>Feature sequence0001 988 743 gene locus_tag LOCUS_00010 988 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1174 2604 gene locus_tag LOCUS_00020 gene miaB 1174 2604 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULM9 protein_id gnl|my_center|LOCUS_00020 2882 2700 gene locus_tag LOCUS_00030 2882 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2819 3562 gene locus_tag LOCUS_00040 2819 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5366 3903 gene locus_tag LOCUS_00050 5366 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_00050 8416 5372 gene locus_tag LOCUS_00060 8416 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_00060 9645 8608 gene locus_tag LOCUS_00070 9645 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 11384 9867 gene locus_tag LOCUS_00080 11384 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11793 14807 gene locus_tag LOCUS_00090 11793 14807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121404.1 protein_id gnl|my_center|LOCUS_00090 15330 17183 gene locus_tag LOCUS_00100 15330 17183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 17248 17985 gene locus_tag LOCUS_00110 17248 17985 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_00110 17987 19336 gene locus_tag LOCUS_00120 17987 19336 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_00120 19844 19533 gene locus_tag LOCUS_00130 gene rplU 19844 19533 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFG2 protein_id gnl|my_center|LOCUS_00130 >Feature sequence0002 90 1121 gene locus_tag LOCUS_00140 90 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 3092 1125 gene locus_tag LOCUS_00150 3092 1125 CDS product IRE (iron responsive element) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120811.1 protein_id gnl|my_center|LOCUS_00150 5143 3089 gene locus_tag LOCUS_00160 5143 3089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325469.1 protein_id gnl|my_center|LOCUS_00160 6159 5203 gene locus_tag LOCUS_00170 6159 5203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120812.1 protein_id gnl|my_center|LOCUS_00170 6667 8265 gene locus_tag LOCUS_00180 6667 8265 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583125.1 protein_id gnl|my_center|LOCUS_00180 8390 8572 gene locus_tag LOCUS_00190 8390 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 8773 9438 gene locus_tag LOCUS_00200 8773 9438 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331723.1 protein_id gnl|my_center|LOCUS_00200 9559 9834 gene locus_tag LOCUS_00210 9559 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 10394 10182 gene locus_tag LOCUS_00220 10394 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 10624 11613 gene locus_tag LOCUS_00230 gene pfkA 10624 11613 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4C1 protein_id gnl|my_center|LOCUS_00230 12044 13288 gene locus_tag LOCUS_00240 12044 13288 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00240 13991 13353 gene locus_tag LOCUS_00250 gene rpoE 13991 13353 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339513.1 protein_id gnl|my_center|LOCUS_00250 14990 14103 gene locus_tag LOCUS_00260 14990 14103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 >Feature sequence0003 2259 91 gene locus_tag LOCUS_00270 gene flhA 2259 91 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860707.1 protein_id gnl|my_center|LOCUS_00270 3028 2264 gene locus_tag LOCUS_00280 3028 2264 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272500.1 protein_id gnl|my_center|LOCUS_00280 3947 3060 gene locus_tag LOCUS_00290 3947 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 4394 3957 gene locus_tag LOCUS_00300 4394 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 5279 4416 gene locus_tag LOCUS_00310 5279 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 5917 5276 gene locus_tag LOCUS_00320 5917 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 6197 6952 gene locus_tag LOCUS_00330 gene flgF 6197 6952 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW67 protein_id gnl|my_center|LOCUS_00330 6977 7765 gene locus_tag LOCUS_00340 6977 7765 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081929.1 protein_id gnl|my_center|LOCUS_00340 7870 8817 gene locus_tag LOCUS_00350 7870 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 8841 9464 gene locus_tag LOCUS_00360 gene flgH 8841 9464 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PPM0 protein_id gnl|my_center|LOCUS_00360 9466 10689 gene locus_tag LOCUS_00370 gene flgI 9466 10689 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F5 protein_id gnl|my_center|LOCUS_00370 10707 11006 gene locus_tag LOCUS_00380 10707 11006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 11003 11527 gene locus_tag LOCUS_00390 11003 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 11530 13491 gene locus_tag LOCUS_00400 gene flgK 11530 13491 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073124.1 protein_id gnl|my_center|LOCUS_00400 >Feature sequence0004 853 778 gene locus_tag LOCUS_t00010 853 778 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2615 1614 gene locus_tag LOCUS_00410 gene cydB 2615 1614 CDS product cytochrome D oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_00410 4143 2617 gene locus_tag LOCUS_00420 gene cydA 4143 2617 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_00420 4343 5266 gene locus_tag LOCUS_00430 4343 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 5679 5338 gene locus_tag LOCUS_00440 5679 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 7052 5763 gene locus_tag LOCUS_00450 7052 5763 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120510.1 protein_id gnl|my_center|LOCUS_00450 7245 7856 gene locus_tag LOCUS_00460 7245 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 9251 7911 gene locus_tag LOCUS_00470 9251 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 9706 9452 gene locus_tag LOCUS_00480 9706 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 10408 9746 gene locus_tag LOCUS_00490 10408 9746 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_00490 11108 10494 gene locus_tag LOCUS_00500 11108 10494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 12935 11595 gene locus_tag LOCUS_00510 12935 11595 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121707.1 protein_id gnl|my_center|LOCUS_00510 13391 13062 gene locus_tag LOCUS_00520 13391 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 >Feature sequence0005 <1 1087 gene locus_tag LOCUS_00530 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867719.1:DNA topoisomerase VI subunit A 1108 1824 gene locus_tag LOCUS_00540 1108 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 2742 1897 gene locus_tag LOCUS_00550 2742 1897 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868712.1 protein_id gnl|my_center|LOCUS_00550 2817 3227 gene locus_tag LOCUS_00560 2817 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 4092 3289 gene locus_tag LOCUS_00570 4092 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 5352 4474 gene locus_tag LOCUS_00580 gene sucD 5352 4474 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKI2 protein_id gnl|my_center|LOCUS_00580 6615 5419 gene locus_tag LOCUS_00590 gene sucC 6615 5419 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKI3 protein_id gnl|my_center|LOCUS_00590 6756 6908 gene locus_tag LOCUS_00600 6756 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 8586 6958 gene locus_tag LOCUS_00610 8586 6958 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121701.1 protein_id gnl|my_center|LOCUS_00610 11952 8692 gene locus_tag LOCUS_00620 11952 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120285.1 