>Feature sequence001 276 3482 gene locus_tag LOCUS_00010 276 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4969 3479 gene locus_tag LOCUS_00020 4969 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5407 5994 gene locus_tag LOCUS_00030 5407 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 protein_id gnl|my_center|LOCUS_00030 7271 6000 gene locus_tag LOCUS_00040 7271 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_00040 7390 7668 gene locus_tag LOCUS_00050 7390 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7744 8685 gene locus_tag LOCUS_00060 7744 8685 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963494.1 protein_id gnl|my_center|LOCUS_00060 8696 10201 gene locus_tag LOCUS_00070 8696 10201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10266 11528 gene locus_tag LOCUS_00080 10266 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12853 11540 gene locus_tag LOCUS_00090 12853 11540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13154 15358 gene locus_tag LOCUS_00100 13154 15358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 15360 15734 gene locus_tag LOCUS_00110 15360 15734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 16155 15997 gene locus_tag LOCUS_00120 16155 15997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16154 17374 gene locus_tag LOCUS_00130 gene tolQ 16154 17374 CDS product biopolymer transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118102.1 protein_id gnl|my_center|LOCUS_00130 17434 19869 gene locus_tag LOCUS_00140 17434 19869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 19879 20952 gene locus_tag LOCUS_00150 19879 20952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324693.1 protein_id gnl|my_center|LOCUS_00150 22249 20957 gene locus_tag LOCUS_00160 gene pfp 22249 20957 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYC5 protein_id gnl|my_center|LOCUS_00160 22137 22388 gene locus_tag LOCUS_00170 22137 22388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 24190 22385 gene locus_tag LOCUS_00180 24190 22385 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123401.1 protein_id gnl|my_center|LOCUS_00180 26221 24374 gene locus_tag LOCUS_00190 26221 24374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 26369 28234 gene locus_tag LOCUS_00200 26369 28234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 28346 29740 gene locus_tag LOCUS_00210 28346 29740 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118487.1 protein_id gnl|my_center|LOCUS_00210 29801 31216 gene locus_tag LOCUS_00220 29801 31216 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_00220 32210 31188 gene locus_tag LOCUS_00230 32210 31188 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121415.1 protein_id gnl|my_center|LOCUS_00230 33264 32323 gene locus_tag LOCUS_00240 gene ispH 33264 32323 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULU1 protein_id gnl|my_center|LOCUS_00240 33715 33386 gene locus_tag LOCUS_00250 33715 33386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 33876 34748 gene locus_tag LOCUS_00260 gene argB 33876 34748 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQZ8 protein_id gnl|my_center|LOCUS_00260 34782 35957 gene locus_tag LOCUS_00270 gene argD 34782 35957 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG65 protein_id gnl|my_center|LOCUS_00270 36013 36936 gene locus_tag LOCUS_00280 gene argF 36013 36936 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQZ6 protein_id gnl|my_center|LOCUS_00280 36961 37704 gene locus_tag LOCUS_00290 gene rph 36961 37704 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URE2 protein_id gnl|my_center|LOCUS_00290 37801 38775 gene locus_tag LOCUS_00300 37801 38775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 39048 38779 gene locus_tag LOCUS_00310 39048 38779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 39244 39834 gene locus_tag LOCUS_00320 39244 39834 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121754.1 protein_id gnl|my_center|LOCUS_00320 40670 39837 gene locus_tag LOCUS_00330 40670 39837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 41560 40682 gene locus_tag LOCUS_00340 gene murB 41560 40682 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK77 protein_id gnl|my_center|LOCUS_00340 41718 42407 gene locus_tag LOCUS_00350 41718 42407 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876732.1 protein_id gnl|my_center|LOCUS_00350 43455 42418 gene locus_tag LOCUS_00360 43455 42418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 44504 43512 gene locus_tag LOCUS_00370 44504 43512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090946.1 protein_id gnl|my_center|LOCUS_00370 46033 44576 gene locus_tag LOCUS_00380 46033 44576 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902142.1 protein_id gnl|my_center|LOCUS_00380 46337 46990 gene locus_tag LOCUS_00390 46337 46990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 47018 47806 gene locus_tag LOCUS_00400 47018 47806 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118954.1 protein_id gnl|my_center|LOCUS_00400 47988 48443 gene locus_tag LOCUS_00410 47988 48443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 49642 48440 gene locus_tag LOCUS_00420 gene bioF 49642 48440 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66875 protein_id gnl|my_center|LOCUS_00420 50745 49663 gene locus_tag LOCUS_00430 gene bioB 50745 49663 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT7 protein_id gnl|my_center|LOCUS_00430 51033 50800 gene locus_tag LOCUS_00440 51033 50800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 51709 51023 gene locus_tag LOCUS_00450 51709 51023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 53440 51986 gene locus_tag LOCUS_00460 53440 51986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_00460 55698 53437 gene locus_tag LOCUS_00470 55698 53437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 57791 55713 gene locus_tag LOCUS_00480 gene butB 57791 55713 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122380.1 protein_id gnl|my_center|LOCUS_00480 58611 58111 gene locus_tag LOCUS_00490 58611 58111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 61254 58630 gene locus_tag LOCUS_00500 61254 58630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 61439 62854 gene locus_tag LOCUS_00510 61439 62854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 63323 62961 gene locus_tag LOCUS_00520 63323 62961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 66141 63529 gene locus_tag LOCUS_00530 66141 63529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 67401 66268 gene locus_tag LOCUS_00540 gene aspC 67401 66268 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG06 protein_id gnl|my_center|LOCUS_00540 68664 67426 gene locus_tag LOCUS_00550 68664 67426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 69556 68708 gene locus_tag LOCUS_00560 69556 68708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 69735 72746 gene locus_tag LOCUS_00570 gene putA 69735 72746 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142749.1 protein_id gnl|my_center|LOCUS_00570 72770 73711 gene locus_tag LOCUS_00580 72770 73711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 73912 73721 gene locus_tag LOCUS_00590 73912 73721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 75646 74108 gene locus_tag LOCUS_00600 75646 74108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 76946 75687 gene locus_tag LOCUS_00610 gene proA 76946 75687 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNV2 protein_id gnl|my_center|LOCUS_00610 78018 76972 gene locus_tag LOCUS_00620 78018 76972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 78885 78040 gene locus_tag LOCUS_00630 78885 78040 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_00630 79772 78912 gene locus_tag LOCUS_00640 gene folP 79772 78912 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJQ5 protein_id gnl|my_center|LOCUS_00640 80339 79785 gene locus_tag LOCUS_00650 80339 79785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 81760 80438 gene locus_tag LOCUS_00660 81760 80438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 82536 81751 gene locus_tag LOCUS_00670 82536 81751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 82994 82551 gene locus_tag LOCUS_00680 gene ybeY 82994 82551 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T3 protein_id gnl|my_center|LOCUS_00680 83964 83035 gene locus_tag LOCUS_00690 gene parA 83964 83035 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_00690 84179 85183 gene locus_tag LOCUS_00700 84179 85183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 85222 85992 gene locus_tag LOCUS_00710 85222 85992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 88555 85994 gene locus_tag LOCUS_00720 88555 85994 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_00720 88816 89754 gene locus_tag LOCUS_00730 88816 89754 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_00730 89959 90822 gene locus_tag LOCUS_00740 gene tolQ 89959 90822 CDS product tolQ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119635.1 protein_id gnl|my_center|LOCUS_00740 90924 91451 gene locus_tag LOCUS_00750 90924 91451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 91448 91969 gene locus_tag LOCUS_00760 91448 91969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 91985 93187 gene locus_tag LOCUS_00770 91985 93187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 93248 95068 gene locus_tag LOCUS_00780 93248 95068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 95264 97498 gene locus_tag LOCUS_00790 95264 97498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 97553 98434 gene locus_tag LOCUS_00800 gene fabI 97553 98434 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871451.1 protein_id gnl|my_center|LOCUS_00800 99499 98447 gene locus_tag LOCUS_00810 99499 98447 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192663.1 protein_id gnl|my_center|LOCUS_00810 99722 101185 gene locus_tag LOCUS_00820 gene gnd 99722 101185 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43774 protein_id gnl|my_center|LOCUS_00820 103718 101226 gene locus_tag LOCUS_00830 gene hrpB 103718 101226 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119679.1 protein_id gnl|my_center|LOCUS_00830 104361 103762 gene locus_tag LOCUS_00840 104361 103762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 104926 104540 gene locus_tag LOCUS_00850 104926 104540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 105102 106607 gene locus_tag LOCUS_00860 gene trpE 105102 106607 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_00860 107822 106611 gene locus_tag LOCUS_00870 107822 106611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_00870 109185 107803 gene locus_tag LOCUS_00880 109185 107803 CDS product DNA repair helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890488.1 protein_id gnl|my_center|LOCUS_00880 112640 109206 gene locus_tag LOCUS_00890 112640 109206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 116001 112648 gene locus_tag LOCUS_00900 gene acrB 116001 112648 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947422.1 protein_id gnl|my_center|LOCUS_00900 117339 116023 gene locus_tag LOCUS_00910 117339 116023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 117492 118079 gene locus_tag LOCUS_00920 117492 118079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 118258 119208 gene locus_tag LOCUS_00930 gene prs 118258 119208 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPM4 protein_id gnl|my_center|LOCUS_00930 120330 119221 gene locus_tag LOCUS_00940 120330 119221 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085059.1 protein_id gnl|my_center|LOCUS_00940 121889 120327 gene locus_tag LOCUS_00950 121889 120327 CDS product D-ribose transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528380.1 protein_id gnl|my_center|LOCUS_00950 122965 121886 gene locus_tag LOCUS_00960 122965 121886 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085057.1 protein_id gnl|my_center|LOCUS_00960 123809 123078 gene locus_tag LOCUS_00970 123809 123078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 124826 123936 gene locus_tag LOCUS_00980 gene adhP 124826 123936 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053082.1 protein_id gnl|my_center|LOCUS_00980 125093 127957 gene locus_tag LOCUS_00990 125093 127957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 127998 129698 gene locus_tag LOCUS_01000 127998 129698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 129747 130517 gene locus_tag LOCUS_01010 129747 130517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_01010 >Feature sequence002 2678 1026 gene locus_tag LOCUS_01020 2678 1026 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119180.1 protein_id gnl|my_center|LOCUS_01020 3459 2737 gene locus_tag LOCUS_01030 3459 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 3642 4727 gene locus_tag LOCUS_01040 gene purM 3642 4727 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI59 protein_id gnl|my_center|LOCUS_01040 5411 4731 gene locus_tag LOCUS_01050 5411 4731 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_01050 6460 5411 gene locus_tag LOCUS_01060 6460 5411 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123518.1 protein_id gnl|my_center|LOCUS_01060 6609 9239 gene locus_tag LOCUS_01070 6609 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 9279 11369 gene locus_tag LOCUS_01080 9279 11369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_01080 13192 11375 gene locus_tag LOCUS_01090 13192 11375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 15021 13189 gene locus_tag LOCUS_01100 15021 13189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 15206 16663 gene locus_tag LOCUS_01110 15206 16663 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_01110 16664 18079 gene locus_tag LOCUS_01120 16664 18079 CDS product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_01120 18076 19449 gene locus_tag LOCUS_01130 18076 19449 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_01130 19870 19682 gene locus_tag LOCUS_01140 19870 19682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 19874 21271 gene locus_tag LOCUS_01150 19874 21271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 22078 24567 gene locus_tag LOCUS_01160 22078 24567 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_01160 24600 24821 gene locus_tag LOCUS_01170 24600 24821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 24808 25536 gene locus_tag LOCUS_01180 24808 25536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020696.1 protein_id gnl|my_center|LOCUS_01180 26005 25667 gene locus_tag LOCUS_01190 gene phnA 26005 25667 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944048.1 protein_id gnl|my_center|LOCUS_01190 26190 26102 gene locus_tag LOCUS_t00010 26190 26102 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 26326 26985 gene locus_tag LOCUS_01200 26326 26985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 28083 26995 gene locus_tag LOCUS_01210 28083 26995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 28280 29446 gene locus_tag LOCUS_01220 28280 29446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 30378 29443 gene locus_tag LOCUS_01230 gene cheY 30378 29443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328012.1 protein_id gnl|my_center|LOCUS_01230 30809 31708 gene locus_tag LOCUS_01240 30809 31708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087510.1 protein_id gnl|my_center|LOCUS_01240 31705 34647 gene locus_tag LOCUS_01250 31705 34647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 34811 35956 gene locus_tag LOCUS_01260 34811 35956 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_01260 39009 35983 gene locus_tag LOCUS_01270 39009 35983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 39952 39206 gene locus_tag LOCUS_01280 39952 39206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 41074 40190 gene locus_tag LOCUS_01290 41074 40190 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_01290 41827 41099 gene locus_tag LOCUS_01300 41827 41099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 42088 42160 gene locus_tag LOCUS_t00020 42088 42160 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 42319 42471 gene locus_tag LOCUS_01310 42319 42471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 43129 42536 gene locus_tag LOCUS_01320 43129 42536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 44612 43296 gene locus_tag LOCUS_01330 44612 43296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122547.1 protein_id gnl|my_center|LOCUS_01330 46908 44662 gene locus_tag LOCUS_01340 46908 44662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_01340 47224 48864 gene locus_tag LOCUS_01350 47224 48864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 48885 50171 gene locus_tag LOCUS_01360 48885 50171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_01360 50168 51331 gene locus_tag LOCUS_01370 50168 51331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 51781 51362 gene locus_tag LOCUS_01380 51781 51362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 52398 51901 gene locus_tag LOCUS_01390 52398 51901 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705180.1 protein_id gnl|my_center|LOCUS_01390 54217 52403 gene locus_tag LOCUS_01400 gene pepF 54217 52403 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_01400 54937 54233 gene locus_tag LOCUS_01410 gene mgtC 54937 54233 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899032.1 protein_id gnl|my_center|LOCUS_01410 55072 55785 gene locus_tag LOCUS_01420 55072 55785 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142748.1 protein_id gnl|my_center|LOCUS_01420 56631 55792 gene locus_tag LOCUS_01430 56631 55792 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986648.1 protein_id gnl|my_center|LOCUS_01430 57836 56628 gene locus_tag LOCUS_01440 57836 56628 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_01440 58033 59298 gene locus_tag LOCUS_01450 gene ribBA 58033 59298 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHZ1 protein_id gnl|my_center|LOCUS_01450 60771 59302 gene locus_tag LOCUS_01460 60771 59302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 61089 60808 gene locus_tag LOCUS_01470 gene rpoZ 61089 60808 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP93 protein_id gnl|my_center|LOCUS_01470 61685 61095 gene locus_tag LOCUS_01480 gene gmk 61685 61095 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F775 protein_id gnl|my_center|LOCUS_01480 62568 61675 gene locus_tag LOCUS_01490 62568 61675 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121239.1 protein_id gnl|my_center|LOCUS_01490 63222 62605 gene locus_tag LOCUS_01500 63222 62605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 64250 64486 gene locus_tag LOCUS_01510 64250 64486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 64483 64689 gene locus_tag LOCUS_01520 64483 64689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01520 64655 64870 gene locus_tag LOCUS_01530 64655 64870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01530 65054 65284 gene locus_tag LOCUS_01540 65054 65284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 65584 66915 gene locus_tag LOCUS_01550 65584 66915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 67018 69564 gene locus_tag LOCUS_01560 67018 69564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 70403 69612 gene locus_tag LOCUS_01570 70403 69612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 70915 70463 gene locus_tag LOCUS_01580 70915 70463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 71323 71772 gene locus_tag LOCUS_01590 71323 71772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 71828 72775 gene locus_tag LOCUS_01600 71828 72775 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_01600 73560 72940 gene locus_tag LOCUS_01610 73560 72940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 protein_id gnl|my_center|LOCUS_01610 74625 73804 gene locus_tag LOCUS_01620 74625 73804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 76650 74674 gene locus_tag LOCUS_01630 76650 74674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 78861 76684 gene locus_tag LOCUS_01640 78861 76684 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_01640 80500 78962 gene locus_tag LOCUS_01650 80500 78962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 82003 81320 gene locus_tag LOCUS_01660 82003 81320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01660 >Feature sequence003 413 1135 gene locus_tag LOCUS_01670 413 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 1902 1630 gene locus_tag LOCUS_01680 1902 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 3197 1920 gene locus_tag LOCUS_01690 3197 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 protein_id gnl|my_center|LOCUS_01690 4792 3185 gene locus_tag LOCUS_01700 4792 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 4907 6148 gene locus_tag LOCUS_01710 4907 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118687.1 protein_id gnl|my_center|LOCUS_01710 6246 8351 gene locus_tag LOCUS_01720 6246 8351 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_01720 8364 9170 gene locus_tag LOCUS_01730 8364 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 9309 9899 gene locus_tag LOCUS_01740 9309 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 10023 12824 gene locus_tag LOCUS_01750 gene dnaK 10023 12824 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120598.1 protein_id gnl|my_center|LOCUS_01750 13750 12860 gene locus_tag LOCUS_01760 gene purC 13750 12860 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFN3 protein_id gnl|my_center|LOCUS_01760 13872 15974 gene locus_tag LOCUS_01770 gene fadJ 13872 15974 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4Z0 protein_id gnl|my_center|LOCUS_01770 16090 16560 gene locus_tag LOCUS_01780 16090 16560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_01780 16592 17857 gene locus_tag LOCUS_01790 16592 17857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118419.1 protein_id gnl|my_center|LOCUS_01790 18167 19192 gene locus_tag LOCUS_01800 18167 19192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_01800 19243 20397 gene locus_tag LOCUS_01810 19243 20397 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_01810 21785 20460 gene locus_tag LOCUS_01820 21785 20460 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120681.1 protein_id gnl|my_center|LOCUS_01820 22000 22461 gene locus_tag LOCUS_01830 22000 22461 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N76 protein_id gnl|my_center|LOCUS_01830 22584 23510 gene locus_tag LOCUS_01840 gene lolI 22584 23510 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_01840 23741 25639 gene locus_tag LOCUS_01850 gene flgI 23741 25639 CDS product flagellar P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120288.1 protein_id gnl|my_center|LOCUS_01850 25699 29337 gene locus_tag LOCUS_01860 gene smc 25699 29337 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQV4 protein_id gnl|my_center|LOCUS_01860 29484 30767 gene locus_tag LOCUS_01870 29484 30767 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FKI3 protein_id gnl|my_center|LOCUS_01870 31093 30764 gene locus_tag LOCUS_01880 31093 30764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 32390 31122 gene locus_tag LOCUS_01890 32390 31122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 33708 32545 gene locus_tag LOCUS_01900 gene folC 33708 32545 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_01900 36229 33968 gene locus_tag LOCUS_01910 36229 33968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 36998 36249 gene locus_tag LOCUS_01920 36998 36249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 37822 37235 gene locus_tag LOCUS_01930 37822 37235 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXS5 protein_id gnl|my_center|LOCUS_01930 39397 37832 gene locus_tag LOCUS_01940 39397 37832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 41019 39394 gene locus_tag LOCUS_01950 41019 39394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 41208 42704 gene locus_tag LOCUS_01960 gene g6pD 41208 42704 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVB9 protein_id gnl|my_center|LOCUS_01960 42797 43501 gene locus_tag LOCUS_01970 42797 43501 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364337.1 protein_id gnl|my_center|LOCUS_01970 43503 43865 gene locus_tag LOCUS_01980 43503 43865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 43956 45299 gene locus_tag LOCUS_01990 43956 45299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 46678 45296 gene locus_tag LOCUS_02000 46678 45296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 46837 47334 gene locus_tag LOCUS_02010 gene ilvN 46837 47334 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122509.1 protein_id gnl|my_center|LOCUS_02010 47334 47639 gene locus_tag LOCUS_02020 47334 47639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 48556 47642 gene locus_tag LOCUS_02030 48556 47642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_02030 48659 49003 gene locus_tag LOCUS_02040 48659 49003 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767882.1 protein_id gnl|my_center|LOCUS_02040 50220 49000 gene locus_tag LOCUS_02050 50220 49000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 50509 53454 gene locus_tag LOCUS_02060 50509 53454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 53451 53699 gene locus_tag LOCUS_02070 gene moaD 53451 53699 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDC0 protein_id gnl|my_center|LOCUS_02070 53706 54128 gene locus_tag LOCUS_02080 53706 54128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02080 54158 55204 gene locus_tag LOCUS_02090 gene moaA 54158 55204 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT69 protein_id gnl|my_center|LOCUS_02090 55770 55207 gene locus_tag LOCUS_02100 55770 55207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 56865 55987 gene locus_tag LOCUS_02110 gene ruvB 56865 55987 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPG4 protein_id gnl|my_center|LOCUS_02110 57685 57056 gene locus_tag LOCUS_02120 gene ruvA 57685 57056 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USB0 protein_id gnl|my_center|LOCUS_02120 58242 57682 gene locus_tag LOCUS_02130 gene ruvC 58242 57682 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US71 protein_id gnl|my_center|LOCUS_02130 59691 58264 gene locus_tag LOCUS_02140 gene cysS 59691 58264 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US70 protein_id gnl|my_center|LOCUS_02140 >Feature sequence004 3507 988 gene locus_tag LOCUS_02150 3507 988 CDS product surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_02150 3688 4764 gene locus_tag LOCUS_02160 gene celM 3688 4764 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121909.1 protein_id gnl|my_center|LOCUS_02160 4907 5419 gene locus_tag LOCUS_02170 4907 5419 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256305.1 protein_id gnl|my_center|LOCUS_02170 6352 5453 gene locus_tag LOCUS_02180 6352 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 9105 6370 gene locus_tag LOCUS_02190 9105 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 10314 9331 gene locus_tag LOCUS_02200 10314 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 11148 10444 gene locus_tag LOCUS_02210 11148 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 11315 11545 gene locus_tag LOCUS_02220 11315 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 11593 11820 gene locus_tag LOCUS_02230 11593 11820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 11821 13977 gene locus_tag LOCUS_02240 gene feoB-2 11821 13977 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGB2 protein_id gnl|my_center|LOCUS_02240 14007 14189 gene locus_tag LOCUS_02250 14007 14189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 14370 15314 gene locus_tag LOCUS_02260 gene ytcB 14370 15314 CDS product putative UDP-glucose epimerase YtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34886 protein_id gnl|my_center|LOCUS_02260 16293 15316 gene locus_tag LOCUS_02270 gene gluQ 16293 15316 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHE2 protein_id gnl|my_center|LOCUS_02270 17171 16290 gene locus_tag LOCUS_02280 17171 16290 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399742.1 protein_id gnl|my_center|LOCUS_02280 17286 17930 gene locus_tag LOCUS_02290 17286 17930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 17948 18280 gene locus_tag LOCUS_02300 17948 18280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142756.1 protein_id gnl|my_center|LOCUS_02300 19012 18272 gene locus_tag LOCUS_02310 gene ubiE 19012 18272 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117867.1 protein_id gnl|my_center|LOCUS_02310 20229 19024 gene locus_tag LOCUS_02320 20229 19024 CDS product S-adenosylmethionine--diacylglycerol 3-amino-3-carboxypropyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_02320 21572 20376 gene locus_tag LOCUS_02330 21572 20376 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970121.1 protein_id gnl|my_center|LOCUS_02330 21748 23718 gene locus_tag LOCUS_02340 21748 23718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141526.1 protein_id gnl|my_center|LOCUS_02340 23792 25726 gene locus_tag LOCUS_02350 23792 25726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 26389 25736 gene locus_tag LOCUS_02360 26389 25736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 26594 27793 gene locus_tag LOCUS_02370 26594 27793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 27823 28905 gene locus_tag LOCUS_02380 27823 28905 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_02380 29920 28895 gene locus_tag LOCUS_02390 29920 28895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 29981 30766 gene locus_tag LOCUS_02400 gene trpC 29981 30766 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKJ7 protein_id gnl|my_center|LOCUS_02400 30771 31796 gene locus_tag LOCUS_02410 30771 31796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 31891 33465 gene locus_tag LOCUS_02420 gene purH 31891 33465 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKJ8 protein_id gnl|my_center|LOCUS_02420 33538 34488 gene locus_tag LOCUS_02430 33538 34488 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_02430 34549 35781 gene locus_tag LOCUS_02440 34549 35781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 35797 36609 gene locus_tag LOCUS_02450 35797 36609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 37779 36613 gene locus_tag LOCUS_02460 37779 36613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 38701 37802 gene locus_tag LOCUS_02470 gene xerC 38701 37802 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQY6 protein_id gnl|my_center|LOCUS_02470 39017 38730 gene locus_tag LOCUS_02480 39017 38730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 39872 39174 gene locus_tag LOCUS_02490 39872 39174 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122587.1 protein_id gnl|my_center|LOCUS_02490 39995 40756 gene locus_tag LOCUS_02500 gene kdsB 39995 40756 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY2 protein_id gnl|my_center|LOCUS_02500 40881 42503 gene locus_tag LOCUS_02510 gene pyrG 40881 42503 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ86 protein_id gnl|my_center|LOCUS_02510 43335 42559 gene locus_tag LOCUS_02520 43335 42559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 44514 43462 gene locus_tag LOCUS_02530 gene mtnA 44514 43462 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKL8 protein_id gnl|my_center|LOCUS_02530 45302 44520 gene locus_tag LOCUS_02540 gene hisN 45302 44520 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS80 protein_id gnl|my_center|LOCUS_02540 47207 45318 gene locus_tag LOCUS_02550 47207 45318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 47542 48465 gene locus_tag LOCUS_02560 47542 48465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 49642 48488 gene locus_tag LOCUS_02570 gene lpxB 49642 48488 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119004.1 protein_id gnl|my_center|LOCUS_02570 50054 49737 gene locus_tag LOCUS_02580 50054 49737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 50136 50882 gene locus_tag LOCUS_02590 50136 50882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 52113 51139 gene locus_tag LOCUS_02600 gene hemH 52113 51139 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TEU9 protein_id gnl|my_center|LOCUS_02600 52504 52199 gene locus_tag LOCUS_02610 52504 52199 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_02610 52733 54127 gene locus_tag LOCUS_02620 52733 54127 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_02620 54214 55218 gene locus_tag LOCUS_02630 gene obg 54214 55218 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH6 protein_id gnl|my_center|LOCUS_02630 55218 55973 gene locus_tag LOCUS_02640 gene coaX 55218 55973 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIJ5 protein_id gnl|my_center|LOCUS_02640 >Feature sequence005 1305 4 gene locus_tag LOCUS_02650 1305 4 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_02650 2880 1339 gene locus_tag LOCUS_02660 2880 1339 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123371.1 protein_id gnl|my_center|LOCUS_02660 4172 2922 gene locus_tag LOCUS_02670 4172 2922 CDS product alkylhalidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117886.1 protein_id gnl|my_center|LOCUS_02670 4935 4390 gene locus_tag LOCUS_02680 4935 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120683.1 protein_id gnl|my_center|LOCUS_02680 6731 4932 gene locus_tag LOCUS_02690 6731 4932 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_02690 8589 6778 gene locus_tag LOCUS_02700 gene shc 8589 6778 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120685.1 protein_id gnl|my_center|LOCUS_02700 9773 8586 gene locus_tag LOCUS_02710 9773 8586 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122552.1 protein_id gnl|my_center|LOCUS_02710 10880 9810 gene locus_tag LOCUS_02720 10880 9810 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121488.1 protein_id gnl|my_center|LOCUS_02720 11346 10882 gene locus_tag LOCUS_02730 gene gcvH 11346 10882 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121110.1 protein_id gnl|my_center|LOCUS_02730 12688 11372 gene locus_tag LOCUS_02740 gene hemN 12688 11372 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_02740 12839 12922 gene locus_tag LOCUS_t00030 12839 12922 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12970 14328 gene locus_tag LOCUS_02750 12970 14328 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123590.1 protein_id gnl|my_center|LOCUS_02750 14476 14835 gene locus_tag LOCUS_02760 14476 14835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 16275 14839 gene locus_tag LOCUS_02770 16275 14839 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_02770 16496 16254 gene locus_tag LOCUS_02780 16496 16254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 16599 17525 gene locus_tag LOCUS_02790 gene nadA 16599 17525 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2Z1 protein_id gnl|my_center|LOCUS_02790 17541 18287 gene locus_tag LOCUS_02800 17541 18287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118740.1 protein_id gnl|my_center|LOCUS_02800 18541 18284 gene locus_tag LOCUS_02810 gene infA 18541 18284 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAJ3 protein_id gnl|my_center|LOCUS_02810 19688 18636 gene locus_tag LOCUS_02820 gene tal 19688 18636 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUN2 protein_id gnl|my_center|LOCUS_02820 20544 19858 gene locus_tag LOCUS_02830 20544 19858 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_02830 21562 20558 gene locus_tag LOCUS_02840 21562 20558 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_02840 21954 21580 gene locus_tag LOCUS_02850 21954 21580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 21932 22099 gene locus_tag LOCUS_02860 21932 22099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 22589 24439 gene locus_tag LOCUS_02870 22589 24439 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_02870 25533 24451 gene locus_tag LOCUS_02880 25533 24451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 25906 27186 gene locus_tag LOCUS_02890 25906 27186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 27223 30567 gene locus_tag LOCUS_02900 27223 30567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 30731 31507 gene locus_tag LOCUS_02910 30731 31507 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119081.1 protein_id gnl|my_center|LOCUS_02910 31532 31954 gene locus_tag LOCUS_02920 31532 31954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_02920 31951 32400 gene locus_tag LOCUS_02930 31951 32400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 32520 32592 gene locus_tag LOCUS_t00040 32520 32592 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 32720 32804 gene locus_tag LOCUS_t00050 32720 32804 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 32832 32902 gene locus_tag LOCUS_t00060 32832 32902 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32930 33001 gene locus_tag LOCUS_t00070 32930 33001 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 33169 34383 gene locus_tag LOCUS_02940 gene tuf 33169 34383 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ0 protein_id gnl|my_center|LOCUS_02940 34478 34630 gene locus_tag LOCUS_02950 gene rpmG1 34478 34630 CDS product 50S ribosomal protein L33 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66219 protein_id gnl|my_center|LOCUS_02950 34685 34759 gene locus_tag LOCUS_t00080 34685 34759 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 34868 36148 gene locus_tag LOCUS_02960 34868 36148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 36173 36814 gene locus_tag LOCUS_02970 gene nusG 36173 36814 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMY8 protein_id gnl|my_center|LOCUS_02970 36828 37292 gene locus_tag LOCUS_02980 gene rplK 36828 37292 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMY7 protein_id gnl|my_center|LOCUS_02980 37390 38223 gene locus_tag LOCUS_02990 gene rplA 37390 38223 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFW1 protein_id gnl|my_center|LOCUS_02990 38284 38856 gene locus_tag LOCUS_03000 gene rplJ 38284 38856 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE22 protein_id gnl|my_center|LOCUS_03000 38932 39342 gene locus_tag LOCUS_03010 gene rplL 38932 39342 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK76 protein_id gnl|my_center|LOCUS_03010 39544 39756 gene locus_tag LOCUS_03020 39544 39756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 39865 43614 gene locus_tag LOCUS_03030 gene rpoB 39865 43614 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URW6 protein_id gnl|my_center|LOCUS_03030 43734 48092 gene locus_tag LOCUS_03040 gene rpoC 43734 48092 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URW4 protein_id gnl|my_center|LOCUS_03040 48357 48629 gene locus_tag LOCUS_03050 48357 48629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 48669 49139 gene locus_tag LOCUS_03060 gene rpsG 48669 49139 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN31 protein_id gnl|my_center|LOCUS_03060 49236 51356 gene locus_tag LOCUS_03070 gene fusA 49236 51356 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121593.1 protein_id gnl|my_center|LOCUS_03070 51557 51892 gene locus_tag LOCUS_03080 gene rpsJ 51557 51892 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN22 protein_id gnl|my_center|LOCUS_03080 52078 52713 gene locus_tag LOCUS_03090 gene rplD 52078 52713 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN19 protein_id gnl|my_center|LOCUS_03090 52745 53074 gene locus_tag LOCUS_03100 gene rplW 52745 53074 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN18 protein_id gnl|my_center|LOCUS_03100 53116 53970 gene locus_tag LOCUS_03110 gene rplB 53116 53970 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN17 protein_id gnl|my_center|LOCUS_03110 54040 54312 gene locus_tag LOCUS_03120 gene rpsS 54040 54312 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN16 protein_id gnl|my_center|LOCUS_03120 >Feature sequence006 <1 536 gene locus_tag LOCUS_03130 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122175.1:metallopeptidase 620 1861 gene locus_tag LOCUS_03140 gene gltP 620 1861 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789589.1 protein_id gnl|my_center|LOCUS_03140 1875 3428 gene locus_tag LOCUS_03150 1875 3428 CDS product N-acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109363.1 protein_id gnl|my_center|LOCUS_03150 3631 6078 gene locus_tag LOCUS_03160 gene butB 3631 6078 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122380.1 protein_id gnl|my_center|LOCUS_03160 6092 7405 gene locus_tag LOCUS_03170 6092 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_03170 7405 9015 gene locus_tag LOCUS_03180 7405 9015 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122383.1 protein_id gnl|my_center|LOCUS_03180 9045 9848 gene locus_tag LOCUS_03190 9045 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 11249 9882 gene locus_tag LOCUS_03200 11249 9882 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117895.1 protein_id gnl|my_center|LOCUS_03200 11443 12015 gene locus_tag LOCUS_03210 11443 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 12242 12078 gene locus_tag LOCUS_03220 12242 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 12488 12300 gene locus_tag LOCUS_03230 12488 12300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 13243 12599 gene locus_tag LOCUS_03240 gene ubiE 13243 12599 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122034.1 protein_id gnl|my_center|LOCUS_03240 13202 13660 gene locus_tag LOCUS_03250 13202 13660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 13853 14074 gene locus_tag LOCUS_03260 13853 14074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 14216 16642 gene locus_tag LOCUS_03270 14216 16642 CDS product filamin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121212.1 protein_id gnl|my_center|LOCUS_03270 16739 18079 gene locus_tag LOCUS_03280 16739 18079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_03280 18119 19033 gene locus_tag LOCUS_03290 18119 19033 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ82 protein_id gnl|my_center|LOCUS_03290 19799 19053 gene locus_tag LOCUS_03300 19799 19053 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121775.1 protein_id gnl|my_center|LOCUS_03300 20266 19922 gene locus_tag LOCUS_03310 20266 19922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 21708 20398 gene locus_tag LOCUS_03320 21708 20398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 22190 22116 gene locus_tag LOCUS_t00090 22190 22116 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 22342 22268 gene locus_tag LOCUS_t00100 22342 22268 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 22563 24632 gene locus_tag LOCUS_03330 22563 24632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 24705 26936 gene locus_tag LOCUS_03340 gene ppk 24705 26936 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKH7 protein_id gnl|my_center|LOCUS_03340 26953 27642 gene locus_tag LOCUS_03350 26953 27642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 28289 27639 gene locus_tag LOCUS_03360 28289 27639 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_03360 28494 29336 gene locus_tag LOCUS_03370 28494 29336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 29361 29915 gene locus_tag LOCUS_03380 gene pyrE 29361 29915 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYX5 protein_id gnl|my_center|LOCUS_03380 30691 29912 gene locus_tag LOCUS_03390 30691 29912 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815002.1 protein_id gnl|my_center|LOCUS_03390 32451 30709 gene locus_tag LOCUS_03400 gene ndhD 32451 30709 CDS product NAD(P)H-quinone oxidoreductase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125219.1 protein_id gnl|my_center|LOCUS_03400 32605 33306 gene locus_tag LOCUS_03410 32605 33306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 33332 34522 gene locus_tag LOCUS_03420 gene truD 33332 34522 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545670.1 protein_id gnl|my_center|LOCUS_03420 34612 35061 gene locus_tag LOCUS_03430 34612 35061 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_03430 35180 35866 gene locus_tag LOCUS_03440 gene folE 35180 35866 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJJ7 protein_id gnl|my_center|LOCUS_03440 35874 36323 gene locus_tag LOCUS_03450 35874 36323 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966887.1 protein_id gnl|my_center|LOCUS_03450 37781 36390 gene locus_tag LOCUS_03460 37781 36390 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_03460 39117 37801 gene locus_tag LOCUS_03470 39117 37801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 40463 39099 gene locus_tag LOCUS_03480 40463 39099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 41543 40620 gene locus_tag LOCUS_03490 41543 40620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118058.1 protein_id gnl|my_center|LOCUS_03490 43013 41667 gene locus_tag LOCUS_03500 43013 41667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_03500 45120 43144 gene locus_tag LOCUS_03510 45120 43144 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085096.1 protein_id gnl|my_center|LOCUS_03510 46363 45113 gene locus_tag LOCUS_03520 46363 45113 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023979.1 protein_id gnl|my_center|LOCUS_03520 46714 47070 gene locus_tag LOCUS_03530 46714 47070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 47401 47078 gene locus_tag LOCUS_03540 47401 47078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 48205 47768 gene locus_tag LOCUS_03550 48205 47768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 50283 48409 gene locus_tag LOCUS_03560 gene gpi2 50283 48409 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_03560 50417 51439 gene locus_tag LOCUS_03570 gene thiG 50417 51439 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US84 protein_id gnl|my_center|LOCUS_03570 51501 51662 gene locus_tag LOCUS_03580 51501 51662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 >Feature sequence007 254 1618 gene locus_tag LOCUS_03590 254 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 1866 1666 gene locus_tag LOCUS_03600 1866 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 1776 3521 gene locus_tag LOCUS_03610 1776 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 3588 4571 gene locus_tag LOCUS_03620 3588 4571 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_03620 4597 5181 gene locus_tag LOCUS_03630 4597 5181 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_03630 5651 5199 gene locus_tag LOCUS_03640 5651 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 6519 5677 gene locus_tag LOCUS_03650 6519 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 7127 6636 gene locus_tag LOCUS_03660 gene mutT 7127 6636 CDS product 7,8-dihydro-8-oxoguanine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037309.1 protein_id gnl|my_center|LOCUS_03660 7444 7151 gene locus_tag LOCUS_03670 7444 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 8005 7547 gene locus_tag LOCUS_03680 8005 7547 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SM89 protein_id gnl|my_center|LOCUS_03680 8216 10438 gene locus_tag LOCUS_03690 8216 10438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 11219 10503 gene locus_tag LOCUS_03700 gene sodA 11219 10503 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q838I4 protein_id gnl|my_center|LOCUS_03700 11506 13623 gene locus_tag LOCUS_03710 gene tkt 11506 13623 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123963.1 protein_id gnl|my_center|LOCUS_03710 13627 14331 gene locus_tag LOCUS_03720 gene rpiA 13627 14331 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HHU6 protein_id gnl|my_center|LOCUS_03720 14361 15380 gene locus_tag