106 967 gene locus_tag LOCUS_05970 2106 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 >Feature sequence225 535 912 gene locus_tag LOCUS_05980 535 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 909 1460 gene locus_tag LOCUS_05990 909 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 >Feature sequence226 562 68 gene locus_tag LOCUS_06000 562 68 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879215.1 protein_id gnl|my_center|LOCUS_06000 2285 573 gene locus_tag LOCUS_06010 gene ilvB 2285 573 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66759 protein_id gnl|my_center|LOCUS_06010 >Feature sequence227 <1 1242 gene locus_tag LOCUS_06020 <1 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258088.1:stage II sporulation protein E 2209 1247 gene locus_tag LOCUS_06030 gene xerC 2209 1247 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQY6 protein_id gnl|my_center|LOCUS_06030 2454 2242 gene locus_tag LOCUS_06040 2454 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence228 611 685 gene locus_tag LOCUS_t00120 611 685 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 815 1993 gene locus_tag LOCUS_06050 815 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 >Feature sequence229 <1 1527 gene locus_tag LOCUS_06060 <1 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583284.1:NADH dehydrogenase >Feature sequence230 379 1086 gene locus_tag LOCUS_06070 379 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 >Feature sequence231 >Feature sequence232 189 2510 gene locus_tag LOCUS_06080 189 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence233 1836 655 gene locus_tag LOCUS_06090 1836 655 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIE0 protein_id gnl|my_center|LOCUS_06090 >Feature sequence234 1120 1767 gene locus_tag LOCUS_06100 gene queE 1120 1767 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGD1 protein_id gnl|my_center|LOCUS_06100 1777 2139 gene locus_tag LOCUS_06110 1777 2139 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CR16 protein_id gnl|my_center|LOCUS_06110 >Feature sequence235 1972 1148 gene locus_tag LOCUS_06120 1972 1148 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941678.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence236 808 371 gene locus_tag LOCUS_06130 gene rplM 808 371 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1G5 protein_id gnl|my_center|LOCUS_06130 >Feature sequence237 <1 662 gene locus_tag LOCUS_06140 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986411.1:NADH:ubiquinone oxidoreductase 761 1144 gene locus_tag LOCUS_06150 761 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence238 <1 812 gene locus_tag LOCUS_06160 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266726.1:glycosyl transferase family 1 910 2415 gene locus_tag LOCUS_06170 910 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 >Feature sequence239 1017 2357 gene locus_tag LOCUS_06180 1017 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 >Feature sequence240 1968 2168 gene locus_tag LOCUS_06190 1968 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 2165 2440 gene locus_tag LOCUS_06200 2165 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence241 2461 1241 gene locus_tag LOCUS_06210 gene accC 2461 1241 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence242 1811 144 gene locus_tag LOCUS_06220 1811 144 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119838.1 protein_id gnl|my_center|LOCUS_06220 2131 1850 gene locus_tag LOCUS_06230 gene csoR 2131 1850 CDS product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32222 protein_id gnl|my_center|LOCUS_06230 >Feature sequence243 1513 617 gene locus_tag LOCUS_06240 1513 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546211.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence244 908 1687 gene locus_tag LOCUS_06250 gene rph 908 1687 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RV5 protein_id gnl|my_center|LOCUS_06250 >Feature sequence245 >Feature sequence246 1710 292 gene locus_tag LOCUS_06260 1710 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence247 1560 2177 gene locus_tag LOCUS_06270 1560 2177 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941355.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence248 2105 855 gene locus_tag LOCUS_06280 2105 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence249 2328 1810 gene locus_tag LOCUS_06290 2328 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence250 <1 2287 gene locus_tag LOCUS_06300 <1 2287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118432.1:general secretion pathway protein GspD >Feature sequence251 118 765 gene locus_tag LOCUS_06310 gene pgaM 118 765 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332332.1 protein_id gnl|my_center|LOCUS_06310 1841 777 gene locus_tag LOCUS_06320 1841 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 2425 1970 gene locus_tag LOCUS_06330 2425 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence252 550 1725 gene locus_tag LOCUS_06340 gene argD 550 1725 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG65 protein_id gnl|my_center|LOCUS_06340 >Feature sequence253 1 657 gene locus_tag LOCUS_06350 1 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 703 1755 gene locus_tag LOCUS_06360 gene nqrB 703 1755 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_06360 >Feature sequence254 1538 381 gene locus_tag LOCUS_06370 1538 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 2476 1538 gene locus_tag LOCUS_06380 gene miaA 2476 1538 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BP1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence255 >Feature sequence256 1936 284 gene locus_tag LOCUS_06390 1936 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_06390 <2464 1923 gene locus_tag LOCUS_06400 <2464 1923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785146.1:membrane protein >Feature sequence257 <2454 1677 gene locus_tag LOCUS_06410 <2454 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940999.1:peptidase >Feature sequence258 <2447 741 gene locus_tag LOCUS_06420 <2447 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O32038:aspartate--tRNA(Asp/Asn) ligase >Feature sequence259 1332 379 gene locus_tag LOCUS_06430 1332 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1782 1417 gene locus_tag LOCUS_06440 1782 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 2364 1990 gene locus_tag LOCUS_06450 2364 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 >Feature sequence260 <1 610 gene locus_tag LOCUS_06460 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121615.1:arylsulfatase 2426 843 gene locus_tag LOCUS_06470 2426 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence261 236 1228 gene locus_tag LOCUS_06480 236 1228 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_06480 1906 1343 gene locus_tag LOCUS_06490 1906 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 >Feature sequence262 >Feature sequence263 162 482 gene locus_tag LOCUS_06500 162 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 479 907 gene locus_tag LOCUS_06510 479 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 929 1390 gene locus_tag LOCUS_06520 929 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 1412 1894 gene locus_tag LOCUS_06530 