protein_id gnl|my_center|LOCUS_00620 12379 12600 gene locus_tag LOCUS_00630 12379 12600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 >Feature sequence0006 689 1957 gene locus_tag LOCUS_00640 689 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 3248 2064 gene locus_tag LOCUS_00650 3248 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 3342 4517 gene locus_tag LOCUS_00660 3342 4517 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_00660 4642 5814 gene locus_tag LOCUS_00670 4642 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 6082 7200 gene locus_tag LOCUS_00680 gene dnaN 6082 7200 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKK1 protein_id gnl|my_center|LOCUS_00680 7215 7682 gene locus_tag LOCUS_00690 7215 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 7685 10183 gene locus_tag LOCUS_00700 gene gyrB 7685 10183 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM28 protein_id gnl|my_center|LOCUS_00700 10209 10724 gene locus_tag LOCUS_00710 10209 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 >Feature sequence0007 3608 2493 gene locus_tag LOCUS_00720 3608 2493 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_00720 5775 3928 gene locus_tag LOCUS_00730 5775 3928 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225606.1 protein_id gnl|my_center|LOCUS_00730 6059 7087 gene locus_tag LOCUS_00740 6059 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 8613 7129 gene locus_tag LOCUS_00750 8613 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 9449 8703 gene locus_tag LOCUS_00760 9449 8703 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_00760 9880 10230 gene locus_tag LOCUS_00770 9880 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 10489 10244 gene locus_tag LOCUS_00780 10489 10244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 10520 10699 gene locus_tag LOCUS_00790 10520 10699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 11113 11346 gene locus_tag LOCUS_00800 11113 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 >Feature sequence0008 1517 2038 gene locus_tag LOCUS_00810 1517 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 2114 3847 gene locus_tag LOCUS_00820 2114 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 4626 3961 gene locus_tag LOCUS_00830 4626 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105540.1 protein_id gnl|my_center|LOCUS_00830 6079 4742 gene locus_tag LOCUS_00840 gene sasR 6079 4742 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330317.1 protein_id gnl|my_center|LOCUS_00840 6663 6172 gene locus_tag LOCUS_00850 6663 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 7132 6638 gene locus_tag LOCUS_00860 7132 6638 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_00860 8662 7415 gene locus_tag LOCUS_00870 8662 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 9193 8702 gene locus_tag LOCUS_00880 9193 8702 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNQ6 protein_id gnl|my_center|LOCUS_00880 9299 9868 gene locus_tag LOCUS_00890 9299 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 11379 9898 gene locus_tag LOCUS_00900 11379 9898 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_00900 >Feature sequence0009 2911 956 gene locus_tag LOCUS_00910 2911 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 5220 3379 gene locus_tag LOCUS_00920 5220 3379 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I417 protein_id gnl|my_center|LOCUS_00920 6124 5312 gene locus_tag LOCUS_00930 6124 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 7196 6150 gene locus_tag LOCUS_00940 7196 6150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 8415 7216 gene locus_tag LOCUS_00950 8415 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 11099 8505 gene locus_tag LOCUS_00960 11099 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 <11652 11099 gene locus_tag LOCUS_00970 <11652 11099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529857.1:dehydrogenase >Feature sequence0010 2229 2789 gene locus_tag LOCUS_00980 2229 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104398.1 protein_id gnl|my_center|LOCUS_00980 3014 2796 gene locus_tag LOCUS_00990 gene infA 3014 2796 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEY5 protein_id gnl|my_center|LOCUS_00990 4383 3163 gene locus_tag LOCUS_01000 4383 3163 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337844.1 protein_id gnl|my_center|LOCUS_01000 4522 5973 gene locus_tag LOCUS_01010 4522 5973 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_01010 6000 6341 gene locus_tag LOCUS_01020 6000 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 7940 6477 gene locus_tag LOCUS_01030 7940 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 9793 8027 gene locus_tag LOCUS_01040 9793 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 10918 10115 gene locus_tag LOCUS_01050 10918 10115 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121897.1 protein_id gnl|my_center|LOCUS_01050 >Feature sequence0011 638 138 gene locus_tag LOCUS_01060 638 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 1867 863 gene locus_tag LOCUS_01070 1867 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 3894 2011 gene locus_tag LOCUS_01080 3894 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 4504 3899 gene locus_tag LOCUS_01090 4504 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 5544 4888 gene locus_tag LOCUS_01100 5544 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 7181 5766 gene locus_tag LOCUS_01110 7181 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 7731 8357 gene locus_tag LOCUS_01120 gene coaE 7731 8357 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FU2 protein_id gnl|my_center|LOCUS_01120 8463 9935 gene locus_tag LOCUS_01130 gene rho 8463 9935 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGV0 protein_id gnl|my_center|LOCUS_01130 11095 9950 gene locus_tag LOCUS_01140 11095 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 >Feature sequence0012 1 1302 gene locus_tag LOCUS_01150 1 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 1390 2991 gene locus_tag LOCUS_01160 1390 2991 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_01160 3724 3044 gene locus_tag LOCUS_01170 3724 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 6050 3741 gene locus_tag LOCUS_01180 6050 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 7007 6180 gene locus_tag LOCUS_01190 7007 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 7253 7071 gene locus_tag LOCUS_01200 7253 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 7274 7888 gene locus_tag LOCUS_01210 7274 7888 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121178.1 protein_id gnl|my_center|LOCUS_01210 7881 11063 gene locus_tag LOCUS_01220 7881 11063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 >Feature sequence0013 6481 38 gene locus_tag LOCUS_01230 6481 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 6531 6797 gene locus_tag LOCUS_01240 6531 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 6927 9161 gene locus_tag LOCUS_01250 6927 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 9640 9218 gene locus_tag LOCUS_01260 9640 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 10006 9662 gene locus_tag LOCUS_01270 10006 9662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 11002 10115 gene locus_tag LOCUS_01280 11002 10115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 >Feature sequence0014 <1 591 gene locus_tag LOCUS_01290 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZLW7:urocanate hydratase 588 2090 gene locus_tag LOCUS_01300 gene hutH 588 