LOCUS_03730 14361 15380 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_03730 15488 16231 gene locus_tag LOCUS_03740 15488 16231 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_03740 16255 16923 gene locus_tag LOCUS_03750 16255 16923 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TEQ9 protein_id gnl|my_center|LOCUS_03750 16959 17954 gene locus_tag LOCUS_03760 gene glk 16959 17954 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLF5 protein_id gnl|my_center|LOCUS_03760 18039 20729 gene locus_tag LOCUS_03770 18039 20729 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_03770 20816 22852 gene locus_tag LOCUS_03780 20816 22852 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378512.1 protein_id gnl|my_center|LOCUS_03780 22857 23909 gene locus_tag LOCUS_03790 22857 23909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 23982 24389 gene locus_tag LOCUS_03800 23982 24389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 24870 24403 gene locus_tag LOCUS_03810 24870 24403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 25045 27546 gene locus_tag LOCUS_03820 25045 27546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 27548 28933 gene locus_tag LOCUS_03830 27548 28933 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 protein_id gnl|my_center|LOCUS_03830 29009 29083 gene locus_tag LOCUS_t00110 29009 29083 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 29170 30504 gene locus_tag LOCUS_03840 29170 30504 CDS product quinohemoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117995.1 protein_id gnl|my_center|LOCUS_03840 30734 30883 gene locus_tag LOCUS_03850 30734 30883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 32570 30903 gene locus_tag LOCUS_03860 32570 30903 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_03860 33366 32686 gene locus_tag LOCUS_03870 33366 32686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974207.1 protein_id gnl|my_center|LOCUS_03870 33548 35497 gene locus_tag LOCUS_03880 gene fbp 33548 35497 CDS product fructose-1,6-bisphosphatase class 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97IR8 protein_id gnl|my_center|LOCUS_03880 35498 37003 gene locus_tag LOCUS_03890 35498 37003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 37027 38034 gene locus_tag LOCUS_03900 gene adhP 37027 38034 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_03900 39235 38156 gene locus_tag LOCUS_03910 39235 38156 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_03910 39406 41730 gene locus_tag LOCUS_03920 39406 41730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 41863 43548 gene locus_tag LOCUS_03930 gene ilvD 41863 43548 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F219 protein_id gnl|my_center|LOCUS_03930 43699 44085 gene locus_tag LOCUS_03940 43699 44085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 46507 44150 gene locus_tag LOCUS_03950 46507 44150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence008 <1 1252 gene locus_tag LOCUS_03960 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122437.1:cytochrome CBB3 2646 1291 gene locus_tag LOCUS_03970 2646 1291 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120681.1 protein_id gnl|my_center|LOCUS_03970 2894 3940 gene locus_tag LOCUS_03980 2894 3940 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_03980 4411 3956 gene locus_tag LOCUS_03990 gene cdd 4411 3956 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616222.1 protein_id gnl|my_center|LOCUS_03990 4515 5408 gene locus_tag LOCUS_04000 4515 5408 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_04000 6751 5483 gene locus_tag LOCUS_04010 6751 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 7789 7292 gene locus_tag LOCUS_04020 7789 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 8700 7801 gene locus_tag LOCUS_04030 gene ispE 8700 7801 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37550 protein_id gnl|my_center|LOCUS_04030 9759 8890 gene locus_tag LOCUS_04040 9759 8890 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_04040 9878 10269 gene locus_tag LOCUS_tm00010 9878 10269 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 10796 11575 gene locus_tag LOCUS_04050 10796 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 12968 11787 gene locus_tag LOCUS_04060 12968 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 13812 13012 gene locus_tag LOCUS_04070 13812 13012 CDS product DUF1445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869458.1 protein_id gnl|my_center|LOCUS_04070 14801 13809 gene locus_tag LOCUS_04080 14801 13809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147169.1 protein_id gnl|my_center|LOCUS_04080 15493 14798 gene locus_tag LOCUS_04090 15493 14798 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZ32 protein_id gnl|my_center|LOCUS_04090 15623 16123 gene locus_tag LOCUS_04100 15623 16123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 16147 16380 gene locus_tag LOCUS_04110 16147 16380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 17624 16524 gene locus_tag LOCUS_04120 17624 16524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 18665 17640 gene locus_tag LOCUS_04130 gene galM 18665 17640 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39840 protein_id gnl|my_center|LOCUS_04130 18756 19820 gene locus_tag LOCUS_04140 18756 19820 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_04140 19838 21409 gene locus_tag LOCUS_04150 19838 21409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 21596 22483 gene locus_tag LOCUS_04160 21596 22483 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385462.1 protein_id gnl|my_center|LOCUS_04160 22480 23214 gene locus_tag LOCUS_04170 gene znuC 22480 23214 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWB5 protein_id gnl|my_center|LOCUS_04170 23539 23225 gene locus_tag LOCUS_04180 23539 23225 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503304.1 protein_id gnl|my_center|LOCUS_04180 23654 23726 gene locus_tag LOCUS_t00120 23654 23726 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 23748 23993 gene locus_tag LOCUS_04190 23748 23993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 24087 26825 gene locus_tag LOCUS_04200 24087 26825 CDS product proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144124.1 protein_id gnl|my_center|LOCUS_04200 27521 26829 gene locus_tag LOCUS_04210 27521 26829 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_04210 27645 29528 gene locus_tag LOCUS_04220 gene htpG 27645 29528 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61185 protein_id gnl|my_center|LOCUS_04220 29547 30194 gene locus_tag LOCUS_04230 29547 30194 CDS product putative phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702362.1 protein_id gnl|my_center|LOCUS_04230 30245 31447 gene locus_tag LOCUS_04240 30245 31447 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_04240 32775 31495 gene locus_tag LOCUS_04250 32775 31495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_04250 34507 32822 gene locus_tag LOCUS_04260 34507 32822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 36838 34646 gene locus_tag LOCUS_04270 36838 34646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 36977 38083 gene locus_tag LOCUS_04280 gene aroB 36977 38083 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q57 protein_id gnl|my_center|LOCUS_04280 38100 39230 gene locus_tag LOCUS_04290 gene dprA 38100 39230 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_04290 39313 40125 gene locus_tag LOCUS_04300 39313 40125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_04300 42379 40193 gene locus_tag LOCUS_04310 gene glnN 42379 40193 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_04310 43906 42494 gene locus_tag LOCUS_04320 43906 42494 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG53 protein_id gnl|my_center|LOCUS_04320 44183 44695 gene locus_tag LOCUS_04330 44183 44695 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_04330 45714 44734 gene locus_tag LOCUS_04340 45714 44734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 46309 45731 gene locus_tag LOCUS_04350 46309 45731 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531317.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence009 489 1796 gene locus_tag LOCUS_04360 gene eno 489 1796 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HBF3 protein_id gnl|my_center|LOCUS_04360 1753 2031 gene locus_tag LOCUS_04370 1753 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 2033 2599 gene locus_tag LOCUS_04380 2033 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 2893 2639 gene locus_tag LOCUS_04390 2893 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 5940 3973 gene locus_tag LOCUS_04400 5940 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 9416 6066 gene locus_tag LOCUS_04410 9416 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 9611 10912 gene locus_tag LOCUS_04420 gene dinB 9611 10912 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJB3 protein_id gnl|my_center|LOCUS_04420 10958 11875 gene locus_tag LOCUS_04430 10958 11875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 11957 12931 gene locus_tag LOCUS_04440 11957 12931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 12973 13506 gene locus_tag LOCUS_04450 12973 13506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 13524 16157 gene locus_tag LOCUS_04460 13524 16157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 16877 16161 gene locus_tag LOCUS_04470 gene hisA 16877 16161 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60581 protein_id gnl|my_center|LOCUS_04470 17525 16905 gene locus_tag LOCUS_04480 gene hisH 17525 16905 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60599 protein_id gnl|my_center|LOCUS_04480 20676 17515 gene locus_tag LOCUS_04490 20676 17515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 21965 20676 gene locus_tag LOCUS_04500 21965 20676 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_04500 22843 23178 gene locus_tag LOCUS_04510 22843 23178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 23756 23193 gene locus_tag LOCUS_04520 gene aroK 23756 23193 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHI3 protein_id gnl|my_center|LOCUS_04520 25271 23775 gene locus_tag LOCUS_04530 25271 23775 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ72 protein_id gnl|my_center|LOCUS_04530 25417 26316 gene locus_tag LOCUS_04540 25417 26316 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120889.1 protein_id gnl|my_center|LOCUS_04540 26638 28944 gene locus_tag LOCUS_04550 gene ptsP 26638 28944 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941826.1 protein_id gnl|my_center|LOCUS_04550 29094 29009 gene locus_tag LOCUS_t00130 29094 29009 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29988 29149 gene locus_tag LOCUS_04560 29988 29149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 31659 30073 gene locus_tag LOCUS_04570 31659 30073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 33756 31666 gene locus_tag LOCUS_04580 gene mdlB 33756 31666 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172203.1 protein_id gnl|my_center|LOCUS_04580 34074 34556 gene locus_tag LOCUS_04590 34074 34556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 34770 34952 gene locus_tag LOCUS_04600 34770 34952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 36518 34980 gene locus_tag LOCUS_04610 gene hemD 36518 34980 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121206.1 protein_id gnl|my_center|LOCUS_04610 37642 36548 gene locus_tag LOCUS_04620 gene tatC 37642 36548 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFI8 protein_id gnl|my_center|LOCUS_04620 37859 38086 gene locus_tag LOCUS_04630 37859 38086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 38105 38533 gene locus_tag LOCUS_04640 38105 38533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 39495 38530 gene locus_tag LOCUS_04650 gene rsmA 39495 38530 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIR4 protein_id gnl|my_center|LOCUS_04650 40104 39499 gene locus_tag LOCUS_04660 40104 39499 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_04660 40943 40140 gene locus_tag LOCUS_04670 40943 40140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 <41627 41128 gene locus_tag LOCUS_04680 <41627 41128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NGI6:adenosylhomocysteinase >Feature sequence010 2838 1357 gene locus_tag LOCUS_04690 gene miaB 2838 1357 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULM9 protein_id gnl|my_center|LOCUS_04690 3878 2907 gene locus_tag LOCUS_04700 gene fmt 3878 2907 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q82ZD8 protein_id gnl|my_center|LOCUS_04700 4478 3900 gene locus_tag LOCUS_04710 gene def 4478 3900 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHZ5 protein_id gnl|my_center|LOCUS_04710 5967 4549 gene locus_tag LOCUS_04720 gene udhA 5967 4549 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224567.1 protein_id gnl|my_center|LOCUS_04720 8338 5996 gene locus_tag LOCUS_04730 8338 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 10084 8378 gene locus_tag LOCUS_04740 gene nuoF 10084 8378 CDS product NADH dehydrogenase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_04740 11765 10137 gene locus_tag LOCUS_04750 11765 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 12731 11778 gene locus_tag LOCUS_04760 12731 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 12893 14323 gene locus_tag LOCUS_04770 12893 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 14617 14330 gene locus_tag LOCUS_04780 14617 14330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 15073 14624 gene locus_tag LOCUS_04790 15073 14624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 16185 15211 gene locus_tag LOCUS_04800 16185 15211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 16868 16182 gene locus_tag LOCUS_04810 16868 16182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 16973 17725 gene locus_tag LOCUS_04820 gene fabG 16973 17725 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324898.1 protein_id gnl|my_center|LOCUS_04820 17837 19225 gene locus_tag LOCUS_04830 17837 19225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 20865 19228 gene locus_tag LOCUS_04840 gene der 20865 19228 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URJ8 protein_id gnl|my_center|LOCUS_04840 21744 22649 gene locus_tag LOCUS_04850 21744 22649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 22936 23169 gene locus_tag LOCUS_04860 22936 23169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 24365 23280 gene locus_tag LOCUS_04870 24365 23280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 24477 26111 gene locus_tag LOCUS_04880 24477 26111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 27070 26132 gene locus_tag LOCUS_04890 27070 26132 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082368.1 protein_id gnl|my_center|LOCUS_04890 28056 27067 gene locus_tag LOCUS_04900 28056 27067 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G39 protein_id gnl|my_center|LOCUS_04900 31361 28053 gene locus_tag LOCUS_04910 31361 28053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 31560 32516 gene locus_tag LOCUS_04920 31560 32516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 32925 32572 gene locus_tag LOCUS_04930 gene glnK 32925 32572 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767694.1 protein_id gnl|my_center|LOCUS_04930 34890 33019 gene locus_tag LOCUS_04940 34890 33019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 34909 35091 gene locus_tag LOCUS_04950 34909 35091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 35358 35915 gene locus_tag LOCUS_04960 35358 35915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 36043 36264 gene locus_tag LOCUS_04970 36043 36264 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7H1 protein_id gnl|my_center|LOCUS_04970 37402 36314 gene locus_tag LOCUS_04980 37402 36314 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121274.1 protein_id gnl|my_center|LOCUS_04980 37832 37359 gene locus_tag LOCUS_04990 37832 37359 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214726.1 protein_id gnl|my_center|LOCUS_04990 38175 37846 gene locus_tag LOCUS_05000 38175 37846 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224094.1 protein_id gnl|my_center|LOCUS_05000 39511 38204 gene locus_tag LOCUS_05010 gene gdh 39511 38204 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887548.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence011 3419 1044 gene locus_tag LOCUS_05020 3419 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 5844 3640 gene locus_tag LOCUS_05030 5844 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 6891 5995 gene locus_tag LOCUS_05040 6891 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_05040 7361 6888 gene locus_tag LOCUS_05050 7361 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 8858 7392 gene locus_tag LOCUS_05060 8858 7392 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117842.1 protein_id gnl|my_center|LOCUS_05060 9961 8903 gene locus_tag LOCUS_05070 gene moxR 9961 8903 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120739.1 protein_id gnl|my_center|LOCUS_05070 10796 10050 gene locus_tag LOCUS_05080 10796 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 11797 10793 gene locus_tag LOCUS_05090 11797 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 12588 11797 gene locus_tag LOCUS_05100 12588 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 13553 12585 gene locus_tag LOCUS_05110 13553 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 14423 13557 gene locus_tag LOCUS_05120 14423 13557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 14963 17632 gene locus_tag LOCUS_05130 14963 17632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 17796 18965 gene locus_tag LOCUS_05140 17796 18965 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805157.1 protein_id gnl|my_center|LOCUS_05140 19042 20607 gene locus_tag LOCUS_05150 19042 20607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142737.1 protein_id gnl|my_center|LOCUS_05150 20992 20687 gene locus_tag LOCUS_05160 20992 20687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 21833 21009 gene locus_tag LOCUS_05170 21833 21009 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258009.1 protein_id gnl|my_center|LOCUS_05170 23487 21820 gene locus_tag LOCUS_05180 23487 21820 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF39 protein_id gnl|my_center|LOCUS_05180 24518 23490 gene locus_tag LOCUS_05190 24518 23490 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF38 protein_id gnl|my_center|LOCUS_05190 25477 24524 gene locus_tag LOCUS_05200 25477 24524 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_05200 26277 25474 gene locus_tag LOCUS_05210 26277 25474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 27494 26319 gene locus_tag LOCUS_05220 27494 26319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_05220 28222 27494 gene locus_tag LOCUS_05230 28222 27494 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404831.1 protein_id gnl|my_center|LOCUS_05230 28803 28222 gene locus_tag LOCUS_05240 28803 28222 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_05240 30233 28803 gene locus_tag LOCUS_05250 30233 28803 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_05250 33548 30237 gene locus_tag LOCUS_05260 33548 30237 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_05260 34213 33536 gene locus_tag LOCUS_05270 34213 33536 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256517.1 protein_id gnl|my_center|LOCUS_05270 35157 34549 gene locus_tag LOCUS_05280 gene mobA 35157 34549 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGH6 protein_id gnl|my_center|LOCUS_05280 36985 35186 gene locus_tag LOCUS_05290 36985 35186 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227894.1 protein_id gnl|my_center|LOCUS_05290 37180 37488 gene locus_tag LOCUS_05300 gene rplU 37180 37488 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WBD7 protein_id gnl|my_center|LOCUS_05300 37652 38911 gene locus_tag LOCUS_05310 37652 38911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 39067 40041 gene locus_tag LOCUS_05320 gene fabH 39067 40041 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59814 protein_id gnl|my_center|LOCUS_05320 >Feature sequence012 1759 959 gene locus_tag LOCUS_05330 1759 959 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_05330 1906 3342 gene locus_tag LOCUS_05340 1906 3342 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_05340 3381 3638 gene locus_tag LOCUS_05350 3381 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 4800 4114 gene locus_tag LOCUS_05360 4800 4114 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCR8 protein_id gnl|my_center|LOCUS_05360 4964 8911 gene locus_tag LOCUS_05370 4964 8911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 8932 9882 gene locus_tag LOCUS_05380 8932 9882 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118052.1 protein_id gnl|my_center|LOCUS_05380 10018 10725 gene locus_tag LOCUS_05390 10018 10725 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_05390 10988 13402 gene locus_tag LOCUS_05400 10988 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120757.1 protein_id gnl|my_center|LOCUS_05400 13494 14846 gene locus_tag LOCUS_05410 13494 14846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_05410 15000 16706 gene locus_tag LOCUS_05420 15000 16706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 18267 16711 gene locus_tag LOCUS_05430 gene leuA 18267 16711 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI51 protein_id gnl|my_center|LOCUS_05430 18597 19883 gene locus_tag LOCUS_05440 18597 19883 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122010.1 protein_id gnl|my_center|LOCUS_05440 20619 19897 gene locus_tag LOCUS_05450 20619 19897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 protein_id gnl|my_center|LOCUS_05450 21334 20663 gene locus_tag LOCUS_05460 21334 20663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057788.1 protein_id gnl|my_center|LOCUS_05460 21719 23179 gene locus_tag LOCUS_05470 gene ffh 21719 23179 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329358.1 protein_id gnl|my_center|LOCUS_05470 23269 23553 gene locus_tag LOCUS_05480 23269 23553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 23559 24230 gene locus_tag LOCUS_05490 gene trmD 23559 24230 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTY8 protein_id gnl|my_center|LOCUS_05490 24256 24666 gene locus_tag LOCUS_05500 gene rplS 24256 24666 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI13 protein_id gnl|my_center|LOCUS_05500 24676 25086 gene locus_tag LOCUS_05510 24676 25086 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I89 protein_id gnl|my_center|LOCUS_05510 25117 26331 gene locus_tag LOCUS_05520 gene tyrS 25117 26331 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67632 protein_id gnl|my_center|LOCUS_05520 26349 27116 gene locus_tag LOCUS_05530 26349 27116 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_05530 27166 27241 gene locus_tag LOCUS_t00140 27166 27241 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27353 27970 gene locus_tag LOCUS_05540 27353 27970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 27986 28768 gene locus_tag LOCUS_05550 27986 28768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 28728 29441 gene locus_tag LOCUS_05560 28728 29441 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546325.1 protein_id gnl|my_center|LOCUS_05560 29434 30909 gene locus_tag LOCUS_05570 29434 30909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 31304 30912 gene locus_tag LOCUS_05580 31304 30912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 31819 31550 gene locus_tag LOCUS_05590 31819 31550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 32020 33222 gene locus_tag LOCUS_05600 gene wbpY 32020 33222 CDS product glycosyltransferase WbpY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102573.1 protein_id gnl|my_center|LOCUS_05600 34440 33238 gene locus_tag LOCUS_05610 34440 33238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 34752 36401 gene locus_tag LOCUS_05620 gene pgi 34752 36401 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z1U7 protein_id gnl|my_center|LOCUS_05620 36449 38254 gene locus_tag LOCUS_05630 36449 38254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335479.1 protein_id gnl|my_center|LOCUS_05630 38402 38475 gene locus_tag LOCUS_t00150 38402 38475 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence013 <1 786 gene locus_tag LOCUS_05640 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119007.1:acetoacetate metabolism regulatory protein AtoC 827 1792 gene locus_tag LOCUS_05650 827 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2220 1825 gene locus_tag LOCUS_05660 2220 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 3219 2338 gene locus_tag LOCUS_05670 3219 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120366.1 protein_id gnl|my_center|LOCUS_05670 3758 3219 gene locus_tag LOCUS_05680 3758 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 3925 4647 gene locus_tag LOCUS_05690 3925 4647 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_05690 4658 5557 gene locus_tag LOCUS_05700 gene ilvE2 4658 5557 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_05700 6958 5657 gene locus_tag LOCUS_05710 gene clpX 6958 5657 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKU7 protein_id gnl|my_center|LOCUS_05710 7523 7116 gene locus_tag LOCUS_05720 7523 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 7803 8711 gene locus_tag LOCUS_05730 7803 8711 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_05730 9266 8850 gene locus_tag LOCUS_05740 9266 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 9550 9413 gene locus_tag LOCUS_05750 9550 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 9561 10442 gene locus_tag LOCUS_05760 9561 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 10855 10646 gene locus_tag LOCUS_05770 10855 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 11058 10825 gene locus_tag LOCUS_05780 11058 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_05780 11547 11347 gene locus_tag LOCUS_05790 11547 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 11825 11544 gene locus_tag LOCUS_05800 11825 11544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 13554 12244 gene locus_tag LOCUS_05810 13554 12244 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118925.1 protein_id gnl|my_center|LOCUS_05810 13657 14361 gene locus_tag LOCUS_05820 13657 14361 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_05820 14935 14489 gene locus_tag LOCUS_05830 14935 14489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 15966 14983 gene locus_tag LOCUS_05840 15966 14983 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_05840 16224 18242 gene locus_tag LOCUS_05850 16224 18242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 18267 19340 gene locus_tag LOCUS_05860 18267 19340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 19365 20441 gene locus_tag LOCUS_05870 19365 20441 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120960.1 protein_id gnl|my_center|LOCUS_05870 20459 21352 gene locus_tag LOCUS_05880 gene xynB 20459 21352 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038153.1 protein_id gnl|my_center|LOCUS_05880 21478 23058 gene locus_tag LOCUS_05890 21478 23058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05979 protein_id gnl|my_center|LOCUS_05890 23864 23121 gene locus_tag LOCUS_05900 23864 23121 CDS product glutamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 protein_id gnl|my_center|LOCUS_05900 25351 23867 gene locus_tag LOCUS_05910 25351 23867 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869326.1 protein_id gnl|my_center|LOCUS_05910 26053 25373 gene locus_tag LOCUS_05920 26053 25373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 26204 28159 gene locus_tag LOCUS_05930 gene glgB 26204 28159 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJB4 protein_id gnl|my_center|LOCUS_05930 29393 28167 gene locus_tag LOCUS_05940 29393 28167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 29562 30197 gene locus_tag LOCUS_05950 29562 30197 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_05950 31782 30199 gene locus_tag LOCUS_05960 31782 30199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05979 protein_id gnl|my_center|LOCUS_05960 >Feature sequence014 407 1855 gene locus_tag LOCUS_05970 407 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 4304 1905 gene locus_tag LOCUS_05980 4304 1905 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118530.1 protein_id gnl|my_center|LOCUS_05980 4435 4905 gene locus_tag LOCUS_05990 4435 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 5242 7026 gene locus_tag LOCUS_06000 5242 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 7362 7048 gene locus_tag LOCUS_06010 7362 7048 CDS product ATP-dependent Clp protease ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329331.1 protein_id gnl|my_center|LOCUS_06010 9059 7389 gene locus_tag LOCUS_06020 9059 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121283.1 protein_id gnl|my_center|LOCUS_06020 12675 9193 gene locus_tag LOCUS_06030 gene pyc 12675 9193 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UES1 protein_id gnl|my_center|LOCUS_06030 13801 12821 gene locus_tag LOCUS_06040 13801 12821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 14438 14004 gene locus_tag LOCUS_06050 14438 14004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 15613 14747 gene locus_tag LOCUS_06060 15613 14747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 17293 15638 gene locus_tag LOCUS_06070 17293 15638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 17974 17384 gene locus_tag LOCUS_06080 17974 17384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 20302 18461 gene locus_tag LOCUS_06090 gene mnmG 20302 18461 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULV7 protein_id gnl|my_center|LOCUS_06090 20442 22385 gene locus_tag LOCUS_06100 20442 22385 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_06100 22417 23661 gene locus_tag LOCUS_06110 22417 23661 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120592.1 protein_id gnl|my_center|LOCUS_06110 23668 24297 gene locus_tag LOCUS_06120 23668 24297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 24445 25731 gene locus_tag LOCUS_06130 24445 25731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 25819 28554 gene locus_tag LOCUS_06140 25819 28554 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121470.1 protein_id gnl|my_center|LOCUS_06140 29348 28626 gene locus_tag LOCUS_06150 29348 28626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 30807 29326 gene locus_tag LOCUS_06160 gene guaB 30807 29326 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJL3 protein_id gnl|my_center|LOCUS_06160 32478 31039 gene locus_tag LOCUS_06170 32478 31039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 33339 32509 gene locus_tag LOCUS_06180 33339 32509 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015208.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence015 1892 618 gene locus_tag LOCUS_06190 1892 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 2517 2005 gene locus_tag LOCUS_06200 2517 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2747 2577 gene locus_tag LOCUS_06210 2747 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3522 3295 gene locus_tag LOCUS_06220 3522 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 3721 4641 gene locus_tag LOCUS_06230 3721 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 4690 5496 gene locus_tag LOCUS_06240 4690 5496 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918821.1 protein_id gnl|my_center|LOCUS_06240 5525 6199 gene locus_tag LOCUS_06250 5525 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121005.1 protein_id gnl|my_center|LOCUS_06250 6324 7022 gene locus_tag LOCUS_06260 gene mtnB 6324 7022 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVC0 protein_id gnl|my_center|LOCUS_06260 7045 7626 gene locus_tag LOCUS_06270 gene mtnD 7045 7626 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819E5 protein_id gnl|my_center|LOCUS_06270 7623 8345 gene locus_tag LOCUS_06280 gene mtnC 7623 8345 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I340 protein_id gnl|my_center|LOCUS_06280 10201 8348 gene locus_tag LOCUS_06290 gene glmS 10201 8348 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA9 protein_id gnl|my_center|LOCUS_06290 11634 10327 gene locus_tag LOCUS_06300 11634 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 13241 11943 gene locus_tag LOCUS_06310 13241 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_06310 13520 13702 gene locus_tag LOCUS_06320 13520 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 14941 13970 gene locus_tag LOCUS_06330 14941 13970 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330953.1 protein_id gnl|my_center|LOCUS_06330 16013 15231 gene locus_tag LOCUS_06340 16013 15231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 16163 16354 gene locus_tag LOCUS_06350 16163 16354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 16506 17609 gene locus_tag LOCUS_06360 16506 17609 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324545.1 protein_id gnl|my_center|LOCUS_06360 18736 17606 gene locus_tag LOCUS_06370 18736 17606 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_06370 19930 19040 gene locus_tag LOCUS_06380 gene hemF 19930 19040 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEK3 protein_id gnl|my_center|LOCUS_06380 20540 20001 gene locus_tag LOCUS_06390 20540 20001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 20716 21597 gene locus_tag LOCUS_06400 20716 21597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 21914 22405 gene locus_tag LOCUS_06410 21914 22405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 22493 23197 gene locus_tag LOCUS_06420 22493 23197 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339994.1 protein_id gnl|my_center|LOCUS_06420 23194 24366 gene locus_tag LOCUS_06430 23194 24366 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122038.1 protein_id gnl|my_center|LOCUS_06430 24376 25482 gene locus_tag LOCUS_06440 gene chsA 24376 25482 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122037.1 protein_id gnl|my_center|LOCUS_06440 26972 25479 gene locus_tag LOCUS_06450 gene gatB 26972 25479 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK56 protein_id gnl|my_center|LOCUS_06450 27463 27143 gene locus_tag LOCUS_06460 27463 27143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 27674 28150 gene locus_tag LOCUS_06470 gene bfr 27674 28150 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD63 protein_id gnl|my_center|LOCUS_06470 28374 28147 gene locus_tag LOCUS_06480 28374 28147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 28535 29002 gene locus_tag LOCUS_06490 28535 29002 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_06490 29033 30250 gene locus_tag LOCUS_06500 gene iscS 29033 30250 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_06500 30300 30707 gene locus_tag LOCUS_06510 gene iscU 30300 30707 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXH0 protein_id gnl|my_center|LOCUS_06510 30745 31089 gene locus_tag LOCUS_06520 30745 31089 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 protein_id gnl|my_center|LOCUS_06520 31149 31655 gene locus_tag LOCUS_06530 gene hscB 31149 31655 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDW4 protein_id gnl|my_center|LOCUS_06530 31655 31727 gene locus_tag LOCUS_t00160 31655 31727 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence016 335 69 gene locus_tag LOCUS_06540 335 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 716 3664 gene locus_tag LOCUS_06550 716 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 4134 3661 gene locus_tag LOCUS_06560 4134 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 4296 4979 gene locus_tag LOCUS_06570 4296 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_06570 5097 7190 gene locus_tag LOCUS_06580 5097 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 8102 7197 gene locus_tag LOCUS_06590 8102 7197 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403318.1 protein_id gnl|my_center|LOCUS_06590 8798 8115 gene locus_tag LOCUS_06600 8798 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 11410 8873 gene locus_tag LOCUS_06610 gene pnp 11410 8873 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR95 protein_id gnl|my_center|LOCUS_06610 11977 11696 gene locus_tag LOCUS_06620 gene rpsO 11977 11696 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21473 protein_id gnl|my_center|LOCUS_06620 12430 12143 gene locus_tag LOCUS_06630 12430 12143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 13657 12662 gene locus_tag LOCUS_06640 gene pdxA 13657 12662 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5H0 protein_id gnl|my_center|LOCUS_06640 14675 13680 gene locus_tag LOCUS_06650 14675 13680 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460882.1 protein_id gnl|my_center|LOCUS_06650 16273 14741 gene locus_tag LOCUS_06660 16273 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 16278 16415 gene locus_tag LOCUS_06670 16278 16415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 17541 16423 gene locus_tag LOCUS_06680 17541 16423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 18707 17538 gene locus_tag LOCUS_06690 18707 17538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 19542 19288 gene locus_tag LOCUS_06700 19542 19288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 20514 19639 gene locus_tag LOCUS_06710 20514 19639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 22332 20524 gene locus_tag LOCUS_06720 gene recJ 22332 20524 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338790.1 protein_id gnl|my_center|LOCUS_06720 23352 24080 gene locus_tag LOCUS_06730 23352 24080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 24927 24244 gene locus_tag LOCUS_06740 gene lplA 24927 24244 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121464.1 protein_id gnl|my_center|LOCUS_06740 26449 24998 gene locus_tag LOCUS_06750 gene gcvPB 26449 24998 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNH1 protein_id gnl|my_center|LOCUS_06750 27872 26487 gene locus_tag LOCUS_06760 gene yqhJ 27872 26487 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNH0 protein_id gnl|my_center|LOCUS_06760 28307 27921 gene locus_tag LOCUS_06770 28307 27921 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811334.1 protein_id gnl|my_center|LOCUS_06770 29480 28401 gene locus_tag LOCUS_06780 29480 28401 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_06780 30834 29590 gene locus_tag LOCUS_06790 gene glyA 30834 29590 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E008 protein_id gnl|my_center|LOCUS_06790 31486 30878 gene locus_tag LOCUS_06800 31486 30878 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087592.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence017 65 2782 gene locus_tag LOCUS_06810 65 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 2952 3299 gene locus_tag LOCUS_06820 2952 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3384 3722 gene locus_tag LOCUS_06830 3384 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 4756 3758 gene locus_tag LOCUS_06840 gene yhcC-1 4756 3758 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_06840 5598 4774 gene locus_tag LOCUS_06850 gene punA 5598 4774 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ11 protein_id gnl|my_center|LOCUS_06850 7092 5698 gene locus_tag LOCUS_06860 7092 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 7991 7107 gene locus_tag LOCUS_06870 7991 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 8267 8689 gene locus_tag LOCUS_06880 8267 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 9947 8709 gene locus_tag LOCUS_06890 9947 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 10836 9958 gene locus_tag LOCUS_06900 10836 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 10954 11331 gene locus_tag LOCUS_06910 gene queF 10954 11331 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG9 protein_id gnl|my_center|LOCUS_06910 11328 12410 gene locus_tag LOCUS_06920 11328 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 13017 12944 gene locus_tag LOCUS_t00170 13017 12944 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13139 13483 gene locus_tag LOCUS_06930 13139 13483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 13638 16166 gene locus_tag LOCUS_06940 13638 16166 CDS product surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_06940 16287 19460 gene locus_tag LOCUS_06950 16287 19460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 19683 25016 gene locus_tag LOCUS_06960 19683 25016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 26421 25096 gene locus_tag LOCUS_06970 26421 25096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 26610 29882 gene locus_tag LOCUS_06980 gene gdhP 26610 29882 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 protein_id gnl|my_center|LOCUS_06980 29897 31855 gene locus_tag LOCUS_06990 gene selB 29897 31855 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937806.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence018 709 2124 gene locus_tag LOCUS_07000 709 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2140 3201 gene locus_tag LOCUS_07010 2140 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 3284 4042 gene locus_tag LOCUS_07020 3284 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 4135 6129 gene locus_tag LOCUS_07030 4135 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 6158 7312 gene locus_tag LOCUS_07040 6158 7312 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_07040 7317 8243 gene locus_tag LOCUS_07050 7317 8243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120245.1 protein_id gnl|my_center|LOCUS_07050 8243 9235 gene locus_tag LOCUS_07060 gene glcK 8243 9235 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254107.1 protein_id gnl|my_center|LOCUS_07060 9219 9941 gene locus_tag LOCUS_07070 gene deoC 9219 9941 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPT7 protein_id gnl|my_center|LOCUS_07070 10136 11416 gene locus_tag LOCUS_07080 10136 11416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 11394 11726 gene locus_tag LOCUS_07090 11394 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 12770 11742 gene locus_tag LOCUS_07100 gene hemE 12770 11742 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBL3 protein_id gnl|my_center|LOCUS_07100 13535 12813 gene locus_tag LOCUS_07110 gene menG 13535 12813 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59912 protein_id gnl|my_center|LOCUS_07110 14030 13674 gene locus_tag LOCUS_07120 14030 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 14472 16028 gene locus_tag LOCUS_07130 14472 16028 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_07130 16038 16394 gene locus_tag LOCUS_07140 16038 16394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 16653 18506 gene locus_tag LOCUS_07150 16653 18506 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121863.1 protein_id gnl|my_center|LOCUS_07150 18572 19408 gene locus_tag LOCUS_07160 gene mqnD 18572 19408 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66654 protein_id gnl|my_center|LOCUS_07160 19591 21348 gene locus_tag LOCUS_07170 19591 21348 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHW9 protein_id gnl|my_center|LOCUS_07170 21586 23997 gene locus_tag LOCUS_07180 21586 23997 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121671.1 protein_id gnl|my_center|LOCUS_07180 24013 25392 gene locus_tag LOCUS_07190 24013 25392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 protein_id gnl|my_center|LOCUS_07190 25453 26613 gene locus_tag LOCUS_07200 25453 26613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 27222 27019 gene locus_tag LOCUS_07210 27222 27019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 27428 28972 gene locus_tag LOCUS_07220 27428 28972 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120298.