1412 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 1915 2133 gene locus_tag LOCUS_06540 1915 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 2126 2326 gene locus_tag LOCUS_06550 2126 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence264 >Feature sequence265 >Feature sequence266 <1 1763 gene locus_tag LOCUS_06560 <1 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RHB7:DNA-directed DNA polymerase 1763 2299 gene locus_tag LOCUS_06570 1763 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 >Feature sequence267 >Feature sequence268 1211 423 gene locus_tag LOCUS_06580 1211 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence269 <2370 504 gene locus_tag LOCUS_06590 <2370 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122418.1:inter-alpha-trypsin inhibitor domain-containing protein >Feature sequence270 <1 1045 gene locus_tag LOCUS_06600 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UPD6:UvrABC system protein C >Feature sequence271 1287 229 gene locus_tag LOCUS_06610 1287 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 >Feature sequence272 3 893 gene locus_tag LOCUS_06620 3 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 911 1423 gene locus_tag LOCUS_06630 gene atpK 911 1423 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669353.1 protein_id gnl|my_center|LOCUS_06630 1567 1788 gene locus_tag LOCUS_06640 1567 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence273 >Feature sequence274 273 1070 gene locus_tag LOCUS_06650 gene tsf 273 1070 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG4 protein_id gnl|my_center|LOCUS_06650 1273 2082 gene locus_tag LOCUS_06660 1273 2082 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_06660 >Feature sequence275 1992 682 gene locus_tag LOCUS_06670 1992 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence276 598 83 gene locus_tag LOCUS_06680 598 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 1209 601 gene locus_tag LOCUS_06690 1209 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 1667 1212 gene locus_tag LOCUS_06700 1667 1212 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence277 1135 581 gene locus_tag LOCUS_06710 gene frr 1135 581 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DQ9 protein_id gnl|my_center|LOCUS_06710 1910 1185 gene locus_tag LOCUS_06720 gene pyrH 1910 1185 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82852 protein_id gnl|my_center|LOCUS_06720 >Feature sequence278 415 74 gene locus_tag LOCUS_06730 415 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 1011 586 gene locus_tag LOCUS_06740 1011 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 <2334 1092 gene locus_tag LOCUS_06750 <2334 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7ULV7:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG >Feature sequence279 424 834 gene locus_tag LOCUS_06760 424 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 831 1727 gene locus_tag LOCUS_06770 gene speE 831 1727 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBJ8 protein_id gnl|my_center|LOCUS_06770 >Feature sequence280 <1 767 gene locus_tag LOCUS_06780 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67358:trigger factor 2327 903 gene locus_tag LOCUS_06790 2327 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence281 107 397 gene locus_tag LOCUS_06800 gene groS1 107 397 CDS product 10 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM98 protein_id gnl|my_center|LOCUS_06800 441 2069 gene locus_tag LOCUS_06810 gene groL2 441 2069 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM97 protein_id gnl|my_center|LOCUS_06810 >Feature sequence282 577 41 gene locus_tag LOCUS_06820 577 41 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_06820 1118 816 gene locus_tag LOCUS_06830 1118 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence283 1955 933 gene locus_tag LOCUS_06840 1955 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence284 <1 2033 gene locus_tag LOCUS_06850 <1 2033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UDY6:protein translocase subunit SecA 1 >Feature sequence285 <1 617 gene locus_tag LOCUS_06860 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877607.1:molybdenum ABC transporter permease 610 1647 gene locus_tag LOCUS_06870 610 1647 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_06870 <2290 1644 gene locus_tag LOCUS_06880 <2290 1644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870318.1:thiamine biosynthesis protein ThiF >Feature sequence286 <1 722 gene locus_tag LOCUS_06890 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CHY0:ATP-dependent Clp protease proteolytic subunit 756 1094 gene locus_tag LOCUS_06900 756 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 1100 1456 gene locus_tag LOCUS_06910 1100 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 1453 1680 gene locus_tag LOCUS_06920 1453 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 1685 2128 gene locus_tag LOCUS_06930 1685 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 >Feature sequence287 1041 154 gene locus_tag LOCUS_06940 gene hemC 1041 154 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MH04 protein_id gnl|my_center|LOCUS_06940 1626 1108 gene locus_tag LOCUS_06950 1626 1108 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_06950 1965 1630 gene locus_tag LOCUS_06960 1965 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence288 <1 936 gene locus_tag LOCUS_06970 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72FX8:tryptophan synthase beta chain <2277 994 gene locus_tag LOCUS_06980 <2277 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404548.1:ATP-dependent DNA helicase >Feature sequence289 >Feature sequence290 889 77 gene locus_tag LOCUS_06990 gene aldC 889 77 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958007.1 protein_id gnl|my_center|LOCUS_06990 2267 1002 gene locus_tag LOCUS_07000 gene asnS 2267 1002 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC3 protein_id gnl|my_center|LOCUS_07000 >Feature sequence291 714 1367 gene locus_tag LOCUS_07010 714 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence292 1 1059 gene locus_tag LOCUS_07020 1 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 1262 1336 gene locus_tag LOCUS_t00130 1262 1336 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1372 1447 gene locus_tag LOCUS_t00140 1372 1447 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence293 228 872 gene locus_tag LOCUS_07030 gene gpp 228 872 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640977.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence294 734 2128 gene locus_tag LOCUS_07040 734 2128 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A0P6 protein_id gnl|my_center|LOCUS_07040 >Feature sequence295 1259 258 gene locus_tag LOCUS_07050 gene lpxK 1259 258 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW7 protein_id gnl|my_center|LOCUS_07050 1798 1256 gene locus_tag LOCUS_07060 gene folA 1798 1256 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G37 protein_id gnl|my_center|LOCUS_07060 >Feature sequence296 1853 237 gene locus_tag LOCUS_07070 1853 237 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748808.1 protein_id gnl|my_center|LOCUS_07070 2066 1896 gene locus_tag LOCUS_07080 2066 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence297 679 2037 gene locus_tag LOCUS_07090 679 2037 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941216.