2090 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF87 protein_id gnl|my_center|LOCUS_01300 2406 2206 gene locus_tag LOCUS_01310 2406 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 3549 2458 gene locus_tag LOCUS_01320 3549 2458 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031134.1 protein_id gnl|my_center|LOCUS_01320 5765 3600 gene locus_tag LOCUS_01330 5765 3600 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_01330 6167 7018 gene locus_tag LOCUS_01340 6167 7018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 7079 7738 gene locus_tag LOCUS_01350 7079 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 7774 8838 gene locus_tag LOCUS_01360 7774 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 8901 10229 gene locus_tag LOCUS_01370 8901 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 10674 10480 gene locus_tag LOCUS_01380 10674 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 >Feature sequence0015 714 1442 gene locus_tag LOCUS_01390 714 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 1465 1875 gene locus_tag LOCUS_01400 1465 1875 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_01400 2723 1890 gene locus_tag LOCUS_01410 2723 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 3241 2822 gene locus_tag LOCUS_01420 3241 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 4857 3439 gene locus_tag LOCUS_01430 gene phr 4857 3439 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114697.1 protein_id gnl|my_center|LOCUS_01430 5099 4950 gene locus_tag LOCUS_01440 5099 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 5130 6473 gene locus_tag LOCUS_01450 5130 6473 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877378.1 protein_id gnl|my_center|LOCUS_01450 7252 6494 gene locus_tag LOCUS_01460 gene exoA 7252 6494 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121736.1 protein_id gnl|my_center|LOCUS_01460 8320 7271 gene locus_tag LOCUS_01470 8320 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_01470 9245 8499 gene locus_tag LOCUS_01480 9245 8499 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_01480 9744 10676 gene locus_tag LOCUS_01490 9744 10676 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 protein_id gnl|my_center|LOCUS_01490 10682 10966 gene locus_tag LOCUS_01500 10682 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_01500 >Feature sequence0016 547 305 gene locus_tag LOCUS_01510 547 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 1848 844 gene locus_tag LOCUS_01520 1848 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 2071 1859 gene locus_tag LOCUS_01530 2071 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 2344 3414 gene locus_tag LOCUS_01540 2344 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 5022 3706 gene locus_tag LOCUS_01550 5022 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 8502 5185 gene locus_tag LOCUS_01560 8502 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 9134 8514 gene locus_tag LOCUS_01570 9134 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 9548 9321 gene locus_tag LOCUS_01580 9548 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 9726 10820 gene locus_tag LOCUS_01590 9726 10820 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122612.1 protein_id gnl|my_center|LOCUS_01590 >Feature sequence0017 1963 740 gene locus_tag LOCUS_01600 gene deaD 1963 740 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121346.1 protein_id gnl|my_center|LOCUS_01600 2195 3871 gene locus_tag LOCUS_01610 2195 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121549.1 protein_id gnl|my_center|LOCUS_01610 7351 4061 gene locus_tag LOCUS_01620 7351 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 8913 7561 gene locus_tag LOCUS_01630 8913 7561 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122733.1 protein_id gnl|my_center|LOCUS_01630 9158 10321 gene locus_tag LOCUS_01640 9158 10321 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_01640 10533 10709 gene locus_tag LOCUS_01650 gene rpmG 10533 10709 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMN0 protein_id gnl|my_center|LOCUS_01650 >Feature sequence0018 2848 3231 gene locus_tag LOCUS_01660 gene rpsM 2848 3231 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC7 protein_id gnl|my_center|LOCUS_01660 3335 3715 gene locus_tag LOCUS_01670 gene rpsK 3335 3715 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC6 protein_id gnl|my_center|LOCUS_01670 3833 4822 gene locus_tag LOCUS_01680 gene rpoA 3833 4822 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC5 protein_id gnl|my_center|LOCUS_01680 4936 5610 gene locus_tag LOCUS_01690 gene rplQ 4936 5610 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIC4 protein_id gnl|my_center|LOCUS_01690 5691 6194 gene locus_tag LOCUS_01700 5691 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 6341 6955 gene locus_tag LOCUS_01710 6341 6955 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121675.1 protein_id gnl|my_center|LOCUS_01710 7826 7044 gene locus_tag LOCUS_01720 7826 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 9086 8208 gene locus_tag LOCUS_01730 9086 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence0019 184 1353 gene locus_tag LOCUS_01740 gene devC 184 1353 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121684.1 protein_id gnl|my_center|LOCUS_01740 1381 2544 gene locus_tag LOCUS_01750 1381 2544 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119520.1 protein_id gnl|my_center|LOCUS_01750 2915 5689 gene locus_tag LOCUS_01760 2915 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 5883 6422 gene locus_tag LOCUS_01770 5883 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 7594 6419 gene locus_tag LOCUS_01780 7594 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 7964 7698 gene locus_tag LOCUS_01790 7964 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 9066 7912 gene locus_tag LOCUS_01800 9066 7912 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976168.1 protein_id gnl|my_center|LOCUS_01800 10143 9070 gene locus_tag LOCUS_01810 gene gfo 10143 9070 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119268.1 protein_id gnl|my_center|LOCUS_01810 >Feature sequence0020 <1 540 gene locus_tag LOCUS_01820 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120869.1:bifunctional cbb3-type cytochrome C oxidase subunit I/II 537 710 gene locus_tag LOCUS_01830 537 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 728 1363 gene locus_tag LOCUS_01840 728 1363 CDS product cytochrome CBB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120870.1 protein_id gnl|my_center|LOCUS_01840 1360 2790 gene locus_tag LOCUS_01850 1360 2790 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_01850 2795 3361 gene locus_tag LOCUS_01860 2795 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 3365 4135 gene locus_tag LOCUS_01870 3365 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120872.1 protein_id gnl|my_center|LOCUS_01870 4132 6609 gene locus_tag LOCUS_01880 4132 6609 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120873.1 protein_id gnl|my_center|LOCUS_01880 6606 6800 gene locus_tag LOCUS_01890 6606 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 7180 7524 gene locus_tag LOCUS_01900 7180 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 8193 7651 gene locus_tag LOCUS_01910 8193 7651 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_01910 8802 8224 gene locus_tag LOCUS_01920 8802 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 9747 8821 gene locus_tag LOCUS_01930 9747 8821 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328804.