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence019 836 18 gene locus_tag LOCUS_07230 gene trpA 836 18 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URN0 protein_id gnl|my_center|LOCUS_07230 2091 883 gene locus_tag LOCUS_07240 gene trpB 2091 883 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKG9 protein_id gnl|my_center|LOCUS_07240 2293 3132 gene locus_tag LOCUS_07250 gene mutM 2293 3132 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHE9 protein_id gnl|my_center|LOCUS_07250 3177 4925 gene locus_tag LOCUS_07260 3177 4925 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123340.1 protein_id gnl|my_center|LOCUS_07260 5860 4943 gene locus_tag LOCUS_07270 5860 4943 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_07270 8281 5867 gene locus_tag LOCUS_07280 8281 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 8433 10022 gene locus_tag LOCUS_07290 gene rpdD 8433 10022 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF51 protein_id gnl|my_center|LOCUS_07290 10320 10069 gene locus_tag LOCUS_07300 10320 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 10838 10323 gene locus_tag LOCUS_07310 10838 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 11187 10993 gene locus_tag LOCUS_07320 11187 10993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 12103 11234 gene locus_tag LOCUS_07330 gene yycJ 12103 11234 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872115.1 protein_id gnl|my_center|LOCUS_07330 12298 12684 gene locus_tag LOCUS_07340 12298 12684 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120691.1 protein_id gnl|my_center|LOCUS_07340 12740 14245 gene locus_tag LOCUS_07350 12740 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 14872 14297 gene locus_tag LOCUS_07360 14872 14297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 15177 16544 gene locus_tag LOCUS_07370 15177 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 16579 17319 gene locus_tag LOCUS_07380 16579 17319 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_07380 17324 18058 gene locus_tag LOCUS_07390 17324 18058 CDS product phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876307.1 protein_id gnl|my_center|LOCUS_07390 18538 18047 gene locus_tag LOCUS_07400 18538 18047 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122012.1 protein_id gnl|my_center|LOCUS_07400 19522 18596 gene locus_tag LOCUS_07410 19522 18596 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122686.1 protein_id gnl|my_center|LOCUS_07410 20363 19506 gene locus_tag LOCUS_07420 gene rimK 20363 19506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121083.1 protein_id gnl|my_center|LOCUS_07420 21344 20391 gene locus_tag LOCUS_07430 gene mch 21344 20391 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPS1 protein_id gnl|my_center|LOCUS_07430 22584 21394 gene locus_tag LOCUS_07440 22584 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879746.1 protein_id gnl|my_center|LOCUS_07440 22644 25640 gene locus_tag LOCUS_07450 22644 25640 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_07450 25656 26759 gene locus_tag LOCUS_07460 25656 26759 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKT3 protein_id gnl|my_center|LOCUS_07460 27016 27234 gene locus_tag LOCUS_07470 27016 27234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 28872 27238 gene locus_tag LOCUS_07480 28872 27238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence020 <1 1403 gene locus_tag LOCUS_07490 <1 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q182I2:L-seryl-tRNA(Sec) selenium transferase 2350 1400 gene locus_tag LOCUS_07500 2350 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 2507 3508 gene locus_tag LOCUS_07510 2507 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 4532 3537 gene locus_tag LOCUS_07520 4532 3537 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DYV8 protein_id gnl|my_center|LOCUS_07520 5330 4560 gene locus_tag LOCUS_07530 5330 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 5413 5811 gene locus_tag LOCUS_07540 5413 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808887.1 protein_id gnl|my_center|LOCUS_07540 7065 5824 gene locus_tag LOCUS_07550 gene cbiET 7065 5824 CDS product precorrin-6Y-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_07550 7962 7105 gene locus_tag LOCUS_07560 7962 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 9428 8001 gene locus_tag LOCUS_07570 9428 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 9693 11990 gene locus_tag LOCUS_07580 9693 11990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 12084 12755 gene locus_tag LOCUS_07590 gene trmJ 12084 12755 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH44 protein_id gnl|my_center|LOCUS_07590 14674 12752 gene locus_tag LOCUS_07600 gene gyrB 14674 12752 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU72 protein_id gnl|my_center|LOCUS_07600 17085 14701 gene locus_tag LOCUS_07610 17085 14701 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H4 protein_id gnl|my_center|LOCUS_07610 18108 17227 gene locus_tag LOCUS_07620 18108 17227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 19476 18184 gene locus_tag LOCUS_07630 19476 18184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 19822 21246 gene locus_tag LOCUS_07640 19822 21246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 21685 21308 gene locus_tag LOCUS_07650 21685 21308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 22363 21878 gene locus_tag LOCUS_07660 22363 21878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 24058 22613 gene locus_tag LOCUS_07670 gene dnaA 24058 22613 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_07670 25147 24233 gene locus_tag LOCUS_07680 25147 24233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 25587 25183 gene locus_tag LOCUS_07690 25587 25183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 25698 25889 gene locus_tag LOCUS_07700 25698 25889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 25895 27250 gene locus_tag LOCUS_07710 25895 27250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 27706 27251 gene locus_tag LOCUS_07720 27706 27251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence021 <1 783 gene locus_tag LOCUS_07730 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZTY3:chaperone protein DnaK 787 999 gene locus_tag LOCUS_07740 787 999 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142213.1 protein_id gnl|my_center|LOCUS_07740 1904 996 gene locus_tag LOCUS_07750 gene yeiN 1904 996 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MMC5 protein_id gnl|my_center|LOCUS_07750 3087 1882 gene locus_tag LOCUS_07760 gene rsgA 3087 1882 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUZ6 protein_id gnl|my_center|LOCUS_07760 3357 3563 gene locus_tag LOCUS_07770 3357 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 5102 3555 gene locus_tag LOCUS_07780 gene fumA 5102 3555 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HNW9 protein_id gnl|my_center|LOCUS_07780 6097 5132 gene locus_tag LOCUS_07790 gene galE 6097 5132 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037025.1 protein_id gnl|my_center|LOCUS_07790 7389 6112 gene locus_tag LOCUS_07800 gene hemA 7389 6112 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKZ2 protein_id gnl|my_center|LOCUS_07800 8201 7386 gene locus_tag LOCUS_07810 8201 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 9198 8326 gene locus_tag LOCUS_07820 9198 8326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 11524 9239 gene locus_tag LOCUS_07830 11524 9239 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_07830 13723 11549 gene locus_tag LOCUS_07840 13723 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 15915 13795 gene locus_tag LOCUS_07850 15915 13795 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122783.1 protein_id gnl|my_center|LOCUS_07850 16517 16107 gene locus_tag LOCUS_07860 16517 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 18427 16646 gene locus_tag LOCUS_07870 18427 16646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_07870 19477 18434 gene locus_tag LOCUS_07880 19477 18434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876468.1 protein_id gnl|my_center|LOCUS_07880 21775 19571 gene locus_tag LOCUS_07890 21775 19571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 22034 21849 gene locus_tag LOCUS_07900 22034 21849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 22371 22036 gene locus_tag LOCUS_07910 22371 22036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 24179 22413 gene locus_tag LOCUS_07920 gene argS 24179 22413 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EL32 protein_id gnl|my_center|LOCUS_07920 24591 24235 gene locus_tag LOCUS_07930 24591 24235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 24908 26257 gene locus_tag LOCUS_07940 24908 26257 CDS product hexuronate transporter ExuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784371.1 protein_id gnl|my_center|LOCUS_07940 27910 26261 gene locus_tag LOCUS_07950 27910 26261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 28149 27943 gene locus_tag LOCUS_07960 28149 27943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence022 61 426 gene locus_tag LOCUS_07970 61 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1923 433 gene locus_tag LOCUS_07980 1923 433 CDS product thermostable carboxypeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLM3 protein_id gnl|my_center|LOCUS_07980 3349 1940 gene locus_tag LOCUS_07990 gene rho 3349 1940 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGV0 protein_id gnl|my_center|LOCUS_07990 3643 5697 gene locus_tag LOCUS_08000 gene glgX 3643 5697 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT9 protein_id gnl|my_center|LOCUS_08000 6116 5715 gene locus_tag LOCUS_08010 gene atpC 6116 5715 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB4 protein_id gnl|my_center|LOCUS_08010 7574 6120 gene locus_tag LOCUS_08020 gene atpD 7574 6120 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB5 protein_id gnl|my_center|LOCUS_08020 8510 7629 gene locus_tag LOCUS_08030 gene atpG 8510 7629 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB6 protein_id gnl|my_center|LOCUS_08030 10214 8532 gene locus_tag LOCUS_08040 gene atpA 10214 8532 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW8 protein_id gnl|my_center|LOCUS_08040 10821 10165 gene locus_tag LOCUS_08050 gene atpH 10821 10165 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X71 protein_id gnl|my_center|LOCUS_08050 11500 10862 gene locus_tag LOCUS_08060 11500 10862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 11816 11535 gene locus_tag LOCUS_08070 gene atpE 11816 11535 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UA7 protein_id gnl|my_center|LOCUS_08070 12816 11923 gene locus_tag LOCUS_08080 gene atpB 12816 11923 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFC2 protein_id gnl|my_center|LOCUS_08080 13298 12870 gene locus_tag LOCUS_08090 13298 12870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 13500 13300 gene locus_tag LOCUS_08100 13500 13300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 13806 14891 gene locus_tag LOCUS_08110 13806 14891 CDS product Rho termination factor domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327172.1 protein_id gnl|my_center|LOCUS_08110 15094 15999 gene locus_tag LOCUS_08120 gene apbE 15094 15999 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTS4 protein_id gnl|my_center|LOCUS_08120 16044 17051 gene locus_tag LOCUS_08130 16044 17051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120295.1 protein_id gnl|my_center|LOCUS_08130 17091 18719 gene locus_tag LOCUS_08140 17091 18719 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326639.1 protein_id gnl|my_center|LOCUS_08140 19910 18777 gene locus_tag LOCUS_08150 19910 18777 CDS product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704678.1 protein_id gnl|my_center|LOCUS_08150 22060 19928 gene locus_tag LOCUS_08160 22060 19928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 23009 22074 gene locus_tag LOCUS_08170 23009 22074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 24398 23190 gene locus_tag LOCUS_08180 24398 23190 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121595.1 protein_id gnl|my_center|LOCUS_08180 24573 25076 gene locus_tag LOCUS_08190 24573 25076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 25928 25092 gene locus_tag LOCUS_08200 25928 25092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 26498 25959 gene locus_tag LOCUS_08210 gene coaD 26498 25959 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6D1 protein_id gnl|my_center|LOCUS_08210 26649 27251 gene locus_tag LOCUS_08220 26649 27251 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_08220 27790 27248 gene locus_tag LOCUS_08230 27790 27248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence023 5683 4595 gene locus_tag LOCUS_08240 gene ychF 5683 4595 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ1 protein_id gnl|my_center|LOCUS_08240 6987 5797 gene locus_tag LOCUS_08250 gene pgk 6987 5797 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEX1 protein_id gnl|my_center|LOCUS_08250 8043 7060 gene locus_tag LOCUS_08260 8043 7060 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH8 protein_id gnl|my_center|LOCUS_08260 8308 9297 gene locus_tag LOCUS_08270 gene mdh 8308 9297 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT13 protein_id gnl|my_center|LOCUS_08270 10146 9301 gene locus_tag LOCUS_08280 10146 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 11023 10253 gene locus_tag LOCUS_08290 11023 10253 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266954.1 protein_id gnl|my_center|LOCUS_08290 12738 11026 gene locus_tag LOCUS_08300 gene lnt 12738 11026 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_08300 13993 12767 gene locus_tag LOCUS_08310 gene moeA1 13993 12767 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_08310 17773 14066 gene locus_tag LOCUS_08320 gene metH 17773 14066 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122502.1 protein_id gnl|my_center|LOCUS_08320 18456 18839 gene locus_tag LOCUS_08330 18456 18839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 19169 18858 gene locus_tag LOCUS_08340 19169 18858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 19476 21263 gene locus_tag LOCUS_08350 gene ybiT 19476 21263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122134.1 protein_id gnl|my_center|LOCUS_08350 22174 21278 gene locus_tag LOCUS_08360 gene desC 22174 21278 CDS product delta-9 desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142860.1 protein_id gnl|my_center|LOCUS_08360 22705 22920 gene locus_tag LOCUS_08370 22705 22920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 22973 25321 gene locus_tag LOCUS_08380 22973 25321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 25332 26717 gene locus_tag LOCUS_08390 25332 26717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122547.1 protein_id gnl|my_center|LOCUS_08390 <27571 26816 gene locus_tag LOCUS_08400 <27571 26816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257687.1:DEAD/DEAH box helicase >Feature sequence024 481 1788 gene locus_tag LOCUS_08410 481 1788 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_08410 1802 3868 gene locus_tag LOCUS_08420 1802 3868 CDS product xylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117993.1 protein_id gnl|my_center|LOCUS_08420 3886 5526 gene locus_tag LOCUS_08430 3886 5526 CDS product antibiotic hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_08430 5619 10238 gene locus_tag LOCUS_08440 5619 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 10575 10766 gene locus_tag LOCUS_08450 10575 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 11122 11388 gene locus_tag LOCUS_08460 11122 11388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_08460 11400 11705 gene locus_tag LOCUS_08470 11400 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 11990 12433 gene locus_tag LOCUS_08480 11990 12433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 13981 12491 gene locus_tag LOCUS_08490 13981 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 14097 14723 gene locus_tag LOCUS_08500 14097 14723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 14727 15860 gene locus_tag LOCUS_08510 14727 15860 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_08510 15862 16404 gene locus_tag LOCUS_08520 15862 16404 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258358.1 protein_id gnl|my_center|LOCUS_08520 18577 16463 gene locus_tag LOCUS_08530 18577 16463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 19184 18621 gene locus_tag LOCUS_08540 19184 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008653063.1 protein_id gnl|my_center|LOCUS_08540 19530 19961 gene locus_tag LOCUS_08550 19530 19961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 20143 19958 gene locus_tag LOCUS_08560 20143 19958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 20379 20933 gene locus_tag LOCUS_08570 20379 20933 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFZ5 protein_id gnl|my_center|LOCUS_08570 20984 26476 gene locus_tag LOCUS_08580 20984 26476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence025 1637 294 gene locus_tag LOCUS_08590 gene argD 1637 294 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEN0 protein_id gnl|my_center|LOCUS_08590 1785 2738 gene locus_tag LOCUS_08600 1785 2738 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143838.1 protein_id gnl|my_center|LOCUS_08600 2944 2735 gene locus_tag LOCUS_08610 2944 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 3472 3146 gene locus_tag LOCUS_08620 gene nasE 3472 3146 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_08620 3570 4124 gene locus_tag LOCUS_08630 3570 4124 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877237.1 protein_id gnl|my_center|LOCUS_08630 4117 4980 gene locus_tag LOCUS_08640 gene panC 4117 4980 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM60 protein_id gnl|my_center|LOCUS_08640 5011 6618 gene locus_tag LOCUS_08650 5011 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 7145 6690 gene locus_tag LOCUS_08660 7145 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 7441 8289 gene locus_tag LOCUS_08670 7441 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 8434 9267 gene locus_tag LOCUS_08680 8434 9267 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121261.1 protein_id gnl|my_center|LOCUS_08680 9282 10112 gene locus_tag LOCUS_08690 9282 10112 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_08690 10109 11386 gene locus_tag LOCUS_08700 10109 11386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 12128 11388 gene locus_tag LOCUS_08710 12128 11388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 12230 13051 gene locus_tag LOCUS_08720 12230 13051 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117794.1 protein_id gnl|my_center|LOCUS_08720 14847 13036 gene locus_tag LOCUS_08730 14847 13036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 16925 15087 gene locus_tag LOCUS_08740 16925 15087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 17355 16963 gene locus_tag LOCUS_08750 17355 16963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 17926 17384 gene locus_tag LOCUS_08760 17926 17384 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_08760 18812 17967 gene locus_tag LOCUS_08770 gene cheR1 18812 17967 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XC4 protein_id gnl|my_center|LOCUS_08770 19900 18845 gene locus_tag LOCUS_08780 gene cheB1 19900 18845 CDS product chemotaxis response regulator protein-glutamate methylesterase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX18 protein_id gnl|my_center|LOCUS_08780 22025 20025 gene locus_tag LOCUS_08790 22025 20025 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937405.1 protein_id gnl|my_center|LOCUS_08790 23954 22092 gene locus_tag LOCUS_08800 23954 22092 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937405.1 protein_id gnl|my_center|LOCUS_08800 24415 23951 gene locus_tag LOCUS_08810 gene cheW 24415 23951 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073088.1 protein_id gnl|my_center|LOCUS_08810 <26875 24412 gene locus_tag LOCUS_08820 <26875 24412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918481.1:chemotaxis protein CheA >Feature sequence026 <1 2138 gene locus_tag LOCUS_08830 <1 2138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123369.1:serine/threonine protein kinase 2198 3874 gene locus_tag LOCUS_08840 2198 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3914 5419 gene locus_tag LOCUS_08850 3914 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 5444 6601 gene locus_tag LOCUS_08860 5444 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_08860 6645 8069 gene locus_tag LOCUS_08870 6645 8069 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122220.1 protein_id gnl|my_center|LOCUS_08870 8008 9219 gene locus_tag LOCUS_08880 8008 9219 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_08880 9144 10322 gene locus_tag LOCUS_08890 9144 10322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 10401 11447 gene locus_tag LOCUS_08900 gene lpxD 10401 11447 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEV1 protein_id gnl|my_center|LOCUS_08900 11498 12370 gene locus_tag LOCUS_08910 11498 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122809.1 protein_id gnl|my_center|LOCUS_08910 12476 13951 gene locus_tag LOCUS_08920 12476 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117691.1 protein_id gnl|my_center|LOCUS_08920 16575 14023 gene locus_tag LOCUS_08930 gene clpC 16575 14023 CDS product ATP-dependent Clp protease ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_08930 18714 16795 gene locus_tag LOCUS_08940 18714 16795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 19803 18736 gene locus_tag LOCUS_08950 gene yacI 19803 18736 CDS product protein-arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV3 protein_id gnl|my_center|LOCUS_08950 20251 19793 gene locus_tag LOCUS_08960 20251 19793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_08960 20813 20325 gene locus_tag LOCUS_08970 gene yacH 20813 20325 CDS product UvrB/UvrC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_08970 20986 22206 gene locus_tag LOCUS_08980 gene adh 20986 22206 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_08980 22418 22885 gene locus_tag LOCUS_08990 22418 22885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 22947 23891 gene locus_tag LOCUS_09000 gene miaA 22947 23891 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH42 protein_id gnl|my_center|LOCUS_09000 23972 24694 gene locus_tag LOCUS_09010 23972 24694 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333247.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence027 2335 1970 gene locus_tag LOCUS_09020 2335 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3693 2344 gene locus_tag LOCUS_09030 gene accC 3693 2344 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_09030 4227 3730 gene locus_tag LOCUS_09040 gene accB 4227 3730 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121914.1 protein_id gnl|my_center|LOCUS_09040 5404 4274 gene locus_tag LOCUS_09050 5404 4274 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121913.1 protein_id gnl|my_center|LOCUS_09050 6207 5407 gene locus_tag LOCUS_09060 6207 5407 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141322.1 protein_id gnl|my_center|LOCUS_09060 7697 6387 gene locus_tag LOCUS_09070 7697 6387 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_09070 8817 7762 gene locus_tag LOCUS_09080 8817 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123438.1 protein_id gnl|my_center|LOCUS_09080 8836 9873 gene locus_tag LOCUS_09090 8836 9873 CDS product thiamine biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461458.1 protein_id gnl|my_center|LOCUS_09090 9877 10743 gene locus_tag LOCUS_09100 9877 10743 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KM52 protein_id gnl|my_center|LOCUS_09100 11280 10759 gene locus_tag LOCUS_09110 11280 10759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 11704 12198 gene locus_tag LOCUS_09120 11704 12198 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142677.1 protein_id gnl|my_center|LOCUS_09120 12842 13420 gene locus_tag LOCUS_09130 12842 13420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 protein_id gnl|my_center|LOCUS_09130 13725 16376 gene locus_tag LOCUS_09140 13725 16376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 16430 18295 gene locus_tag LOCUS_09150 16430 18295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 18350 20542 gene locus_tag LOCUS_09160 18350 20542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 22227 20578 gene locus_tag LOCUS_09170 22227 20578 CDS product N-acyl-D-amino-acid deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729326.1 protein_id gnl|my_center|LOCUS_09170 23197 22169 gene locus_tag LOCUS_09180 23197 22169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 23384 24742 gene locus_tag LOCUS_09190 gene hisD 23384 24742 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX39 protein_id gnl|my_center|LOCUS_09190 24762 25826 gene locus_tag LOCUS_09200 gene hisC 24762 25826 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNC3 protein_id gnl|my_center|LOCUS_09200 >Feature sequence028 954 361 gene locus_tag LOCUS_09210 gene ppiA 954 361 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747E8 protein_id gnl|my_center|LOCUS_09210 1137 2042 gene locus_tag LOCUS_09220 gene lipA 1137 2042 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH37 protein_id gnl|my_center|LOCUS_09220 2061 2687 gene locus_tag LOCUS_09230 2061 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2718 3746 gene locus_tag LOCUS_09240 gene holB 2718 3746 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122947.1 protein_id gnl|my_center|LOCUS_09240 4667 3747 gene locus_tag LOCUS_09250 4667 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 5785 4664 gene locus_tag LOCUS_09260 5785 4664 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103297.1 protein_id gnl|my_center|LOCUS_09260 5881 7812 gene locus_tag LOCUS_09270 5881 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 8708 7842 gene locus_tag LOCUS_09280 8708 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 15834 8890 gene locus_tag LOCUS_09290 gene uvrA 15834 8890 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMV4 protein_id gnl|my_center|LOCUS_09290 16095 16670 gene locus_tag LOCUS_09300 gene sigW 16095 16670 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFL5 protein_id gnl|my_center|LOCUS_09300 16667 17974 gene locus_tag LOCUS_09310 16667 17974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 18741 17971 gene locus_tag LOCUS_09320 18741 17971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 18998 21388 gene locus_tag LOCUS_09330 18998 21388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 21508 22395 gene locus_tag LOCUS_09340 21508 22395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 22417 23361 gene locus_tag LOCUS_09350 gene fpr 22417 23361 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 protein_id gnl|my_center|LOCUS_09350 24668 23370 gene locus_tag LOCUS_09360 24668 23370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 24856 25851 gene locus_tag LOCUS_09370 gene accA 24856 25851 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTY7 protein_id gnl|my_center|LOCUS_09370 >Feature sequence029 <1 926 gene locus_tag LOCUS_09380 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120214.1:Ta11 non-LTR retroelement 963 2375 gene locus_tag LOCUS_09390 963 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2372 3268 gene locus_tag LOCUS_09400 2372 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 4541 3243 gene locus_tag LOCUS_09410 4541 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 4726 6105 gene locus_tag LOCUS_09420 4726 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_09420 7183 6119 gene locus_tag LOCUS_09430 7183 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 8384 7431 gene locus_tag LOCUS_09440 8384 7431 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_09440 8926 9810 gene locus_tag LOCUS_09450 gene lpxK 8926 9810 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW7 protein_id gnl|my_center|LOCUS_09450 9827 10828 gene locus_tag LOCUS_09460 9827 10828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_09460 10844 12391 gene locus_tag LOCUS_09470 gene hldE 10844 12391 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF6 protein_id gnl|my_center|LOCUS_09470 12417 13484 gene locus_tag LOCUS_09480 12417 13484 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_09480 13632 13429 gene locus_tag LOCUS_09490 13632 13429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 13631 16123 gene locus_tag LOCUS_09500 13631 16123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 16228 17430 gene locus_tag LOCUS_09510 16228 17430 CDS product WabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_09510 18865 18287 gene locus_tag LOCUS_09520 gene efp 18865 18287 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X284 protein_id gnl|my_center|LOCUS_09520 19931 18978 gene locus_tag LOCUS_09530 19931 18978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 19930 20292 gene locus_tag LOCUS_09540 19930 20292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 20588 20289 gene locus_tag LOCUS_09550 20588 20289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 20808 21821 gene locus_tag LOCUS_09560 20808 21821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 21848 22540 gene locus_tag LOCUS_09570 21848 22540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 22609 22767 gene locus_tag LOCUS_09580 22609 22767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 22834 23109 gene locus_tag LOCUS_09590 22834 23109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 23106 23618 gene locus_tag LOCUS_09600 23106 23618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 23664 25085 gene locus_tag LOCUS_09610 gene glcD 23664 25085 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057464.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence030 681 1124 gene locus_tag LOCUS_09620 681 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3758 1206 gene locus_tag LOCUS_09630 3758 1206 CDS product collagenolytic serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071157.1 protein_id gnl|my_center|LOCUS_09630 3757 3963 gene locus_tag LOCUS_09640 3757 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 5971 3983 gene locus_tag LOCUS_09650 gene nadE 5971 3983 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120563.1 protein_id gnl|my_center|LOCUS_09650 7277 6111 gene locus_tag LOCUS_09660 7277 6111 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582756.1 protein_id gnl|my_center|LOCUS_09660 7383 8255 gene locus_tag LOCUS_09670 7383 8255 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 protein_id gnl|my_center|LOCUS_09670 8322 8747 gene locus_tag LOCUS_09680 8322 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 10582 8756 gene locus_tag LOCUS_09690 10582 8756 CDS product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 protein_id gnl|my_center|LOCUS_09690 10813 12189 gene locus_tag LOCUS_09700 10813 12189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_09700 12221 14698 gene locus_tag LOCUS_09710 12221 14698 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120349.1 protein_id gnl|my_center|LOCUS_09710 14717 17851 gene locus_tag LOCUS_09720 14717 17851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 19112 17832 gene locus_tag LOCUS_09730 19112 17832 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228553.1 protein_id gnl|my_center|LOCUS_09730 20375 19140 gene locus_tag LOCUS_09740 20375 19140 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_09740 21124 20420 gene locus_tag LOCUS_09750 21124 20420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 22297 21131 gene locus_tag LOCUS_09760 22297 21131 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817270.1 protein_id gnl|my_center|LOCUS_09760 22515 24470 gene locus_tag LOCUS_09770 gene acsA 22515 24470 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP98 protein_id gnl|my_center|LOCUS_09770 <25145 24532 gene locus_tag LOCUS_09780 <25145 24532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391011.1:cyclohexadienyl dehydrogenase >Feature sequence031 1288 476 gene locus_tag LOCUS_09790 1288 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1732 1289 gene locus_tag LOCUS_09800 1732 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1931 1743 gene locus_tag LOCUS_09810 1931 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2934 1954 gene locus_tag LOCUS_09820 2934 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 3172 4134 gene locus_tag LOCUS_09830 3172 4134 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337437.1 protein_id gnl|my_center|LOCUS_09830 5490 4216 gene locus_tag LOCUS_09840 5490 4216 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_09840 6599 5619 gene locus_tag LOCUS_09850 6599 5619 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931757.1 protein_id gnl|my_center|LOCUS_09850 6671 7162 gene locus_tag LOCUS_09860 6671 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257567.1 protein_id gnl|my_center|LOCUS_09860 7131 7925 gene locus_tag LOCUS_09870 gene hpcH 7131 7925 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085757.1 protein_id gnl|my_center|LOCUS_09870 8538 7930 gene locus_tag LOCUS_09880 8538 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 8976 8617 gene locus_tag LOCUS_09890 8976 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 10080 9064 gene locus_tag LOCUS_09900 gene argC 10080 9064 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVL4 protein_id gnl|my_center|LOCUS_09900 10126 11448 gene locus_tag LOCUS_09910 10126 11448 CDS product glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 protein_id gnl|my_center|LOCUS_09910 11460 12092 gene locus_tag LOCUS_09920 11460 12092 CDS product tolQ-type transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141141.1 protein_id gnl|my_center|LOCUS_09920 12100 12777 gene locus_tag LOCUS_09930 12100 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 12774 13376 gene locus_tag LOCUS_09940 12774 13376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 14311 13379 gene locus_tag LOCUS_09950 14311 13379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 15433 14321 gene locus_tag LOCUS_09960 gene ribD 15433 14321 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I5V2 protein_id gnl|my_center|LOCUS_09960 15603 16361 gene locus_tag LOCUS_09970 gene truA1 15603 16361 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CJ2 protein_id gnl|my_center|LOCUS_09970 16358 17662 gene locus_tag LOCUS_09980 gene aroA 16358 17662 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19786 protein_id gnl|my_center|LOCUS_09980 17681 19519 gene locus_tag LOCUS_09990 17681 19519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 19562 20632 gene locus_tag LOCUS_10000 gene rfaF 19562 20632 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_10000 20611 21207 gene locus_tag LOCUS_10010 20611 21207 CDS product septum formation inhibitor Maf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868834.1 protein_id gnl|my_center|LOCUS_10010 21313 22419 gene locus_tag LOCUS_10020 gene carA 21313 22419 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ6 protein_id gnl|my_center|LOCUS_10020 22448 23431 gene locus_tag LOCUS_10030 22448 23431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 <24792 23521 gene locus_tag LOCUS_10040 <24792 23521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120935.1:GTP-binding protein >Feature sequence032 <1 773 gene locus_tag LOCUS_10050 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147051.1:serine/threonine protein kinase 1039 5235 gene locus_tag LOCUS_10060 1039 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 5400 7325 gene locus_tag LOCUS_10070 5400 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120253.1 protein_id gnl|my_center|LOCUS_10070 7336 8712 gene locus_tag LOCUS_10080 7336 8712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_10080 8786 9547 gene locus_tag LOCUS_10090 8786 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 protein_id gnl|my_center|LOCUS_10090 9864 9791 gene locus_tag LOCUS_t00180 9864 9791 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10979 9918 gene locus_tag LOCUS_10100 gene trx 10979 9918 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 protein_id gnl|my_center|LOCUS_10100 11103 12416 gene locus_tag LOCUS_10110 gene argA 11103 12416 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPQ0 protein_id gnl|my_center|LOCUS_10110 13816 12443 gene locus_tag LOCUS_10120 13816 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 13870 15246 gene locus_tag LOCUS_10130 13870 15246 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088393.1 protein_id gnl|my_center|LOCUS_10130 16808 15327 gene locus_tag LOCUS_10140 16808 15327 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122652.1 protein_id gnl|my_center|LOCUS_10140 17041 18165 gene locus_tag LOCUS_10150 17041 18165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 18338 18547 gene locus_tag LOCUS_10160 18338 18547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 18680 18862 gene locus_tag LOCUS_10170 18680 18862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 20290 18941 gene locus_tag LOCUS_10180 20290 18941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 21689 20625 gene locus_tag LOCUS_10190 21689 20625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 22524 22015 gene locus_tag LOCUS_10200 gene TPX 22524 22015 CDS product 2-Cys peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326977.1 protein_id gnl|my_center|LOCUS_10200 23729 22572 gene locus_tag LOCUS_10210 gene stf3 23729 22572 CDS product PAPS-dependent sulfotransferase Stf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLG1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence033 1241 2608 gene locus_tag LOCUS_10220 1241 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 2632 5721 gene locus_tag LOCUS_10230 2632 5721 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087702.1 protein_id gnl|my_center|LOCUS_10230 6477 5818 gene locus_tag LOCUS_10240 6477 5818 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259683.1 protein_id gnl|my_center|LOCUS_10240 7279 6467 gene locus_tag LOCUS_10250 7279 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 8284 7319 gene locus_tag LOCUS_10260 gene phoH 8284 7319 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117767.1 protein_id gnl|my_center|LOCUS_10260 9114 8299 gene locus_tag LOCUS_10270 9114 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 9985 9215 gene locus_tag LOCUS_10280 gene uppS 9985 9215 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF53 protein_id gnl|my_center|LOCUS_10280 11309 10014 gene locus_tag LOCUS_10290 gene purA 11309 10014 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHW3 protein_id gnl|my_center|LOCUS_10290 11538 12755 gene locus_tag LOCUS_10300 11538 12755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 13708 12752 gene locus_tag LOCUS_10310 gene selD 13708 12752 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI12 protein_id gnl|my_center|LOCUS_10310 14010 13822 gene locus_tag LOCUS_10320 14010 13822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 14163 14618 gene locus_tag LOCUS_10330 14163 14618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 16561 14624 gene locus_tag LOCUS_10340 16561 14624 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_10340 17048 16581 gene locus_tag LOCUS_10350 17048 16581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 17162 18028 gene locus_tag LOCUS_10360 17162 18028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 19171 18029 gene locus_tag LOCUS_10370 19171 18029 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_10370 20236 19196 gene locus_tag LOCUS_10380 gene moeB 20236 19196 CDS product molybdopterin-synthase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31702 protein_id gnl|my_center|LOCUS_10380 20601 20233 gene locus_tag LOCUS_10390 20601 20233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 20875 20603 gene locus_tag LOCUS_10400 20875 20603 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259328.1 protein_id gnl|my_center|LOCUS_10400 22189 20930 gene locus_tag LOCUS_10410 gene thrC1 22189 20930 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546459.1 protein_id gnl|my_center|LOCUS_10410 23683 22583 gene locus_tag LOCUS_10420 23683 22583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 <24663 23718 gene locus_tag LOCUS_10430 <24663 23718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P17922:phenylalanine--tRNA ligase beta subunit >Feature sequence034 42 515 gene locus_tag LOCUS_10440 42 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 577 1335 gene locus_tag LOCUS_10450 577 1335 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_10450 1543 1941 gene locus_tag LOCUS_10460 gene acpP 1543 1941 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP48 protein_id gnl|my_center|LOCUS_10460 2041 2535 gene locus_tag LOCUS_10470 2041 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2608 3879 gene locus_tag LOCUS_10480 2608 3879 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJX3 protein_id gnl|my_center|LOCUS_10480 3942 5234 gene locus_tag LOCUS_10490 gene fabF 3942 5234 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ1 protein_id gnl|my_center|LOCUS_10490 5257 6282 gene locus_tag LOCUS_10500 5257 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 6298 8019 gene locus_tag LOCUS_10510 6298 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_10510 8078 9097 gene locus_tag LOCUS_10520 gene corA-1 8078 9097 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB7 protein_id gnl|my_center|LOCUS_10520 9178 9570 gene locus_tag LOCUS_10530 9178 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 10554 9571 gene locus_tag LOCUS_10540 10554 9571 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459460.1 protein_id gnl|my_center|LOCUS_10540 11544 10558 gene locus_tag LOCUS_10550 gene galE 11544 10558 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120830.1 protein_id gnl|my_center|LOCUS_10550 12505 11570 gene locus_tag LOCUS_10560 12505 11570 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_10560 14781 12538 gene locus_tag LOCUS_10570 14781 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121270.1 protein_id gnl|my_center|LOCUS_10570 15151 14846 gene locus_tag LOCUS_10580 15151 14846 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249651.1 protein_id gnl|my_center|LOCUS_10580 17857 15155 gene locus_tag LOCUS_10590 17857 15155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 18678 17854 gene locus_tag LOCUS_10600 gene panB 18678 17854 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM79 protein_id gnl|my_center|LOCUS_10600 18946 19749 gene locus_tag LOCUS_10610 gene thyX 18946 19749 CDS product flavin-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DEI2 protein_id gnl|my_center|LOCUS_10610 19746 21035 gene locus_tag LOCUS_10620 gene rho 19746 21035 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMK2 protein_id gnl|my_center|LOCUS_10620 21158 22186 gene locus_tag LOCUS_10630 21158 22186 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_10630 22288 22737 gene locus_tag LOCUS_10640 gene ndk 22288 22737 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMQ5 protein_id gnl|my_center|LOCUS_10640 23720 22818 gene locus_tag LOCUS_10650 23720 22818 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119121.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence035 3264 3494 gene locus_tag LOCUS_10660 3264 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142023.1 protein_id gnl|my_center|LOCUS_10660 3494 3886 gene locus_tag LOCUS_10670 3494 3886 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_10670 4002 5096 gene locus_tag LOCUS_10680 4002 5096 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085740.1 protein_id gnl|my_center|LOCUS_10680 5109 6425 gene locus_tag LOCUS_10690 gene GALNS 5109 6425 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121931.1 protein_id gnl|my_center|LOCUS_10690 6596 6808 gene locus_tag LOCUS_10700 6596 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 6805 7323 gene locus_tag LOCUS_10710 6805 7323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 7551 8714 gene locus_tag LOCUS_10720 gene mexE 7551 8714 CDS product resistance-nodulation-cell division multidrug efflux membrane fusion protein MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 protein_id gnl|my_center|LOCUS_10720 8714 11998 gene locus_tag LOCUS_10730 gene saxF 8714 11998 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380455.1 protein_id gnl|my_center|LOCUS_10730 11995 15228 gene locus_tag LOCUS_10740 gene saxF 11995 15228 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380455.1 protein_id gnl|my_center|LOCUS_10740 15572 15219 gene locus_tag LOCUS_10750 15572 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 17059 15572 gene locus_tag LOCUS_10760 17059 15572 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940504.1 protein_id gnl|my_center|LOCUS_10760 17626 17802 gene locus_tag LOCUS_10770 17626 17802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 18278 19198 gene locus_tag LOCUS_10780 18278 19198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 20663 19611 gene locus_tag LOCUS_10790 gene cbh 20663 19611 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207030.1 protein_id gnl|my_center|LOCUS_10790 22147 20822 gene locus_tag LOCUS_10800 22147 20822 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_10800 22985 22251 gene locus_tag LOCUS_10810 22985 22251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 23852 23346 gene locus_tag LOCUS_10820 23852 23346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946524.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence036 <1 768 gene locus_tag LOCUS_10830 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120039.1:lipase/esterase 765 3311 gene locus_tag LOCUS_10840 765 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3332 3754 gene locus_tag LOCUS_10850 3332 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3770 4843 gene locus_tag LOCUS_10860 3770 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 4990 5328 gene locus_tag LOCUS_10870 4990 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 5368 6414 gene locus_tag LOCUS_10880 5368 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 8258 6660 gene locus_tag LOCUS_10890 gene cysJ 8258 6660 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117879.1 protein_id gnl|my_center|LOCUS_10890 10108 8270 gene locus_tag LOCUS_10900 gene nirA 10108 8270 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117878.1 protein_id gnl|my_center|LOCUS_10900 12334 10124 gene locus_tag LOCUS_10910 gene narB 12334 10124 CDS product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117877.1 protein_id gnl|my_center|LOCUS_10910 15421 14102 gene locus_tag LOCUS_10920 gene crnA 15421 14102 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_10920 15782 16210 gene locus_tag LOCUS_10930 15782 16210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 16402 18297 gene locus_tag LOCUS_10940 16402 18297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 18294 19859 gene locus_tag LOCUS_10950 18294 19859 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_10950 19884 20945 gene locus_tag LOCUS_10960 19884 20945 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015600.1 protein_id gnl|my_center|LOCUS_10960 20972 22333 gene locus_tag LOCUS_10970 20972 22333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620242.1 protein_id gnl|my_center|LOCUS_10970 23694 22354 gene locus_tag LOCUS_10980 23694 22354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123475.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence037 1074 4697 gene locus_tag LOCUS_10990 1074 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 4782 5972 gene locus_tag LOCUS_11000 4782 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 5972 9421 gene locus_tag LOCUS_11010 5972 9421 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121181.1 protein_id gnl|my_center|LOCUS_11010 9863 9429 gene locus_tag LOCUS_11020 9863 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 11352 10063 gene locus_tag LOCUS_11030 11352 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119116.1 protein_id gnl|my_center|LOCUS_11030 11675 13954 gene locus_tag LOCUS_11040 11675 13954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 13967 15250 gene locus_tag LOCUS_11050 13967 15250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_11050 15535 15287 gene locus_tag LOCUS_11060 15535 15287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 15633 16601 gene locus_tag LOCUS_11070 gene pilE1 15633 16601 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_11070 16591 17049 gene locus_tag LOCUS_11080 16591 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 17459 17181 gene locus_tag LOCUS_11090 17459 17181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933583.1 protein_id gnl|my_center|LOCUS_11090 20540 17838 gene locus_tag LOCUS_11100 20540 17838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403128.1 protein_id gnl|my_center|LOCUS_11100 20791 22635 gene locus_tag LOCUS_11110 20791 22635 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879216.1 protein_id gnl|my_center|LOCUS_11110 22759 23076 gene locus_tag LOCUS_11120 22759 23076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 23073 23291 gene locus_tag LOCUS_11130 23073 23291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence038 146 613 gene locus_tag LOCUS_11140 146 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1003 617 gene locus_tag LOCUS_11150 1003 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11150 954 1220 gene locus_tag LOCUS_11160 954 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2833 1103 gene locus_tag LOCUS_11170 2833 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11170 5716 2918 gene locus_tag LOCUS_11180 5716 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 6908 5970 gene locus_tag LOCUS_11190 6908 5970 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870521.1 protein_id gnl|my_center|LOCUS_11190 8240 6933 gene locus_tag LOCUS_11200 gene kdtA 8240 6933 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_11200 11949 8281 gene locus_tag LOCUS_11210 gene secA1 11949 8281 CDS product protein translocase subunit SecA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UDY6 protein_id gnl|my_center|LOCUS_11210 14436 12058 gene locus_tag LOCUS_11220 14436 12058 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124101.1 protein_id gnl|my_center|LOCUS_11220 14668 16206 gene locus_tag LOCUS_11230 14668 16206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 16304 16573 gene locus_tag LOCUS_11240 gene rpsT 16304 16573 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUS3 protein_id gnl|my_center|LOCUS_11240 19002 16630 gene locus_tag LOCUS_11250 19002 16630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 19537 19286 gene locus_tag LOCUS_11260 19537 19286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 19894 19562 gene locus_tag LOCUS_11270 19894 19562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 20895 20014 gene locus_tag LOCUS_11280 gene hisG 20895 20014 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_11280 21263 20892 gene locus_tag LOCUS_11290 gene hisI 21263 20892 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62386 protein_id gnl|my_center|LOCUS_11290 21800 21288 gene locus_tag LOCUS_11300 gene apt 21800 21288 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1A4 protein_id gnl|my_center|LOCUS_11300 21866 22351 gene locus_tag LOCUS_11310 21866 22351 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071200.1 protein_id gnl|my_center|LOCUS_11310 22348 23253 gene locus_tag LOCUS_11320 22348 23253 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020824.