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence298 2133 1261 gene locus_tag LOCUS_07100 2133 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 >Feature sequence299 >Feature sequence300 81 1193 gene locus_tag LOCUS_07110 81 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 <2234 1269 gene locus_tag LOCUS_07120 <2234 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943186.1:DNA polymerase >Feature sequence301 <1 940 gene locus_tag LOCUS_07130 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UG04:homoserine O-acetyltransferase 937 1224 gene locus_tag LOCUS_07140 937 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 1310 1786 gene locus_tag LOCUS_07150 gene fabZ 1310 1786 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence302 >Feature sequence303 >Feature sequence304 1107 55 gene locus_tag LOCUS_07160 1107 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence305 >Feature sequence306 >Feature sequence307 761 1987 gene locus_tag LOCUS_07170 761 1987 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228553.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence308 804 1904 gene locus_tag LOCUS_07180 804 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 1965 2159 gene locus_tag LOCUS_07190 1965 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 >Feature sequence309 333 76 gene locus_tag LOCUS_07200 333 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 698 333 gene locus_tag LOCUS_07210 gene rplN 698 333 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J32 protein_id gnl|my_center|LOCUS_07210 993 712 gene locus_tag LOCUS_07220 gene rpsQ 993 712 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D7X9 protein_id gnl|my_center|LOCUS_07220 1211 1008 gene locus_tag LOCUS_07230 1211 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 1613 1233 gene locus_tag LOCUS_07240 gene rplP 1613 1233 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7J9 protein_id gnl|my_center|LOCUS_07240 <2222 1588 gene locus_tag LOCUS_07250 <2222 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q748Z4:30S ribosomal protein S3 >Feature sequence310 <2221 50 gene locus_tag LOCUS_07260 <2221 50 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002665246.1:sodium:proton antiporter >Feature sequence311 2159 1368 gene locus_tag LOCUS_07270 2159 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence312 617 994 gene locus_tag LOCUS_07280 617 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 <2214 1293 gene locus_tag LOCUS_07290 <2214 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068541.1:ATPase AAA >Feature sequence313 654 1037 gene locus_tag LOCUS_07300 654 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 1379 1116 gene locus_tag LOCUS_07310 gene rpmE2 1379 1116 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JU1 protein_id gnl|my_center|LOCUS_07310 <2202 1638 gene locus_tag LOCUS_07320 <2202 1638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201965.1:beta-hexosaminidase >Feature sequence314 <1 1166 gene locus_tag LOCUS_07330 <1 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122552.1:radical SAM protein >Feature sequence315 2040 553 gene locus_tag LOCUS_07340 gene trpE 2040 553 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence316 940 674 gene locus_tag LOCUS_07350 940 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence317 >Feature sequence318 85 1149 gene locus_tag LOCUS_07360 85 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence319 626 84 gene locus_tag LOCUS_07370 626 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 889 626 gene locus_tag LOCUS_07380 889 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence320 218 147 gene locus_tag LOCUS_t00150 218 147 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 788 282 gene locus_tag LOCUS_07390 gene ppiB 788 282 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WER4 protein_id gnl|my_center|LOCUS_07390 1481 798 gene locus_tag LOCUS_07400 1481 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence321 1282 731 gene locus_tag LOCUS_07410 gene mntP 1282 731 CDS product putative manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727E5 protein_id gnl|my_center|LOCUS_07410 >Feature sequence322 >Feature sequence323 141 659 gene locus_tag LOCUS_07420 141 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 725 919 gene locus_tag LOCUS_07430 725 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 1047 1334 gene locus_tag LOCUS_07440 1047 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1356 1643 gene locus_tag LOCUS_07450 1356 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence324 939 178 gene locus_tag LOCUS_07460 939 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence325 1611 1159 gene locus_tag LOCUS_07470 1611 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence326 240 1007 gene locus_tag LOCUS_07480 240 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence327 519 713 gene locus_tag LOCUS_07490 519 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496483.1 protein_id gnl|my_center|LOCUS_07490 718 1725 gene locus_tag LOCUS_07500 718 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence328 >Feature sequence329 1815 910 gene locus_tag LOCUS_07510 1815 910 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence330 <1 544 gene locus_tag LOCUS_07520 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964226.1:tRNA threonylcarbamoyladenosine dehydratase 580 651 gene locus_tag LOCUS_t00160 580 651 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 834 1919 gene locus_tag LOCUS_07530 gene nahK 834 1919 CDS product mucin desulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence331 2 346 gene locus_tag LOCUS_07540 2 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 443 1411 gene locus_tag LOCUS_07550 443 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 1770 2009 gene locus_tag LOCUS_07560 1770 2009 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292400.1 protein_id gnl|my_center|LOCUS_07560 >Feature sequence332 1097 225 gene locus_tag LOCUS_07570 1097 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 1843 1094 gene locus_tag LOCUS_07580 1843 1094 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence333 >Feature sequence334 207 770 gene locus_tag LOCUS_07590 207 770 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2H4 protein_id gnl|my_center|LOCUS_07590 1404 775 gene locus_tag LOCUS_07600 1404 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence335 32 931 gene locus_tag LOCUS_07610 32 931 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313706.1 protein_id gnl|my_center|LOCUS_07610 989 1897 gene locus_tag LOCUS_07620 989 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence336 <1 937 gene locus_tag LOCUS_07630 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582857.1:(Fe-S)-binding protein 952 1989 gene locus_tag LOCUS_07640 952 1989 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence337 165 252 gene locus_tag LOCUS_t00170 165 252 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 355 1371 gene locus_tag LOCUS_07650 355 1371 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122968.