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence0021 928 2151 gene locus_tag LOCUS_01940 928 2151 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337450.1 protein_id gnl|my_center|LOCUS_01940 3810 2197 gene locus_tag LOCUS_01950 3810 2197 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 protein_id gnl|my_center|LOCUS_01950 3993 4904 gene locus_tag LOCUS_01960 gene fabD 3993 4904 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY3 protein_id gnl|my_center|LOCUS_01960 5042 5806 gene locus_tag LOCUS_01970 gene fabG 5042 5806 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324898.1 protein_id gnl|my_center|LOCUS_01970 6180 6416 gene locus_tag LOCUS_01980 gene acpP 6180 6416 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY2 protein_id gnl|my_center|LOCUS_01980 6442 7686 gene locus_tag LOCUS_01990 gene fabF 6442 7686 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYY0 protein_id gnl|my_center|LOCUS_01990 7866 8450 gene locus_tag LOCUS_02000 7866 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 8724 9107 gene locus_tag LOCUS_02010 8724 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 9373 10233 gene locus_tag LOCUS_02020 9373 10233 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121261.1 protein_id gnl|my_center|LOCUS_02020 >Feature sequence0022 2 919 gene locus_tag LOCUS_02030 2 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 1717 956 gene locus_tag LOCUS_02040 1717 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 2962 1730 gene locus_tag LOCUS_02050 2962 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 4117 2981 gene locus_tag LOCUS_02060 4117 2981 CDS product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097642.1 protein_id gnl|my_center|LOCUS_02060 5055 4114 gene locus_tag LOCUS_02070 5055 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 5653 5204 gene locus_tag LOCUS_02080 5653 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 5805 6707 gene locus_tag LOCUS_02090 5805 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 6843 7553 gene locus_tag LOCUS_02100 gene aat 6843 7553 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLT7 protein_id gnl|my_center|LOCUS_02100 8658 7648 gene locus_tag LOCUS_02110 8658 7648 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331323.1 protein_id gnl|my_center|LOCUS_02110 8847 9656 gene locus_tag LOCUS_02120 gene queC 8847 9656 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W2G5 protein_id gnl|my_center|LOCUS_02120 >Feature sequence0023 97 855 gene locus_tag LOCUS_02130 97 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 881 1072 gene locus_tag LOCUS_02140 881 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 1084 2007 gene locus_tag LOCUS_02150 1084 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 2026 3792 gene locus_tag LOCUS_02160 2026 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 3843 4805 gene locus_tag LOCUS_02170 3843 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 4771 4947 gene locus_tag LOCUS_02180 4771 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 4944 5915 gene locus_tag LOCUS_02190 4944 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 6067 6780 gene locus_tag LOCUS_02200 6067 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 6804 8675 gene locus_tag LOCUS_02210 6804 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 8683 9525 gene locus_tag LOCUS_02220 8683 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 >Feature sequence0024 3622 2822 gene locus_tag LOCUS_02230 3622 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 3732 4433 gene locus_tag LOCUS_02240 3732 4433 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975741.1 protein_id gnl|my_center|LOCUS_02240 4446 4964 gene locus_tag LOCUS_02250 4446 4964 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061548.1 protein_id gnl|my_center|LOCUS_02250 5058 5528 gene locus_tag LOCUS_02260 gene mscL 5058 5528 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749E9 protein_id gnl|my_center|LOCUS_02260 7770 5578 gene locus_tag LOCUS_02270 7770 5578 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122235.1 protein_id gnl|my_center|LOCUS_02270 7944 9914 gene locus_tag LOCUS_02280 7944 9914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence0025 <1 503 gene locus_tag LOCUS_02290 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788731.1:phosphate starvation protein PhoH 540 749 gene locus_tag LOCUS_02300 540 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 2116 1031 gene locus_tag LOCUS_02310 2116 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 3609 2341 gene locus_tag LOCUS_02320 3609 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 4510 3620 gene locus_tag LOCUS_02330 4510 3620 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329752.1 protein_id gnl|my_center|LOCUS_02330 4605 5339 gene locus_tag LOCUS_02340 gene bioD 4605 5339 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URG0 protein_id gnl|my_center|LOCUS_02340 5306 5602 gene locus_tag LOCUS_02350 5306 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 5651 5917 gene locus_tag LOCUS_02360 5651 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 6961 5990 gene locus_tag LOCUS_02370 gene fmt 6961 5990 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHZ6 protein_id gnl|my_center|LOCUS_02370 7548 6955 gene locus_tag LOCUS_02380 gene def 7548 6955 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHZ5 protein_id gnl|my_center|LOCUS_02380 7781 8053 gene locus_tag LOCUS_02390 7781 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 8482 9363 gene locus_tag LOCUS_02400 8482 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 >Feature sequence0026 2514 2849 gene locus_tag LOCUS_02410 2514 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 3479 2934 gene locus_tag LOCUS_02420 3479 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 3655 4218 gene locus_tag LOCUS_02430 3655 4218 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895191.1 protein_id gnl|my_center|LOCUS_02430 4252 4545 gene locus_tag LOCUS_02440 4252 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333356.1 protein_id gnl|my_center|LOCUS_02440 4594 4995 gene locus_tag LOCUS_02450 4594 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 5167 6186 gene locus_tag LOCUS_02460 5167 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 6213 7265 gene locus_tag LOCUS_02470 6213 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 >Feature sequence0027 126 2342 gene locus_tag LOCUS_02480 126 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 2351 3031 gene locus_tag LOCUS_02490 2351 3031 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_02490 4051 3164 gene locus_tag LOCUS_02500 4051 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 4522 6303 gene locus_tag LOCUS_02510 4522 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 7165 6377 gene locus_tag LOCUS_02520 7165 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 <9895 7274 gene locus_tag LOCUS_02530 <9895 7274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259099.1:glutamate synthase >Feature sequence0028 421 1350 gene locus_tag LOCUS_02540 gene ubiA 421 1350 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 protein_id gnl|my_center|LOCUS_02540 1371 2525 gene locus_tag LOCUS_02550 gene mqnE 1371 2525 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA9 protein_id gnl|my_center|LOCUS_02550 4052 2769 gene locus_tag LOCUS_02560 4052 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_02560 4509 4739 gene locus_tag LOCUS_02570 4509 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 6415 4826 gene locus_tag LOCUS_02580 gene