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence039 385 2283 gene locus_tag LOCUS_11330 385 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 2306 3874 gene locus_tag LOCUS_11340 2306 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 5732 3876 gene locus_tag LOCUS_11350 5732 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 6731 5823 gene locus_tag LOCUS_11360 6731 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 7303 6731 gene locus_tag LOCUS_11370 7303 6731 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_11370 7424 8527 gene locus_tag LOCUS_11380 7424 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 8687 9466 gene locus_tag LOCUS_11390 8687 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 9469 11283 gene locus_tag LOCUS_11400 gene dnaK 9469 11283 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK6 protein_id gnl|my_center|LOCUS_11400 11293 12747 gene locus_tag LOCUS_11410 11293 12747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 12929 14815 gene locus_tag LOCUS_11420 12929 14815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 14820 16184 gene locus_tag LOCUS_11430 gene arsA 14820 16184 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_11430 16186 17898 gene locus_tag LOCUS_11440 16186 17898 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976195.1 protein_id gnl|my_center|LOCUS_11440 18479 21607 gene locus_tag LOCUS_11450 18479 21607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 21634 23085 gene locus_tag LOCUS_11460 21634 23085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124058.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence040 <1 567 gene locus_tag LOCUS_11470 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259367.1:3-beta hydroxysteroid dehydrogenase 564 1466 gene locus_tag LOCUS_11480 gene pyrF 564 1466 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 protein_id gnl|my_center|LOCUS_11480 1487 2983 gene locus_tag LOCUS_11490 1487 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3150 4874 gene locus_tag LOCUS_11500 3150 4874 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_11500 4895 5137 gene locus_tag LOCUS_11510 4895 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 5140 7344 gene locus_tag LOCUS_11520 5140 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 7910 7350 gene locus_tag LOCUS_11530 7910 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 8189 7977 gene locus_tag LOCUS_11540 8189 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 8137 8316 gene locus_tag LOCUS_11550 8137 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 8387 10924 gene locus_tag LOCUS_11560 8387 10924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 11020 12237 gene locus_tag LOCUS_11570 11020 12237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_11570 12248 13111 gene locus_tag LOCUS_11580 12248 13111 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_11580 13878 13108 gene locus_tag LOCUS_11590 13878 13108 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_11590 15318 13900 gene locus_tag LOCUS_11600 15318 13900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 protein_id gnl|my_center|LOCUS_11600 16246 15365 gene locus_tag LOCUS_11610 gene sucD 16246 15365 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKI2 protein_id gnl|my_center|LOCUS_11610 17486 16287 gene locus_tag LOCUS_11620 gene sucC 17486 16287 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKI3 protein_id gnl|my_center|LOCUS_11620 17629 18795 gene locus_tag LOCUS_11630 gene argE 17629 18795 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_11630 18904 19092 gene locus_tag LOCUS_11640 18904 19092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 22806 19159 gene locus_tag LOCUS_11650 22806 19159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 <23659 22943 gene locus_tag LOCUS_11660 <23659 22943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119623.1:collagenase >Feature sequence041 997 14 gene locus_tag LOCUS_11670 gene ribF 997 14 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFW8 protein_id gnl|my_center|LOCUS_11670 2880 1492 gene locus_tag LOCUS_11680 2880 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_11680 2991 3596 gene locus_tag LOCUS_11690 2991 3596 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGM3 protein_id gnl|my_center|LOCUS_11690 3809 4675 gene locus_tag LOCUS_11700 gene rpsB 3809 4675 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKH4 protein_id gnl|my_center|LOCUS_11700 4729 5568 gene locus_tag LOCUS_11710 gene tsf 4729 5568 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6M7 protein_id gnl|my_center|LOCUS_11710 5636 7006 gene locus_tag LOCUS_11720 5636 7006 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_11720 7233 7739 gene locus_tag LOCUS_11730 7233 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11730 7903 11544 gene locus_tag LOCUS_11740 7903 11544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119561.1 protein_id gnl|my_center|LOCUS_11740 11578 12852 gene locus_tag LOCUS_11750 11578 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119562.1 protein_id gnl|my_center|LOCUS_11750 14585 12927 gene locus_tag LOCUS_11760 14585 12927 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121094.1 protein_id gnl|my_center|LOCUS_11760 15084 16379 gene locus_tag LOCUS_11770 15084 16379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 16381 16833 gene locus_tag LOCUS_11780 16381 16833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 18819 16834 gene locus_tag LOCUS_11790 18819 16834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 21038 18873 gene locus_tag LOCUS_11800 21038 18873 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120349.1 protein_id gnl|my_center|LOCUS_11800 22415 21084 gene locus_tag LOCUS_11810 22415 21084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_11810 <23510 22593 gene locus_tag LOCUS_11820 <23510 22593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941668.1:acetoacetate metabolism regulatory protein AtoC >Feature sequence042 1559 3121 gene locus_tag LOCUS_11830 1559 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3373 3576 gene locus_tag LOCUS_11840 gene csrA2 3373 3576 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CQ8 protein_id gnl|my_center|LOCUS_11840 3659 4612 gene locus_tag LOCUS_11850 gene ctrB 3659 4612 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122225.1 protein_id gnl|my_center|LOCUS_11850 4650 5507 gene locus_tag LOCUS_11860 4650 5507 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_11860 5573 6436 gene locus_tag LOCUS_11870 5573 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 7197 6457 gene locus_tag LOCUS_11880 7197 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 8381 7353 gene locus_tag LOCUS_11890 8381 7353 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120584.1 protein_id gnl|my_center|LOCUS_11890 8703 9398 gene locus_tag LOCUS_11900 8703 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 10904 9495 gene locus_tag LOCUS_11910 gene lpd 10904 9495 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXM8 protein_id gnl|my_center|LOCUS_11910 12221 10950 gene locus_tag LOCUS_11920 12221 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 15015 12292 gene locus_tag LOCUS_11930 15015 12292 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU96 protein_id gnl|my_center|LOCUS_11930 15346 16644 gene locus_tag LOCUS_11940 gene hflX 15346 16644 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD7 protein_id gnl|my_center|LOCUS_11940 19383 16699 gene locus_tag LOCUS_11950 19383 16699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 19597 22269 gene locus_tag LOCUS_11960 gene topA 19597 22269 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q725N5 protein_id gnl|my_center|LOCUS_11960 23099 22314 gene locus_tag LOCUS_11970 23099 22314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence043 578 1372 gene locus_tag LOCUS_11980 578 1372 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF3 protein_id gnl|my_center|LOCUS_11980 1409 2167 gene locus_tag LOCUS_11990 1409 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2172 2993 gene locus_tag LOCUS_12000 gene pyrK 2172 2993 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_12000 3140 5308 gene locus_tag LOCUS_12010 3140 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 8702 5322 gene locus_tag LOCUS_12020 8702 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 8855 10273 gene locus_tag LOCUS_12030 gene chlI 8855 10273 CDS product magnesium protoporphyrin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117844.1 protein_id gnl|my_center|LOCUS_12030 10287 11987 gene locus_tag LOCUS_12040 10287 11987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 protein_id gnl|my_center|LOCUS_12040 12055 12894 gene locus_tag LOCUS_12050 12055 12894 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_12050 14151 12916 gene locus_tag LOCUS_12060 gene pepT 14151 12916 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KH9 protein_id gnl|my_center|LOCUS_12060 14822 14148 gene locus_tag LOCUS_12070 gene nth 14822 14148 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NTL4 protein_id gnl|my_center|LOCUS_12070 14961 15863 gene locus_tag LOCUS_12080 14961 15863 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704134.1 protein_id gnl|my_center|LOCUS_12080 17417 15867 gene locus_tag LOCUS_12090 17417 15867 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_12090 17614 18951 gene locus_tag LOCUS_12100 17614 18951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_12100 19042 20349 gene locus_tag LOCUS_12110 gene hom 19042 20349 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFK4 protein_id gnl|my_center|LOCUS_12110 20368 21594 gene locus_tag LOCUS_12120 gene bcpC 20368 21594 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_868623.2 protein_id gnl|my_center|LOCUS_12120 22688 21645 gene locus_tag LOCUS_12130 22688 21645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120927.1 protein_id gnl|my_center|LOCUS_12130 23058 22699 gene locus_tag LOCUS_12140 23058 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence044 442 1164 gene locus_tag LOCUS_12150 442 1164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_12150 1176 2546 gene locus_tag LOCUS_12160 1176 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 2566 3909 gene locus_tag LOCUS_12170 2566 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 6007 3884 gene locus_tag LOCUS_12180 6007 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 7093 6107 gene locus_tag LOCUS_12190 7093 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 7531 7827 gene locus_tag LOCUS_12200 7531 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 7946 8566 gene locus_tag LOCUS_12210 7946 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 8572 9645 gene locus_tag LOCUS_12220 gene rluD 8572 9645 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHX8 protein_id gnl|my_center|LOCUS_12220 11244 9649 gene locus_tag LOCUS_12230 gene glyQS 11244 9649 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEU9 protein_id gnl|my_center|LOCUS_12230 13513 11483 gene locus_tag LOCUS_12240 13513 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121017.1 protein_id gnl|my_center|LOCUS_12240 13816 13562 gene locus_tag LOCUS_12250 13816 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 14116 14595 gene locus_tag LOCUS_12260 gene greA 14116 14595 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA0 protein_id gnl|my_center|LOCUS_12260 14643 15698 gene locus_tag LOCUS_12270 14643 15698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120903.1 protein_id gnl|my_center|LOCUS_12270 16965 16066 gene locus_tag LOCUS_12280 16965 16066 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259145.1 protein_id gnl|my_center|LOCUS_12280 17076 17870 gene locus_tag LOCUS_12290 17076 17870 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_12290 19278 17872 gene locus_tag LOCUS_12300 19278 17872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 19560 20324 gene locus_tag LOCUS_12310 19560 20324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 22004 20325 gene locus_tag LOCUS_12320 22004 20325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence045 32 874 gene locus_tag LOCUS_12330 32 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1071 1688 gene locus_tag LOCUS_12340 1071 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1710 4211 gene locus_tag LOCUS_12350 1710 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 4393 7737 gene locus_tag LOCUS_12360 4393 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121175.1 protein_id gnl|my_center|LOCUS_12360 7843 8232 gene locus_tag LOCUS_12370 gene dgkA 7843 8232 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324157.1 protein_id gnl|my_center|LOCUS_12370 8248 9654 gene locus_tag LOCUS_12380 8248 9654 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730063.1 protein_id gnl|my_center|LOCUS_12380 10460 9666 gene locus_tag LOCUS_12390 10460 9666 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190175.1 protein_id gnl|my_center|LOCUS_12390 10578 12803 gene locus_tag LOCUS_12400 10578 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 12918 13694 gene locus_tag LOCUS_12410 12918 13694 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_12410 13751 16114 gene locus_tag LOCUS_12420 13751 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 16137 17471 gene locus_tag LOCUS_12430 gene mnmE 16137 17471 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJI3 protein_id gnl|my_center|LOCUS_12430 17585 18739 gene locus_tag LOCUS_12440 gene ispG 17585 18739 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIQ4 protein_id gnl|my_center|LOCUS_12440 18797 20692 gene locus_tag LOCUS_12450 18797 20692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence046 2347 731 gene locus_tag LOCUS_12460 2347 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_12460 3320 2439 gene locus_tag LOCUS_12470 gene prmC 3320 2439 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT2 protein_id gnl|my_center|LOCUS_12470 4418 3342 gene locus_tag LOCUS_12480 gene prfA 4418 3342 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIA8 protein_id gnl|my_center|LOCUS_12480 4768 4499 gene locus_tag LOCUS_12490 4768 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6466 5456 gene locus_tag LOCUS_12500 6466 5456 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346314.1 protein_id gnl|my_center|LOCUS_12500 6759 7175 gene locus_tag LOCUS_12510 6759 7175 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_12510 7278 9161 gene locus_tag LOCUS_12520 7278 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 9158 10510 gene locus_tag LOCUS_12530 9158 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_12530 10535 10987 gene locus_tag LOCUS_12540 10535 10987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 10911 12224 gene locus_tag LOCUS_12550 gene adh 10911 12224 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_12550 13064 12234 gene locus_tag LOCUS_12560 13064 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 14374 13097 gene locus_tag LOCUS_12570 14374 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_12570 16746 14383 gene locus_tag LOCUS_12580 16746 14383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_12580 17999 16893 gene locus_tag LOCUS_12590 17999 16893 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933214.1 protein_id gnl|my_center|LOCUS_12590 18689 18030 gene locus_tag LOCUS_12600 18689 18030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 20388 18817 gene locus_tag LOCUS_12610 20388 18817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence047 3544 368 gene locus_tag LOCUS_12620 3544 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 3976 3611 gene locus_tag LOCUS_12630 3976 3611 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330921.1 protein_id gnl|my_center|LOCUS_12630 5137 4028 gene locus_tag LOCUS_12640 gene tgt 5137 4028 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWK9 protein_id gnl|my_center|LOCUS_12640 6501 5164 gene locus_tag LOCUS_12650 gene rpoA 6501 5164 CDS product RNA polymerase subunit alpha domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328259.1 protein_id gnl|my_center|LOCUS_12650 6715 7854 gene locus_tag LOCUS_12660 6715 7854 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259167.1 protein_id gnl|my_center|LOCUS_12660 7858 8943 gene locus_tag LOCUS_12670 7858 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 10419 8947 gene locus_tag LOCUS_12680 10419 8947 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123505.1 protein_id gnl|my_center|LOCUS_12680 10483 11550 gene locus_tag LOCUS_12690 gene truD 10483 11550 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI49 protein_id gnl|my_center|LOCUS_12690 11705 12391 gene locus_tag LOCUS_12700 11705 12391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 13333 12398 gene locus_tag LOCUS_12710 13333 12398 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YN8 protein_id gnl|my_center|LOCUS_12710 14524 13451 gene locus_tag LOCUS_12720 14524 13451 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942604.1 protein_id gnl|my_center|LOCUS_12720 14876 14511 gene locus_tag LOCUS_12730 14876 14511 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE73 protein_id gnl|my_center|LOCUS_12730 15011 15574 gene locus_tag LOCUS_12740 15011 15574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 17497 15875 gene locus_tag LOCUS_12750 gene groL3 17497 15875 CDS product 60 kDa chaperonin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTY9 protein_id gnl|my_center|LOCUS_12750 17852 17562 gene locus_tag LOCUS_12760 gene groS 17852 17562 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1B0 protein_id gnl|my_center|LOCUS_12760 18180 19028 gene locus_tag LOCUS_12770 18180 19028 CDS product TIGR00268 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_12770 19043 19315 gene locus_tag LOCUS_12780 19043 19315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 19334 20161 gene locus_tag LOCUS_12790 19334 20161 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_12790 20170 21207 gene locus_tag LOCUS_12800 gene tsaD 20170 21207 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM42 protein_id gnl|my_center|LOCUS_12800 >Feature sequence048 2231 2983 gene locus_tag LOCUS_12810 2231 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 3040 3993 gene locus_tag LOCUS_12820 3040 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 5349 3994 gene locus_tag LOCUS_12830 5349 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_12830 5462 6334 gene locus_tag LOCUS_12840 5462 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124104.1 protein_id gnl|my_center|LOCUS_12840 7527 6331 gene locus_tag LOCUS_12850 gene argJ 7527 6331 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62061 protein_id gnl|my_center|LOCUS_12850 9892 7562 gene locus_tag LOCUS_12860 9892 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120740.1 protein_id gnl|my_center|LOCUS_12860 10185 12251 gene locus_tag LOCUS_12870 gene thiC 10185 12251 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FE9 protein_id gnl|my_center|LOCUS_12870 12514 13842 gene locus_tag LOCUS_12880 gene emrA 12514 13842 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121732.1 protein_id gnl|my_center|LOCUS_12880 13851 15377 gene locus_tag LOCUS_12890 13851 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 15374 16093 gene locus_tag LOCUS_12900 15374 16093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 16090 16593 gene locus_tag LOCUS_12910 16090 16593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 16568 18172 gene locus_tag LOCUS_12920 16568 18172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 18590 18174 gene locus_tag LOCUS_12930 18590 18174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 19768 19529 gene locus_tag LOCUS_12940 19768 19529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 20311 20000 gene locus_tag LOCUS_12950 20311 20000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence049 84 416 gene locus_tag LOCUS_12960 84 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1872 418 gene locus_tag LOCUS_12970 gene purB 1872 418 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFU0 protein_id gnl|my_center|LOCUS_12970 2276 2109 gene locus_tag LOCUS_12980 2276 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2497 3528 gene locus_tag LOCUS_12990 gene moxR 2497 3528 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336577.1 protein_id gnl|my_center|LOCUS_12990 3639 4859 gene locus_tag LOCUS_13000 3639 4859 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118398.1 protein_id gnl|my_center|LOCUS_13000 4869 6338 gene locus_tag LOCUS_13010 4869 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 6271 6675 gene locus_tag LOCUS_13020 6271 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 7379 6684 gene locus_tag LOCUS_13030 7379 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 8029 7376 gene locus_tag LOCUS_13040 gene cmk1 8029 7376 CDS product cytidylate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43892 protein_id gnl|my_center|LOCUS_13040 8690 8130 gene locus_tag LOCUS_13050 8690 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 9431 8895 gene locus_tag LOCUS_13060 9431 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 11362 9878 gene locus_tag LOCUS_13070 11362 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 11744 11367 gene locus_tag LOCUS_13080 11744 11367 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329333.1 protein_id gnl|my_center|LOCUS_13080 12956 11859 gene locus_tag LOCUS_13090 12956 11859 CDS product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 protein_id gnl|my_center|LOCUS_13090 14792 12963 gene locus_tag LOCUS_13100 14792 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 16306 14795 gene locus_tag LOCUS_13110 16306 14795 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932603.1 protein_id gnl|my_center|LOCUS_13110 16768 16331 gene locus_tag LOCUS_13120 gene dtd 16768 16331 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183H9 protein_id gnl|my_center|LOCUS_13120 16939 17202 gene locus_tag LOCUS_13130 16939 17202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 18015 17206 gene locus_tag LOCUS_13140 18015 17206 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XX0 protein_id gnl|my_center|LOCUS_13140 18628 18227 gene locus_tag LOCUS_13150 18628 18227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_13150 18825 19580 gene locus_tag LOCUS_13160 18825 19580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 20306 19596 gene locus_tag LOCUS_13170 20306 19596 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340751.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence050 38 2944 gene locus_tag LOCUS_13180 gene valS 38 2944 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1H7 protein_id gnl|my_center|LOCUS_13180 3031 5484 gene locus_tag LOCUS_13190 3031 5484 CDS product chromosome segregation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118036.1 protein_id gnl|my_center|LOCUS_13190 5489 6913 gene locus_tag LOCUS_13200 5489 6913 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123599.1 protein_id gnl|my_center|LOCUS_13200 6928 8226 gene locus_tag LOCUS_13210 6928 8226 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_13210 8459 8731 gene locus_tag LOCUS_13220 8459 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 9090 8707 gene locus_tag LOCUS_13230 9090 8707 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056015.1 protein_id gnl|my_center|LOCUS_13230 12075 9109 gene locus_tag LOCUS_13240 12075 9109 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_13240 12719 12159 gene locus_tag LOCUS_13250 gene frr 12719 12159 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTH0 protein_id gnl|my_center|LOCUS_13250 13496 12750 gene locus_tag LOCUS_13260 gene pyrH 13496 12750 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTH1 protein_id gnl|my_center|LOCUS_13260 14698 13583 gene locus_tag LOCUS_13270 14698 13583 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120946.1 protein_id gnl|my_center|LOCUS_13270 14856 17015 gene locus_tag LOCUS_13280 14856 17015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120539.1 protein_id gnl|my_center|LOCUS_13280 17760 17020 gene locus_tag LOCUS_13290 17760 17020 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNW9 protein_id gnl|my_center|LOCUS_13290 18374 17763 gene locus_tag LOCUS_13300 18374 17763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 18695 20476 gene locus_tag LOCUS_13310 18695 20476 CDS product lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546216.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence051 <1 1469 gene locus_tag LOCUS_13320 <1 1469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202992.1:cysteine protease 1521 3179 gene locus_tag LOCUS_13330 1521 3179 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120416.1 protein_id gnl|my_center|LOCUS_13330 3240 3500 gene locus_tag LOCUS_13340 3240 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 3652 4803 gene locus_tag LOCUS_13350 3652 4803 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070584.1 protein_id gnl|my_center|LOCUS_13350 5819 4884 gene locus_tag LOCUS_13360 5819 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 6255 5842 gene locus_tag LOCUS_13370 6255 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 6410 6892 gene locus_tag LOCUS_13380 6410 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 7341 6895 gene locus_tag LOCUS_13390 7341 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 7443 8246 gene locus_tag LOCUS_13400 7443 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 8430 9140 gene locus_tag LOCUS_13410 8430 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 10048 9149 gene locus_tag LOCUS_13420 10048 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 11430 10243 gene locus_tag LOCUS_13430 11430 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_13430 14451 11440 gene locus_tag LOCUS_13440 14451 11440 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118999.1 protein_id gnl|my_center|LOCUS_13440 15142 14552 gene locus_tag LOCUS_13450 15142 14552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 16571 15246 gene locus_tag LOCUS_13460 16571 15246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_13460 16742 16927 gene locus_tag LOCUS_13470 16742 16927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 17172 18104 gene locus_tag LOCUS_13480 17172 18104 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_13480 18151 18582 gene locus_tag LOCUS_13490 18151 18582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 19265 18579 gene locus_tag LOCUS_13500 19265 18579 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 protein_id gnl|my_center|LOCUS_13500 19367 20134 gene locus_tag LOCUS_13510 19367 20134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 20250 20336 gene locus_tag LOCUS_t00190 20250 20336 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence052 218 93 gene locus_tag LOCUS_13520 218 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 448 696 gene locus_tag LOCUS_13530 448 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 832 1062 gene locus_tag LOCUS_13540 832 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1056 2291 gene locus_tag LOCUS_13550 1056 2291 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118084.1 protein_id gnl|my_center|LOCUS_13550 4294 2939 gene locus_tag LOCUS_13560 4294 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 6821 4371 gene locus_tag LOCUS_13570 6821 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 7585 6818 gene locus_tag LOCUS_13580 7585 6818 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 protein_id gnl|my_center|LOCUS_13580 8310 7612 gene locus_tag LOCUS_13590 8310 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 9663 8446 gene locus_tag LOCUS_13600 9663 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120898.1 protein_id gnl|my_center|LOCUS_13600 10820 9663 gene locus_tag LOCUS_13610 10820 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120897.1 protein_id gnl|my_center|LOCUS_13610 11650 10853 gene locus_tag LOCUS_13620 gene dapB1 11650 10853 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGJ4 protein_id gnl|my_center|LOCUS_13620 12963 11668 gene locus_tag LOCUS_13630 12963 11668 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_13630 14309 13128 gene locus_tag LOCUS_13640 gene rnd 14309 13128 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120569.1 protein_id gnl|my_center|LOCUS_13640 14475 14738 gene locus_tag LOCUS_13650 14475 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 15825 14743 gene locus_tag LOCUS_13660 15825 14743 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_13660 15874 16998 gene locus_tag LOCUS_13670 15874 16998 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108126.1 protein_id gnl|my_center|LOCUS_13670 17232 19733 gene locus_tag LOCUS_13680 17232 19733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence053 <1 1139 gene locus_tag LOCUS_13690 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118036.1:chromosome segregation protein 1171 2604 gene locus_tag LOCUS_13700 1171 2604 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117906.1 protein_id gnl|my_center|LOCUS_13700 2838 5597 gene locus_tag LOCUS_13710 gene ppc 2838 5597 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHN1 protein_id gnl|my_center|LOCUS_13710 6474 5602 gene locus_tag LOCUS_13720 6474 5602 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_13720 9035 6471 gene locus_tag LOCUS_13730 9035 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122580.1 protein_id gnl|my_center|LOCUS_13730 12461 9045 gene locus_tag LOCUS_13740 12461 9045 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266501.1 protein_id gnl|my_center|LOCUS_13740 13469 12480 gene locus_tag LOCUS_13750 13469 12480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_13750 14980 13466 gene locus_tag LOCUS_13760 14980 13466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_13760 16510 15278 gene locus_tag LOCUS_13770 16510 15278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 16849 18273 gene locus_tag LOCUS_13780 16849 18273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 18827 18345 gene locus_tag LOCUS_13790 18827 18345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 20251 18938 gene locus_tag LOCUS_13800 20251 18938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_13800 20535 20314 gene locus_tag LOCUS_13810 20535 20314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13810 >Feature sequence054 2042 726 gene locus_tag LOCUS_13820 2042 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_13820 7151 2136 gene locus_tag LOCUS_13830 7151 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 7398 7646 gene locus_tag LOCUS_13840 7398 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 7643 7843 gene locus_tag LOCUS_13850 7643 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 7857 9245 gene locus_tag LOCUS_13860 7857 9245 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118348.1 protein_id gnl|my_center|LOCUS_13860 9453 10472 gene locus_tag LOCUS_13870 gene moxR 9453 10472 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122148.1 protein_id gnl|my_center|LOCUS_13870 10479 11423 gene locus_tag LOCUS_13880 10479 11423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_13880 11433 13574 gene locus_tag LOCUS_13890 11433 13574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 13584 16025 gene locus_tag LOCUS_13900 13584 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 16028 17881 gene locus_tag LOCUS_13910 16028 17881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence055 <1 1968 gene locus_tag LOCUS_13920 <1 1968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URR0:translation initiation factor IF-2 1985 2275 gene locus_tag LOCUS_13930 1985 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_13930 2292 2756 gene locus_tag LOCUS_13940 2292 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2821 3546 gene locus_tag LOCUS_13950 2821 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 6015 3577 gene locus_tag LOCUS_13960 6015 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 6151 7689 gene locus_tag LOCUS_13970 gene pckA1 6151 7689 CDS product phosphoenolpyruvate carboxykinase [ATP] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKS7 protein_id gnl|my_center|LOCUS_13970 8703 7699 gene locus_tag LOCUS_13980 8703 7699 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269211.1 protein_id gnl|my_center|LOCUS_13980 8833 9894 gene locus_tag LOCUS_13990 8833 9894 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_13990 9910 10920 gene locus_tag LOCUS_14000 9910 10920 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258663.1 protein_id gnl|my_center|LOCUS_14000 11065 11559 gene locus_tag LOCUS_14010 11065 11559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 12418 11660 gene locus_tag LOCUS_14020 12418 11660 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 protein_id gnl|my_center|LOCUS_14020 12717 14198 gene locus_tag LOCUS_14030 gene lysS 12717 14198 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK37 protein_id gnl|my_center|LOCUS_14030 14295 15656 gene locus_tag LOCUS_14040 gene lolC 14295 15656 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121144.1 protein_id gnl|my_center|LOCUS_14040 15679 16485 gene locus_tag LOCUS_14050 gene lolD2 15679 16485 CDS product lipoprotein-releasing system ATP-binding protein LolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPK3 protein_id gnl|my_center|LOCUS_14050 16516 17370 gene locus_tag LOCUS_14060 gene ilvE 16516 17370 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_14060 17427 17897 gene locus_tag LOCUS_14070 gene usp-2 17427 17897 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E46 protein_id gnl|my_center|LOCUS_14070 18848 19066 gene locus_tag LOCUS_14080 18848 19066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 19208 19477 gene locus_tag LOCUS_14090 19208 19477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 19487 20356 gene locus_tag LOCUS_14100 19487 20356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence056 2501 2782 gene locus_tag LOCUS_14110 2501 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 6591 2803 gene locus_tag LOCUS_14120 6591 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 7363 6632 gene locus_tag LOCUS_14130 7363 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 7543 8031 gene locus_tag LOCUS_14140 7543 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_14140 8111 8686 gene locus_tag LOCUS_14150 8111 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 8701 9666 gene locus_tag LOCUS_14160 8701 9666 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118295.1 protein_id gnl|my_center|LOCUS_14160 9663 11099 gene locus_tag LOCUS_14170 9663 11099 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_14170 11105 12007 gene locus_tag LOCUS_14180 11105 12007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 13069 12038 gene locus_tag LOCUS_14190 13069 12038 CDS product delta 9 acyl-lipid fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333080.1 protein_id gnl|my_center|LOCUS_14190 13603 14040 gene locus_tag LOCUS_14200 gene mraZ 13603 14040 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P75467 protein_id gnl|my_center|LOCUS_14200 14350 14162 gene locus_tag LOCUS_14210 14350 14162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 14288 15202 gene locus_tag LOCUS_14220 gene rsmH 14288 15202 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFX8 protein_id gnl|my_center|LOCUS_14220 15241 16605 gene locus_tag LOCUS_14230 15241 16605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 17629 16721 gene locus_tag LOCUS_14240 17629 16721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 17706 18290 gene locus_tag LOCUS_14250 17706 18290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 18793 18353 gene locus_tag LOCUS_14260 18793 18353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 19158 18841 gene locus_tag LOCUS_14270 19158 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 19336 20325 gene locus_tag LOCUS_14280 19336 20325 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence057 3824 609 gene locus_tag LOCUS_14290 3824 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 4402 3863 gene locus_tag LOCUS_14300 4402 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 5457 4411 gene locus_tag LOCUS_14310 5457 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 5731 6255 gene locus_tag LOCUS_14320 5731 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 7922 6279 gene locus_tag LOCUS_14330 7922 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 9566 8034 gene locus_tag LOCUS_14340 9566 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 9955 12120 gene locus_tag LOCUS_14350 gene recD2 9955 12120 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCL3 protein_id gnl|my_center|LOCUS_14350 12255 15791 gene locus_tag LOCUS_14360 12255 15791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 16554 15823 gene locus_tag LOCUS_14370 16554 15823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 17303 17503 gene locus_tag LOCUS_14380 17303 17503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 17984 17607 gene locus_tag LOCUS_14390 17984 17607 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957355.1 protein_id gnl|my_center|LOCUS_14390 19179 18013 gene locus_tag LOCUS_14400 gene xylA 19179 18013 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0B8 protein_id gnl|my_center|LOCUS_14400 19772 19224 gene locus_tag LOCUS_14410 19772 19224 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868874.1 protein_id gnl|my_center|LOCUS_14410 <20461 19850 gene locus_tag LOCUS_14420 <20461 19850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122968.1:oxidoreductase >Feature sequence058 5191 4136 gene locus_tag LOCUS_14430 gene cysA 5191 4136 CDS product sulfate/thiosulfate import ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6Z1 protein_id gnl|my_center|LOCUS_14430 6066 5188 gene locus_tag LOCUS_14440 gene cysW 6066 5188 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205087.1 protein_id gnl|my_center|LOCUS_14440 6880 6056 gene locus_tag LOCUS_14450 6880 6056 CDS product sulfate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142071.1 protein_id gnl|my_center|LOCUS_14450 7990 6923 gene locus_tag LOCUS_14460 gene sbp1 7990 6923 CDS product sulfate transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208965.1 protein_id gnl|my_center|LOCUS_14460 8290 9147 gene locus_tag LOCUS_14470 gene accD 8290 9147 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHX0 protein_id gnl|my_center|LOCUS_14470 9853 9149 gene locus_tag LOCUS_14480 9853 9149 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182D6 protein_id gnl|my_center|LOCUS_14480 9939 10664 gene locus_tag LOCUS_14490 9939 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 10724 11293 gene locus_tag LOCUS_14500 10724 11293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 11311 11517 gene locus_tag LOCUS_14510 11311 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 12188 11580 gene locus_tag LOCUS_14520 12188 11580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 12351 13514 gene locus_tag LOCUS_14530 12351 13514 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_14530 15273 13516 gene locus_tag LOCUS_14540 15273 13516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 16030 15260 gene locus_tag LOCUS_14550 16030 15260 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_14550 16911 16045 gene locus_tag LOCUS_14560 16911 16045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 17059 18186 gene locus_tag LOCUS_14570 gene ald 17059 18186 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXF1 protein_id gnl|my_center|LOCUS_14570 18186 19436 gene locus_tag LOCUS_14580 gene xseA 18186 19436 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C85 protein_id gnl|my_center|LOCUS_14580 19462 19764 gene locus_tag LOCUS_14590 19462 19764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence059 2888 411 gene locus_tag LOCUS_14600 gene butB 2888 411 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122380.1 protein_id gnl|my_center|LOCUS_14600 3025 3624 gene locus_tag LOCUS_14610 3025 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3883 4923 gene locus_tag LOCUS_14620 3883 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946960.1 protein_id gnl|my_center|LOCUS_14620 6358 4952 gene locus_tag LOCUS_14630 6358 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 7010 6339 gene locus_tag LOCUS_14640 7010 6339 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532631.1 protein_id gnl|my_center|LOCUS_14640 7212 8849 gene locus_tag LOCUS_14650 7212 8849 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122718.1 protein_id gnl|my_center|LOCUS_14650 9135 11861 gene locus_tag LOCUS_14660 9135 11861 CDS product UPF0753 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF65 protein_id gnl|my_center|LOCUS_14660 11858 13225 gene locus_tag LOCUS_14670 gene ndhF 11858 13225 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122712.1 protein_id gnl|my_center|LOCUS_14670 13766 13449 gene locus_tag LOCUS_14680 13766 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 14360 14178 gene locus_tag LOCUS_14690 14360 14178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 14627 15484 gene locus_tag LOCUS_14700 14627 15484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence060 566 2092 gene locus_tag LOCUS_14710 gene phr 566 2092 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_14710 2096 2350 gene locus_tag LOCUS_14720 2096 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 2486 6376 gene locus_tag LOCUS_14730 2486 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 6465 7196 gene locus_tag LOCUS_14740 6465 7196 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122635.1 protein_id gnl|my_center|LOCUS_14740 7240 8580 gene locus_tag LOCUS_14750 7240 8580 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123366.1 protein_id gnl|my_center|LOCUS_14750 8617 8877 gene locus_tag LOCUS_14760 8617 8877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 8877 10838 gene locus_tag LOCUS_14770 8877 10838 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123461.1 protein_id gnl|my_center|LOCUS_14770 11553 10852 gene locus_tag LOCUS_14780 11553 10852 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402891.1 protein_id gnl|my_center|LOCUS_14780 13032 11569 gene locus_tag LOCUS_14790 13032 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 13237 14820 gene locus_tag LOCUS_14800 13237 14820 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_14800 14851 16731 gene locus_tag LOCUS_14810 gene mutL 14851 16731 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ2 protein_id gnl|my_center|LOCUS_14810 >Feature sequence061 298 1092 gene locus_tag LOCUS_14820 298 1092 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667138.1 protein_id gnl|my_center|LOCUS_14820 2833 1100 gene locus_tag LOCUS_14830 2833 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3581 2910 gene locus_tag LOCUS_14840 3581 2910 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392988.1 protein_id gnl|my_center|LOCUS_14840 3728 4501 gene locus_tag LOCUS_14850 3728 4501 CDS product LmbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325025.1 protein_id gnl|my_center|LOCUS_14850 5614 4850 gene locus_tag LOCUS_14860 5614 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 6947 5850 gene locus_tag LOCUS_14870 gene rlmN 6947 5850 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7V1 protein_id gnl|my_center|LOCUS_14870 7111 7698 gene locus_tag LOCUS_14880 gene ahpC 7111 7698 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136732.1 protein_id gnl|my_center|LOCUS_14880 7775 8638 gene locus_tag LOCUS_14890 gene folD 7775 8638 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNN9 protein_id gnl|my_center|LOCUS_14890 8767 11007 gene locus_tag LOCUS_14900 8767 11007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 11072 11824 gene locus_tag LOCUS_14910 11072 11824 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62036 protein_id gnl|my_center|LOCUS_14910 13319 11898 gene locus_tag LOCUS_14920 13319 11898 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_14920 16184 13371 gene locus_tag LOCUS_14930 16184 13371 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121568.1 protein_id gnl|my_center|LOCUS_14930 17517 16354 gene locus_tag LOCUS_14940 17517 16354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 17975 17556 gene locus_tag LOCUS_14950 17975 17556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 18092 19414 gene locus_tag LOCUS_14960 18092 19414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence062 187 681 gene locus_tag LOCUS_14970 187 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085261.1 protein_id gnl|my_center|LOCUS_14970 1567 737 gene locus_tag LOCUS_14980 gene purU 1567 737 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RD3 protein_id gnl|my_center|LOCUS_14980 3078 1603 gene locus_tag LOCUS_14990 3078 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_14990 6148 3092 gene locus_tag LOCUS_15000 6148 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123598.1 protein_id gnl|my_center|LOCUS_15000 6569 6910 gene locus_tag LOCUS_15010 6569 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 6911 7309 gene locus_tag LOCUS_15020 6911 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 8163 7921 gene locus_tag LOCUS_15030 8163 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 8476 9102 gene locus_tag LOCUS_15040 8476 9102 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968051.1 protein_id gnl|my_center|LOCUS_15040 9575 9108 gene locus_tag LOCUS_15050 9575 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_15050 11069 9603 gene locus_tag LOCUS_15060 11069 9603 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117906.1 protein_id gnl|my_center|LOCUS_15060 14176 11081 gene locus_tag LOCUS_15070 gene cti 14176 11081 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121858.1 protein_id gnl|my_center|LOCUS_15070 15763 14303 gene locus_tag LOCUS_15080 15763 14303 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123803.1 protein_id gnl|my_center|LOCUS_15080 18410 15783 gene locus_tag LOCUS_15090 18410 15783 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123804.