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence338 <1 1464 gene locus_tag LOCUS_07660 <1 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121231.1:ABC transporter permease >Feature sequence339 1643 696 gene locus_tag LOCUS_07670 1643 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence340 >Feature sequence341 410 1549 gene locus_tag LOCUS_07680 410 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence342 1845 646 gene locus_tag LOCUS_07690 1845 646 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555401.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence343 >Feature sequence344 <1 1140 gene locus_tag LOCUS_07700 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404999.1:amino acid transporter 1271 1621 gene locus_tag LOCUS_07710 1271 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence345 961 581 gene locus_tag LOCUS_07720 961 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 <2104 1170 gene locus_tag LOCUS_07730 <2104 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932301.1:3-isopropylmalate dehydratase large subunit >Feature sequence346 1311 1892 gene locus_tag LOCUS_07740 1311 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence347 1153 263 gene locus_tag LOCUS_07750 1153 263 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460731.1 protein_id gnl|my_center|LOCUS_07750 2004 1150 gene locus_tag LOCUS_07760 gene cysH 2004 1150 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence348 692 387 gene locus_tag LOCUS_07770 692 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 1503 913 gene locus_tag LOCUS_07780 1503 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 2015 1500 gene locus_tag LOCUS_07790 2015 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence349 >Feature sequence350 1916 180 gene locus_tag LOCUS_07800 1916 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence351 1756 305 gene locus_tag LOCUS_07810 1756 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence352 1 555 gene locus_tag LOCUS_07820 1 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 571 1386 gene locus_tag LOCUS_07830 571 1386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966898.1 protein_id gnl|my_center|LOCUS_07830 <2086 1468 gene locus_tag LOCUS_07840 <2086 1468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404979.1:alpha-glucosidase >Feature sequence353 <2084 872 gene locus_tag LOCUS_07850 <2084 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880484.1:peptidase S41 >Feature sequence354 319 873 gene locus_tag LOCUS_07860 319 873 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891044.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence355 243 1199 gene locus_tag LOCUS_07870 gene hprA 243 1199 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942316.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence356 >Feature sequence357 78 1673 gene locus_tag LOCUS_07880 78 1673 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence358 <1 1125 gene locus_tag LOCUS_07890 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327082.1:O-acetylhomoserine aminocarboxypropyltransferase >Feature sequence359 573 1598 gene locus_tag LOCUS_07900 573 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence360 <1 1254 gene locus_tag LOCUS_07910 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001255442.1:hydrolase 1267 1800 gene locus_tag LOCUS_07920 1267 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence361 <1 1010 gene locus_tag LOCUS_07930 <1 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000898866.1:decaprenyl-phosphate phosphoribosyltransferase 1013 1969 gene locus_tag LOCUS_07940 1013 1969 CDS product glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085896.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence362 1270 32 gene locus_tag LOCUS_07950 1270 32 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583646.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence363 227 451 gene locus_tag LOCUS_07960 227 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 565 1674 gene locus_tag LOCUS_07970 gene aspC 565 1674 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG06 protein_id gnl|my_center|LOCUS_07970 >Feature sequence364 >Feature sequence365 <1 833 gene locus_tag LOCUS_07980 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119571.1:CDP-diacylglycerol--serine O-phosphatidyltransferase 830 1987 gene locus_tag LOCUS_07990 830 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence366 587 1525 gene locus_tag LOCUS_08000 587 1525 CDS product malonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016534.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence367 960 241 gene locus_tag LOCUS_08010 960 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 <2031 998 gene locus_tag LOCUS_08020 <2031 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942139.1:type II secretion system protein F >Feature sequence368 >Feature sequence369 714 142 gene locus_tag LOCUS_08030 gene gmhA 714 142 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF4 protein_id gnl|my_center|LOCUS_08030 1544 711 gene locus_tag LOCUS_08040 1544 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 2023 1577 gene locus_tag LOCUS_08050 2023 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence370 1430 183 gene locus_tag LOCUS_08060 1430 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence371 >Feature sequence372 218 625 gene locus_tag LOCUS_08070 218 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 729 1961 gene locus_tag LOCUS_08080 729 1961 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084993.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence373 <2018 270 gene locus_tag LOCUS_08090 <2018 270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KEP3:chaperone protein DnaK >Feature sequence374 1719 1970 gene locus_tag LOCUS_08100 1719 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082814.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence375 113 610 gene locus_tag LOCUS_08110 113 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 687 1109 gene locus_tag LOCUS_08120 gene acpP 687 1109 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP48 protein_id gnl|my_center|LOCUS_08120 1210 1683 gene locus_tag LOCUS_08130 1210 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence376 139 537 gene locus_tag LOCUS_08140 139 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 515 802 gene locus_tag LOCUS_08150 515 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1071 2006 gene locus_tag LOCUS_08160 1071 2006 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103416.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence377 >Feature sequence378 1654 197 gene locus_tag LOCUS_08170 1654 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence379 472 735 gene locus_tag LOCUS_08180 472 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence380 >Feature sequence381 1253 483 gene locus_tag LOCUS_08190 1253 483 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_08190 1769 1272 gene locus_tag LOCUS_08200 1769 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence382 >Feature sequence383 <1981 1363 gene locus_tag LOCUS_08210 <1981 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036927.1:9-O-acetylesterase >Feature sequence384 140 1147 gene locus_tag LOCUS_08220 140 1147 CDS product glycosyl hydrolase family 43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767017.