gspE 6415 4826 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940996.1 protein_id gnl|my_center|LOCUS_02580 8928 6490 gene locus_tag LOCUS_02590 8928 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 >Feature sequence0029 3174 2116 gene locus_tag LOCUS_02600 gene tal 3174 2116 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUN2 protein_id gnl|my_center|LOCUS_02600 5307 3268 gene locus_tag LOCUS_02610 gene speA 5307 3268 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTS2 protein_id gnl|my_center|LOCUS_02610 5441 5983 gene locus_tag LOCUS_02620 5441 5983 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119001.1 protein_id gnl|my_center|LOCUS_02620 7412 6192 gene locus_tag LOCUS_02630 7412 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 8800 7448 gene locus_tag LOCUS_02640 8800 7448 CDS product MATE efflux family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_02640 >Feature sequence0030 3646 2222 gene locus_tag LOCUS_02650 3646 2222 CDS product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199123.1 protein_id gnl|my_center|LOCUS_02650 4914 3646 gene locus_tag LOCUS_02660 gene phnA 4914 3646 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040446.1 protein_id gnl|my_center|LOCUS_02660 5040 9149 gene locus_tag LOCUS_02670 5040 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 >Feature sequence0031 1914 2576 gene locus_tag LOCUS_02680 gene cmk 1914 2576 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEW6 protein_id gnl|my_center|LOCUS_02680 2573 3295 gene locus_tag LOCUS_02690 2573 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 3424 4008 gene locus_tag LOCUS_02700 3424 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 4046 5761 gene locus_tag LOCUS_02710 gene ggtB 4046 5761 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_02710 7740 5755 gene locus_tag LOCUS_02720 gene nadE 7740 5755 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_02720 >Feature sequence0032 1401 367 gene locus_tag LOCUS_02730 1401 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121447.1 protein_id gnl|my_center|LOCUS_02730 1833 1423 gene locus_tag LOCUS_02740 1833 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121445.1 protein_id gnl|my_center|LOCUS_02740 2173 1859 gene locus_tag LOCUS_02750 2173 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2692 3123 gene locus_tag LOCUS_02760 2692 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 4628 3147 gene locus_tag LOCUS_02770 4628 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_02770 5498 4815 gene locus_tag LOCUS_02780 5498 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 7402 5852 gene locus_tag LOCUS_02790 gene rpdD 7402 5852 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF51 protein_id gnl|my_center|LOCUS_02790 8469 9041 gene locus_tag LOCUS_02800 8469 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 >Feature sequence0033 734 405 gene locus_tag LOCUS_02810 734 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 1893 1096 gene locus_tag LOCUS_02820 1893 1096 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667138.1 protein_id gnl|my_center|LOCUS_02820 2554 3669 gene locus_tag LOCUS_02830 2554 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 3725 5269 gene locus_tag LOCUS_02840 3725 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 6531 5389 gene locus_tag LOCUS_02850 6531 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 7121 6648 gene locus_tag LOCUS_02860 7121 6648 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG74 protein_id gnl|my_center|LOCUS_02860 8002 7121 gene locus_tag LOCUS_02870 8002 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121358.1 protein_id gnl|my_center|LOCUS_02870 9091 8024 gene locus_tag LOCUS_02880 gene manC 9091 8024 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence0034 1684 683 gene locus_tag LOCUS_02890 gene xerC 1684 683 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQY6 protein_id gnl|my_center|LOCUS_02890 2059 1745 gene locus_tag LOCUS_02900 2059 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 3468 2299 gene locus_tag LOCUS_02910 3468 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 4729 3578 gene locus_tag LOCUS_02920 4729 3578 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327931.1 protein_id gnl|my_center|LOCUS_02920 5066 6217 gene locus_tag LOCUS_02930 5066 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 7095 6214 gene locus_tag LOCUS_02940 7095 6214 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_02940 7822 7112 gene locus_tag LOCUS_02950 7822 7112 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120235.1 protein_id gnl|my_center|LOCUS_02950 8259 7825 gene locus_tag LOCUS_02960 8259 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 <9389 8278 gene locus_tag LOCUS_02970 <9389 8278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007337168.1:glucose-1-phosphate adenylyltransferase >Feature sequence0035 430 17 gene locus_tag LOCUS_02980 430 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 2650 809 gene locus_tag LOCUS_02990 2650 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 3501 2755 gene locus_tag LOCUS_03000 3501 2755 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_03000 5788 3554 gene locus_tag LOCUS_03010 5788 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 <9387 5954 gene locus_tag LOCUS_03020 <9387 5954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UQV4:chromosome partition protein Smc >Feature sequence0036 1525 629 gene locus_tag LOCUS_03030 1525 629 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963564.1 protein_id gnl|my_center|LOCUS_03030 3754 2546 gene locus_tag LOCUS_03040 3754 2546 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_03040 4240 4073 gene locus_tag LOCUS_03050 4240 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 4240 5454 gene locus_tag LOCUS_03060 4240 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 5609 6973 gene locus_tag LOCUS_03070 5609 6973 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_03070 6994 7494 gene locus_tag LOCUS_03080 gene yjgM 6994 7494 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_03080 8406 7558 gene locus_tag LOCUS_03090 gene folP 8406 7558 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ75 protein_id gnl|my_center|LOCUS_03090 >Feature sequence0037 679 1719 gene locus_tag LOCUS_03100 gene ychF 679 1719 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS65 protein_id gnl|my_center|LOCUS_03100 2404 1769 gene locus_tag LOCUS_03110 gene dfp 2404 1769 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121990.1 protein_id gnl|my_center|LOCUS_03110 3005 2418 gene locus_tag LOCUS_03120 3005 2418 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121238.1 protein_id gnl|my_center|LOCUS_03120 3275 3015 gene locus_tag LOCUS_03130 gene rpoZ 3275 3015 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP93 protein_id gnl|my_center|LOCUS_03130 3898 3260 gene locus_tag LOCUS_03140 gene gmk 3898 3260 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP92 protein_id gnl|my_center|LOCUS_03140 4787 3912 gene locus_tag LOCUS_03150 4787 3912 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121239.1 protein_id gnl|my_center|LOCUS_03150 5498 4842 gene locus_tag LOCUS_03160 5498 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 6373 5606 gene locus_tag LOCUS_03170 gene tpiA 6373 5606 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP89 protein_id gnl|my_center|LOCUS_03170 >Feature sequence0038 429 752 gene locus_tag LOCUS_03180 429 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 3092 1527 gene locus_tag LOCUS_03190 3092 