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence063 121 48 gene locus_tag LOCUS_t00200 121 48 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1192 176 gene locus_tag LOCUS_15100 1192 176 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176584.1 protein_id gnl|my_center|LOCUS_15100 2022 1198 gene locus_tag LOCUS_15110 2022 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 2123 3481 gene locus_tag LOCUS_15120 2123 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118694.1 protein_id gnl|my_center|LOCUS_15120 4968 3484 gene locus_tag LOCUS_15130 4968 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 5138 6475 gene locus_tag LOCUS_15140 5138 6475 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122491.1 protein_id gnl|my_center|LOCUS_15140 6743 6519 gene locus_tag LOCUS_15150 6743 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 7381 8130 gene locus_tag LOCUS_15160 7381 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 8698 8516 gene locus_tag LOCUS_15170 8698 8516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 9912 9256 gene locus_tag LOCUS_15180 9912 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 14666 10062 gene locus_tag LOCUS_15190 14666 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 15278 15793 gene locus_tag LOCUS_15200 15278 15793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 15817 16572 gene locus_tag LOCUS_15210 15817 16572 CDS product polysaccharide/polyol phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706700.1 protein_id gnl|my_center|LOCUS_15210 16593 17582 gene locus_tag LOCUS_15220 gene pmi 16593 17582 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_15220 17596 18072 gene locus_tag LOCUS_15230 17596 18072 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942724.1 protein_id gnl|my_center|LOCUS_15230 18168 19172 gene locus_tag LOCUS_15240 gene gmd 18168 19172 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ72 protein_id gnl|my_center|LOCUS_15240 >Feature sequence064 1197 1907 gene locus_tag LOCUS_15250 1197 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 4571 2358 gene locus_tag LOCUS_15260 gene fdhF 4571 2358 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121932.1 protein_id gnl|my_center|LOCUS_15260 4683 5390 gene locus_tag LOCUS_15270 4683 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 5493 6899 gene locus_tag LOCUS_15280 5493 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_15280 8361 6976 gene locus_tag LOCUS_15290 8361 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_15290 8733 10316 gene locus_tag LOCUS_15300 gene purF 8733 10316 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGS5 protein_id gnl|my_center|LOCUS_15300 10405 10890 gene locus_tag LOCUS_15310 gene smpB 10405 10890 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMJ6 protein_id gnl|my_center|LOCUS_15310 10915 11928 gene locus_tag LOCUS_15320 10915 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 11933 13660 gene locus_tag LOCUS_15330 11933 13660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 13809 14654 gene locus_tag LOCUS_15340 13809 14654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 14729 15403 gene locus_tag LOCUS_15350 14729 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 15403 16032 gene locus_tag LOCUS_15360 gene coaC 15403 16032 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287045.1 protein_id gnl|my_center|LOCUS_15360 16136 17080 gene locus_tag LOCUS_15370 16136 17080 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104025.1 protein_id gnl|my_center|LOCUS_15370 17124 18047 gene locus_tag LOCUS_15380 17124 18047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence065 1316 321 gene locus_tag LOCUS_15390 1316 321 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123521.1 protein_id gnl|my_center|LOCUS_15390 3339 1381 gene locus_tag LOCUS_15400 3339 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 3525 4520 gene locus_tag LOCUS_15410 3525 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 4832 5914 gene locus_tag LOCUS_15420 4832 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 6088 8037 gene locus_tag LOCUS_15430 6088 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 8050 9144 gene locus_tag LOCUS_15440 8050 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 9544 9173 gene locus_tag LOCUS_15450 9544 9173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 10518 9580 gene locus_tag LOCUS_15460 gene htrB 10518 9580 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121326.1 protein_id gnl|my_center|LOCUS_15460 10704 12086 gene locus_tag LOCUS_15470 gene strI 10704 12086 CDS product streptomycin biosynthesis protein StrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_15470 13205 12144 gene locus_tag LOCUS_15480 13205 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 13682 13356 gene locus_tag LOCUS_15490 13682 13356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 14686 13745 gene locus_tag LOCUS_15500 14686 13745 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_15500 14871 15113 gene locus_tag LOCUS_15510 14871 15113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 15142 17361 gene locus_tag LOCUS_15520 gene thrS 15142 17361 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ52 protein_id gnl|my_center|LOCUS_15520 17442 18071 gene locus_tag LOCUS_15530 17442 18071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence066 238 309 gene locus_tag LOCUS_t00210 238 309 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 347 697 gene locus_tag LOCUS_15540 gene rplV 347 697 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN15 protein_id gnl|my_center|LOCUS_15540 756 1457 gene locus_tag LOCUS_15550 gene rpsC 756 1457 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN14 protein_id gnl|my_center|LOCUS_15550 1396 1818 gene locus_tag LOCUS_15560 gene rplP 1396 1818 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN13 protein_id gnl|my_center|LOCUS_15560 1855 2076 gene locus_tag LOCUS_15570 gene rpmC 1855 2076 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN12 protein_id gnl|my_center|LOCUS_15570 2080 2388 gene locus_tag LOCUS_15580 2080 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 2444 2812 gene locus_tag LOCUS_15590 gene rplN 2444 2812 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN10 protein_id gnl|my_center|LOCUS_15590 2850 3185 gene locus_tag LOCUS_15600 gene rplX 2850 3185 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFQ8 protein_id gnl|my_center|LOCUS_15600 3252 3791 gene locus_tag LOCUS_15610 gene rplE 3252 3791 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFQ9 protein_id gnl|my_center|LOCUS_15610 3810 4046 gene locus_tag LOCUS_15620 3810 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 4059 4505 gene locus_tag LOCUS_15630 gene rpsH 4059 4505 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN06 protein_id gnl|my_center|LOCUS_15630 4522 5073 gene locus_tag LOCUS_15640 4522 5073 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810135.1 protein_id gnl|my_center|LOCUS_15640 5090 5458 gene locus_tag LOCUS_15650 gene rplR 5090 5458 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZAE3 protein_id gnl|my_center|LOCUS_15650 5501 5998 gene locus_tag LOCUS_15660 gene rpsE 5501 5998 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN03 protein_id gnl|my_center|LOCUS_15660 5998 6492 gene locus_tag LOCUS_15670 gene rplO 5998 6492 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN02 protein_id gnl|my_center|LOCUS_15670 6626 7993 gene locus_tag LOCUS_15680 gene secY 6626 7993 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN01 protein_id gnl|my_center|LOCUS_15680 8116 8766 gene locus_tag LOCUS_15690 gene adk 8116 8766 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EJ9 protein_id gnl|my_center|LOCUS_15690 8773 9582 gene locus_tag LOCUS_15700 8773 9582 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_15700 9855 10241 gene locus_tag LOCUS_15710 gene rpsM 9855 10241 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC7 protein_id gnl|my_center|LOCUS_15710 10276 10650 gene locus_tag LOCUS_15720 gene rpsK 10276 10650 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC6 protein_id gnl|my_center|LOCUS_15720 10715 11347 gene locus_tag LOCUS_15730 gene rpsD 10715 11347 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80373 protein_id gnl|my_center|LOCUS_15730 11423 12418 gene locus_tag LOCUS_15740 gene rpoA 11423 12418 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC5 protein_id gnl|my_center|LOCUS_15740 12455 12871 gene locus_tag LOCUS_15750 gene rplQ 12455 12871 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H5 protein_id gnl|my_center|LOCUS_15750 13026 14345 gene locus_tag LOCUS_15760 13026 14345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 14930 14439 gene locus_tag LOCUS_15770 14930 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 17041 15374 gene locus_tag LOCUS_15780 17041 15374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence067 1751 858 gene locus_tag LOCUS_15790 1751 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 4004 1866 gene locus_tag LOCUS_15800 gene fadB 4004 1866 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR9 protein_id gnl|my_center|LOCUS_15800 10987 4019 gene locus_tag LOCUS_15810 10987 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 14405 11001 gene locus_tag LOCUS_15820 14405 11001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 14639 15997 gene locus_tag LOCUS_15830 14639 15997 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_15830 17757 15994 gene locus_tag LOCUS_15840 17757 15994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence068 2629 422 gene locus_tag LOCUS_15850 2629 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 4106 2622 gene locus_tag LOCUS_15860 gene lysA1 4106 2622 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_15860 5161 4103 gene locus_tag LOCUS_15870 5161 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 5403 5158 gene locus_tag LOCUS_15880 5403 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 6140 5400 gene locus_tag LOCUS_15890 6140 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 8806 6953 gene locus_tag LOCUS_15900 gene secA2 8806 6953 CDS product protein translocase subunit SecA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWI5 protein_id gnl|my_center|LOCUS_15900 9601 10557 gene locus_tag LOCUS_15910 9601 10557 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_15910 10570 11559 gene locus_tag LOCUS_15920 10570 11559 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E005 protein_id gnl|my_center|LOCUS_15920 15079 11561 gene locus_tag LOCUS_15930 gene yahN 15079 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122867.1 protein_id gnl|my_center|LOCUS_15930 16365 15079 gene locus_tag LOCUS_15940 16365 15079 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_15940 16603 16400 gene locus_tag LOCUS_15950 16603 16400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence069 309 1520 gene locus_tag LOCUS_15960 309 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_15960 1777 1517 gene locus_tag LOCUS_15970 1777 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2045 3664 gene locus_tag LOCUS_15980 2045 3664 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880464.1 protein_id gnl|my_center|LOCUS_15980 3813 4022 gene locus_tag LOCUS_15990 3813 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 4440 5246 gene locus_tag LOCUS_16000 4440 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 5344 5973 gene locus_tag LOCUS_16010 5344 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 5976 6623 gene locus_tag LOCUS_16020 5976 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 7898 6639 gene locus_tag LOCUS_16030 gene metK 7898 6639 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CXS7 protein_id gnl|my_center|LOCUS_16030 8003 9403 gene locus_tag LOCUS_16040 8003 9403 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122884.1 protein_id gnl|my_center|LOCUS_16040 9543 9899 gene locus_tag LOCUS_16050 9543 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 10032 10241 gene locus_tag LOCUS_16060 10032 10241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 10255 12840 gene locus_tag LOCUS_16070 10255 12840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 12842 13408 gene locus_tag LOCUS_16080 12842 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 13420 16077 gene locus_tag LOCUS_16090 13420 16077 CDS product arsenite oxidase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257094.1 protein_id gnl|my_center|LOCUS_16090 16309 16043 gene locus_tag LOCUS_16100 16309 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 <17725 16666 gene locus_tag LOCUS_16110 <17725 16666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UPZ8:phosphoribosylamine--glycine ligase >Feature sequence070 1120 1980 gene locus_tag LOCUS_16120 1120 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 2695 2063 gene locus_tag LOCUS_16130 2695 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 4465 2732 gene locus_tag LOCUS_16140 4465 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 5709 4534 gene locus_tag LOCUS_16150 gene pilT 5709 4534 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_16150 6516 5746 gene locus_tag LOCUS_16160 gene hisF 6516 5746 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKJ9 protein_id gnl|my_center|LOCUS_16160 6741 8096 gene locus_tag LOCUS_16170 6741 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_16170 8195 8545 gene locus_tag LOCUS_16180 8195 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 8807 10171 gene locus_tag LOCUS_16190 8807 10171 CDS product glucarate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334635.1 protein_id gnl|my_center|LOCUS_16190 10185 10772 gene locus_tag LOCUS_16200 10185 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 11297 10776 gene locus_tag LOCUS_16210 11297 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 13086 11710 gene locus_tag LOCUS_16220 13086 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 13282 13983 gene locus_tag LOCUS_16230 13282 13983 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CKQ0 protein_id gnl|my_center|LOCUS_16230 14091 16340 gene locus_tag LOCUS_16240 gene priA 14091 16340 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFQ0 protein_id gnl|my_center|LOCUS_16240 17167 16409 gene locus_tag LOCUS_16250 17167 16409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 17435 17509 gene locus_tag LOCUS_t00220 17435 17509 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence071 <1 1560 gene locus_tag LOCUS_16260 <1 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879438.1:cysteine proteinase 2548 1613 gene locus_tag LOCUS_16270 2548 1613 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_16270 2741 2657 gene locus_tag LOCUS_t00230 2741 2657 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4525 2804 gene locus_tag LOCUS_16280 4525 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 6147 4522 gene locus_tag LOCUS_16290 6147 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 8639 6174 gene locus_tag LOCUS_16300 8639 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 11074 8636 gene locus_tag LOCUS_16310 11074 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 12183 11239 gene locus_tag LOCUS_16320 12183 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 12343 13731 gene locus_tag LOCUS_16330 12343 13731 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_16330 13781 14317 gene locus_tag LOCUS_16340 13781 14317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 14327 14791 gene locus_tag LOCUS_16350 14327 14791 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140010.1 protein_id gnl|my_center|LOCUS_16350 15709 14849 gene locus_tag LOCUS_16360 15709 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 17135 15720 gene locus_tag LOCUS_16370 17135 15720 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0P8 protein_id gnl|my_center|LOCUS_16370 >Feature sequence072 617 1099 gene locus_tag LOCUS_16380 617 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1096 1518 gene locus_tag LOCUS_16390 1096 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 5918 1551 gene locus_tag LOCUS_16400 5918 1551 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117959.1 protein_id gnl|my_center|LOCUS_16400 7078 5960 gene locus_tag LOCUS_16410 7078 5960 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_16410 7322 8056 gene locus_tag LOCUS_16420 7322 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 8221 10578 gene locus_tag LOCUS_16430 8221 10578 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117697.1 protein_id gnl|my_center|LOCUS_16430 10589 13744 gene locus_tag LOCUS_16440 gene gdhP 10589 13744 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 protein_id gnl|my_center|LOCUS_16440 14534 13761 gene locus_tag LOCUS_16450 14534 13761 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121235.1 protein_id gnl|my_center|LOCUS_16450 15783 14599 gene locus_tag LOCUS_16460 15783 14599 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence073 1117 605 gene locus_tag LOCUS_16470 1117 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1632 1114 gene locus_tag LOCUS_16480 1632 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2071 1637 gene locus_tag LOCUS_16490 gene tesB 2071 1637 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331599.1 protein_id gnl|my_center|LOCUS_16490 3921 2068 gene locus_tag LOCUS_16500 3921 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 5735 3936 gene locus_tag LOCUS_16510 gene lepA1 5735 3936 CDS product elongation factor 4 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX15 protein_id gnl|my_center|LOCUS_16510 5876 6442 gene locus_tag LOCUS_16520 5876 6442 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW63 protein_id gnl|my_center|LOCUS_16520 7322 6495 gene locus_tag LOCUS_16530 7322 6495 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVF1 protein_id gnl|my_center|LOCUS_16530 7491 8492 gene locus_tag LOCUS_16540 7491 8492 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_16540 8489 9457 gene locus_tag LOCUS_16550 8489 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 10577 9519 gene locus_tag LOCUS_16560 10577 9519 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331256.1 protein_id gnl|my_center|LOCUS_16560 10705 11418 gene locus_tag LOCUS_16570 10705 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 11598 12995 gene locus_tag LOCUS_16580 11598 12995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 14387 13002 gene locus_tag LOCUS_16590 14387 13002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_16590 15592 14594 gene locus_tag LOCUS_16600 15592 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121108.1 protein_id gnl|my_center|LOCUS_16600 15763 17385 gene locus_tag LOCUS_16610 15763 17385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence074 <1 956 gene locus_tag LOCUS_16620 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120800.1:oxidoreductase 969 2444 gene locus_tag LOCUS_16630 969 2444 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_16630 2549 2794 gene locus_tag LOCUS_16640 gene mazE 2549 2794 CDS product multidrug transporter MatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443825.1 protein_id gnl|my_center|LOCUS_16640 2791 3132 gene locus_tag LOCUS_16650 2791 3132 CDS product mRNA-degrading endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_16650 3156 4073 gene locus_tag LOCUS_16660 3156 4073 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URI8 protein_id gnl|my_center|LOCUS_16660 4299 5945 gene locus_tag LOCUS_16670 4299 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 7395 5965 gene locus_tag LOCUS_16680 7395 5965 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_16680 10679 7392 gene locus_tag LOCUS_16690 10679 7392 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_16690 11196 12539 gene locus_tag LOCUS_16700 11196 12539 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_16700 12613 15729 gene locus_tag LOCUS_16710 12613 15729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 15814 16272 gene locus_tag LOCUS_16720 15814 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 16464 16916 gene locus_tag LOCUS_16730 16464 16916 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence075 3270 319 gene locus_tag LOCUS_16740 3270 319 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120793.1 protein_id gnl|my_center|LOCUS_16740 4234 3296 gene locus_tag LOCUS_16750 4234 3296 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762562.1 protein_id gnl|my_center|LOCUS_16750 4492 5058 gene locus_tag LOCUS_16760 4492 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 6232 5078 gene locus_tag LOCUS_16770 6232 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 6893 6288 gene locus_tag LOCUS_16780 gene clpP2 6893 6288 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK66 protein_id gnl|my_center|LOCUS_16780 7654 7004 gene locus_tag LOCUS_16790 gene clpP1 7654 7004 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK67 protein_id gnl|my_center|LOCUS_16790 9175 7682 gene locus_tag LOCUS_16800 gene tig 9175 7682 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URG5 protein_id gnl|my_center|LOCUS_16800 9455 9383 gene locus_tag LOCUS_t00240 9455 9383 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11318 9558 gene locus_tag LOCUS_16810 11318 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 12384 11440 gene locus_tag LOCUS_16820 12384 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660854.1 protein_id gnl|my_center|LOCUS_16820 13566 12529 gene locus_tag LOCUS_16830 13566 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 13804 15138 gene locus_tag LOCUS_16840 13804 15138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_16840 17325 15226 gene locus_tag LOCUS_16850 17325 15226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence076 2092 452 gene locus_tag LOCUS_16860 gene glpA 2092 452 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F412 protein_id gnl|my_center|LOCUS_16860 2581 2381 gene locus_tag LOCUS_16870 2581 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2538 4523 gene locus_tag LOCUS_16880 2538 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 5268 4525 gene locus_tag LOCUS_16890 5268 4525 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969922.1 protein_id gnl|my_center|LOCUS_16890 5875 6942 gene locus_tag LOCUS_16900 5875 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121934.1 protein_id gnl|my_center|LOCUS_16900 6942 8261 gene locus_tag LOCUS_16910 6942 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 8254 10092 gene locus_tag LOCUS_16920 8254 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 10174 11493 gene locus_tag LOCUS_16930 10174 11493 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 protein_id gnl|my_center|LOCUS_16930 14205 11566 gene locus_tag LOCUS_16940 14205 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 14381 15415 gene locus_tag LOCUS_16950 14381 15415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 15419 16354 gene locus_tag LOCUS_16960 15419 16354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence077 862 476 gene locus_tag LOCUS_16970 862 476 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_16970 1095 859 gene locus_tag LOCUS_16980 1095 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142023.1 protein_id gnl|my_center|LOCUS_16980 1999 1316 gene locus_tag LOCUS_16990 1999 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2742 2113 gene locus_tag LOCUS_17000 2742 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 3923 2733 gene locus_tag LOCUS_17010 3923 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 4777 3923 gene locus_tag LOCUS_17020 4777 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 4985 6595 gene locus_tag LOCUS_17030 gene crtI 4985 6595 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122696.1 protein_id gnl|my_center|LOCUS_17030 6641 8212 gene locus_tag LOCUS_17040 6641 8212 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123504.1 protein_id gnl|my_center|LOCUS_17040 8209 9030 gene locus_tag LOCUS_17050 8209 9030 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123503.1 protein_id gnl|my_center|LOCUS_17050 10183 10872 gene locus_tag LOCUS_17060 10183 10872 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159676.1 protein_id gnl|my_center|LOCUS_17060 11891 10950 gene locus_tag LOCUS_17070 11891 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 13288 12200 gene locus_tag LOCUS_17080 13288 12200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 14860 13298 gene locus_tag LOCUS_17090 14860 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 16106 14853 gene locus_tag LOCUS_17100 gene cinA 16106 14853 CDS product putative competence-damage inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BS8 protein_id gnl|my_center|LOCUS_17100 <16880 16103 gene locus_tag LOCUS_17110 <16880 16103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140914.1:MFS transporter >Feature sequence078 <1 1111 gene locus_tag LOCUS_17120 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095374.1:dehydratase 1209 2510 gene locus_tag LOCUS_17130 1209 2510 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_17130 2827 4374 gene locus_tag LOCUS_17140 2827 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4548 5177 gene locus_tag LOCUS_17150 4548 5177 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334179.1 protein_id gnl|my_center|LOCUS_17150 5158 6408 gene locus_tag LOCUS_17160 gene papS 5158 6408 CDS product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118607.1 protein_id gnl|my_center|LOCUS_17160 6525 7631 gene locus_tag LOCUS_17170 gene recA 6525 7631 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58254 protein_id gnl|my_center|LOCUS_17170 7786 9285 gene locus_tag LOCUS_17180 7786 9285 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088124.1 protein_id gnl|my_center|LOCUS_17180 9301 10146 gene locus_tag LOCUS_17190 9301 10146 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_17190 10246 10956 gene locus_tag LOCUS_17200 10246 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 11234 11818 gene locus_tag LOCUS_17210 11234 11818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 13185 11878 gene locus_tag LOCUS_17220 13185 11878 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210604.1 protein_id gnl|my_center|LOCUS_17220 13872 13210 gene locus_tag LOCUS_17230 13872 13210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 13962 15425 gene locus_tag LOCUS_17240 13962 15425 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3U9 protein_id gnl|my_center|LOCUS_17240 15832 15539 gene locus_tag LOCUS_17250 15832 15539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 16048 16668 gene locus_tag LOCUS_17260 16048 16668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence079 1517 114 gene locus_tag LOCUS_17270 1517 114 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_17270 3853 1532 gene locus_tag LOCUS_17280 3853 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119051.1 protein_id gnl|my_center|LOCUS_17280 5249 3975 gene locus_tag LOCUS_17290 gene eno 5249 3975 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SME1 protein_id gnl|my_center|LOCUS_17290 5973 5269 gene locus_tag LOCUS_17300 gene pur3 5973 5269 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_17300 6059 9487 gene locus_tag LOCUS_17310 gene ileS 6059 9487 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_17310 9501 10604 gene locus_tag LOCUS_17320 gene uxaB 9501 10604 CDS product altronate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NIJ4 protein_id gnl|my_center|LOCUS_17320 12461 10608 gene locus_tag LOCUS_17330 12461 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 12829 12461 gene locus_tag LOCUS_17340 12829 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 13841 12816 gene locus_tag LOCUS_17350 13841 12816 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence080 549 1097 gene locus_tag LOCUS_17360 549 1097 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084729.1 protein_id gnl|my_center|LOCUS_17360 1094 2002 gene locus_tag LOCUS_17370 1094 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084728.1 protein_id gnl|my_center|LOCUS_17370 3077 2313 gene locus_tag LOCUS_17380 3077 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_17380 4915 3506 gene locus_tag LOCUS_17390 4915 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_17390 <16355 5118 gene locus_tag LOCUS_17400 <16355 5118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073976.1:biofilm-promoting protein BpfA >Feature sequence081 2455 3276 gene locus_tag LOCUS_17410 gene whiG 2455 3276 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFV6 protein_id gnl|my_center|LOCUS_17410 3409 3867 gene locus_tag LOCUS_17420 3409 3867 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_17420 3881 5068 gene locus_tag LOCUS_17430 gene rlmI 3881 5068 CDS product ribosomal RNA large subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHR8 protein_id gnl|my_center|LOCUS_17430 5152 6123 gene locus_tag LOCUS_17440 5152 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 7780 6161 gene locus_tag LOCUS_17450 7780 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 9706 7817 gene locus_tag LOCUS_17460 9706 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 9838 10761 gene locus_tag LOCUS_17470 gene thiL 9838 10761 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPP0 protein_id gnl|my_center|LOCUS_17470 10792 12060 gene locus_tag LOCUS_17480 10792 12060 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123557.1 protein_id gnl|my_center|LOCUS_17480 12076 13233 gene locus_tag LOCUS_17490 gene fadA 12076 13233 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TP0 protein_id gnl|my_center|LOCUS_17490 13943 13245 gene locus_tag LOCUS_17500 gene lon 13943 13245 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327343.1 protein_id gnl|my_center|LOCUS_17500 14055 15080 gene locus_tag LOCUS_17510 gene pilC1 14055 15080 CDS product fimbrial assembly protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880450.1 protein_id gnl|my_center|LOCUS_17510 15637 15077 gene locus_tag LOCUS_17520 15637 15077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence082 167 1213 gene locus_tag LOCUS_17530 167 1213 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121665.1 protein_id gnl|my_center|LOCUS_17530 1234 1680 gene locus_tag LOCUS_17540 1234 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2118 1771 gene locus_tag LOCUS_17550 2118 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2978 2505 gene locus_tag LOCUS_17560 2978 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3856 3011 gene locus_tag LOCUS_17570 3856 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529363.1 protein_id gnl|my_center|LOCUS_17570 4097 4861 gene locus_tag LOCUS_17580 4097 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708126.1 protein_id gnl|my_center|LOCUS_17580 4960 5847 gene locus_tag LOCUS_17590 4960 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122544.1 protein_id gnl|my_center|LOCUS_17590 6045 6236 gene locus_tag LOCUS_17600 6045 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 8050 6329 gene locus_tag LOCUS_17610 8050 6329 CDS product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122835.1 protein_id gnl|my_center|LOCUS_17610 9162 8071 gene locus_tag LOCUS_17620 9162 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195875.1 protein_id gnl|my_center|LOCUS_17620 9585 9349 gene locus_tag LOCUS_17630 9585 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 9874 10422 gene locus_tag LOCUS_17640 9874 10422 CDS product RNAse inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962725.1 protein_id gnl|my_center|LOCUS_17640 12511 10577 gene locus_tag LOCUS_17650 12511 10577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 12930 12547 gene locus_tag LOCUS_17660 12930 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 14031 13006 gene locus_tag LOCUS_17670 14031 13006 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_17670 14563 14862 gene locus_tag LOCUS_17680 14563 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 14923 15792 gene locus_tag LOCUS_17690 14923 15792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence083 <1 2349 gene locus_tag LOCUS_17700 <1 2349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118043.1:cytochrome c 3080 2379 gene locus_tag LOCUS_17710 3080 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 4684 4040 gene locus_tag LOCUS_17720 4684 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 4897 6330 gene locus_tag LOCUS_17730 4897 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_17730 6380 8500 gene locus_tag LOCUS_17740 6380 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 8519 9847 gene locus_tag LOCUS_17750 gene mucD 8519 9847 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122202.1 protein_id gnl|my_center|LOCUS_17750 10862 9861 gene locus_tag LOCUS_17760 10862 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 12294 10870 gene locus_tag LOCUS_17770 12294 10870 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333818.1 protein_id gnl|my_center|LOCUS_17770 15290 12303 gene locus_tag LOCUS_17780 15290 12303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 <16000 15294 gene locus_tag LOCUS_17790 <16000 15294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120681.1:sulfatase >Feature sequence084 1159 140 gene locus_tag LOCUS_17800 1159 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 2129 1248 gene locus_tag LOCUS_17810 2129 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 3642 2197 gene locus_tag LOCUS_17820 3642 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_17820 6109 3701 gene locus_tag LOCUS_17830 6109 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 7679 6204 gene locus_tag LOCUS_17840 7679 6204 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_17840 9079 7676 gene locus_tag LOCUS_17850 9079 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_17850 11407 9509 gene locus_tag LOCUS_17860 11407 9509 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121956.1 protein_id gnl|my_center|LOCUS_17860 12004 13812 gene locus_tag LOCUS_17870 gene dnaG 12004 13812 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC38 protein_id gnl|my_center|LOCUS_17870 13812 15461 gene locus_tag LOCUS_17880 gene sigA 13812 15461 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQG1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence085 3782 1260 gene locus_tag LOCUS_17890 3782 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119051.1 protein_id gnl|my_center|LOCUS_17890 3951 5156 gene locus_tag LOCUS_17900 3951 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 5342 7747 gene locus_tag LOCUS_17910 gene butB 5342 7747 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122380.1 protein_id gnl|my_center|LOCUS_17910 7763 9079 gene locus_tag LOCUS_17920 7763 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_17920 9150 11405 gene locus_tag LOCUS_17930 9150 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 12856 11414 gene locus_tag LOCUS_17940 12856 11414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence086 705 1859 gene locus_tag LOCUS_17950 705 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 2302 4692 gene locus_tag LOCUS_17960 2302 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17960 4776 6101 gene locus_tag LOCUS_17970 4776 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_17970 6433 7518 gene locus_tag LOCUS_17980 6433 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 8592 7681 gene locus_tag LOCUS_17990 8592 7681 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_17990 8796 9596 gene locus_tag LOCUS_18000 8796 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 9844 11286 gene locus_tag LOCUS_18010 9844 11286 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119342.1 protein_id gnl|my_center|LOCUS_18010 11490 13835 gene locus_tag LOCUS_18020 11490 13835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119051.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence087 1826 690 gene locus_tag LOCUS_18030 1826 690 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_18030 2008 2364 gene locus_tag LOCUS_18040 2008 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 3272 2370 gene locus_tag LOCUS_18050 3272 2370 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123806.1 protein_id gnl|my_center|LOCUS_18050 5155 3371 gene locus_tag LOCUS_18060 5155 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 5400 7631 gene locus_tag LOCUS_18070 5400 7631 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 protein_id gnl|my_center|LOCUS_18070 7687 8694 gene locus_tag LOCUS_18080 7687 8694 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_18080 8691 9824 gene locus_tag LOCUS_18090 8691 9824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 10441 10067 gene locus_tag LOCUS_18100 gene rnpA 10441 10067 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I820 protein_id gnl|my_center|LOCUS_18100 11352 10459 gene locus_tag LOCUS_18110 gene dnaJ 11352 10459 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_18110 11552 12334 gene locus_tag LOCUS_18120 11552 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 12349 13560 gene locus_tag LOCUS_18130 gene fabF 12349 13560 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY0 protein_id gnl|my_center|LOCUS_18130 15000 13612 gene locus_tag LOCUS_18140 15000 13612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence088 666 1472 gene locus_tag LOCUS_18150 666 1472 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729452.1 protein_id gnl|my_center|LOCUS_18150 1524 2507 gene locus_tag LOCUS_18160 gene sgbU 1524 2507 CDS product hexulose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_18160 2528 2872 gene locus_tag LOCUS_18170 2528 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2934 3494 gene locus_tag LOCUS_18180 2934 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121172.1 protein_id gnl|my_center|LOCUS_18180 3573 4604 gene locus_tag LOCUS_18190 gene queA 3573 4604 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGI9 protein_id gnl|my_center|LOCUS_18190 4651 5031 gene locus_tag LOCUS_18200 gene yqhL 4651 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54510 protein_id gnl|my_center|LOCUS_18200 5115 6353 gene locus_tag LOCUS_18210 5115 6353 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764309.1 protein_id gnl|my_center|LOCUS_18210 6547 7557 gene locus_tag LOCUS_18220 6547 7557 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_18220 7630 9081 gene locus_tag LOCUS_18230 7630 9081 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_18230 10324 9167 gene locus_tag LOCUS_18240 10324 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 10518 10910 gene locus_tag LOCUS_18250 gene tspO 10518 10910 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123177.1 protein_id gnl|my_center|LOCUS_18250 11300 10911 gene locus_tag LOCUS_18260 11300 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 12314 11313 gene locus_tag LOCUS_18270 12314 11313 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122231.1 protein_id gnl|my_center|LOCUS_18270 13806 12301 gene locus_tag LOCUS_18280 13806 12301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 14498 13803 gene locus_tag LOCUS_18290 14498 13803 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815117.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence089 <1 1109 gene locus_tag LOCUS_18300 <1 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJX3:3-oxoacyl-[acyl-carrier-protein] synthase 2 1809 1123 gene locus_tag LOCUS_18310 gene surE 1809 1123 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_18310 1877 2113 gene locus_tag LOCUS_18320 1877 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 3321 2128 gene locus_tag LOCUS_18330 3321 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 4427 3318 gene locus_tag LOCUS_18340 4427 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120927.1 protein_id gnl|my_center|LOCUS_18340 5395 4427 gene locus_tag LOCUS_18350 5395 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 9180 5392 gene locus_tag LOCUS_18360 9180 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 14186 9216 gene locus_tag LOCUS_18370 14186 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence090 1879 2988 gene locus_tag LOCUS_18380 1879 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 3643 3041 gene locus_tag LOCUS_18390 gene potI 3643 3041 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023281.1 protein_id gnl|my_center|LOCUS_18390 4691 3828 gene locus_tag LOCUS_18400 4691 3828 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 protein_id gnl|my_center|LOCUS_18400 5701 4688 gene locus_tag LOCUS_18410 5701 4688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532646.1 protein_id gnl|my_center|LOCUS_18410 6833 5709 gene locus_tag LOCUS_18420 6833 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 7475 6858 gene locus_tag LOCUS_18430 7475 6858 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887115.1 protein_id gnl|my_center|LOCUS_18430 7910 7509 gene locus_tag LOCUS_18440 7910 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 8900 7923 gene locus_tag LOCUS_18450 8900 7923 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325404.1 protein_id gnl|my_center|LOCUS_18450 9085 9405 gene locus_tag LOCUS_18460 9085 9405 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122598.1 protein_id gnl|my_center|LOCUS_18460 9417 10265 gene locus_tag LOCUS_18470 gene glpF 9417 10265 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175868.1 protein_id gnl|my_center|LOCUS_18470 10284 11393 gene locus_tag LOCUS_18480 10284 11393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_18480 11812 11420 gene locus_tag LOCUS_18490 gene panD 11812 11420 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRF3 protein_id gnl|my_center|LOCUS_18490 12726 11899 gene locus_tag LOCUS_18500 12726 11899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 14029 13274 gene locus_tag LOCUS_18510 gene natA 14029 13274 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence091 3930 1987 gene locus_tag LOCUS_18520 3930 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 4788 3961 gene locus_tag LOCUS_18530 gene kdsA 4788 3961 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ25 protein_id gnl|my_center|LOCUS_18530 5163 4801 gene locus_tag LOCUS_18540 5163 4801 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USG1 protein_id gnl|my_center|LOCUS_18540 7489 5264 gene locus_tag LOCUS_18550 gene pcrA 7489 5264 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIR9 protein_id gnl|my_center|LOCUS_18550 7593 7997 gene locus_tag LOCUS_18560 gene acpS 7593 7997 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQA5 protein_id gnl|my_center|LOCUS_18560 8050 8610 gene locus_tag LOCUS_18570 8050 8610 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121758.1 protein_id gnl|my_center|LOCUS_18570 8637 9683 gene locus_tag LOCUS_18580 8637 9683 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107718.1 protein_id gnl|my_center|LOCUS_18580 9635 12049 gene locus_tag LOCUS_18590 9635 12049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 12153 12566 gene locus_tag LOCUS_18600 12153 12566 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_18600 12563 13744 gene locus_tag LOCUS_18610 12563 13744 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942440.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence092 3132 2566 gene locus_tag LOCUS_18620 3132 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 5792 3156 gene locus_tag LOCUS_18630 5792 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_18630 7030 5789 gene locus_tag LOCUS_18640 7030 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_18640 7271 8044 gene locus_tag LOCUS_18650 7271 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 protein_id gnl|my_center|LOCUS_18650 8284 10629 gene locus_tag LOCUS_18660 8284 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 10683 11960 gene locus_tag LOCUS_18670 10683 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_18670 12094 13164 gene locus_tag LOCUS_18680 12094 13164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119567.1 protein_id gnl|my_center|LOCUS_18680 13929 13183 gene locus_tag LOCUS_18690 13929 13183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence093 4236 2956 gene locus_tag LOCUS_18700 4236 2956 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367128.1 protein_id gnl|my_center|LOCUS_18700 5392 4403 gene locus_tag LOCUS_18710 5392 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 6403 5657 gene locus_tag LOCUS_18720 6403 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 7607 6510 gene locus_tag LOCUS_18730 7607 6510 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_18730 7958 7695 gene locus_tag LOCUS_18740 gene rpmA 7958 7695 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPR5 protein_id gnl|my_center|LOCUS_18740 8773 8045 gene locus_tag LOCUS_18750 8773 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 11052 9097 gene locus_tag LOCUS_18760 gene dnaK 11052 9097 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM31 protein_id gnl|my_center|LOCUS_18760 11604 12737 gene locus_tag LOCUS_18770 11604 12737 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546845.1 protein_id gnl|my_center|LOCUS_18770 12887 13642 gene locus_tag LOCUS_18780 gene tpi 12887 13642 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I7EP62 protein_id gnl|my_center|LOCUS_18780 >Feature sequence094 568 284 gene locus_tag LOCUS_18790 568 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18790 970 3114 gene locus_tag LOCUS_18800 970 3114 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_18800 3183 3323 gene locus_tag LOCUS_18810 3183 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 3324 3521 gene locus_tag LOCUS_18820 3324 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 4640 3576 gene locus_tag LOCUS_18830 4640 3576 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 protein_id gnl|my_center|LOCUS_18830 5273 4659 gene locus_tag LOCUS_18840 5273 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 6692 5298 gene locus_tag LOCUS_18850 gene rimO 6692 5298 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK39 protein_id gnl|my_center|LOCUS_18850 6865 7005 gene locus_tag LOCUS_18860 6865 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence095 <1 858 gene locus_tag LOCUS_18870 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125189.1:alanine--glyoxylate aminotransferase 913 2811 gene locus_tag LOCUS_18880 913 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2840 4129 gene locus_tag LOCUS_18890 gene hemL 2840 4129 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPM9 protein_id gnl|my_center|LOCUS_18890 4298 5095 gene locus_tag LOCUS_18900 4298 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 5185 6561 gene locus_tag LOCUS_18910 5185 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 6606 7712 gene locus_tag LOCUS_18920 6606 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 8159 7731 gene locus_tag LOCUS_18930 8159 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 9455 8598 gene locus_tag LOCUS_18940 9455 8598 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121199.1 protein_id gnl|my_center|LOCUS_18940 9739 11004 gene locus_tag LOCUS_18950 9739 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 11908 10985 gene locus_tag LOCUS_18960 11908 10985 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_18960 12422 12784 gene locus_tag LOCUS_18970 12422 12784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 12886 13284 gene locus_tag LOCUS_18980 12886 13284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence096 1092 256 gene locus_tag LOCUS_18990 1092 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122998.1 protein_id gnl|my_center|LOCUS_18990 1894 1112 gene locus_tag LOCUS_19000 1894 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2230 3675 gene locus_tag LOCUS_19010 2230 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3802 4287 gene locus_tag LOCUS_19020 3802 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 4312 5238 gene locus_tag LOCUS_19030 4312 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 5799 5242 gene locus_tag LOCUS_19040 5799 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 5969 7204 gene locus_tag LOCUS_19050 gene aspC 5969 7204 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121115.1 protein_id gnl|my_center|LOCUS_19050 7430 7689 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggctctggagtcttaggagc 9337 8552 gene locus_tag LOCUS_19060 9337 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 9422 10120 gene locus_tag LOCUS_19070 9422 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 10120 10485 gene locus_tag LOCUS_19080 10120 10485 CDS product putative gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP33 protein_id gnl|my_center|LOCUS_19080 10933 10508 gene locus_tag LOCUS_19090 10933 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 11061 11972 gene locus_tag LOCUS_19100 11061 11972 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454899.1 protein_id gnl|my_center|LOCUS_19100 11969 12907 gene locus_tag LOCUS_19110 11969 12907 CDS product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206386.