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence385 <1 708 gene locus_tag LOCUS_08230 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C4L6:tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC >Feature sequence386 285 1637 gene locus_tag LOCUS_08240 285 1637 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120415.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence387 >Feature sequence388 <1968 864 gene locus_tag LOCUS_08250 <1968 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RK84:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence389 >Feature sequence390 977 420 gene locus_tag LOCUS_08260 977 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1903 974 gene locus_tag LOCUS_08270 1903 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence391 <1958 1386 gene locus_tag LOCUS_08280 <1958 1386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460176.1:transcriptional regulator >Feature sequence392 315 632 gene locus_tag LOCUS_08290 gene rplU 315 632 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XL6 protein_id gnl|my_center|LOCUS_08290 >Feature sequence393 220 1035 gene locus_tag LOCUS_08300 220 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 <1948 1097 gene locus_tag LOCUS_08310 <1948 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2WGI5:deoxyguanosinetriphosphate triphosphohydrolase-like protein >Feature sequence394 78 872 gene locus_tag LOCUS_08320 78 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 1582 938 gene locus_tag LOCUS_08330 1582 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence395 >Feature sequence396 1127 246 gene locus_tag LOCUS_08340 1127 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1909 1190 gene locus_tag LOCUS_08350 1909 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence397 263 1600 gene locus_tag LOCUS_08360 263 1600 CDS product ethanolamine utilization protein EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119028.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence398 1759 38 gene locus_tag LOCUS_08370 1759 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence399 313 1440 gene locus_tag LOCUS_08380 313 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence400 <1 916 gene locus_tag LOCUS_08390 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GZ6:pyruvate-flavodoxin oxidoreductase >Feature sequence401 <1926 1207 gene locus_tag LOCUS_08400 <1926 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259250.1:ATPase >Feature sequence402 <1 634 gene locus_tag LOCUS_08410 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000395025.1:beta-ketoacyl-ACP reductase 851 1717 gene locus_tag LOCUS_08420 851 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 >Feature sequence403 <1914 716 gene locus_tag LOCUS_08430 <1914 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123533.1:xylulokinase >Feature sequence404 <1 820 gene locus_tag LOCUS_08440 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583067.1:alcohol dehydrogenase 817 1320 gene locus_tag LOCUS_08450 gene purE 817 1320 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGE9 protein_id gnl|my_center|LOCUS_08450 >Feature sequence405 994 11 gene locus_tag LOCUS_08460 994 11 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ29 protein_id gnl|my_center|LOCUS_08460 1750 1052 gene locus_tag LOCUS_08470 1750 1052 CDS product magnesium transporter MgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942574.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence406 178 1305 gene locus_tag LOCUS_08480 178 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1514 1708 gene locus_tag LOCUS_08490 1514 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence407 1597 374 gene locus_tag LOCUS_08500 1597 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence408 917 486 gene locus_tag LOCUS_08510 917 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence409 97 1329 gene locus_tag LOCUS_08520 97 1329 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence410 >Feature sequence411 <1896 502 gene locus_tag LOCUS_08530 <1896 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120094.1:N-acetylgalactosamine-6-sulfatase >Feature sequence412 <1 605 gene locus_tag LOCUS_08540 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123682.1:arylsulfatase 743 1396 gene locus_tag LOCUS_08550 743 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 1816 1403 gene locus_tag LOCUS_08560 1816 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence413 1710 487 gene locus_tag LOCUS_08570 1710 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence414 <1 770 gene locus_tag LOCUS_08580 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GT6:4-hydroxy-tetrahydrodipicolinate synthase 1570 872 gene locus_tag LOCUS_08590 1570 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence415 979 494 gene locus_tag LOCUS_08600 979 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1095 1472 gene locus_tag LOCUS_08610 1095 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence416 >Feature sequence417 205 1725 gene locus_tag LOCUS_08620 205 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence418 1184 432 gene locus_tag LOCUS_08630 1184 432 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_08630 <1887 1315 gene locus_tag LOCUS_08640 <1887 1315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YHZ1:riboflavin biosynthesis protein RibBA >Feature sequence419 >Feature sequence420 >Feature sequence421 >Feature sequence422 <1 1045 gene locus_tag LOCUS_08650 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P5H0:4-hydroxythreonine-4-phosphate dehydrogenase >Feature sequence423 >Feature sequence424 1298 522 gene locus_tag LOCUS_08660 1298 522 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975324.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence425 253 1050 gene locus_tag LOCUS_08670 253 1050 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016586.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence426 8 622 gene locus_tag LOCUS_08680 8 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105095.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence427 <1862 949 gene locus_tag LOCUS_08690 <1862 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545126.1:penicillin-binding protein 2 >Feature sequence428 >Feature sequence429 127 741 gene locus_tag LOCUS_08700 gene rplY 127 741 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHZ1 protein_id gnl|my_center|LOCUS_08700 745 1350 gene locus_tag LOCUS_08710 gene pth 745 1350 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKV0 protein_id gnl|my_center|LOCUS_08710 >Feature sequence430 574 347 gene locus_tag LOCUS_08720 574 347 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_08720 1394 675 gene locus_tag LOCUS_08730 1394 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence431 >Feature sequence432 <1 762 gene locus_tag LOCUS_08740 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203533.1:sulfatase 1344 763 gene locus_tag LOCUS_08750 1344 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence433 <1842 964 gene locus_tag LOCUS_08760 <1842 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E391:cysteine--tRNA ligase >Feature sequence434 414 1226 gene locus_tag LOCUS_08770 414 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 >Feature sequence435 <1 1167 gene locus_tag LOCUS_08780 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256833.1:polysaccharide biosynthesis protein CapD >Feature sequence436 >Feature sequence437 450 1085 gene locus_tag LOCUS_08790 gene hisH 450 1085 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60599 protein_id gnl|my_center|LOCUS_08790 1512 1165 gene locus_tag LOCUS_08800 1512 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence438 171 914 gene locus_tag LOCUS_08810 171 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence439 361 1821 gene locus_tag LOCUS_08820 361 1821 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121006.