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118208.1 protein_id gnl|my_center|LOCUS_03190 3451 4281 gene locus_tag LOCUS_03200 gene panC 3451 4281 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0G6 protein_id gnl|my_center|LOCUS_03200 4334 5662 gene locus_tag LOCUS_03210 gene lgt 4334 5662 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMF7 protein_id gnl|my_center|LOCUS_03210 6032 6586 gene locus_tag LOCUS_03220 gene sigW 6032 6586 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFL5 protein_id gnl|my_center|LOCUS_03220 >Feature sequence0039 1146 154 gene locus_tag LOCUS_03230 gene prfB 1146 154 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ31 protein_id gnl|my_center|LOCUS_03230 2205 1375 gene locus_tag LOCUS_03240 2205 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 2796 4025 gene locus_tag LOCUS_03250 gene pilT 2796 4025 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_03250 4025 5902 gene locus_tag LOCUS_03260 4025 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 5972 7306 gene locus_tag LOCUS_03270 gene hofB 5972 7306 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326269.1 protein_id gnl|my_center|LOCUS_03270 7317 7973 gene locus_tag LOCUS_03280 7317 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 8104 8916 gene locus_tag LOCUS_03290 8104 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 >Feature sequence0040 635 1060 gene locus_tag LOCUS_03300 gene queF 635 1060 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG9 protein_id gnl|my_center|LOCUS_03300 1057 2043 gene locus_tag LOCUS_03310 1057 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118962.1 protein_id gnl|my_center|LOCUS_03310 2074 2829 gene locus_tag LOCUS_03320 2074 2829 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224574.1 protein_id gnl|my_center|LOCUS_03320 <9238 2924 gene locus_tag LOCUS_03330 <9238 2924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082715.1:YSIRK signal domain/LPXTG anchor domain surface protein >Feature sequence0041 1276 800 gene locus_tag LOCUS_03340 1276 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 2590 1277 gene locus_tag LOCUS_03350 2590 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 3745 2600 gene locus_tag LOCUS_03360 3745 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 5173 4037 gene locus_tag LOCUS_03370 gene stf3 5173 4037 CDS product PAPS-dependent sulfotransferase Stf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64964 protein_id gnl|my_center|LOCUS_03370 6317 5181 gene locus_tag LOCUS_03380 6317 5181 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804287.1 protein_id gnl|my_center|LOCUS_03380 7388 6483 gene locus_tag LOCUS_03390 7388 6483 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_03390 7696 7391 gene locus_tag LOCUS_03400 7696 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence0042 941 258 gene locus_tag LOCUS_03410 941 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 1055 2017 gene locus_tag LOCUS_03420 gene cysK1 1055 2017 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WP55 protein_id gnl|my_center|LOCUS_03420 2055 3389 gene locus_tag LOCUS_03430 2055 3389 CDS product cell division control protein 48 CDC48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701100.1 protein_id gnl|my_center|LOCUS_03430 3426 4745 gene locus_tag LOCUS_03440 3426 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 6642 4765 gene locus_tag LOCUS_03450 6642 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 6800 6639 gene locus_tag LOCUS_03460 6800 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 <9102 6936 gene locus_tag LOCUS_03470 <9102 6936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123801.1:alcohol dehydrogenase >Feature sequence0043 5022 1501 gene locus_tag LOCUS_03480 5022 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 6461 5025 gene locus_tag LOCUS_03490 6461 5025 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202170.1 protein_id gnl|my_center|LOCUS_03490 7104 6583 gene locus_tag LOCUS_03500 7104 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 8068 7175 gene locus_tag LOCUS_03510 8068 7175 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence0044 2595 2257 gene locus_tag LOCUS_03520 gene glnB 2595 2257 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119123.1 protein_id gnl|my_center|LOCUS_03520 3259 2708 gene locus_tag LOCUS_03530 3259 2708 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119124.1 protein_id gnl|my_center|LOCUS_03530 3358 3711 gene locus_tag LOCUS_03540 3358 3711 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338041.1 protein_id gnl|my_center|LOCUS_03540 4550 3738 gene locus_tag LOCUS_03550 4550 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 5425 4553 gene locus_tag LOCUS_03560 5425 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 6839 5430 gene locus_tag LOCUS_03570 6839 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 8034 6862 gene locus_tag LOCUS_03580 8034 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 8629 8027 gene locus_tag LOCUS_03590 8629 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 >Feature sequence0045 751 1056 gene locus_tag LOCUS_03600 751 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 1449 1123 gene locus_tag LOCUS_03610 1449 1123 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_03610 2803 1532 gene locus_tag LOCUS_03620 2803 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 2894 3166 gene locus_tag LOCUS_03630 2894 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 4613 3291 gene locus_tag LOCUS_03640 4613 3291 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_03640 5263 4664 gene locus_tag LOCUS_03650 gene cox3 5263 4664 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120015.1 protein_id gnl|my_center|LOCUS_03650 5666 5289 gene locus_tag LOCUS_03660 gene ctaF 5666 5289 CDS product cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123858.1 protein_id gnl|my_center|LOCUS_03660 6969 5731 gene locus_tag LOCUS_03670 gene ctaE 6969 5731 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123857.1 protein_id gnl|my_center|LOCUS_03670 8716 7013 gene locus_tag LOCUS_03680 gene ctaD 8716 7013 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328372.1 protein_id gnl|my_center|LOCUS_03680 >Feature sequence0046 2108 1032 gene locus_tag LOCUS_03690 2108 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2511 2191 gene locus_tag LOCUS_03700 2511 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 3781 2537 gene locus_tag LOCUS_03710 3781 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123852.1 protein_id gnl|my_center|LOCUS_03710 5238 3850 gene locus_tag LOCUS_03720 5238 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123851.1 protein_id gnl|my_center|LOCUS_03720 6709 5303 gene locus_tag LOCUS_03730 6709 5303 CDS product molybdopterin oxidoreductase membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_03730 <8975 6788 gene locus_tag LOCUS_03740 <8975 6788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123849.1:molybdopterin oxidoreductase >Feature sequence0047 289 1737 gene locus_tag LOCUS_03750 gene der 289 1737 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URJ8 protein_id gnl|my_center|LOCUS_03750 2048 3154 gene locus_tag LOCUS_03760 gene ald 2048 3154 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXF1 protein_id gnl|my_center|LOCUS_03760 3229 4293 gene locus_tag LOCUS_03770 gene mtnA 3229 4293 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKL8 protein_id gnl|my_center|LOCUS_03770 6235 4331 gene locus_tag LOCUS_03780 6235 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 