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence097 30 2741 gene locus_tag LOCUS_19120 30 2741 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHM1 protein_id gnl|my_center|LOCUS_19120 3588 2815 gene locus_tag LOCUS_19130 3588 2815 CDS product cAMP phosphodiesterase class-II:metallo-beta-lactamase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_19130 4521 3715 gene locus_tag LOCUS_19140 4521 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 4658 5296 gene locus_tag LOCUS_19150 gene pdxH 4658 5296 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WN7 protein_id gnl|my_center|LOCUS_19150 6416 5301 gene locus_tag LOCUS_19160 gene galM 6416 5301 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_19160 6543 7718 gene locus_tag LOCUS_19170 6543 7718 CDS product acetyl-CoA--oxalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296867.1 protein_id gnl|my_center|LOCUS_19170 7768 8910 gene locus_tag LOCUS_19180 7768 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 9212 8928 gene locus_tag LOCUS_19190 9212 8928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 9502 11454 gene locus_tag LOCUS_19200 9502 11454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 12870 11482 gene locus_tag LOCUS_19210 12870 11482 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence098 2077 6369 gene locus_tag LOCUS_19220 2077 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 6539 7978 gene locus_tag LOCUS_19230 6539 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 7982 9835 gene locus_tag LOCUS_19240 7982 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 11691 9901 gene locus_tag LOCUS_19250 gene atsA 11691 9901 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122139.1 protein_id gnl|my_center|LOCUS_19250 12652 11717 gene locus_tag LOCUS_19260 12652 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence099 948 109 gene locus_tag LOCUS_19270 948 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1178 2455 gene locus_tag LOCUS_19280 1178 2455 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_19280 2501 3418 gene locus_tag LOCUS_19290 gene ffsA 2501 3418 CDS product formylmethanofuran--tetrahydromethanopterin formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE70 protein_id gnl|my_center|LOCUS_19290 3458 4264 gene locus_tag LOCUS_19300 3458 4264 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270512.1 protein_id gnl|my_center|LOCUS_19300 4325 5326 gene locus_tag LOCUS_19310 4325 5326 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_19310 5438 7396 gene locus_tag LOCUS_19320 gene shc-1 5438 7396 CDS product squalene-hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_19320 7486 8505 gene locus_tag LOCUS_19330 gene hpnH 7486 8505 CDS product hopanoid biosynthesis associated radical SAM protein HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_19330 8490 9314 gene locus_tag LOCUS_19340 8490 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 9648 10676 gene locus_tag LOCUS_19350 9648 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 11500 10736 gene locus_tag LOCUS_19360 11500 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975431.1 protein_id gnl|my_center|LOCUS_19360 12854 11622 gene locus_tag LOCUS_19370 12854 11622 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence100 19 759 gene locus_tag LOCUS_19380 19 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120912.1 protein_id gnl|my_center|LOCUS_19380 1299 763 gene locus_tag LOCUS_19390 1299 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 3678 1303 gene locus_tag LOCUS_19400 3678 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 4696 3806 gene locus_tag LOCUS_19410 4696 3806 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124007.1 protein_id gnl|my_center|LOCUS_19410 5922 4744 gene locus_tag LOCUS_19420 5922 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 7479 6004 gene locus_tag LOCUS_19430 7479 6004 CDS product L-fuculose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_19430 7631 8038 gene locus_tag LOCUS_19440 7631 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 8156 8356 gene locus_tag LOCUS_19450 8156 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530089.1 protein_id gnl|my_center|LOCUS_19450 8591 12256 gene locus_tag LOCUS_19460 8591 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence101 4172 1227 gene locus_tag LOCUS_19470 4172 1227 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120962.1 protein_id gnl|my_center|LOCUS_19470 4262 4594 gene locus_tag LOCUS_19480 4262 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 4591 4872 gene locus_tag LOCUS_19490 4591 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 5832 4906 gene locus_tag LOCUS_19500 5832 4906 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_19500 6047 6937 gene locus_tag LOCUS_19510 6047 6937 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_19510 6993 8447 gene locus_tag LOCUS_19520 6993 8447 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y8I9 protein_id gnl|my_center|LOCUS_19520 10529 8529 gene locus_tag LOCUS_19530 10529 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 11347 10529 gene locus_tag LOCUS_19540 11347 10529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 12792 11485 gene locus_tag LOCUS_19550 12792 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence102 1673 315 gene locus_tag LOCUS_19560 1673 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 1909 2481 gene locus_tag LOCUS_19570 1909 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2665 3600 gene locus_tag LOCUS_19580 2665 3600 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_19580 3633 4019 gene locus_tag LOCUS_19590 3633 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121901.1 protein_id gnl|my_center|LOCUS_19590 4230 4505 gene locus_tag LOCUS_19600 4230 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 4535 4987 gene locus_tag LOCUS_19610 4535 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 6474 5098 gene locus_tag LOCUS_19620 6474 5098 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8G1 protein_id gnl|my_center|LOCUS_19620 6718 8088 gene locus_tag LOCUS_19630 6718 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_19630 8254 11400 gene locus_tag LOCUS_19640 8254 11400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence103 323 1741 gene locus_tag LOCUS_19650 323 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_19650 1893 3017 gene locus_tag LOCUS_19660 1893 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 3049 3888 gene locus_tag LOCUS_19670 3049 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 5349 3901 gene locus_tag LOCUS_19680 5349 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121614.1 protein_id gnl|my_center|LOCUS_19680 6652 5489 gene locus_tag LOCUS_19690 6652 5489 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119341.1 protein_id gnl|my_center|LOCUS_19690 8396 8019 gene locus_tag LOCUS_19700 8396 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 9605 8481 gene locus_tag LOCUS_19710 9605 8481 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119341.1 protein_id gnl|my_center|LOCUS_19710 11822 9855 gene locus_tag LOCUS_19720 11822 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122005.1 protein_id gnl|my_center|LOCUS_19720 12440 11850 gene locus_tag LOCUS_19730 12440 11850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19730 >Feature sequence104 157 1560 gene locus_tag LOCUS_19740 gene aslA 157 1560 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_19740 1760 2278 gene locus_tag LOCUS_19750 1760 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2371 2502 gene locus_tag LOCUS_19760 2371 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2778 3428 gene locus_tag LOCUS_19770 2778 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 3715 4491 gene locus_tag LOCUS_19780 3715 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 4590 6017 gene locus_tag LOCUS_19790 4590 6017 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459002.1 protein_id gnl|my_center|LOCUS_19790 6014 6166 gene locus_tag LOCUS_19800 6014 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 6463 6600 gene locus_tag LOCUS_19810 6463 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 6656 7159 gene locus_tag LOCUS_19820 6656 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 8285 7326 gene locus_tag LOCUS_19830 8285 7326 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085065.1 protein_id gnl|my_center|LOCUS_19830 9735 8320 gene locus_tag LOCUS_19840 9735 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_19840 9901 10350 gene locus_tag LOCUS_19850 9901 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 10364 11677 gene locus_tag LOCUS_19860 10364 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence105 <1 1365 gene locus_tag LOCUS_19870 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119585.1:peptidase S9 1837 3396 gene locus_tag LOCUS_19880 1837 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 3345 3629 gene locus_tag LOCUS_19890 3345 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 4260 3925 gene locus_tag LOCUS_19900 4260 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 5453 4401 gene locus_tag LOCUS_19910 5453 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 5678 6052 gene locus_tag LOCUS_19920 5678 6052 CDS product malonate transporter MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112671.1 protein_id gnl|my_center|LOCUS_19920 6056 6829 gene locus_tag LOCUS_19930 6056 6829 CDS product malonate transporter MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084016.1 protein_id gnl|my_center|LOCUS_19930 6862 8334 gene locus_tag LOCUS_19940 6862 8334 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_19940 8348 9712 gene locus_tag LOCUS_19950 8348 9712 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120027.1 protein_id gnl|my_center|LOCUS_19950 10062 9754 gene locus_tag LOCUS_19960 10062 9754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 10181 11578 gene locus_tag LOCUS_19970 10181 11578 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence106 780 130 gene locus_tag LOCUS_19980 780 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 1285 791 gene locus_tag LOCUS_19990 gene fabZ 1285 791 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_19990 1437 2414 gene locus_tag LOCUS_20000 1437 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 2517 3890 gene locus_tag LOCUS_20010 2517 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 4348 5166 gene locus_tag LOCUS_20020 4348 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 5591 6463 gene locus_tag LOCUS_20030 gene bcpA 5591 6463 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808124.1 protein_id gnl|my_center|LOCUS_20030 7812 6475 gene locus_tag LOCUS_20040 7812 6475 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868664.1 protein_id gnl|my_center|LOCUS_20040 8085 9392 gene locus_tag LOCUS_20050 8085 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_20050 9557 10606 gene locus_tag LOCUS_20060 9557 10606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 11924 10512 gene locus_tag LOCUS_20070 11924 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence107 <1 854 gene locus_tag LOCUS_20080 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UWR2:delta-aminolevulinic acid dehydratase 2293 860 gene locus_tag LOCUS_20090 2293 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 3445 2315 gene locus_tag LOCUS_20100 3445 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084987.1 protein_id gnl|my_center|LOCUS_20100 3717 3448 gene locus_tag LOCUS_20110 3717 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 4609 3800 gene locus_tag LOCUS_20120 gene fabG 4609 3800 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122369.1 protein_id gnl|my_center|LOCUS_20120 6022 4640 gene locus_tag LOCUS_20130 6022 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 6229 6744 gene locus_tag LOCUS_20140 6229 6744 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 protein_id gnl|my_center|LOCUS_20140 9808 6761 gene locus_tag LOCUS_20150 9808 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 10187 11524 gene locus_tag LOCUS_20160 10187 11524 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066658.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence108 168 1550 gene locus_tag LOCUS_20170 168 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 2840 1539 gene locus_tag LOCUS_20180 2840 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 3359 2859 gene locus_tag LOCUS_20190 3359 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 3782 3402 gene locus_tag LOCUS_20200 3782 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 4354 3782 gene locus_tag LOCUS_20210 4354 3782 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889720.1 protein_id gnl|my_center|LOCUS_20210 4744 4397 gene locus_tag LOCUS_20220 4744 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 6425 4764 gene locus_tag LOCUS_20230 6425 4764 CDS product protein fwdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870682.1 protein_id gnl|my_center|LOCUS_20230 7786 6467 gene locus_tag LOCUS_20240 7786 6467 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_20240 8230 7808 gene locus_tag LOCUS_20250 8230 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 9221 8283 gene locus_tag LOCUS_20260 9221 8283 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence109 3533 159 gene locus_tag LOCUS_20270 3533 159 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123694.1 protein_id gnl|my_center|LOCUS_20270 3756 4532 gene locus_tag LOCUS_20280 3756 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 protein_id gnl|my_center|LOCUS_20280 4679 4924 gene locus_tag LOCUS_20290 4679 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 4937 5929 gene locus_tag LOCUS_20300 4937 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 7208 5949 gene locus_tag LOCUS_20310 7208 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_20310 9618 7225 gene locus_tag LOCUS_20320 9618 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_20320 9931 10329 gene locus_tag LOCUS_20330 9931 10329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 10373 11056 gene locus_tag LOCUS_20340 10373 11056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 <11807 11142 gene locus_tag LOCUS_20350 <11807 11142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000757386.1:thioredoxin >Feature sequence110 424 3195 gene locus_tag LOCUS_20360 424 3195 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085792.1 protein_id gnl|my_center|LOCUS_20360 4707 3217 gene locus_tag LOCUS_20370 4707 3217 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034312.1 protein_id gnl|my_center|LOCUS_20370 5274 4717 gene locus_tag LOCUS_20380 5274 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_20380 6278 5283 gene locus_tag LOCUS_20390 gene gpsA 6278 5283 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182W5 protein_id gnl|my_center|LOCUS_20390 6604 6828 gene locus_tag LOCUS_20400 6604 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 7696 6833 gene locus_tag LOCUS_20410 7696 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121285.1 protein_id gnl|my_center|LOCUS_20410 8317 7901 gene locus_tag LOCUS_20420 8317 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 8654 10336 gene locus_tag LOCUS_20430 8654 10336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118733.1 protein_id gnl|my_center|LOCUS_20430 10518 11333 gene locus_tag LOCUS_20440 gene mqnA 10518 11333 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT25 protein_id gnl|my_center|LOCUS_20440 >Feature sequence111 190 2784 gene locus_tag LOCUS_20450 190 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 3029 4252 gene locus_tag LOCUS_20460 3029 4252 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119140.1 protein_id gnl|my_center|LOCUS_20460 4263 5249 gene locus_tag LOCUS_20470 4263 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 5683 5276 gene locus_tag LOCUS_20480 5683 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 6002 5814 gene locus_tag LOCUS_20490 6002 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 7427 6084 gene locus_tag LOCUS_20500 gene pdhC 7427 6084 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3N1I5 protein_id gnl|my_center|LOCUS_20500 9412 7430 gene locus_tag LOCUS_20510 gene bkdA 9412 7430 CDS product 2-oxoisovalerate dehydrogenase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228884.1 protein_id gnl|my_center|LOCUS_20510 10284 9430 gene locus_tag LOCUS_20520 10284 9430 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_20520 11588 10281 gene locus_tag LOCUS_20530 11588 10281 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204367.1 protein_id gnl|my_center|LOCUS_20530 >Feature sequence112 2504 207 gene locus_tag LOCUS_20540 2504 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119051.1 protein_id gnl|my_center|LOCUS_20540 3219 3668 gene locus_tag LOCUS_20550 3219 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 4572 3676 gene locus_tag LOCUS_20560 4572 3676 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118181.1 protein_id gnl|my_center|LOCUS_20560 4830 6005 gene locus_tag LOCUS_20570 gene hdc 4830 6005 CDS product histidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRG7 protein_id gnl|my_center|LOCUS_20570 6002 6394 gene locus_tag LOCUS_20580 6002 6394 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_20580 6948 6391 gene locus_tag LOCUS_20590 gene fldA 6948 6391 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67866 protein_id gnl|my_center|LOCUS_20590 7106 8395 gene locus_tag LOCUS_20600 7106 8395 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_20600 8468 9619 gene locus_tag LOCUS_20610 gene solA 8468 9619 CDS product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_20610 9671 10216 gene locus_tag LOCUS_20620 9671 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 10649 10287 gene locus_tag LOCUS_20630 10649 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_20630 10776 11237 gene locus_tag LOCUS_20640 10776 11237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 11568 11296 gene locus_tag LOCUS_20650 11568 11296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence113 564 923 gene locus_tag LOCUS_20660 564 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20660 1337 1597 gene locus_tag LOCUS_20670 1337 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 1539 1916 gene locus_tag LOCUS_20680 1539 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 1920 2150 gene locus_tag LOCUS_20690 1920 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2440 3489 gene locus_tag LOCUS_20700 2440 3489 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_20700 3566 3991 gene locus_tag LOCUS_20710 3566 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 6995 4131 gene locus_tag LOCUS_20720 6995 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 7371 9569 gene locus_tag LOCUS_20730 7371 9569 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_20730 9566 10051 gene locus_tag LOCUS_20740 9566 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence114 1158 250 gene locus_tag LOCUS_20750 1158 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 2689 1229 gene locus_tag LOCUS_20760 2689 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_20760 3814 2819 gene locus_tag LOCUS_20770 3814 2819 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974245.1 protein_id gnl|my_center|LOCUS_20770 4810 3899 gene locus_tag LOCUS_20780 4810 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 4695 4910 gene locus_tag LOCUS_20790 4695 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 5181 5471 gene locus_tag LOCUS_20800 5181 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 5554 6600 gene locus_tag LOCUS_20810 5554 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118659.1 protein_id gnl|my_center|LOCUS_20810 7797 6604 gene locus_tag LOCUS_20820 7797 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 8310 7810 gene locus_tag LOCUS_20830 8310 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 8980 8330 gene locus_tag LOCUS_20840 gene rpsH 8980 8330 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW29 protein_id gnl|my_center|LOCUS_20840 10163 9078 gene locus_tag LOCUS_20850 gene rlmN 10163 9078 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHU7 protein_id gnl|my_center|LOCUS_20850 10399 11538 gene locus_tag LOCUS_20860 10399 11538 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCG7 protein_id gnl|my_center|LOCUS_20860 >Feature sequence115 <1 601 gene locus_tag LOCUS_20870 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199088.1:galactonate dehydratase 1361 618 gene locus_tag LOCUS_20880 1361 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 1478 1897 gene locus_tag LOCUS_20890 1478 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2055 1980 gene locus_tag LOCUS_t00250 2055 1980 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2265 4859 gene locus_tag LOCUS_20900 2265 4859 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120680.1 protein_id gnl|my_center|LOCUS_20900 4886 6316 gene locus_tag LOCUS_20910 4886 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 6576 7628 gene locus_tag LOCUS_20920 6576 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 9080 7635 gene locus_tag LOCUS_20930 9080 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 <11426 9093 gene locus_tag LOCUS_20940 <11426 9093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KG04:alanine--tRNA ligase >Feature sequence116 1516 3306 gene locus_tag LOCUS_20950 1516 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 3343 4722 gene locus_tag LOCUS_20960 3343 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_20960 4810 8661 gene locus_tag LOCUS_20970 4810 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 8685 10103 gene locus_tag LOCUS_20980 8685 10103 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_20980 10150 10761 gene locus_tag LOCUS_20990 10150 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 >Feature sequence117 1766 3064 gene locus_tag LOCUS_21000 1766 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_21000 4106 3174 gene locus_tag LOCUS_21010 4106 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 protein_id gnl|my_center|LOCUS_21010 5565 4132 gene locus_tag LOCUS_21020 5565 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_21020 7944 5593 gene locus_tag LOCUS_21030 7944 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_21030 8336 9496 gene locus_tag LOCUS_21040 gene dgsA 8336 9496 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263354.1 protein_id gnl|my_center|LOCUS_21040 9704 10693 gene locus_tag LOCUS_21050 gene pilE1 9704 10693 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_21050 10729 11157 gene locus_tag LOCUS_21060 10729 11157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence118 124 423 gene locus_tag LOCUS_21070 124 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 782 606 gene locus_tag LOCUS_21080 782 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 831 1214 gene locus_tag LOCUS_21090 831 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2350 1220 gene locus_tag LOCUS_21100 gene asd 2350 1220 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAP1 protein_id gnl|my_center|LOCUS_21100 3842 2415 gene locus_tag LOCUS_21110 3842 2415 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123571.1 protein_id gnl|my_center|LOCUS_21110 5588 3948 gene locus_tag LOCUS_21120 5588 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 5849 5776 gene locus_tag LOCUS_t00260 5849 5776 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6660 5953 gene locus_tag LOCUS_21130 gene rplC 6660 5953 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN20 protein_id gnl|my_center|LOCUS_21130 6914 8305 gene locus_tag LOCUS_21140 6914 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 9064 8312 gene locus_tag LOCUS_21150 9064 8312 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395055.1 protein_id gnl|my_center|LOCUS_21150 9180 10055 gene locus_tag LOCUS_21160 9180 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 10125 10871 gene locus_tag LOCUS_21170 10125 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence119 936 733 gene locus_tag LOCUS_21180 936 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 857 1225 gene locus_tag LOCUS_21190 857 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 1232 1966 gene locus_tag LOCUS_21200 1232 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3268 2003 gene locus_tag LOCUS_21210 3268 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 3448 4356 gene locus_tag LOCUS_21220 3448 4356 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_21220 4392 4829 gene locus_tag LOCUS_21230 4392 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 4943 5971 gene locus_tag LOCUS_21240 4943 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 6117 6614 gene locus_tag LOCUS_21250 6117 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 6672 7301 gene locus_tag LOCUS_21260 6672 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 7376 8278 gene locus_tag LOCUS_21270 7376 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 8465 9031 gene locus_tag LOCUS_21280 8465 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence120 1117 173 gene locus_tag LOCUS_21290 1117 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_21290 2233 1133 gene locus_tag LOCUS_21300 gene moxR 2233 1133 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120739.1 protein_id gnl|my_center|LOCUS_21300 5718 2218 gene locus_tag LOCUS_21310 5718 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 6045 7349 gene locus_tag LOCUS_21320 6045 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 7370 8281 gene locus_tag LOCUS_21330 gene ctaC 7370 8281 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIL9 protein_id gnl|my_center|LOCUS_21330 8503 10137 gene locus_tag LOCUS_21340 gene ctaD 8503 10137 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence121 3465 451 gene locus_tag LOCUS_21350 3465 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 6260 3462 gene locus_tag LOCUS_21360 6260 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 7236 6298 gene locus_tag LOCUS_21370 7236 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_21370 8374 7262 gene locus_tag LOCUS_21380 gene moxR 8374 7262 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_21380 9527 8415 gene locus_tag LOCUS_21390 9527 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123327.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence122 434 361 gene locus_tag LOCUS_t00270 434 361 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1008 535 gene locus_tag LOCUS_21400 1008 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 1153 2610 gene locus_tag LOCUS_21410 1153 2610 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_21410 3157 2669 gene locus_tag LOCUS_21420 gene fur 3157 2669 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121869.1 protein_id gnl|my_center|LOCUS_21420 3495 3271 gene locus_tag LOCUS_21430 3495 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 4921 3863 gene locus_tag LOCUS_21440 gene ltaE 4921 3863 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_21440 5407 4955 gene locus_tag LOCUS_21450 5407 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 5482 6588 gene locus_tag LOCUS_21460 gene aroC 5482 6588 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI34 protein_id gnl|my_center|LOCUS_21460 7746 6589 gene locus_tag LOCUS_21470 7746 6589 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727179.1 protein_id gnl|my_center|LOCUS_21470 7999 9819 gene locus_tag LOCUS_21480 gene ask 7999 9819 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 protein_id gnl|my_center|LOCUS_21480 <10982 9908 gene locus_tag LOCUS_21490 <10982 9908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404751.1:tagatose 1,6-diphosphate aldolase >Feature sequence123 513 337 gene locus_tag LOCUS_21500 513 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 955 650 gene locus_tag LOCUS_21510 955 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1345 4134 gene locus_tag LOCUS_21520 1345 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 5009 4119 gene locus_tag LOCUS_21530 gene dapA 5009 4119 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVB1 protein_id gnl|my_center|LOCUS_21530 5191 5853 gene locus_tag LOCUS_21540 5191 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141352.1 protein_id gnl|my_center|LOCUS_21540 6803 5835 gene locus_tag LOCUS_21550 6803 5835 CDS product acetamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975888.1 protein_id gnl|my_center|LOCUS_21550 8337 6832 gene locus_tag LOCUS_21560 8337 6832 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123599.1 protein_id gnl|my_center|LOCUS_21560 <10798 8343 gene locus_tag LOCUS_21570 <10798 8343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123585.1:chromosome segregation protein >Feature sequence124 550 1032 gene locus_tag LOCUS_21580 550 1032 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932411.1 protein_id gnl|my_center|LOCUS_21580 1093 3153 gene locus_tag LOCUS_21590 1093 3153 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89C25 protein_id gnl|my_center|LOCUS_21590 3157 4122 gene locus_tag LOCUS_21600 3157 4122 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAY9 protein_id gnl|my_center|LOCUS_21600 4139 4408 gene locus_tag LOCUS_21610 4139 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 5594 4410 gene locus_tag LOCUS_21620 5594 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 6570 5755 gene locus_tag LOCUS_21630 6570 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 7558 6719 gene locus_tag LOCUS_21640 gene rpoS 7558 6719 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTR4 protein_id gnl|my_center|LOCUS_21640 9702 7909 gene locus_tag LOCUS_21650 9702 7909 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118918.1 protein_id gnl|my_center|LOCUS_21650 <10761 9920 gene locus_tag LOCUS_21660 <10761 9920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9W9T3:cysteine synthase >Feature sequence125 728 240 gene locus_tag LOCUS_21670 gene rpiB 728 240 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_21670 1270 788 gene locus_tag LOCUS_21680 1270 788 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_21680 2651 1572 gene locus_tag LOCUS_21690 gene mnmA 2651 1572 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GY2 protein_id gnl|my_center|LOCUS_21690 2955 4475 gene locus_tag LOCUS_21700 gene glgA 2955 4475 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPY2 protein_id gnl|my_center|LOCUS_21700 4582 6678 gene locus_tag LOCUS_21710 4582 6678 CDS product amylopullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545008.1 protein_id gnl|my_center|LOCUS_21710 6730 7737 gene locus_tag LOCUS_21720 gene galT 6730 7737 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_21720 8353 7742 gene locus_tag LOCUS_21730 8353 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 9265 9510 gene locus_tag LOCUS_21740 9265 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 <10733 9575 gene locus_tag LOCUS_21750 <10733 9575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NG46:nickel/cobalt efflux system >Feature sequence126 1874 684 gene locus_tag LOCUS_21760 1874 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2885 1878 gene locus_tag LOCUS_21770 gene yeaC 2885 1878 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_21770 3738 2992 gene locus_tag LOCUS_21780 3738 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 3847 4833 gene locus_tag LOCUS_21790 gene trpS 3847 4833 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1Z8 protein_id gnl|my_center|LOCUS_21790 6145 5030 gene locus_tag LOCUS_21800 6145 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 6830 6375 gene locus_tag LOCUS_21810 6830 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 8402 7239 gene locus_tag LOCUS_21820 8402 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 8561 8800 gene locus_tag LOCUS_21830 8561 8800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 8855 8929 gene locus_tag LOCUS_t00280 8855 8929 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence127 1202 2491 gene locus_tag LOCUS_21840 1202 2491 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_21840 2623 3207 gene locus_tag LOCUS_21850 2623 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 3462 4442 gene locus_tag LOCUS_21860 3462 4442 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_21860 4417 4869 gene locus_tag LOCUS_21870 4417 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 4942 5769 gene locus_tag LOCUS_21880 4942 5769 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_21880 5791 5967 gene locus_tag LOCUS_21890 5791 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 6016 7107 gene locus_tag LOCUS_21900 gene gldA 6016 7107 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_312901.2 protein_id gnl|my_center|LOCUS_21900 7256 8182 gene locus_tag LOCUS_21910 7256 8182 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121519.1 protein_id gnl|my_center|LOCUS_21910 8196 8606 gene locus_tag LOCUS_21920 8196 8606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 8606 9805 gene locus_tag LOCUS_21930 8606 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 10213 9821 gene locus_tag LOCUS_21940 10213 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 10163 10369 gene locus_tag LOCUS_21950 10163 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence128 411 229 gene locus_tag LOCUS_21960 411 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2442 628 gene locus_tag LOCUS_21970 2442 628 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_21970 2654 2439 gene locus_tag LOCUS_21980 2654 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 3722 2811 gene locus_tag LOCUS_21990 3722 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 3985 4407 gene locus_tag LOCUS_22000 3985 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 4375 4913 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcagtagggcagcaaggattagcagccgttgacac 5011 5190 gene locus_tag LOCUS_22010 5011 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 5745 5999 gene locus_tag LOCUS_22020 5745 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 6007 7824 gene locus_tag LOCUS_22030 6007 7824 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121863.1 protein_id gnl|my_center|LOCUS_22030 7883 10102 gene locus_tag LOCUS_22040 7883 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence129 1365 58 gene locus_tag LOCUS_22050 1365 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_22050 2057 4504 gene locus_tag LOCUS_22060 gene butB 2057 4504 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122380.1 protein_id gnl|my_center|LOCUS_22060 4546 5886 gene locus_tag LOCUS_22070 4546 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_22070 5934 8363 gene locus_tag LOCUS_22080 5934 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 8559 9071 gene locus_tag LOCUS_22090 8559 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 9085 9546 gene locus_tag LOCUS_22100 9085 9546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence130 439 915 gene locus_tag LOCUS_22110 439 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 1255 1605 gene locus_tag LOCUS_22120 1255 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1795 2232 gene locus_tag LOCUS_22130 1795 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2484 3242 gene locus_tag LOCUS_22140 gene guaA 2484 3242 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 protein_id gnl|my_center|LOCUS_22140 3263 4441 gene locus_tag LOCUS_22150 3263 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 4520 5416 gene locus_tag LOCUS_22160 4520 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 5449 7746 gene locus_tag LOCUS_22170 gene natB 5449 7746 CDS product sodium extrusion protein NatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121496.1 protein_id gnl|my_center|LOCUS_22170 8521 7859 gene locus_tag LOCUS_22180 8521 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence131 1572 1087 gene locus_tag LOCUS_22190 1572 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263212.1 protein_id gnl|my_center|LOCUS_22190 1678 2532 gene locus_tag LOCUS_22200 1678 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 protein_id gnl|my_center|LOCUS_22200 2758 3789 gene locus_tag LOCUS_22210 2758 3789 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120266.1 protein_id gnl|my_center|LOCUS_22210 3810 4127 gene locus_tag LOCUS_22220 3810 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 5026 4133 gene locus_tag LOCUS_22230 5026 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 6787 5123 gene locus_tag LOCUS_22240 6787 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 7925 6816 gene locus_tag LOCUS_22250 7925 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108907.1 protein_id gnl|my_center|LOCUS_22250 8379 8161 gene locus_tag LOCUS_22260 8379 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence132 2783 903 gene locus_tag LOCUS_22270 2783 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 3930 2974 gene locus_tag LOCUS_22280 3930 2974 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118191.1 protein_id gnl|my_center|LOCUS_22280 4470 3979 gene locus_tag LOCUS_22290 4470 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 4469 4651 gene locus_tag LOCUS_22300 4469 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 5594 4698 gene locus_tag LOCUS_22310 5594 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 6901 5594 gene locus_tag LOCUS_22320 6901 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_22320 9368 6999 gene locus_tag LOCUS_22330 9368 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 9976 9425 gene locus_tag LOCUS_22340 9976 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence133 48 1073 gene locus_tag LOCUS_22350 48 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 1184 2539 gene locus_tag LOCUS_22360 1184 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2617 3663 gene locus_tag LOCUS_22370 2617 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 3737 5908 gene locus_tag LOCUS_22380 3737 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 7476 6382 gene locus_tag LOCUS_22390 7476 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108907.1 protein_id gnl|my_center|LOCUS_22390 8222 7995 gene locus_tag LOCUS_22400 8222 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence134 <1 714 gene locus_tag LOCUS_22410 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015368569.1:6-phosphogluconolactonase 745 3471 gene locus_tag LOCUS_22420 745 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 4665 3532 gene locus_tag LOCUS_22430 4665 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 4885 5277 gene locus_tag LOCUS_22440 4885 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 5314 6249 gene locus_tag LOCUS_22450 5314 6249 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_22450 6581 8185 gene locus_tag LOCUS_22460 6581 8185 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_22460 >Feature sequence135 239 1189 gene locus_tag LOCUS_22470 239 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 3284 1560 gene locus_tag LOCUS_22480 3284 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 3821 3339 gene locus_tag LOCUS_22490 3821 3339 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942129.1 protein_id gnl|my_center|LOCUS_22490 3908 4120 gene locus_tag LOCUS_22500 3908 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 4730 5470 gene locus_tag LOCUS_22510 4730 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 7007 5745 gene locus_tag LOCUS_22520 7007 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 7248 7688 gene locus_tag LOCUS_22530 7248 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 8918 7983 gene locus_tag LOCUS_22540 8918 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence136 2727 1177 gene locus_tag LOCUS_22550 2727 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2991 3725 gene locus_tag LOCUS_22560 2991 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 4122 3727 gene locus_tag LOCUS_22570 4122 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 5095 4151 gene locus_tag LOCUS_22580 gene gspG 5095 4151 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118411.1 protein_id gnl|my_center|LOCUS_22580 5418 8390 gene locus_tag LOCUS_22590 5418 8390 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120793.1 protein_id gnl|my_center|LOCUS_22590 8436 9332 gene locus_tag LOCUS_22600 8436 9332 CDS product myo-inositol catabolism protein IolH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence137 1481 207 gene locus_tag LOCUS_22610 1481 207 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_22610 3022 1652 gene locus_tag LOCUS_22620 3022 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 3231 4517 gene locus_tag LOCUS_22630 3231 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256908.1 protein_id gnl|my_center|LOCUS_22630 4570 6075 gene locus_tag LOCUS_22640 4570 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_22640 6163 7353 gene locus_tag LOCUS_22650 6163 7353 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122159.1 protein_id gnl|my_center|LOCUS_22650 7566 7895 gene locus_tag LOCUS_22660 7566 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 7932 8396 gene locus_tag LOCUS_22670 gene fruA 7932 8396 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_22670 8437 8730 gene locus_tag LOCUS_22680 8437 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence138 92 21 gene locus_tag LOCUS_t00290 92 21 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 241 2088 gene locus_tag LOCUS_22690 241 2088 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121988.1 protein_id gnl|my_center|LOCUS_22690 2353 2135 gene locus_tag LOCUS_22700 gene csrA 2353 2135 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG38 protein_id gnl|my_center|LOCUS_22700 3775 2624 gene locus_tag LOCUS_22710 3775 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3961 4737 gene locus_tag LOCUS_22720 3961 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 6324 4774 gene locus_tag LOCUS_22730 6324 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 6507 7541 gene locus_tag LOCUS_22740 6507 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 7538 8563 gene locus_tag LOCUS_22750 7538 8563 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259483.1 protein_id gnl|my_center|LOCUS_22750 8517 9512 gene locus_tag LOCUS_22760 gene dmt 8517 9512 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence139 454 65 gene locus_tag LOCUS_22770 454 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_22770 570 1406 gene locus_tag LOCUS_22780 570 1406 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_22780 1996 1424 gene locus_tag LOCUS_22790 1996 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2300 2602 gene locus_tag LOCUS_22800 2300 2602 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NLN6 protein_id gnl|my_center|LOCUS_22800 2713 3960 gene locus_tag LOCUS_22810 2713 3960 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_22810 4662 3961 gene locus_tag LOCUS_22820 4662 3961 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_22820 5340 4909 gene locus_tag LOCUS_22830 5340 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 6287 5373 gene locus_tag LOCUS_22840 6287 5373 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121978.1 protein_id gnl|my_center|LOCUS_22840 8169 6520 gene locus_tag LOCUS_22850 8169 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 8434 8748 gene locus_tag LOCUS_22860 8434 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 8738 9703 gene locus_tag LOCUS_22870 8738 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence140 302 5284 gene locus_tag LOCUS_22880 302 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 5372 6259 gene locus_tag LOCUS_22890 gene map 5372 6259 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKR2 protein_id gnl|my_center|LOCUS_22890 6269 7477 gene locus_tag LOCUS_22900 gene tgt 6269 7477 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFH5 protein_id gnl|my_center|LOCUS_22900 8154 7489 gene locus_tag LOCUS_22910 8154 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599486.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence141 <1 1098 gene locus_tag LOCUS_22920 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UXF5:glucose-1-phosphate adenylyltransferase 1160 1591 gene locus_tag LOCUS_22930 1160 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2751 1639 gene locus_tag LOCUS_22940 2751 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 4022 2748 gene locus_tag LOCUS_22950 4022 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_22950 5633 4047 gene locus_tag LOCUS_22960 5633 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121107.1 protein_id gnl|my_center|LOCUS_22960 5958 6053 gene locus_tag LOCUS_t00300 5958 6053 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 6462 6653 gene locus_tag LOCUS_22970 6462 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence142 <1 1076 gene locus_tag LOCUS_22980 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932301.1:3-isopropylmalate dehydratase large subunit 1073 1645 gene locus_tag LOCUS_22990 1073 1645 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_22990 2165 1662 gene locus_tag LOCUS_23000 2165 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2500 4194 gene locus_tag LOCUS_23010 gene groL1 2500 4194 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM99 protein_id gnl|my_center|LOCUS_23010 4259 4573 gene locus_tag LOCUS_23020 gene groS1 4259 4573 CDS product 10 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM98 protein_id gnl|my_center|LOCUS_23020 4606 6225 gene locus_tag LOCUS_23030 gene groL2 4606 6225 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM97 protein_id gnl|my_center|LOCUS_23030 6337 7479 gene locus_tag LOCUS_23040 gene dnaJ 6337 7479 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEY1 protein_id gnl|my_center|LOCUS_23040 7522 8064 gene locus_tag LOCUS_23050 7522 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 8095 8436 gene locus_tag LOCUS_23060 8095 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 8438 8626 gene locus_tag LOCUS_23070 8438 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence143 1658 276 gene locus_tag LOCUS_23080 1658 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268661.1 protein_id gnl|my_center|LOCUS_23080 3736 1655 gene locus_tag LOCUS_23090 3736 1655 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942936.1 protein_id gnl|my_center|LOCUS_23090 5495 4152 gene locus_tag LOCUS_23100 5495 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123475.1 protein_id gnl|my_center|LOCUS_23100 8073 5527 gene locus_tag LOCUS_23110 8073 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence144 <1 1102 gene locus_tag LOCUS_23120 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583578.1:phosphohydrolase 1538 1104 gene locus_tag LOCUS_23130 1538 1104 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326136.1 protein_id gnl|my_center|LOCUS_23130 2330 1605 gene locus_tag LOCUS_23140 2330 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 3049 2495 gene locus_tag LOCUS_23150 3049 2495 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_23150 4740 3073 gene locus_tag LOCUS_23160 gene ndh 4740 3073 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087552.1 protein_id gnl|my_center|LOCUS_23160 4842 5180 gene locus_tag LOCUS_23170 4842 5180 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143941.1 protein_id gnl|my_center|LOCUS_23170 5430 5867 gene locus_tag LOCUS_23180 5430 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 5892 6797 gene locus_tag LOCUS_23190 5892 6797 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118191.1 protein_id gnl|my_center|LOCUS_23190 7987 6881 gene locus_tag LOCUS_23200 7987 6881 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120182.1 protein_id gnl|my_center|LOCUS_23200 8950 8012 gene locus_tag LOCUS_23210 gene lpxC 8950 8012 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGZ2 protein_id gnl|my_center|LOCUS_23210 >Feature sequence145 933 1685 gene locus_tag LOCUS_23220 933 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 3028 1694 gene locus_tag LOCUS_23230 gene hslU 3028 1694 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG00 protein_id gnl|my_center|LOCUS_23230 3609 3073 gene locus_tag LOCUS_23240 gene hslV 3609 3073 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJP6 protein_id gnl|my_center|LOCUS_23240 3746 4942 gene locus_tag LOCUS_23250 3746 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 4980 5456 gene locus_tag LOCUS_23260 4980 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 5449 6381 gene locus_tag LOCUS_23270 gene hemC 5449 6381 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8T5 protein_id gnl|my_center|LOCUS_23270 7053 6385 gene locus_tag LOCUS_23280 7053 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118676.