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence440 >Feature sequence441 >Feature sequence442 21 1670 gene locus_tag LOCUS_08830 21 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence443 1459 401 gene locus_tag LOCUS_08840 1459 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence444 380 1129 gene locus_tag LOCUS_08850 380 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1262 1765 gene locus_tag LOCUS_08860 1262 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence445 323 250 gene locus_tag LOCUS_t00180 323 250 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 990 496 gene locus_tag LOCUS_08870 990 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1265 1696 gene locus_tag LOCUS_08880 1265 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence446 1574 384 gene locus_tag LOCUS_08890 1574 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence447 87 971 gene locus_tag LOCUS_08900 87 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence448 49 1353 gene locus_tag LOCUS_08910 49 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence449 <1 731 gene locus_tag LOCUS_08920 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIT6:anthranilate phosphoribosyltransferase 731 1510 gene locus_tag LOCUS_08930 gene trpC 731 1510 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence450 248 1090 gene locus_tag LOCUS_08940 248 1090 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5C3 protein_id gnl|my_center|LOCUS_08940 >Feature sequence451 1068 995 gene locus_tag LOCUS_t00190 1068 995 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence452 1617 967 gene locus_tag LOCUS_08950 gene rex 1617 967 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P32 protein_id gnl|my_center|LOCUS_08950 >Feature sequence453 <1799 719 gene locus_tag LOCUS_08960 <1799 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028721.1:phosphomannomutase/phosphoglucomutase >Feature sequence454 <1 849 gene locus_tag LOCUS_08970 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WF00:3-dehydroquinate synthase >Feature sequence455 >Feature sequence456 163 816 gene locus_tag LOCUS_08980 gene nqrD 163 816 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBZ3 protein_id gnl|my_center|LOCUS_08980 813 1508 gene locus_tag LOCUS_08990 gene nqrE 813 1508 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR7 protein_id gnl|my_center|LOCUS_08990 >Feature sequence457 >Feature sequence458 220 561 gene locus_tag LOCUS_09000 220 561 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence459 >Feature sequence460 270 1334 gene locus_tag LOCUS_09010 270 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence461 1607 645 gene locus_tag LOCUS_09020 1607 645 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362004.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence462 <1 1155 gene locus_tag LOCUS_09030 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943042.1:argininosuccinate synthase >Feature sequence463 <1 1241 gene locus_tag LOCUS_09040 <1 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120368.1:N-acetylgalactosamine-6-sulfatase >Feature sequence464 <1776 391 gene locus_tag LOCUS_09050 <1776 391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124071.1:iduronate-2-sulfatase >Feature sequence465 <1 1497 gene locus_tag LOCUS_09060 <1 1497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5HYC5:ribonuclease R >Feature sequence466 <1 1053 gene locus_tag LOCUS_09070 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGI3:alanine racemase >Feature sequence467 <1771 778 gene locus_tag LOCUS_09080 <1771 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709406.1:GlcNAc transferase >Feature sequence468 <1768 757 gene locus_tag LOCUS_09090 <1768 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KQI5:arginine--tRNA ligase >Feature sequence469 >Feature sequence470 <1 807 gene locus_tag LOCUS_09100 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YFY7:glutamate racemase 817 1701 gene locus_tag LOCUS_09110 817 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence471 174 917 gene locus_tag LOCUS_09120 174 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532007.1 protein_id gnl|my_center|LOCUS_09120 914 1471 gene locus_tag LOCUS_09130 gene hpt 914 1471 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327769.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence472 >Feature sequence473 143 430 gene locus_tag LOCUS_09140 143 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 923 540 gene locus_tag LOCUS_09150 923 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence474 <1 1136 gene locus_tag LOCUS_09160 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O51120:V-type ATP synthase beta chain >Feature sequence475 1050 316 gene locus_tag LOCUS_09170 1050 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392826.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence476 665 192 gene locus_tag LOCUS_09180 gene ispF 665 192 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR3 protein_id gnl|my_center|LOCUS_09180 >Feature sequence477 >Feature sequence478 1250 834 gene locus_tag LOCUS_09190 1250 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1516 1250 gene locus_tag LOCUS_09200 1516 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence479 >Feature sequence480 >Feature sequence481 1521 115 gene locus_tag LOCUS_09210 1521 115 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378927.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence482 <1 1642 gene locus_tag LOCUS_09220 <1 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UGK9:signal peptidase I >Feature sequence483 >Feature sequence484 905 600 gene locus_tag LOCUS_09230 gene hup 905 600 CDS product DNA-binding protein HU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P36206 protein_id gnl|my_center|LOCUS_09230 <1738 1054 gene locus_tag LOCUS_09240 <1738 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203586.1:nucleotidyltransferase >Feature sequence485 >Feature sequence486 <1727 772 gene locus_tag LOCUS_09250 <1727 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P45043:xylose operon regulatory protein >Feature sequence487 662 1684 gene locus_tag LOCUS_09260 662 1684 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence488 818 492 gene locus_tag LOCUS_09270 818 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 <1724 873 gene locus_tag LOCUS_09280 <1724 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328284.1:type IV pilus biogenesis protein PilC >Feature sequence489 1599 265 gene locus_tag LOCUS_09290 1599 265 CDS product HMGL-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252961.