6424 8424 gene locus_tag LOCUS_03790 gene argS 6424 8424 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URC7 protein_id gnl|my_center|LOCUS_03790 >Feature sequence0048 2164 254 gene locus_tag LOCUS_03800 2164 254 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122594.1 protein_id gnl|my_center|LOCUS_03800 2323 3237 gene locus_tag LOCUS_03810 2323 3237 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921271.1 protein_id gnl|my_center|LOCUS_03810 3617 3997 gene locus_tag LOCUS_03820 3617 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 3990 5996 gene locus_tag LOCUS_03830 3990 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 >Feature sequence0049 913 545 gene locus_tag LOCUS_03840 gene rplR 913 545 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN04 protein_id gnl|my_center|LOCUS_03840 1542 1006 gene locus_tag LOCUS_03850 gene rplF 1542 1006 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN05 protein_id gnl|my_center|LOCUS_03850 2055 1660 gene locus_tag LOCUS_03860 gene rpsH 2055 1660 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN06 protein_id gnl|my_center|LOCUS_03860 2869 2303 gene locus_tag LOCUS_03870 gene rplE 2869 2303 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN08 protein_id gnl|my_center|LOCUS_03870 3317 2949 gene locus_tag LOCUS_03880 gene rplN 3317 2949 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN10 protein_id gnl|my_center|LOCUS_03880 3755 3453 gene locus_tag LOCUS_03890 3755 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 4080 3850 gene locus_tag LOCUS_03900 gene rpmC 4080 3850 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN12 protein_id gnl|my_center|LOCUS_03900 4659 4243 gene locus_tag LOCUS_03910 gene rplP 4659 4243 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN13 protein_id gnl|my_center|LOCUS_03910 5305 4598 gene locus_tag LOCUS_03920 gene rpsC 5305 4598 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN14 protein_id gnl|my_center|LOCUS_03920 5704 5357 gene locus_tag LOCUS_03930 gene rplV 5704 5357 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN15 protein_id gnl|my_center|LOCUS_03930 5995 5726 gene locus_tag LOCUS_03940 gene rpsS 5995 5726 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN16 protein_id gnl|my_center|LOCUS_03940 6922 6065 gene locus_tag LOCUS_03950 gene rplB 6922 6065 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN17 protein_id gnl|my_center|LOCUS_03950 7403 7059 gene locus_tag LOCUS_03960 gene rplW 7403 7059 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN18 protein_id gnl|my_center|LOCUS_03960 8181 7534 gene locus_tag LOCUS_03970 gene rplD 8181 7534 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN19 protein_id gnl|my_center|LOCUS_03970 >Feature sequence0050 1465 281 gene locus_tag LOCUS_03980 1465 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 2672 1827 gene locus_tag LOCUS_03990 2672 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 2995 4680 gene locus_tag LOCUS_04000 2995 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 4950 5849 gene locus_tag LOCUS_04010 4950 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 7913 5916 gene locus_tag LOCUS_04020 7913 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_04020 <8643 7992 gene locus_tag LOCUS_04030 <8643 7992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120643.1:alcohol dehydrogenase >Feature sequence0051 2887 3426 gene locus_tag LOCUS_04040 2887 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 4278 3706 gene locus_tag LOCUS_04050 4278 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 4548 5405 gene locus_tag LOCUS_04060 4548 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 5405 6190 gene locus_tag LOCUS_04070 gene nei1 5405 6190 CDS product endonuclease 8 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64159 protein_id gnl|my_center|LOCUS_04070 6264 7607 gene locus_tag LOCUS_04080 6264 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_04080 8374 7613 gene locus_tag LOCUS_04090 8374 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence0052 1671 130 gene locus_tag LOCUS_04100 1671 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122704.1 protein_id gnl|my_center|LOCUS_04100 2102 2836 gene locus_tag LOCUS_04110 gene lplA 2102 2836 CDS product lipoate--protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121230.1 protein_id gnl|my_center|LOCUS_04110 4439 2847 gene locus_tag LOCUS_04120 4439 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 5642 4560 gene locus_tag LOCUS_04130 5642 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 6624 5647 gene locus_tag LOCUS_04140 6624 5647 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118508.1 protein_id gnl|my_center|LOCUS_04140 >Feature sequence0053 2316 811 gene locus_tag LOCUS_04150 2316 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 2650 3237 gene locus_tag LOCUS_04160 2650 3237 CDS product RNAse inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962725.1 protein_id gnl|my_center|LOCUS_04160 3450 5783 gene locus_tag LOCUS_04170 3450 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 5883 6455 gene locus_tag LOCUS_04180 5883 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 6540 6995 gene locus_tag LOCUS_04190 6540 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118347.1 protein_id gnl|my_center|LOCUS_04190 7138 7554 gene locus_tag LOCUS_04200 7138 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence0054 829 500 gene locus_tag LOCUS_04210 829 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 2229 901 gene locus_tag LOCUS_04220 2229 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 3697 2222 gene locus_tag LOCUS_04230 3697 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 6975 4030 gene locus_tag LOCUS_04240 6975 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 >Feature sequence0055 1229 840 gene locus_tag LOCUS_04250 1229 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 1904 2500 gene locus_tag LOCUS_04260 1904 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2497 3327 gene locus_tag LOCUS_04270 2497 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 3592 4950 gene locus_tag LOCUS_04280 3592 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 4965 5831 gene locus_tag LOCUS_04290 4965 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 5868 6338 gene locus_tag LOCUS_04300 5868 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 >Feature sequence0056 <1 721 gene locus_tag LOCUS_04310 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121284.1:oxidoreductase 914 2347 gene locus_tag LOCUS_04320 914 2347 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_04320 3172 2477 gene locus_tag LOCUS_04330 3172 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142665.1 protein_id gnl|my_center|LOCUS_04330 3248 5311 gene locus_tag LOCUS_04340 3248 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 5478 5978 gene locus_tag LOCUS_04350 5478 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 6114 7499 gene locus_tag LOCUS_04360 6114 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 <8392 7512 gene locus_tag LOCUS_04370 <8392 7512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7ULJ4:polyphosphate kinase >Feature sequence0057 219 1358 gene locus_tag LOCUS_04380 gene aroC 219 1358 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BL4 protein_id gnl|my_center|LOCUS_04380 1358 2605 gene locus_tag LOCUS_04390 1358 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 6940 2645 gene locus_tag LOCUS_04400 6940 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 8046 6946 gene locus_tag LOCUS_04410 8046 