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence146 <1 864 gene locus_tag LOCUS_23290 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63R35:phospho-2-dehydro-3-deoxyheptonate aldolase 1315 1124 gene locus_tag LOCUS_23300 1315 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 1764 1402 gene locus_tag LOCUS_23310 1764 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 2280 1765 gene locus_tag LOCUS_23320 2280 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 3544 2411 gene locus_tag LOCUS_23330 3544 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 5700 3553 gene locus_tag LOCUS_23340 gene rnr 5700 3553 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR0 protein_id gnl|my_center|LOCUS_23340 6732 5749 gene locus_tag LOCUS_23350 6732 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_23350 8305 6812 gene locus_tag LOCUS_23360 8305 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence147 <1 830 gene locus_tag LOCUS_23370 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118057.1:iduronate-2-sulfatase 843 2525 gene locus_tag LOCUS_23380 843 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2795 5434 gene locus_tag LOCUS_23390 2795 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123476.1 protein_id gnl|my_center|LOCUS_23390 5450 6844 gene locus_tag LOCUS_23400 5450 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123475.1 protein_id gnl|my_center|LOCUS_23400 7031 8836 gene locus_tag LOCUS_23410 7031 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence148 2938 533 gene locus_tag LOCUS_23420 2938 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 3171 3692 gene locus_tag LOCUS_23430 3171 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 4931 3699 gene locus_tag LOCUS_23440 4931 3699 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 protein_id gnl|my_center|LOCUS_23440 6508 4949 gene locus_tag LOCUS_23450 6508 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 8106 6568 gene locus_tag LOCUS_23460 8106 6568 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767327.1 protein_id gnl|my_center|LOCUS_23460 8459 8286 gene locus_tag LOCUS_23470 8459 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence149 276 2333 gene locus_tag LOCUS_23480 276 2333 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_23480 2368 3120 gene locus_tag LOCUS_23490 2368 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 3210 4604 gene locus_tag LOCUS_23500 3210 4604 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118427.1 protein_id gnl|my_center|LOCUS_23500 4703 6706 gene locus_tag LOCUS_23510 4703 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121017.1 protein_id gnl|my_center|LOCUS_23510 6752 8188 gene locus_tag LOCUS_23520 6752 8188 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_23520 9105 8272 gene locus_tag LOCUS_23530 9105 8272 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938290.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence150 8044 1559 gene locus_tag LOCUS_23540 8044 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 <9210 8041 gene locus_tag LOCUS_23550 <9210 8041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071756.1:2-nitropropane dioxygenase >Feature sequence151 1132 152 gene locus_tag LOCUS_23560 1132 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 1386 2642 gene locus_tag LOCUS_23570 1386 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_23570 4053 3980 gene locus_tag LOCUS_t00310 4053 3980 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5767 4145 gene locus_tag LOCUS_23580 5767 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 6066 8957 gene locus_tag LOCUS_23590 6066 8957 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence152 1705 746 gene locus_tag LOCUS_23600 gene tadB 1705 746 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120690.1 protein_id gnl|my_center|LOCUS_23600 3066 1717 gene locus_tag LOCUS_23610 gene tadA 3066 1717 CDS product secretion system protein TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120689.1 protein_id gnl|my_center|LOCUS_23610 4320 3079 gene locus_tag LOCUS_23620 gene cpaE 4320 3079 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120312.1 protein_id gnl|my_center|LOCUS_23620 6642 4360 gene locus_tag LOCUS_23630 6642 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 7666 6713 gene locus_tag LOCUS_23640 7666 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 8557 7940 gene locus_tag LOCUS_23650 gene cpaA 8557 7940 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326626.1 protein_id gnl|my_center|LOCUS_23650 8770 8597 gene locus_tag LOCUS_23660 8770 8597 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939393.1 protein_id gnl|my_center|LOCUS_23660 9137 8943 gene locus_tag LOCUS_23670 9137 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence153 333 2882 gene locus_tag LOCUS_23680 333 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_23680 2896 4167 gene locus_tag LOCUS_23690 2896 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121153.1 protein_id gnl|my_center|LOCUS_23690 5901 4180 gene locus_tag LOCUS_23700 5901 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 6056 7132 gene locus_tag LOCUS_23710 6056 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142695.1 protein_id gnl|my_center|LOCUS_23710 >Feature sequence154 1841 231 gene locus_tag LOCUS_23720 1841 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 3270 1903 gene locus_tag LOCUS_23730 3270 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 3544 3302 gene locus_tag LOCUS_23740 3544 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 3731 5233 gene locus_tag LOCUS_23750 3731 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 7434 5230 gene locus_tag LOCUS_23760 7434 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence155 1121 288 gene locus_tag LOCUS_23770 1121 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 3134 1182 gene locus_tag LOCUS_23780 gene zwf 3134 1182 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLF4 protein_id gnl|my_center|LOCUS_23780 4946 3225 gene locus_tag LOCUS_23790 4946 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 6556 5279 gene locus_tag LOCUS_23800 6556 5279 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 protein_id gnl|my_center|LOCUS_23800 7413 6589 gene locus_tag LOCUS_23810 7413 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 8756 7569 gene locus_tag LOCUS_23820 8756 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 >Feature sequence156 240 1721 gene locus_tag LOCUS_23830 240 1721 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122652.1 protein_id gnl|my_center|LOCUS_23830 1856 2638 gene locus_tag LOCUS_23840 1856 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2798 3805 gene locus_tag LOCUS_23850 2798 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 3864 5261 gene locus_tag LOCUS_23860 gene hemY 3864 5261 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_23860 5348 6634 gene locus_tag LOCUS_23870 gene glgC 5348 6634 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337168.1 protein_id gnl|my_center|LOCUS_23870 7485 6691 gene locus_tag LOCUS_23880 7485 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 8431 7577 gene locus_tag LOCUS_23890 gene hpaG 8431 7577 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_23890 >Feature sequence157 2147 234 gene locus_tag LOCUS_23900 2147 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2530 2333 gene locus_tag LOCUS_23910 2530 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 2869 2618 gene locus_tag LOCUS_23920 2869 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 3732 3130 gene locus_tag LOCUS_23930 3732 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 4037 5368 gene locus_tag LOCUS_23940 4037 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_23940 6402 5476 gene locus_tag LOCUS_23950 6402 5476 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_23950 6833 6417 gene locus_tag LOCUS_23960 6833 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 7190 8185 gene locus_tag LOCUS_23970 7190 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 8396 8566 gene locus_tag LOCUS_23980 8396 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence158 3616 2174 gene locus_tag LOCUS_23990 3616 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 protein_id gnl|my_center|LOCUS_23990 6688 3656 gene locus_tag LOCUS_24000 6688 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 7913 7089 gene locus_tag LOCUS_24010 7913 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence159 1306 2886 gene locus_tag LOCUS_24020 1306 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2898 6026 gene locus_tag LOCUS_24030 gene czcA 2898 6026 CDS product resistance-nodulation-cell division divalent metal cation efflux transporter CzcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115707.1 protein_id gnl|my_center|LOCUS_24030 6064 6438 gene locus_tag LOCUS_24040 6064 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 8048 6573 gene locus_tag LOCUS_24050 8048 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_24050 8532 8146 gene locus_tag LOCUS_24060 8532 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence160 555 1589 gene locus_tag LOCUS_24070 555 1589 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EL0 protein_id gnl|my_center|LOCUS_24070 1794 2099 gene locus_tag LOCUS_24080 1794 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2153 3532 gene locus_tag LOCUS_24090 2153 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_24090 3592 5898 gene locus_tag LOCUS_24100 3592 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 5924 8359 gene locus_tag LOCUS_24110 5924 8359 CDS product surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence161 107 1453 gene locus_tag LOCUS_24120 107 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 1539 3839 gene locus_tag LOCUS_24130 1539 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 4007 4201 gene locus_tag LOCUS_24140 4007 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 4198 4590 gene locus_tag LOCUS_24150 gene vapC 4198 4590 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D058 protein_id gnl|my_center|LOCUS_24150 4679 6502 gene locus_tag LOCUS_24160 4679 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 6508 7332 gene locus_tag LOCUS_24170 6508 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24170 7495 7863 gene locus_tag LOCUS_24180 7495 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence162 553 2466 gene locus_tag LOCUS_24190 gene dxs 553 2466 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWB7 protein_id gnl|my_center|LOCUS_24190 2487 3329 gene locus_tag LOCUS_24200 gene nadK 2487 3329 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWB8 protein_id gnl|my_center|LOCUS_24200 3334 3615 gene locus_tag LOCUS_24210 gene acyP 3334 3615 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73PK2 protein_id gnl|my_center|LOCUS_24210 3721 4869 gene locus_tag LOCUS_24220 3721 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 5148 4987 gene locus_tag LOCUS_24230 5148 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 5375 6736 gene locus_tag LOCUS_24240 5375 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 7913 6723 gene locus_tag LOCUS_24250 7913 6723 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence163 2729 129 gene locus_tag LOCUS_24260 2729 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 3087 5060 gene locus_tag LOCUS_24270 3087 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence164 1877 669 gene locus_tag LOCUS_24280 gene garP 1877 669 CDS product putative galactarate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AA80 protein_id gnl|my_center|LOCUS_24280 2797 1877 gene locus_tag LOCUS_24290 2797 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 3981 2803 gene locus_tag LOCUS_24300 3981 2803 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029014.1 protein_id gnl|my_center|LOCUS_24300 5413 4022 gene locus_tag LOCUS_24310 5413 4022 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_24310 8113 5426 gene locus_tag LOCUS_24320 8113 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence165 <1 2055 gene locus_tag LOCUS_24330 <1 2055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120679.1:surface protein 2074 4137 gene locus_tag LOCUS_24340 2074 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120678.1 protein_id gnl|my_center|LOCUS_24340 4194 4436 gene locus_tag LOCUS_24350 4194 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 4839 4498 gene locus_tag LOCUS_24360 4839 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 5087 6928 gene locus_tag LOCUS_24370 5087 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_24370 7050 8030 gene locus_tag LOCUS_24380 7050 8030 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_24380 >Feature sequence166 464 1717 gene locus_tag LOCUS_24390 464 1717 CDS product polysaccharide pyruvyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118126.1 protein_id gnl|my_center|LOCUS_24390 3144 1750 gene locus_tag LOCUS_24400 3144 1750 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123398.1 protein_id gnl|my_center|LOCUS_24400 4903 3494 gene locus_tag LOCUS_24410 4903 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123792.1 protein_id gnl|my_center|LOCUS_24410 5622 5191 gene locus_tag LOCUS_24420 5622 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 7014 6019 gene locus_tag LOCUS_24430 7014 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence167 770 18 gene locus_tag LOCUS_24440 770 18 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122697.1 protein_id gnl|my_center|LOCUS_24440 879 1460 gene locus_tag LOCUS_24450 879 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1474 3300 gene locus_tag LOCUS_24460 1474 3300 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262096.1 protein_id gnl|my_center|LOCUS_24460 3413 3982 gene locus_tag LOCUS_24470 3413 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120933.1 protein_id gnl|my_center|LOCUS_24470 3979 4266 gene locus_tag LOCUS_24480 3979 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528905.1 protein_id gnl|my_center|LOCUS_24480 4858 4286 gene locus_tag LOCUS_24490 4858 4286 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Z9 protein_id gnl|my_center|LOCUS_24490 5769 4870 gene locus_tag LOCUS_24500 5769 4870 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_24500 7360 5810 gene locus_tag LOCUS_24510 gene gltX 7360 5810 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNF9 protein_id gnl|my_center|LOCUS_24510 7926 7441 gene locus_tag LOCUS_24520 7926 7441 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence168 109 1389 gene locus_tag LOCUS_24530 109 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123538.1 protein_id gnl|my_center|LOCUS_24530 4252 1481 gene locus_tag LOCUS_24540 4252 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 5096 4518 gene locus_tag LOCUS_24550 5096 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 5310 5080 gene locus_tag LOCUS_24560 5310 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 5547 6263 gene locus_tag LOCUS_24570 5547 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 <7950 6283 gene locus_tag LOCUS_24580 <7950 6283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919356.1:adenylyl-sulfate kinase >Feature sequence169 2532 1378 gene locus_tag LOCUS_24590 2532 1378 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1C0 protein_id gnl|my_center|LOCUS_24590 2920 4620 gene locus_tag LOCUS_24600 2920 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 4770 5951 gene locus_tag LOCUS_24610 4770 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 7260 6007 gene locus_tag LOCUS_24620 7260 6007 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119140.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence170 659 1387 gene locus_tag LOCUS_24630 659 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998659.1 protein_id gnl|my_center|LOCUS_24630 2803 1409 gene locus_tag LOCUS_24640 2803 1409 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_24640 4311 2830 gene locus_tag LOCUS_24650 4311 2830 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123803.1 protein_id gnl|my_center|LOCUS_24650 7736 4317 gene locus_tag LOCUS_24660 7736 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence171 <1 2223 gene locus_tag LOCUS_24670 <1 2223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122496.1:competence protein ComEC 2636 3565 gene locus_tag LOCUS_24680 2636 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 3655 3843 gene locus_tag LOCUS_24690 3655 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 5184 3943 gene locus_tag LOCUS_24700 5184 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 7555 5279 gene locus_tag LOCUS_24710 7555 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 >Feature sequence172 <1 783 gene locus_tag LOCUS_24720 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFS3:GMP synthase [glutamine-hydrolyzing] 796 1635 gene locus_tag LOCUS_24730 gene dapF 796 1635 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK34 protein_id gnl|my_center|LOCUS_24730 1662 2339 gene locus_tag LOCUS_24740 1662 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 2382 2879 gene locus_tag LOCUS_24750 2382 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2916 3599 gene locus_tag LOCUS_24760 2916 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 3656 3871 gene locus_tag LOCUS_24770 3656 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 4283 3876 gene locus_tag LOCUS_24780 4283 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 5169 4258 gene locus_tag LOCUS_24790 5169 4258 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118191.1 protein_id gnl|my_center|LOCUS_24790 <7841 5306 gene locus_tag LOCUS_24800 <7841 5306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933346.1:pyruvate, phosphate dikinase >Feature sequence173 1683 523 gene locus_tag LOCUS_24810 1683 523 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59806 protein_id gnl|my_center|LOCUS_24810 2816 1758 gene locus_tag LOCUS_24820 2816 1758 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_24820 3116 2883 gene locus_tag LOCUS_24830 3116 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 3227 3146 gene locus_tag LOCUS_t00320 3227 3146 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5571 3271 gene locus_tag LOCUS_24840 5571 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 5623 6060 gene locus_tag LOCUS_24850 5623 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 6443 6066 gene locus_tag LOCUS_24860 6443 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence174 1973 3412 gene locus_tag LOCUS_24870 1973 3412 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_24870 3565 4899 gene locus_tag LOCUS_24880 gene cyaA 3565 4899 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247973.1 protein_id gnl|my_center|LOCUS_24880 5049 5825 gene locus_tag LOCUS_24890 5049 5825 CDS product hpch/hpai aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525325.1 protein_id gnl|my_center|LOCUS_24890 5861 7513 gene locus_tag LOCUS_24900 5861 7513 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269292.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence175 3354 217 gene locus_tag LOCUS_24910 3354 217 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0E1 protein_id gnl|my_center|LOCUS_24910 4111 3515 gene locus_tag LOCUS_24920 4111 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 4298 4948 gene locus_tag LOCUS_24930 4298 4948 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119950.1 protein_id gnl|my_center|LOCUS_24930 4945 5352 gene locus_tag LOCUS_24940 4945 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 5527 6267 gene locus_tag LOCUS_24950 5527 6267 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_24950 6283 7236 gene locus_tag LOCUS_24960 gene pyrB 6283 7236 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNR3 protein_id gnl|my_center|LOCUS_24960 >Feature sequence176 165 1478 gene locus_tag LOCUS_24970 165 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 1571 2995 gene locus_tag LOCUS_24980 gene argD 1571 2995 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJU8 protein_id gnl|my_center|LOCUS_24980 3026 3991 gene locus_tag LOCUS_24990 3026 3991 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406943.1 protein_id gnl|my_center|LOCUS_24990 4114 5169 gene locus_tag LOCUS_25000 4114 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732405.1 protein_id gnl|my_center|LOCUS_25000 5671 5453 gene locus_tag LOCUS_25010 5671 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 5696 6208 gene locus_tag LOCUS_25020 5696 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 6262 7425 gene locus_tag LOCUS_25030 6262 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327711.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence177 273 2177 gene locus_tag LOCUS_25040 273 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 3851 2196 gene locus_tag LOCUS_25050 3851 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 4019 5986 gene locus_tag LOCUS_25060 4019 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 7011 5992 gene locus_tag LOCUS_25070 gene add 7011 5992 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_25070 >Feature sequence178 1870 686 gene locus_tag LOCUS_25080 1870 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 2014 2886 gene locus_tag LOCUS_25090 2014 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728848.1 protein_id gnl|my_center|LOCUS_25090 2895 3770 gene locus_tag LOCUS_25100 2895 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 3948 4397 gene locus_tag LOCUS_25110 3948 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 5613 4459 gene locus_tag LOCUS_25120 5613 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 5929 7476 gene locus_tag LOCUS_25130 5929 7476 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119516.1 protein_id gnl|my_center|LOCUS_25130 >Feature sequence179 998 768 gene locus_tag LOCUS_25140 998 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 1048 1293 gene locus_tag LOCUS_25150 1048 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1424 2326 gene locus_tag LOCUS_25160 1424 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2528 4300 gene locus_tag LOCUS_25170 2528 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 4306 4647 gene locus_tag LOCUS_25180 4306 4647 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DP1 protein_id gnl|my_center|LOCUS_25180 4675 5289 gene locus_tag LOCUS_25190 gene recR 4675 5289 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ68 protein_id gnl|my_center|LOCUS_25190 5336 6838 gene locus_tag LOCUS_25200 5336 6838 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120948.1 protein_id gnl|my_center|LOCUS_25200 7258 6839 gene locus_tag LOCUS_25210 7258 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence180 57 1334 gene locus_tag LOCUS_25220 57 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2841 1327 gene locus_tag LOCUS_25230 2841 1327 CDS product 5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761791.1 protein_id gnl|my_center|LOCUS_25230 3214 2852 gene locus_tag LOCUS_25240 3214 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 3781 3218 gene locus_tag LOCUS_25250 3781 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 3998 4363 gene locus_tag LOCUS_25260 3998 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 4459 4881 gene locus_tag LOCUS_25270 4459 4881 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057301.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence181 641 934 gene locus_tag LOCUS_25280 641 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 3040 938 gene locus_tag LOCUS_25290 3040 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 3222 3294 gene locus_tag LOCUS_t00330 3222 3294 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3574 4584 gene locus_tag LOCUS_25300 gene pilE1 3574 4584 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_25300 5376 4612 gene locus_tag LOCUS_25310 5376 4612 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_25310 5521 6426 gene locus_tag LOCUS_25320 5521 6426 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108897.1 protein_id gnl|my_center|LOCUS_25320 6459 6827 gene locus_tag LOCUS_25330 6459 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence182 1041 208 gene locus_tag LOCUS_25340 1041 208 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938290.1 protein_id gnl|my_center|LOCUS_25340 2384 1428 gene locus_tag LOCUS_25350 2384 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 2775 3428 gene locus_tag LOCUS_25360 2775 3428 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706149.1 protein_id gnl|my_center|LOCUS_25360 3665 3865 gene locus_tag LOCUS_25370 3665 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 5177 3972 gene locus_tag LOCUS_25380 5177 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 5489 5899 gene locus_tag LOCUS_25390 5489 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 5939 6877 gene locus_tag LOCUS_25400 5939 6877 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence183 294 1121 gene locus_tag LOCUS_25410 294 1121 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538091.1 protein_id gnl|my_center|LOCUS_25410 1760 1140 gene locus_tag LOCUS_25420 1760 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2640 1891 gene locus_tag LOCUS_25430 gene eutC 2640 1891 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FL9 protein_id gnl|my_center|LOCUS_25430 4118 2643 gene locus_tag LOCUS_25440 4118 2643 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529187.1 protein_id gnl|my_center|LOCUS_25440 5530 4118 gene locus_tag LOCUS_25450 gene eutB 5530 4118 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093232.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence184 <1 951 gene locus_tag LOCUS_25460 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121871.1:ornithine decarboxylase 1938 973 gene locus_tag LOCUS_25470 1938 973 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119907.1 protein_id gnl|my_center|LOCUS_25470 2135 2614 gene locus_tag LOCUS_25480 2135 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2748 3263 gene locus_tag LOCUS_25490 2748 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 3953 3747 gene locus_tag LOCUS_25500 3953 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 4703 5350 gene locus_tag LOCUS_25510 gene pcxB 4703 5350 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121516.1 protein_id gnl|my_center|LOCUS_25510 6253 5354 gene locus_tag LOCUS_25520 6253 5354 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_25520 <6862 6250 gene locus_tag LOCUS_25530 <6862 6250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791093.1:MFS transporter >Feature sequence185 2569 1658 gene locus_tag LOCUS_25540 2569 1658 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118351.1 protein_id gnl|my_center|LOCUS_25540 2748 3545 gene locus_tag LOCUS_25550 2748 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 3572 4315 gene locus_tag LOCUS_25560 3572 4315 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333296.1 protein_id gnl|my_center|LOCUS_25560 4455 5159 gene locus_tag LOCUS_25570 4455 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 5178 5912 gene locus_tag LOCUS_25580 5178 5912 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460169.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence186 <1 1258 gene locus_tag LOCUS_25590 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947053.1:adenylate/guanylate cyclase domain-containing protein 1341 2453 gene locus_tag LOCUS_25600 1341 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 2566 3825 gene locus_tag LOCUS_25610 gene dctA 2566 3825 CDS product C4-dicarboxylate transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAH2 protein_id gnl|my_center|LOCUS_25610 3806 4672 gene locus_tag LOCUS_25620 3806 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 4685 5065 gene locus_tag LOCUS_25630 4685 5065 CDS product endoribonuclease L-PSP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174212.1 protein_id gnl|my_center|LOCUS_25630 5157 6467 gene locus_tag LOCUS_25640 5157 6467 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660710.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence187 2095 1334 gene locus_tag LOCUS_25650 2095 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 protein_id gnl|my_center|LOCUS_25650 2251 3519 gene locus_tag LOCUS_25660 2251 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 3629 6055 gene locus_tag LOCUS_25670 3629 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence188 668 162 gene locus_tag LOCUS_25680 668 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 1049 1486 gene locus_tag LOCUS_25690 1049 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_25690 1596 2672 gene locus_tag LOCUS_25700 1596 2672 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082266.1 protein_id gnl|my_center|LOCUS_25700 2769 4088 gene locus_tag LOCUS_25710 2769 4088 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938989.1 protein_id gnl|my_center|LOCUS_25710 4102 4917 gene locus_tag LOCUS_25720 4102 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 5085 5777 gene locus_tag LOCUS_25730 5085 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 >Feature sequence189 365 1495 gene locus_tag LOCUS_25740 gene purK 365 1495 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKY0 protein_id gnl|my_center|LOCUS_25740 1615 2133 gene locus_tag LOCUS_25750 1615 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2157 2840 gene locus_tag LOCUS_25760 2157 2840 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120671.1 protein_id gnl|my_center|LOCUS_25760 3523 2843 gene locus_tag LOCUS_25770 3523 2843 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056165.1 protein_id gnl|my_center|LOCUS_25770 3762 4583 gene locus_tag LOCUS_25780 3762 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 4586 5680 gene locus_tag LOCUS_25790 4586 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 >Feature sequence190 333 1355 gene locus_tag LOCUS_25800 333 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 1352 3124 gene locus_tag LOCUS_25810 1352 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_25810 3228 3635 gene locus_tag LOCUS_25820 3228 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 4218 5270 gene locus_tag LOCUS_25830 4218 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence191 36 845 gene locus_tag LOCUS_25840 36 845 CDS product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIQ8 protein_id gnl|my_center|LOCUS_25840 2749 1328 gene locus_tag LOCUS_25850 2749 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120961.1 protein_id gnl|my_center|LOCUS_25850 5561 2742 gene locus_tag LOCUS_25860 5561 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123598.1 protein_id gnl|my_center|LOCUS_25860 6358 6107 gene locus_tag LOCUS_25870 6358 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence192 1500 190 gene locus_tag LOCUS_25880 1500 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119155.1 protein_id gnl|my_center|LOCUS_25880 1645 1845 gene locus_tag LOCUS_25890 1645 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 1947 2687 gene locus_tag LOCUS_25900 1947 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 2836 4572 gene locus_tag LOCUS_25910 2836 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 5762 5547 gene locus_tag LOCUS_25920 5762 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence193 <1 555 gene locus_tag LOCUS_25930 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YIN0:aminotransferase 589 1548 gene locus_tag LOCUS_25940 gene ala 589 1548 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_25940 4217 1620 gene locus_tag LOCUS_25950 4217 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 >Feature sequence194 <1 708 gene locus_tag LOCUS_25960 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970557.1:sorbosone dehydrogenase 696 1790 gene locus_tag LOCUS_25970 696 1790 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_25970 1927 4167 gene locus_tag LOCUS_25980 gene dpp4 1927 4167 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118275.1 protein_id gnl|my_center|LOCUS_25980 4240 5343 gene locus_tag LOCUS_25990 4240 5343 CDS product muconate-lactonizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_25990 <6578 5362 gene locus_tag LOCUS_26000 <6578 5362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392674.1:metallophosphoesterase >Feature sequence195 1370 345 gene locus_tag LOCUS_26010 1370 345 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWR2 protein_id gnl|my_center|LOCUS_26010 2753 1497 gene locus_tag LOCUS_26020 2753 1497 CDS product ceramide glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122407.1 protein_id gnl|my_center|LOCUS_26020 2998 3462 gene locus_tag LOCUS_26030 2998 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 5770 3536 gene locus_tag LOCUS_26040 5770 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 6070 5786 gene locus_tag LOCUS_26050 6070 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence196 167 1099 gene locus_tag LOCUS_26060 167 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 1243 1887 gene locus_tag LOCUS_26070 gene rplY 1243 1887 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FE7 protein_id gnl|my_center|LOCUS_26070 1924 2490 gene locus_tag LOCUS_26080 gene pth 1924 2490 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181A2 protein_id gnl|my_center|LOCUS_26080 2533 3024 gene locus_tag LOCUS_26090 2533 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 3144 3641 gene locus_tag LOCUS_26100 gene ssb 3144 3641 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73M33 protein_id gnl|my_center|LOCUS_26100 3666 4181 gene locus_tag LOCUS_26110 gene rplI 3666 4181 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKV4 protein_id gnl|my_center|LOCUS_26110 4249 5610 gene locus_tag LOCUS_26120 gene dnaB 4249 5610 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWY4 protein_id gnl|my_center|LOCUS_26120 5629 6105 gene locus_tag LOCUS_26130 gene ispF 5629 6105 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F830 protein_id gnl|my_center|LOCUS_26130 >Feature sequence197 426 3473 gene locus_tag LOCUS_26140 426 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123598.1 protein_id gnl|my_center|LOCUS_26140 3485 4900 gene locus_tag LOCUS_26150 3485 4900 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121859.1 protein_id gnl|my_center|LOCUS_26150 5030 5542 gene locus_tag LOCUS_26160 5030 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 5692 6495 gene locus_tag LOCUS_26170 5692 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence198 914 3859 gene locus_tag LOCUS_26180 914 3859 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_26180 3885 5249 gene locus_tag LOCUS_26190 3885 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 5498 5283 gene locus_tag LOCUS_26200 5498 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 >Feature sequence199 <1 1149 gene locus_tag LOCUS_26210 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015777065.1:sugar kinase 1222 2382 gene locus_tag LOCUS_26220 1222 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120425.1 protein_id gnl|my_center|LOCUS_26220 2503 3414 gene locus_tag LOCUS_26230 2503 3414 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121020.1 protein_id gnl|my_center|LOCUS_26230 3414 3677 gene locus_tag LOCUS_26240 3414 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 3824 3750 gene locus_tag LOCUS_t00340 3824 3750 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4688 4065 gene locus_tag LOCUS_26250 4688 4065 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460224.1 protein_id gnl|my_center|LOCUS_26250 5133 4690 gene locus_tag LOCUS_26260 5133 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 5441 5148 gene locus_tag LOCUS_26270 5441 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 5687 5762 gene locus_tag LOCUS_t00350 5687 5762 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence200 2381 189 gene locus_tag LOCUS_26280 2381 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 4344 2425 gene locus_tag LOCUS_26290 4344 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 5299 4397 gene locus_tag LOCUS_26300 5299 4397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120812.1 protein_id gnl|my_center|LOCUS_26300 <6239 5625 gene locus_tag LOCUS_26310 <6239 5625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RTA0:putative arginyl-tRNA--protein transferase >Feature sequence201 3662 3051 gene locus_tag LOCUS_26320 gene nadD 3662 3051 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHF0 protein_id gnl|my_center|LOCUS_26320 3841 4449 gene locus_tag LOCUS_26330 3841 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence202 1616 513 gene locus_tag LOCUS_26340 1616 513 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113026.1 protein_id gnl|my_center|LOCUS_26340 2617 1622 gene locus_tag LOCUS_26350 2617 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084186.1 protein_id gnl|my_center|LOCUS_26350 3693 2614 gene locus_tag LOCUS_26360 gene gnl 3693 2614 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120521.1 protein_id gnl|my_center|LOCUS_26360 4619 5173 gene locus_tag LOCUS_26370 4619 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 5310 5398 gene locus_tag LOCUS_t00360 5310 5398 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <6127 5432 gene locus_tag LOCUS_26380 <6127 5432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940506.1:multidrug efflux RND transporter permease subunit >Feature sequence203 2698 1577 gene locus_tag LOCUS_26390 2698 1577 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_26390 3611 2742 gene locus_tag LOCUS_26400 3611 2742 CDS product creatinine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732022.1 protein_id gnl|my_center|LOCUS_26400 4749 3631 gene locus_tag LOCUS_26410 4749 3631 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_26410 5759 4746 gene locus_tag LOCUS_26420 5759 4746 CDS product N-alpha-acetyl diaminobutyric acid deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975303.1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence204 4502 2433 gene locus_tag LOCUS_26430 4502 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_26430 5302 4520 gene locus_tag LOCUS_26440 5302 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence205 1112 1426 gene locus_tag LOCUS_26450 1112 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 1467 1688 gene locus_tag LOCUS_26460 1467 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1771 2727 gene locus_tag LOCUS_26470 1771 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 2724 4028 gene locus_tag LOCUS_26480 2724 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence206 1711 173 gene locus_tag LOCUS_26490 1711 173 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767764.1 protein_id gnl|my_center|LOCUS_26490 2619 1807 gene locus_tag LOCUS_26500 2619 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122465.1 protein_id gnl|my_center|LOCUS_26500 5801 3009 gene locus_tag LOCUS_26510 5801 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 >Feature sequence207 408 1877 gene locus_tag LOCUS_26520 408 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_26520 2033 5095 gene locus_tag LOCUS_26530 2033 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence208 2541 3440 gene locus_tag LOCUS_26540 2541 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 3455 4312 gene locus_tag LOCUS_26550 gene lpqC 3455 4312 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_26550 4921 4331 gene locus_tag LOCUS_26560 4921 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 <5939 4943 gene locus_tag LOCUS_26570 <5939 4943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UQD2:UPF0365 protein >Feature sequence209 2862 1066 gene locus_tag LOCUS_26580 2862 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 3882 2905 gene locus_tag LOCUS_26590 3882 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 4764 3940 gene locus_tag LOCUS_26600 4764 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 5323 5120 gene locus_tag LOCUS_26610 5323 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence210 2637 811 gene locus_tag LOCUS_26620 gene degP 2637 811 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121355.1 protein_id gnl|my_center|LOCUS_26620 3890 2655 gene locus_tag LOCUS_26630 3890 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 4984 3890 gene locus_tag LOCUS_26640 4984 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence211 289 1539 gene locus_tag LOCUS_26650 289 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1626 2762 gene locus_tag LOCUS_26660 1626 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 4174 3260 gene locus_tag LOCUS_26670 4174 3260 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704110.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence212 2146 1307 gene locus_tag LOCUS_26680 2146 1307 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122511.1 protein_id gnl|my_center|LOCUS_26680 2244 2822 gene locus_tag LOCUS_26690 2244 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119639.1 protein_id gnl|my_center|LOCUS_26690 2824 3780 gene locus_tag LOCUS_26700 2824 3780 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_26700 4862 3894 gene locus_tag LOCUS_26710 4862 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 <5667 4911 gene locus_tag LOCUS_26720 <5667 4911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000023319.1:biotin-dependent carboxyltransferase family protein >Feature sequence213 334 3675 gene locus_tag LOCUS_26730 gene mfd 334 3675 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQN7 protein_id gnl|my_center|LOCUS_26730 <5642 3679 gene locus_tag LOCUS_26740 <5642 3679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UPN2:glutamate-ammonia-ligase adenylyltransferase >Feature sequence214 1848 1024 gene locus_tag LOCUS_26750 1848 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 2965 1874 gene locus_tag LOCUS_26760 2965 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 3191 4513 gene locus_tag LOCUS_26770 3191 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 5506 4607 gene locus_tag LOCUS_26780 5506 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058043.1 protein_id gnl|my_center|LOCUS_26780 >Feature sequence215 817 2490 gene locus_tag LOCUS_26790 817 2490 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123862.1 protein_id gnl|my_center|LOCUS_26790 2499 4733 gene locus_tag LOCUS_26800 2499 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 4791 5330 gene locus_tag LOCUS_26810 4791 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 >Feature sequence216 210 2696 gene locus_tag LOCUS_26820 210 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_26820 4222 2744 gene locus_tag LOCUS_26830 4222 2744 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120134.1 protein_id gnl|my_center|LOCUS_26830 5361 4225 gene locus_tag LOCUS_26840 5361 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence217 1345 1962 gene locus_tag LOCUS_26850 1345 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 1965 4073 gene locus_tag LOCUS_26860 1965 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 5080 4196 gene locus_tag LOCUS_26870 5080 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence218 514 780 gene locus_tag LOCUS_26880 514 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 2065 818 gene locus_tag LOCUS_26890 2065 818 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147155.1 protein_id gnl|my_center|LOCUS_26890 3312 2251 gene locus_tag LOCUS_26900 3312 2251 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220497.1 protein_id gnl|my_center|LOCUS_26900 4991 3318 gene locus_tag LOCUS_26910 gene ggtA 4991 3318 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence219 1443 157 gene locus_tag LOCUS_26920 gene pyrC 1443 157 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP4 protein_id gnl|my_center|LOCUS_26920 1629 4673 gene locus_tag LOCUS_26930 1629 4673 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB7 protein_id gnl|my_center|LOCUS_26930 >Feature sequence220 169 696 gene locus_tag LOCUS_26940 169 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 1618 776 gene locus_tag LOCUS_26950 1618 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 3298 1808 gene locus_tag LOCUS_26960 3298 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_26960 <5403 3334 gene locus_tag LOCUS_26970 <5403 3334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122306.1:large multi-functional protein >Feature sequence221 1900 275 gene locus_tag LOCUS_26980 1900 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 3594 1936 gene locus_tag LOCUS_26990 3594 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence222 1550 234 gene locus_tag LOCUS_27000 1550 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 1717 3126 gene locus_tag LOCUS_27010 1717 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_27010 4647 3133 gene locus_tag LOCUS_27020 gene proS 4647 3133 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ6 protein_id gnl|my_center|LOCUS_27020 >Feature sequence223 2918 5077 gene locus_tag LOCUS_27030 2918 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence224 336 1910 gene locus_tag LOCUS_27040 336 1910 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_27040 2916 1930 gene locus_tag LOCUS_27050 gene nadR 2916 1930 CDS product transcriptional regulator NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_27050 3535 2909 gene locus_tag LOCUS_27060 3535 2909 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766257.1 protein_id gnl|my_center|LOCUS_27060 >Feature sequence225 1660 2811 gene locus_tag LOCUS_27070 1660 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 5262 2818 gene locus_tag LOCUS_27080 5262 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence226 2647 4683 gene locus_tag LOCUS_27090 2647 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence227 2686 797 gene locus_tag LOCUS_27100 2686 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 3945 2722 gene locus_tag LOCUS_27110 gene nanH 3945 2722 CDS product neuraminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122061.