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence490 <1 1014 gene locus_tag LOCUS_09300 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121448.1:N-acetylgalactosamine-6-sulfatase <1720 1200 gene locus_tag LOCUS_09310 <1720 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036701.1:acetylhydrolase >Feature sequence491 >Feature sequence492 98 1135 gene locus_tag LOCUS_09320 98 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence493 >Feature sequence494 >Feature sequence495 366 1160 gene locus_tag LOCUS_09330 gene dapB1 366 1160 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGJ4 protein_id gnl|my_center|LOCUS_09330 >Feature sequence496 <1 922 gene locus_tag LOCUS_09340 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003732630.1:ABC transporter ATP-binding protein >Feature sequence497 >Feature sequence498 >Feature sequence499 >Feature sequence500 <1 750 gene locus_tag LOCUS_09350 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q727A5:glutamine--tRNA ligase >Feature sequence501 1459 1181 gene locus_tag LOCUS_09360 1459 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence502 1704 1381 gene locus_tag LOCUS_09370 1704 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence503 392 811 gene locus_tag LOCUS_09380 392 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1186 1305 gene locus_tag LOCUS_09390 1186 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence504 >Feature sequence505 >Feature sequence506 465 1622 gene locus_tag LOCUS_09400 465 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence507 >Feature sequence508 <1 1306 gene locus_tag LOCUS_09410 <1 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119603.1:arylsulfatase 1688 1404 gene locus_tag LOCUS_09420 1688 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence509 1668 679 gene locus_tag LOCUS_09430 1668 679 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence510 >Feature sequence511 1001 570 gene locus_tag LOCUS_09440 1001 570 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222658.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence512 <1 656 gene locus_tag LOCUS_09450 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E2K5:aspartate carbamoyltransferase >Feature sequence513 >Feature sequence514 1 324 gene locus_tag LOCUS_09460 1 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 >Feature sequence515 1535 135 gene locus_tag LOCUS_09470 1535 135 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815237.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence516 347 1018 gene locus_tag LOCUS_09480 gene tolQ 347 1018 CDS product TolQ-type transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120828.1 protein_id gnl|my_center|LOCUS_09480 1079 1627 gene locus_tag LOCUS_09490 1079 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence517 1368 148 gene locus_tag LOCUS_09500 gene metK 1368 148 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61946 protein_id gnl|my_center|LOCUS_09500 >Feature sequence518 677 222 gene locus_tag LOCUS_09510 677 222 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214726.1 protein_id gnl|my_center|LOCUS_09510 1479 679 gene locus_tag LOCUS_09520 gene moaA 1479 679 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGL2 protein_id gnl|my_center|LOCUS_09520 >Feature sequence519 294 1178 gene locus_tag LOCUS_09530 294 1178 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence520 <1 1071 gene locus_tag LOCUS_09540 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257071.1:NADH dehydrogenase >Feature sequence521 523 245 gene locus_tag LOCUS_09550 523 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 <1665 576 gene locus_tag LOCUS_09560 <1665 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121186.1:UDP-N-acetylhexosamine pyrophosphorylase >Feature sequence522 360 695 gene locus_tag LOCUS_09570 360 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 750 1394 gene locus_tag LOCUS_09580 750 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09580 >Feature sequence523 426 1406 gene locus_tag LOCUS_09590 426 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence524 1002 82 gene locus_tag LOCUS_09600 1002 82 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289860.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence525 >Feature sequence526 >Feature sequence527 261 1208 gene locus_tag LOCUS_09610 261 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence528 927 319 gene locus_tag LOCUS_09620 927 319 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KL8 protein_id gnl|my_center|LOCUS_09620 >Feature sequence529 >Feature sequence530 >Feature sequence531 1265 171 gene locus_tag LOCUS_09630 1265 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528090.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence532 128 346 gene locus_tag LOCUS_09640 128 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 339 716 gene locus_tag LOCUS_09650 339 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 713 910 gene locus_tag LOCUS_09660 713 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 837 1124 gene locus_tag LOCUS_09670 837 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1613 1125 gene locus_tag LOCUS_09680 1613 1125 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence533 >Feature sequence534 >Feature sequence535 191 820 gene locus_tag LOCUS_09690 191 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence536 1090 1233 gene locus_tag LOCUS_09700 1090 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence537 847 1500 gene locus_tag LOCUS_09710 847 1500 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014470.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence538 >Feature sequence539 >Feature sequence540 369 800 gene locus_tag LOCUS_09720 369 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 797 1630 gene locus_tag LOCUS_09730 797 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence541 473 949 gene locus_tag LOCUS_09740 gene rpsG 473 949 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN31 protein_id gnl|my_center|LOCUS_09740 >Feature sequence542 >Feature sequence543 >Feature sequence544 >Feature sequence545 <1 700 gene locus_tag LOCUS_09750 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023359.1:mechanosensitive ion channel protein MscS <1616 729 gene locus_tag LOCUS_09760 <1616 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125281.1:acetoacetate metabolism regulatory protein AtoC >Feature sequence546 >Feature sequence547 >Feature sequence548 >Feature sequence549 1 150 gene locus_tag LOCUS_09770 1 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 155 1141 gene locus_tag LOCUS_09780 155 1141 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence550 677 3 gene locus_tag LOCUS_09790 677 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 814 731 gene locus_tag LOCUS_t00200 814 731 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1078 1563 gene locus_tag LOCUS_09800 1078 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence551 690 94 gene locus_tag LOCUS_09810 690 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 <1606 687 gene locus_tag LOCUS_09820 <1606 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546458.1:ribonucleoside triphosphate reductase >Feature sequence552 <1 797 gene locus_tag LOCUS_09830 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120976.1:XylR family transcriptional regulator >Feature sequence553 365 195 gene locus_tag LOCUS_09840 gene frx-2 365 195 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943346.1 protein_id gnl|my_center|LOCUS_09840 523 993 gene locus_tag LOCUS_09850 523 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 998 1408 gene locus_tag LOCUS_09860 998 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence554 1035 244 gene locus_tag LOCUS_09870 gene coaX 1035 244 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S560 protein_id gnl|my_center|LOCUS_09870 1181 1109 gene locus_tag LOCUS_t00210 1181 1109 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence555 >Feature sequence556 >Feature sequence557 238 810 gene locus_tag LOCUS_09880 gene folE 238 810 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJJ7 protein_id gnl|my_center|LOCUS_09880 >Feature sequence558 <1 822 gene locus_tag LOCUS_09890 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q746Y7:glutamyl-tRNA(Gln) amidotransferase subunit A 1585 902 gene locus_tag LOCUS_09900 1585 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence559 <1 660 gene locus_tag LOCUS_09910 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BF6:bifunctional protein HldE >Feature sequence560 <1594 508 gene locus_tag LOCUS_09920 <1594 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123899.1:type IV fimbrial assembly protein PilB >Feature sequence561 40 1002 gene locus_tag LOCUS_09930 gene pmi 40 1002 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence562 508 281 gene locus_tag LOCUS_09940 508 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 691 512 gene locus_tag LOCUS_09950 691 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1134 874 gene locus_tag LOCUS_09960 gene rpmB 1134 874 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q82ZE4 protein_id gnl|my_center|LOCUS_09960 >Feature sequence563 753 1139 gene locus_tag LOCUS_09970 753 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 >Feature sequence564 121 249 gene locus_tag LOCUS_09980 121 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence565 >Feature sequence566 <1582 196 gene locus_tag LOCUS_09990 <1582 196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5I619:DNA primase >Feature sequence567 <1581 723 gene locus_tag LOCUS_10000 <1581 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KPG4:phospho-N-acetylmuramoyl-pentapeptide-transferase >Feature sequence568 <1578 848 gene locus_tag LOCUS_10010 <1578 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024467.1:shikimate dehydrogenase >Feature sequence569 <1 976 gene locus_tag LOCUS_10020 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103106.1:DNA polymerase I 1510 977 gene locus_tag LOCUS_10030 1510 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence570 >Feature sequence571 756 1376 gene locus_tag LOCUS_10040 756 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence572 <1 934 gene locus_tag LOCUS_10050 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107277.1:beta-N-acetylhexosaminidase >Feature sequence573 >Feature sequence574 >Feature sequence575 929 480 gene locus_tag LOCUS_10060 gene dut 929 480 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61908 protein_id gnl|my_center|LOCUS_10060 <1561 929 gene locus_tag LOCUS_10070 <1561 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121990.1:flavoprotein >Feature sequence576 818 93 gene locus_tag LOCUS_10080 818 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1252 845 gene locus_tag LOCUS_10090 1252 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence577 >Feature sequence578 <1 1284 gene locus_tag LOCUS_10100 <1 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q73M28:V-type ATP synthase alpha chain >Feature sequence579 894 541 gene locus_tag LOCUS_10110 894 541 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887809.1 protein_id gnl|my_center|LOCUS_10110 1292 924 gene locus_tag LOCUS_10120 1292 924 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918812.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence580 191 637 gene locus_tag LOCUS_10130 191 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10130 760 1326 gene locus_tag LOCUS_10140 760 1326 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228166.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence581 >Feature sequence582 <1 740 gene locus_tag LOCUS_10150 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943552.1:5-methyltetrahydrofolate--homocysteine methyltransferase 759 1406 gene locus_tag LOCUS_10160 759 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence583 >Feature sequence584 >Feature sequence585 <1 966 gene locus_tag LOCUS_10170 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120094.1:N-acetylgalactosamine-6-sulfatase >Feature sequence586 <1531 588 gene locus_tag LOCUS_10180 <1531 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120005.1:protein-export membrane protein SecD >Feature sequence587 244 942 gene locus_tag LOCUS_10190 244 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence588 >Feature sequence589 1529 735 gene locus_tag LOCUS_10200 1529 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence590 <1529 529 gene locus_tag LOCUS_10210 <1529 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036701.1:acetylhydrolase >Feature sequence591 1444 1040 gene locus_tag LOCUS_10220 1444 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence592 >Feature sequence593 86 454 gene locus_tag LOCUS_10230 gene panD 86 454 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58285 protein_id gnl|my_center|LOCUS_10230 >Feature sequence594 >Feature sequence595 >Feature sequence596 75 356 gene locus_tag LOCUS_10240 75 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 370 567 gene locus_tag LOCUS_10250 370 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 819 1106 gene locus_tag LOCUS_10260 819 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1072 1332 gene locus_tag LOCUS_10270 1072 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1507 1388 gene locus_tag LOCUS_10280 1507 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence597 <1 973 gene locus_tag LOCUS_10290 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJ31:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence598 <1510 872 gene locus_tag LOCUS_10300 <1510 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72AA6:thiamine-phosphate synthase >Feature sequence599 658 733 gene locus_tag LOCUS_t00220 658 733 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 <1508 974 gene locus_tag LOCUS_10310 <1508 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932621.1:cob(I)alamin adenosyltransferase >Feature sequence600 >Feature sequence601 477 112 gene locus_tag LOCUS_10320 477 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1106 534 gene locus_tag LOCUS_10330 gene ribH 1106 534 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LG8 protein_id gnl|my_center|LOCUS_10330 1303 1466 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq catccctttcagcggcgtcaggtcggtcactt >Feature sequence602