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence228 80 1183 gene locus_tag LOCUS_27120 gene dnaN 80 1183 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKK1 protein_id gnl|my_center|LOCUS_27120 1207 1533 gene locus_tag LOCUS_27130 1207 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 1556 4096 gene locus_tag LOCUS_27140 gene gyrB 1556 4096 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM28 protein_id gnl|my_center|LOCUS_27140 4120 4887 gene locus_tag LOCUS_27150 4120 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence229 <1 1266 gene locus_tag LOCUS_27160 <1 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122741.1:serine/threonine protein kinase 1719 1270 gene locus_tag LOCUS_27170 1719 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 2834 1794 gene locus_tag LOCUS_27180 2834 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121174.1 protein_id gnl|my_center|LOCUS_27180 4947 2899 gene locus_tag LOCUS_27190 gene degP 4947 2899 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121357.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence230 1223 426 gene locus_tag LOCUS_27200 1223 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 4448 1332 gene locus_tag LOCUS_27210 4448 1332 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942010.1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence231 109 993 gene locus_tag LOCUS_27220 gene nfo 109 993 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WII8 protein_id gnl|my_center|LOCUS_27220 1750 995 gene locus_tag LOCUS_27230 1750 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 1942 3942 gene locus_tag LOCUS_27240 gene ligA 1942 3942 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ER9 protein_id gnl|my_center|LOCUS_27240 4005 4706 gene locus_tag LOCUS_27250 4005 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence232 1289 471 gene locus_tag LOCUS_27260 1289 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 1824 1273 gene locus_tag LOCUS_27270 1824 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 3187 1856 gene locus_tag LOCUS_27280 gene hisS 3187 1856 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UZ20 protein_id gnl|my_center|LOCUS_27280 4086 3247 gene locus_tag LOCUS_27290 4086 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence233 223 672 gene locus_tag LOCUS_27300 223 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 1877 687 gene locus_tag LOCUS_27310 1877 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 3637 2600 gene locus_tag LOCUS_27320 3637 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 4076 4987 gene locus_tag LOCUS_27330 4076 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122454.1 protein_id gnl|my_center|LOCUS_27330 >Feature sequence234 1800 1372 gene locus_tag LOCUS_27340 1800 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 2303 2587 gene locus_tag LOCUS_27350 2303 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2745 3491 gene locus_tag LOCUS_27360 2745 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 3880 4062 gene locus_tag LOCUS_27370 3880 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 4447 4088 gene locus_tag LOCUS_27380 4447 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 4787 4569 gene locus_tag LOCUS_27390 4787 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 >Feature sequence235 4056 1948 gene locus_tag LOCUS_27400 4056 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 4646 4380 gene locus_tag LOCUS_27410 4646 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 >Feature sequence236 894 2579 gene locus_tag LOCUS_27420 894 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140390.1 protein_id gnl|my_center|LOCUS_27420 2640 4718 gene locus_tag LOCUS_27430 2640 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence237 1050 130 gene locus_tag LOCUS_27440 1050 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118832.1 protein_id gnl|my_center|LOCUS_27440 1050 1211 gene locus_tag LOCUS_27450 1050 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 1220 1408 gene locus_tag LOCUS_27460 1220 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 1677 2540 gene locus_tag LOCUS_27470 1677 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919009.1 protein_id gnl|my_center|LOCUS_27470 3855 2632 gene locus_tag LOCUS_27480 3855 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 4173 4436 gene locus_tag LOCUS_27490 4173 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence238 265 1647 gene locus_tag LOCUS_27500 265 1647 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124074.1 protein_id gnl|my_center|LOCUS_27500 1734 2747 gene locus_tag LOCUS_27510 1734 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184801.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence239 2392 755 gene locus_tag LOCUS_27520 2392 755 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635613.2 protein_id gnl|my_center|LOCUS_27520 3343 2396 gene locus_tag LOCUS_27530 gene oleB 3343 2396 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_27530 4434 3610 gene locus_tag LOCUS_27540 4434 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27540 <5003 4461 gene locus_tag LOCUS_27550 <5003 4461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071757.1:beta-hydroxyacyl-ACP dehydratase >Feature sequence240 65 138 gene locus_tag LOCUS_t00370 65 138 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 590 919 gene locus_tag LOCUS_27560 590 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 998 1225 gene locus_tag LOCUS_27570 998 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 2276 1539 gene locus_tag LOCUS_27580 2276 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 3361 2432 gene locus_tag LOCUS_27590 3361 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 4225 3419 gene locus_tag LOCUS_27600 4225 3419 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191284.1 protein_id gnl|my_center|LOCUS_27600 >Feature sequence241 2829 4277 gene locus_tag LOCUS_27610 2829 4277 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_27610 4328 4564 gene locus_tag LOCUS_27620 4328 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 >Feature sequence242 <1 531 gene locus_tag LOCUS_27630 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942461.1:UDP-glucose 6-dehydrogenase 573 1910 gene locus_tag LOCUS_27640 573 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 1903 3309 gene locus_tag LOCUS_27650 1903 3309 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546113.1 protein_id gnl|my_center|LOCUS_27650 4134 3292 gene locus_tag LOCUS_27660 4134 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence243 681 1157 gene locus_tag LOCUS_27670 681 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27670 3208 1205 gene locus_tag LOCUS_27680 3208 1205 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121863.1 protein_id gnl|my_center|LOCUS_27680 3325 4569 gene locus_tag LOCUS_27690 3325 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence244 179 547 gene locus_tag LOCUS_27700 179 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_27700 963 2198 gene locus_tag LOCUS_27710 963 2198 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 protein_id gnl|my_center|LOCUS_27710 2414 4051 gene locus_tag LOCUS_27720 2414 4051 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119006.1 protein_id gnl|my_center|LOCUS_27720 >Feature sequence245 2200 722 gene locus_tag LOCUS_27730 gene phoD 2200 722 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_27730 <4834 2226 gene locus_tag LOCUS_27740 <4834 2226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UMC0:leucine--tRNA ligase >Feature sequence246 959 1945 gene locus_tag LOCUS_27750 959 1945 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123535.1 protein_id gnl|my_center|LOCUS_27750 2020 2907 gene locus_tag LOCUS_27760 gene xynB 2020 2907 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038153.1 protein_id gnl|my_center|LOCUS_27760 >Feature sequence247 2798 1776 gene locus_tag LOCUS_27770 gene pheS 2798 1776 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDN0 protein_id gnl|my_center|LOCUS_27770 3205 2837 gene locus_tag LOCUS_27780 gene rplT 3205 2837 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60491 protein_id gnl|my_center|LOCUS_27780 3461 3261 gene locus_tag LOCUS_27790 gene rpmI 3461 3261 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9K5 protein_id gnl|my_center|LOCUS_27790 4252 3644 gene locus_tag LOCUS_27800 gene infC 4252 3644 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ17 protein_id gnl|my_center|LOCUS_27800 4595 4356 gene locus_tag LOCUS_27810 4595 4356 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124572.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence248 795 127 gene locus_tag LOCUS_27820 gene phoU 795 127 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP22 protein_id gnl|my_center|LOCUS_27820 1649 819 gene locus_tag LOCUS_27830 gene pstB 1649 819 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7S9 protein_id gnl|my_center|LOCUS_27830 1850 2707 gene locus_tag LOCUS_27840 1850 2707 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120776.1 protein_id gnl|my_center|LOCUS_27840 2738 3598 gene locus_tag LOCUS_27850 2738 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27850 <4749 3608 gene locus_tag LOCUS_27860 <4749 3608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393971.1:PAS domain-containing sensor histidine kinase >Feature sequence249 <4725 3363 gene locus_tag LOCUS_27870 <4725 3363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002305489.1:amino acid permease >Feature sequence250 892 2211 gene locus_tag LOCUS_27880 892 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120350.1 protein_id gnl|my_center|LOCUS_27880 2863 2225 gene locus_tag LOCUS_27890 2863 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 <4721 3189 gene locus_tag LOCUS_27900 <4721 3189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035279.1:peptidase S41 >Feature sequence251 207 458 gene locus_tag LOCUS_27910 207 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 3076 584 gene locus_tag LOCUS_27920 3076 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 3320 3568 gene locus_tag LOCUS_27930 3320 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 4715 3627 gene locus_tag LOCUS_27940 4715 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence252 1026 202 gene locus_tag LOCUS_27950 1026 202 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_27950 1227 2384 gene locus_tag LOCUS_27960 1227 2384 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_27960 3702 2386 gene locus_tag LOCUS_27970 3702 2386 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_27970 3834 4226 gene locus_tag LOCUS_27980 3834 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence253 133 1068 gene locus_tag LOCUS_27990 133 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 1103 2386 gene locus_tag LOCUS_28000 1103 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 3003 2395 gene locus_tag LOCUS_28010 gene lexA 3003 2395 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2R7 protein_id gnl|my_center|LOCUS_28010 3157 4176 gene locus_tag LOCUS_28020 3157 4176 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460914.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence254 455 1426 gene locus_tag LOCUS_28030 455 1426 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120402.1 protein_id gnl|my_center|LOCUS_28030 1445 1606 gene locus_tag LOCUS_28040 1445 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 1647 2363 gene locus_tag LOCUS_28050 1647 2363 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KMT9 protein_id gnl|my_center|LOCUS_28050 3118 2366 gene locus_tag LOCUS_28060 3118 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 3705 3115 gene locus_tag LOCUS_28070 gene rpoE 3705 3115 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222975.1 protein_id gnl|my_center|LOCUS_28070 4350 3823 gene locus_tag LOCUS_28080 gene msrA 4350 3823 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_28080 4598 4671 gene locus_tag LOCUS_t00380 4598 4671 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence255 2230 836 gene locus_tag LOCUS_28090 2230 836 CDS product UDP-N-acetylhexosamine pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_28090 2986 2261 gene locus_tag LOCUS_28100 gene phnP 2986 2261 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_28100 <4638 3097 gene locus_tag LOCUS_28110 <4638 3097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119516.1:MFS transporter >Feature sequence256 3553 1892 gene locus_tag LOCUS_28120 3553 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 4486 3617 gene locus_tag LOCUS_28130 gene metF 4486 3617 CDS product 5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67422 protein_id gnl|my_center|LOCUS_28130 >Feature sequence257 474 908 gene locus_tag LOCUS_28140 gene mscL 474 908 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCK7 protein_id gnl|my_center|LOCUS_28140 938 3004 gene locus_tag LOCUS_28150 938 3004 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_28150 3037 3879 gene locus_tag LOCUS_28160 3037 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 >Feature sequence258 <1 1317 gene locus_tag LOCUS_28170 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680941.1:ATPase AAA 1507 2463 gene locus_tag LOCUS_28180 1507 2463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_28180 2537 4102 gene locus_tag LOCUS_28190 2537 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 >Feature sequence259 798 220 gene locus_tag LOCUS_28200 798 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 1115 1564 gene locus_tag LOCUS_28210 1115 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 1779 2321 gene locus_tag LOCUS_28220 1779 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 2394 3056 gene locus_tag LOCUS_28230 2394 3056 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_28230 3059 3928 gene locus_tag LOCUS_28240 3059 3928 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence260 <1 504 gene locus_tag LOCUS_28250 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887088.1:thymidine phosphorylase 544 969 gene locus_tag LOCUS_28260 544 969 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_28260 969 1784 gene locus_tag LOCUS_28270 969 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 2972 1767 gene locus_tag LOCUS_28280 2972 1767 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970145.1 protein_id gnl|my_center|LOCUS_28280 3066 3602 gene locus_tag LOCUS_28290 gene mogA 3066 3602 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422732.1 protein_id gnl|my_center|LOCUS_28290 3611 4306 gene locus_tag LOCUS_28300 3611 4306 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62EU9 protein_id gnl|my_center|LOCUS_28300 >Feature sequence261 2021 2515 gene locus_tag LOCUS_28310 2021 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 4415 2538 gene locus_tag LOCUS_28320 4415 2538 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_28320 >Feature sequence262 <1 749 gene locus_tag LOCUS_28330 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123928.1:dolichyl-phosphate mannose synthase 746 2326 gene locus_tag LOCUS_28340 746 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_28340 3787 2330 gene locus_tag LOCUS_28350 gene arsA 3787 2330 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119603.1 protein_id gnl|my_center|LOCUS_28350 >Feature sequence263 280 663 gene locus_tag LOCUS_28360 280 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 932 2212 gene locus_tag LOCUS_28370 gene ndh 932 2212 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_28370 2962 2318 gene locus_tag LOCUS_28380 2962 2318 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_28380 3061 3969 gene locus_tag LOCUS_28390 3061 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence264 3311 801 gene locus_tag LOCUS_28400 3311 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 >Feature sequence265 59 688 gene locus_tag LOCUS_28410 59 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 734 2398 gene locus_tag LOCUS_28420 gene nadB 734 2398 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTK8 protein_id gnl|my_center|LOCUS_28420 2548 4128 gene locus_tag LOCUS_28430 gene leuA 2548 4128 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332450.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence266 196 1329 gene locus_tag LOCUS_28440 gene ycbU 196 1329 CDS product putative aminotransferase YcbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42253 protein_id gnl|my_center|LOCUS_28440 2740 1385 gene locus_tag LOCUS_28450 2740 1385 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence267 3161 735 gene locus_tag LOCUS_28460 3161 735 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120680.1 protein_id gnl|my_center|LOCUS_28460 <4505 3317 gene locus_tag LOCUS_28470 <4505 3317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120681.1:sulfatase >Feature sequence268 1669 1202 gene locus_tag LOCUS_28480 1669 1202 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_28480 1905 2588 gene locus_tag LOCUS_28490 1905 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 2676 3014 gene locus_tag LOCUS_28500 gene trx 2676 3014 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI85 protein_id gnl|my_center|LOCUS_28500 >Feature sequence269 139 3360 gene locus_tag LOCUS_28510 139 3360 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_28510 3605 3396 gene locus_tag LOCUS_28520 3605 3396 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_28520 <4482 3737 gene locus_tag LOCUS_28530 <4482 3737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582837.1:glucan endo-1,3-beta-D-glucosidase >Feature sequence270 2173 4293 gene locus_tag LOCUS_28540 2173 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence271 548 318 gene locus_tag LOCUS_28550 548 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 2096 702 gene locus_tag LOCUS_28560 2096 702 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117786.1 protein_id gnl|my_center|LOCUS_28560 <4431 2089 gene locus_tag LOCUS_28570 <4431 2089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085718.1:RND transporter >Feature sequence272 1886 588 gene locus_tag LOCUS_28580 gene lysA 1886 588 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL42 protein_id gnl|my_center|LOCUS_28580 3340 1964 gene locus_tag LOCUS_28590 gene argH 3340 1964 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK64 protein_id gnl|my_center|LOCUS_28590 <4409 3435 gene locus_tag LOCUS_28600 <4409 3435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Y709:aspartate--tRNA ligase >Feature sequence273 134 1450 gene locus_tag LOCUS_28610 134 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 1561 1797 gene locus_tag LOCUS_28620 1561 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 2106 2909 gene locus_tag LOCUS_28630 2106 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3115 3438 gene locus_tag LOCUS_28640 3115 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 3472 4359 gene locus_tag LOCUS_28650 3472 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28650 >Feature sequence274 <1 699 gene locus_tag LOCUS_28660 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34623:DNA polymerase III subunit alpha 1216 686 gene locus_tag LOCUS_28670 1216 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 1947 1213 gene locus_tag LOCUS_28680 1947 1213 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_28680 2058 2696 gene locus_tag LOCUS_28690 2058 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 2730 4265 gene locus_tag LOCUS_28700 gene comM 2730 4265 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 protein_id gnl|my_center|LOCUS_28700 >Feature sequence275 438 34 gene locus_tag LOCUS_28710 438 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 755 435 gene locus_tag LOCUS_28720 755 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 1335 1246 gene locus_tag LOCUS_t00390 1335 1246 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2665 1412 gene locus_tag LOCUS_28730 2665 1412 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH36 protein_id gnl|my_center|LOCUS_28730 3164 2892 gene locus_tag LOCUS_28740 3164 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 3697 3281 gene locus_tag LOCUS_28750 3697 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 >Feature sequence276 <1 2902 gene locus_tag LOCUS_28760 <1 2902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941986.1:cation transporter <4270 2895 gene locus_tag LOCUS_28770 <4270 2895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010201131.1:RND transporter >Feature sequence277 2405 108 gene locus_tag LOCUS_28780 2405 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 >Feature sequence278 <1 1263 gene locus_tag LOCUS_28790 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289076.1:glycosyl transferase family 2 1260 3401 gene locus_tag LOCUS_28800 1260 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 <4248 3403 gene locus_tag LOCUS_28810 <4248 3403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035843.1:glycosyl transferase >Feature sequence279 695 2167 gene locus_tag LOCUS_28820 695 2167 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_28820 2601 3164 gene locus_tag LOCUS_28830 2601 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 3709 3323 gene locus_tag LOCUS_28840 3709 3323 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_28840 3945 3709 gene locus_tag LOCUS_28850 3945 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142023.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence280 1054 2193 gene locus_tag LOCUS_28860 1054 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 2211 3182 gene locus_tag LOCUS_28870 2211 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 >Feature sequence281 2154 1156 gene locus_tag LOCUS_28880 2154 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 3682 2177 gene locus_tag LOCUS_28890 gene atsA 3682 2177 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118387.1 protein_id gnl|my_center|LOCUS_28890 >Feature sequence282 114 401 gene locus_tag LOCUS_28900 114 401 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461445.1 protein_id gnl|my_center|LOCUS_28900 455 1933 gene locus_tag LOCUS_28910 gene gatA 455 1933 CDS product aspartyl/glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812377.1 protein_id gnl|my_center|LOCUS_28910 2622 1936 gene locus_tag LOCUS_28920 2622 1936 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_28920 3329 2619 gene locus_tag LOCUS_28930 gene queC 3329 2619 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSY8 protein_id gnl|my_center|LOCUS_28930 >Feature sequence283 1565 288 gene locus_tag LOCUS_28940 1565 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 2320 1568 gene locus_tag LOCUS_28950 gene bioD 2320 1568 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT8 protein_id gnl|my_center|LOCUS_28950 3712 2327 gene locus_tag LOCUS_28960 gene bioA 3712 2327 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT9 protein_id gnl|my_center|LOCUS_28960 >Feature sequence284 1 144 gene locus_tag LOCUS_28970 1 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 182 1615 gene locus_tag LOCUS_28980 182 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 2525 1644 gene locus_tag LOCUS_28990 gene dapA4 2525 1644 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181M9 protein_id gnl|my_center|LOCUS_28990 3925 2528 gene locus_tag LOCUS_29000 3925 2528 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTN0 protein_id gnl|my_center|LOCUS_29000 >Feature sequence285 1244 162 gene locus_tag LOCUS_29010 1244 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 2375 1260 gene locus_tag LOCUS_29020 2375 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 2885 2490 gene locus_tag LOCUS_29030 2885 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 3842 2901 gene locus_tag LOCUS_29040 3842 2901 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_29040 >Feature sequence286 2031 1375 gene locus_tag LOCUS_29050 2031 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_29050 2560 2120 gene locus_tag LOCUS_29060 2560 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 2896 2594 gene locus_tag LOCUS_29070 2896 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 3651 3070 gene locus_tag LOCUS_29080 3651 3070 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393578.1 protein_id gnl|my_center|LOCUS_29080 >Feature sequence287 1 729 gene locus_tag LOCUS_29090 1 729 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_29090 778 1092 gene locus_tag LOCUS_29100 778 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 1116 2156 gene locus_tag LOCUS_29110 gene ldh 1116 2156 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118931.1 protein_id gnl|my_center|LOCUS_29110 2159 2413 gene locus_tag LOCUS_29120 2159 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 2410 3672 gene locus_tag LOCUS_29130 2410 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 3705 3977 gene locus_tag LOCUS_29140 3705 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 >Feature sequence288 4002 967 gene locus_tag LOCUS_29150 4002 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence289 <1 2209 gene locus_tag LOCUS_29160 <1 2209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024173.1:cell surface protein >Feature sequence290 1758 313 gene locus_tag LOCUS_29170 1758 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 2168 1782 gene locus_tag LOCUS_29180 2168 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 2374 2165 gene locus_tag LOCUS_29190 2374 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 2735 2274 gene locus_tag LOCUS_29200 2735 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 2923 3912 gene locus_tag LOCUS_29210 2923 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence291 440 2644 gene locus_tag LOCUS_29220 gene cyaA 440 2644 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947053.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence292 309 22 gene locus_tag LOCUS_29230 gene groS 309 22 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1B0 protein_id gnl|my_center|LOCUS_29230 768 364 gene locus_tag LOCUS_29240 768 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 2230 1076 gene locus_tag LOCUS_29250 2230 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 <3967 2598 gene locus_tag LOCUS_29260 <3967 2598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947081.1:aldehyde dehydrogenase >Feature sequence293 843 13 gene locus_tag LOCUS_29270 843 13 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_29270 2052 901 gene locus_tag LOCUS_29280 2052 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 >Feature sequence294 357 1928 gene locus_tag LOCUS_29290 357 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 2536 2375 gene locus_tag LOCUS_29300 2536 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 2610 3398 gene locus_tag LOCUS_29310 2610 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 3417 3599 gene locus_tag LOCUS_29320 3417 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 >Feature sequence295 50 2536 gene locus_tag LOCUS_29330 50 2536 CDS product chromosome segregation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123585.1 protein_id gnl|my_center|LOCUS_29330 >Feature sequence296 981 256 gene locus_tag LOCUS_29340 gene rnc 981 256 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGZ7 protein_id gnl|my_center|LOCUS_29340 1268 2758 gene locus_tag LOCUS_29350 1268 2758 CDS product MucD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_29350 <3856 2827 gene locus_tag LOCUS_29360 <3856 2827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119140.1:serine/threonine protein kinase >Feature sequence297 985 1755 gene locus_tag LOCUS_29370 985 1755 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919952.1 protein_id gnl|my_center|LOCUS_29370 1841 3019 gene locus_tag LOCUS_29380 1841 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 3070 3687 gene locus_tag LOCUS_29390 3070 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence298 2271 1117 gene locus_tag LOCUS_29400 gene iscS 2271 1117 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZS1 protein_id gnl|my_center|LOCUS_29400 2688 2308 gene locus_tag LOCUS_29410 2688 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 2932 3711 gene locus_tag LOCUS_29420 2932 3711 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_29420 >Feature sequence299 297 893 gene locus_tag LOCUS_29430 gene hisB 297 893 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNC2 protein_id gnl|my_center|LOCUS_29430 1008 1226 gene locus_tag LOCUS_29440 1008 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 1258 1674 gene locus_tag LOCUS_29450 1258 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 1704 2648 gene locus_tag LOCUS_29460 gene psd 1704 2648 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTK9 protein_id gnl|my_center|LOCUS_29460 3787 2645 gene locus_tag LOCUS_29470 gene mqnE 3787 2645 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA9 protein_id gnl|my_center|LOCUS_29470 >Feature sequence300 3785 3300 gene locus_tag LOCUS_29480 gene dcd 3785 3300 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7P1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence301 771 2117 gene locus_tag LOCUS_29490 771 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 2609 2133 gene locus_tag LOCUS_29500 2609 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 >Feature sequence302 <1 564 gene locus_tag LOCUS_29510 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335393.1:secretion protein 629 1258 gene locus_tag LOCUS_29520 629 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 1437 2768 gene locus_tag LOCUS_29530 1437 2768 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_29530 2836 3570 gene locus_tag LOCUS_29540 2836 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 >Feature sequence303 187 333 gene locus_tag LOCUS_29550 187 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 435 1742 gene locus_tag LOCUS_29560 435 1742 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_29560 1746 2792 gene locus_tag LOCUS_29570 1746 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 <3687 2802 gene locus_tag LOCUS_29580 <3687 2802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142622.1:dipeptidyl-peptidase >Feature sequence304 <1 2227 gene locus_tag LOCUS_29590 <1 2227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WHJ8:chaperone protein ClpB 2283 3668 gene locus_tag LOCUS_29600 2283 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_29600 >Feature sequence305 1152 2255 gene locus_tag LOCUS_29610 1152 2255 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_29610 3359 2388 gene locus_tag LOCUS_29620 3359 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 >Feature sequence306 1313 594 gene locus_tag LOCUS_29630 1313 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 2120 1380 gene locus_tag LOCUS_29640 2120 1380 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_29640 3089 2325 gene locus_tag LOCUS_29650 3089 2325 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118951.1 protein_id gnl|my_center|LOCUS_29650 <3665 3092 gene locus_tag LOCUS_29660 <3665 3092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UP22:phosphate transport system regulatory protein PhoU >Feature sequence307 870 1943 gene locus_tag LOCUS_29670 870 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence308 1415 741 gene locus_tag LOCUS_29680 1415 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 <3587 1516 gene locus_tag LOCUS_29690 <3587 1516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34779:protein phosphatase PrpC >Feature sequence309 <1 885 gene locus_tag LOCUS_29700 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92T74:putative phosphoketolase 1 843 2054 gene locus_tag LOCUS_29710 gene ackA 843 2054 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37877 protein_id gnl|my_center|LOCUS_29710 2246 2097 gene locus_tag LOCUS_29720 2246 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 >Feature sequence310 849 1298 gene locus_tag LOCUS_29730 849 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 1330 1644 gene locus_tag LOCUS_29740 1330 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 3303 1708 gene locus_tag LOCUS_29750 gene yljF 3303 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_29750 >Feature sequence311 1666 2475 gene locus_tag LOCUS_29760 1666 2475 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181558.1 protein_id gnl|my_center|LOCUS_29760 >Feature sequence312 <1 2004 gene locus_tag LOCUS_29770 <1 2004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003356323.1:glycosyl hydrolase 3154 2093 gene locus_tag LOCUS_29780 3154 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_29780 >Feature sequence313 3092 582 gene locus_tag LOCUS_29790 3092 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence314 1372 209 gene locus_tag LOCUS_29800 gene hemN 1372 209 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122512.1 protein_id gnl|my_center|LOCUS_29800 1453 2235 gene locus_tag LOCUS_29810 gene gdh 1453 2235 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121332.1 protein_id gnl|my_center|LOCUS_29810 >Feature sequence315 100 1038 gene locus_tag LOCUS_29820 100 1038 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_29820 1056 2438 gene locus_tag LOCUS_29830 1056 2438 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122408.1 protein_id gnl|my_center|LOCUS_29830 2560 3261 gene locus_tag LOCUS_29840 2560 3261 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775976.1 protein_id gnl|my_center|LOCUS_29840 >Feature sequence316 <1 948 gene locus_tag LOCUS_29850 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120365.1:amino acid dehydrogenase 1376 3307 gene locus_tag LOCUS_29860 1376 3307 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121863.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence317 <3395 2258 gene locus_tag LOCUS_29870 <3395 2258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120622.1:cytochrome c >Feature sequence318 2302 389 gene locus_tag LOCUS_29880 gene sdhA 2302 389 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050920.1 protein_id gnl|my_center|LOCUS_29880 3013 2321 gene locus_tag LOCUS_29890 3013 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_29890 >Feature sequence319 54 680 gene locus_tag LOCUS_29900 gene nccH 54 680 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121583.1 protein_id gnl|my_center|LOCUS_29900 1110 2825 gene locus_tag LOCUS_29910 1110 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 3058 3291 gene locus_tag LOCUS_29920 3058 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 >Feature sequence320 995 132 gene locus_tag LOCUS_29930 995 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 2136 1087 gene locus_tag LOCUS_29940 2136 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 <3290 2154 gene locus_tag LOCUS_29950 <3290 2154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103999.1:capK domain protein >Feature sequence321 1505 2326 gene locus_tag LOCUS_29960 1505 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_29960 2341 2706 gene locus_tag LOCUS_29970 gene cbiX 2341 2706 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 protein_id gnl|my_center|LOCUS_29970 <3285 2703 gene locus_tag LOCUS_29980 <3285 2703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122705.1:MtdA bifunctional protein >Feature sequence322 >Feature sequence323 494 1336 gene locus_tag LOCUS_29990 494 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 1925 1416 gene locus_tag LOCUS_30000 1925 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 2845 2141 gene locus_tag LOCUS_30010 2845 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 >Feature sequence324 3215 2253 gene locus_tag LOCUS_30020 3215 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 >Feature sequence325 2674 953 gene locus_tag LOCUS_30030 2674 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 >Feature sequence326 2628 1030 gene locus_tag LOCUS_30040 2628 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence327 1891 104 gene locus_tag LOCUS_30050 1891 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 >Feature sequence328 31 1827 gene locus_tag LOCUS_30060 31 1827 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_30060 1831 2175 gene locus_tag LOCUS_30070 1831 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119559.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence329 1131 274 gene locus_tag LOCUS_30080 gene aroE 1131 274 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CUJ9 protein_id gnl|my_center|LOCUS_30080 2131 1142 gene locus_tag LOCUS_30090 2131 1142 CDS product periplasmic sugar-binding protein of ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140809.1 protein_id gnl|my_center|LOCUS_30090 <3115 2206 gene locus_tag LOCUS_30100 <3115 2206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120947.1:2-alkenal reductase >Feature sequence330 24 1313 gene locus_tag LOCUS_30110 gene serS 24 1313 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KB2 protein_id gnl|my_center|LOCUS_30110 1347 2714 gene locus_tag LOCUS_30120 gene uvrC 1347 2714 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD6 protein_id gnl|my_center|LOCUS_30120 >Feature sequence331 310 486 gene locus_tag LOCUS_30130 310 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 498 818 gene locus_tag LOCUS_30140 gene eutN 498 818 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118935.1 protein_id gnl|my_center|LOCUS_30140 858 2279 gene locus_tag LOCUS_30150 gene eutE 858 2279 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_30150 2289 2543 gene locus_tag LOCUS_30160 2289 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence332 1702 383 gene locus_tag LOCUS_30170 gene ugd 1702 383 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_30170 2709 1705 gene locus_tag LOCUS_30180 2709 1705 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_30180 >Feature sequence333 <1 1789 gene locus_tag LOCUS_30190 <1 1789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UMG7:DNA topoisomerase (ATP-hydrolyzing) 1814 2788 gene locus_tag LOCUS_30200 1814 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065050.1 protein_id gnl|my_center|LOCUS_30200 >Feature sequence334 457 1206 gene locus_tag LOCUS_30210 gene troB 457 1206 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_30210 1210 2334 gene locus_tag LOCUS_30220 1210 2334 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256104.1 protein_id gnl|my_center|LOCUS_30220 >Feature sequence335 381 1844 gene locus_tag LOCUS_30230 381 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence336 2220 49 gene locus_tag LOCUS_30240 2220 49 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123527.1 protein_id gnl|my_center|LOCUS_30240 >Feature sequence337 <1 889 gene locus_tag LOCUS_30250 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63NU3:2-methylisocitrate lyase 947 2098 gene locus_tag LOCUS_30260 gene prpC 947 2098 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0ML00 protein_id gnl|my_center|LOCUS_30260 >Feature sequence338 2027 1263 gene locus_tag LOCUS_30270 2027 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 2777 2067 gene locus_tag LOCUS_30280 2777 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence339 526 1170 gene locus_tag LOCUS_30290 526 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 1274 1900 gene locus_tag LOCUS_30300 gene cnrH 1274 1900 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122499.1 protein_id gnl|my_center|LOCUS_30300 >Feature sequence340 <2907 2082 gene locus_tag LOCUS_30310 <2907 2082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H67:protein TolB >Feature sequence341 2163 766 gene locus_tag LOCUS_30320 2163 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence342 158 277 gene locus_tag LOCUS_30330 158 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 305 802 gene locus_tag LOCUS_30340 305 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 2344 812 gene locus_tag LOCUS_30350 2344 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 2733 2867 gene locus_tag LOCUS_30360 2733 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 >Feature sequence343 709 1509 gene locus_tag LOCUS_30370 709 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 <2774 1523 gene locus_tag LOCUS_30380 <2774 1523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257129.1:glycosyl transferase family 1 >Feature sequence344 <2773 1311 gene locus_tag LOCUS_30390 <2773 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120349.1:S-layer protein >Feature sequence345 528 1556 gene locus_tag LOCUS_30400 528 1556 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031699.1 protein_id gnl|my_center|LOCUS_30400 1574 2350 gene locus_tag LOCUS_30410 1574 2350 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM3 protein_id gnl|my_center|LOCUS_30410 >Feature sequence346 465 1691 gene locus_tag LOCUS_30420 465 1691 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_30420 >Feature sequence347 <1 1029 gene locus_tag LOCUS_30430 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NGL0:peptide chain release factor 3 1357 1091 gene locus_tag LOCUS_30440 1357 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_30440 1552 2292 gene locus_tag LOCUS_30450 1552 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 2734 2312 gene locus_tag LOCUS_30460 2734 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 >Feature sequence348 469 1515 gene locus_tag LOCUS_30470 469 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 >Feature sequence349 1230 31 gene locus_tag LOCUS_30480 1230 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 1374 1889 gene locus_tag LOCUS_30490 1374 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 >Feature sequence350 1279 101 gene locus_tag LOCUS_30500 gene ackA 1279 101 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVK1 protein_id gnl|my_center|LOCUS_30500 1588 1292 gene locus_tag LOCUS_30510 1588 1292 CDS product carboxysome shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868831.1 protein_id gnl|my_center|LOCUS_30510 1915 1622 gene locus_tag LOCUS_30520 gene eutM 1915 1622 CDS product ethanolamine utilization protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_30520 2669 1971 gene locus_tag LOCUS_30530 2669 1971 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVJ7 protein_id gnl|my_center|LOCUS_30530 >Feature sequence351 2601 1174 gene locus_tag LOCUS_30540 2601 1174 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence352 1438 1842 gene locus_tag LOCUS_30550 1438 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 1892 2530 gene locus_tag LOCUS_30560 gene aat 1892 2530 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X5I5 protein_id gnl|my_center|LOCUS_30560 >Feature sequence353 <1 1405 gene locus_tag LOCUS_30570 <1 1405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931857.1:2-oxoglutarate ferredoxin oxidoreductase subunit alpha 1402 2394 gene locus_tag LOCUS_30580 gene korB 1402 2394 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121170.1 protein_id gnl|my_center|LOCUS_30580 >Feature sequence354 >Feature sequence355 <1 1087 gene locus_tag LOCUS_30590 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143506.1:Xaa-Pro dipeptidase 1128 2396 gene locus_tag LOCUS_30600 1128 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_30600 >Feature sequence356 120 1373 gene locus_tag LOCUS_30610 120 1373 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_30610 >Feature sequence357 31 1095 gene locus_tag LOCUS_30620 31 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 >Feature sequence358 <1 521 gene locus_tag LOCUS_30630 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FUM5:thymidine kinase 613 2052 gene locus_tag LOCUS_30640 gene yeiM 613 2052 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_30640 >Feature sequence359 >Feature sequence360 >Feature sequence361 2 829 gene locus_tag LOCUS_30650 2 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 857 2203 gene locus_tag LOCUS_30660 857 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 protein_id gnl|my_center|LOCUS_30660 >Feature sequence362 1305 1811 gene locus_tag LOCUS_30670 gene hpt 1305 1811 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327769.1 protein_id gnl|my_center|LOCUS_30670 >Feature sequence363 22 97 gene locus_tag LOCUS_t00400 22 97 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 265 1467 gene locus_tag LOCUS_30680 265 1467 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_30680 2374 1487 gene locus_tag LOCUS_30690 gene ubiA 2374 1487 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 protein_id gnl|my_center|LOCUS_30690 >Feature sequence364 75 371 gene locus_tag LOCUS_30700 75 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 417 345 gene locus_tag LOCUS_t00410 417 345 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 503 1870 gene locus_tag LOCUS_30710 gene pds 503 1870 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122224.1 protein_id gnl|my_center|LOCUS_30710 <2437 1872 gene locus_tag LOCUS_30720 <2437 1872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329973.1:PTS fructose transporter subunit IIA >Feature sequence365 1306 656 gene locus_tag LOCUS_30730 1306 656 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_30730 <2405 1393 gene locus_tag LOCUS_30740 <2405 1393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122409.1:9-O-acetylesterase >Feature sequence366 2040 685 gene locus_tag LOCUS_30750 2040 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_30750 2171 2037 gene locus_tag LOCUS_30760 2171 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence367 1043 447 gene locus_tag LOCUS_30770 1043 447 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946639.1 protein_id gnl|my_center|LOCUS_30770 1921 1106 gene locus_tag LOCUS_30780 1921 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence368 >Feature sequence369 20 1810 gene locus_tag LOCUS_30790 gene rho 20 1810 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7C5 protein_id gnl|my_center|LOCUS_30790 1847 2320 gene locus_tag LOCUS_30800 gene ribH 1847 2320 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHQ1 protein_id gnl|my_center|LOCUS_30800 >Feature sequence370 798 676 gene locus_tag LOCUS_30810 798 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 1669 788 gene locus_tag LOCUS_30820 1669 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 >Feature sequence371 <1 2026 gene locus_tag LOCUS_30830 <1 2026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118945.1:azurin >Feature sequence372 >Feature sequence373 <2052 639 gene locus_tag LOCUS_30840 <2052 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123172.1:sulfatase >Feature sequence374 >Feature sequence375 1524 355 gene locus_tag LOCUS_30850 1524 355 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122967.1 protein_id gnl|my_center|LOCUS_30850 1689 1919 gene locus_tag LOCUS_30860 1689 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 >Feature sequence376 <1873 1307 gene locus_tag LOCUS_30870 <1873 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258747.1:isocitrate dehydrogenase (NADP(+)) >Feature sequence377 640 1734 gene locus_tag LOCUS_30880 640 1734 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532402.1 protein_id gnl|my_center|LOCUS_30880 >Feature sequence378 >Feature sequence379 985 1251 gene locus_tag LOCUS_30890 985 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 >Feature sequence380 1008 256 gene locus_tag LOCUS_30900 gene fabG 1008 256 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086690.1 protein_id gnl|my_center|LOCUS_30900 >Feature sequence381 1211 141 gene locus_tag LOCUS_30910 gene ytaP 1211 141 CDS product putative hydrolase YtaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34973 protein_id gnl|my_center|LOCUS_30910