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121934.1 protein_id gnl|my_center|LOCUS_04410 >Feature sequence0058 217 1410 gene locus_tag LOCUS_04420 217 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 1549 2847 gene locus_tag LOCUS_04430 1549 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 2844 3497 gene locus_tag LOCUS_04440 gene nth 2844 3497 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_04440 3887 5740 gene locus_tag LOCUS_04450 3887 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 5754 5966 gene locus_tag LOCUS_04460 5754 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 6004 6423 gene locus_tag LOCUS_04470 6004 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 7265 6405 gene locus_tag LOCUS_04480 7265 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 8222 7329 gene locus_tag LOCUS_04490 8222 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 >Feature sequence0059 1169 2170 gene locus_tag LOCUS_04500 gene argC 1169 2170 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVL4 protein_id gnl|my_center|LOCUS_04500 2257 3471 gene locus_tag LOCUS_04510 gene argJ 2257 3471 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUJ7 protein_id gnl|my_center|LOCUS_04510 3735 4055 gene locus_tag LOCUS_04520 3735 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 4233 7694 gene locus_tag LOCUS_04530 gene ileS 4233 7694 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ2 protein_id gnl|my_center|LOCUS_04530 >Feature sequence0060 2877 469 gene locus_tag LOCUS_04540 gene epsB 2877 469 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118858.1 protein_id gnl|my_center|LOCUS_04540 3325 3504 gene locus_tag LOCUS_04550 3325 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 3449 6070 gene locus_tag LOCUS_04560 gene mutS 3449 6070 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP05 protein_id gnl|my_center|LOCUS_04560 7202 6747 gene locus_tag LOCUS_04570 7202 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence0061 <1 2950 gene locus_tag LOCUS_04580 <1 2950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123029.1:RND transporter 4383 2956 gene locus_tag LOCUS_04590 4383 2956 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_04590 <8134 4395 gene locus_tag LOCUS_04600 <8134 4395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120738.1:cytochrome c >Feature sequence0062 184 3027 gene locus_tag LOCUS_04610 184 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 3634 3086 gene locus_tag LOCUS_04620 3634 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 4902 3820 gene locus_tag LOCUS_04630 4902 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 <8128 5049 gene locus_tag LOCUS_04640 <8128 5049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TJ3:tricorn protease >Feature sequence0063 2142 2270 gene locus_tag LOCUS_04650 2142 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 3274 2384 gene locus_tag LOCUS_04660 3274 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 3543 4481 gene locus_tag LOCUS_04670 gene bcrA 3543 4481 CDS product bacitracin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170849.1 protein_id gnl|my_center|LOCUS_04670 4478 5587 gene locus_tag LOCUS_04680 4478 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 5901 5716 gene locus_tag LOCUS_04690 5901 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 6001 7410 gene locus_tag LOCUS_04700 gene amtB 6001 7410 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYZ3 protein_id gnl|my_center|LOCUS_04700 <8122 7487 gene locus_tag LOCUS_04710 <8122 7487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957884.1:2-methylcitrate dehydratase >Feature sequence0064 812 1138 gene locus_tag LOCUS_04720 812 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 2249 1179 gene locus_tag LOCUS_04730 2249 1179 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXK8 protein_id gnl|my_center|LOCUS_04730 2393 2884 gene locus_tag LOCUS_04740 2393 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 2932 3210 gene locus_tag LOCUS_04750 2932 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 3265 4398 gene locus_tag LOCUS_04760 3265 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109596.1 protein_id gnl|my_center|LOCUS_04760 4398 4829 gene locus_tag LOCUS_04770 4398 4829 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325564.1 protein_id gnl|my_center|LOCUS_04770 5871 4792 gene locus_tag LOCUS_04780 5871 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 5815 5970 gene locus_tag LOCUS_04790 5815 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 7049 6147 gene locus_tag LOCUS_04800 gene uppP 7049 6147 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNQ8 protein_id gnl|my_center|LOCUS_04800 >Feature sequence0065 842 1837 gene locus_tag LOCUS_04810 gene dys1 842 1837 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118343.1 protein_id gnl|my_center|LOCUS_04810 3169 2348 gene locus_tag LOCUS_04820 3169 2348 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970849.1 protein_id gnl|my_center|LOCUS_04820 5215 3329 gene locus_tag LOCUS_04830 5215 3329 CDS product 4-hydroxybenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117803.1 protein_id gnl|my_center|LOCUS_04830 5388 6839 gene locus_tag LOCUS_04840 gene pepA 5388 6839 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ62 protein_id gnl|my_center|LOCUS_04840 7937 7197 gene locus_tag LOCUS_04850 7937 7197 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938841.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence0066 670 1320 gene locus_tag LOCUS_04860 670 1320 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333247.1 protein_id gnl|my_center|LOCUS_04860 2298 1480 gene locus_tag LOCUS_04870 2298 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 2582 4570 gene locus_tag LOCUS_04880 2582 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 5997 5176 gene locus_tag LOCUS_04890 5997 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 7227 6367 gene locus_tag LOCUS_04900 7227 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 8027 7545 gene locus_tag LOCUS_04910 gene hpt 8027 7545 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327769.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence0067 1808 3199 gene locus_tag LOCUS_04920 1808 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_04920 4021 3242 gene locus_tag LOCUS_04930 4021 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121303.1 protein_id gnl|my_center|LOCUS_04930 5283 4165 gene locus_tag LOCUS_04940 5283 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 5539 6981 gene locus_tag LOCUS_04950 5539 6981 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120321.1 protein_id gnl|my_center|LOCUS_04950 7293 7036 gene locus_tag LOCUS_04960 7293 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 >Feature sequence0068 429 1100 gene locus_tag LOCUS_04970 429 1100 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121331.1 protein_id gnl|my_center|LOCUS_04970 1748 1176 gene locus_tag LOCUS_04980 1748 1176 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW63 protein_id gnl|my_center|LOCUS_04980 2040 2999 gene locus_tag LOCUS_04990 gene dapA 2040 2999 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385696.1 protein_id gnl|my_center|LOCUS_04990 4579 3053 gene locus_tag LOCUS_05000 4579 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 5007 4576 gene locus_tag LOCUS_05010 5007 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932933.1 protein_id gnl|my_center|LOCUS_05010 5786 5022 gene locus_tag LOCUS_05020 5786 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 6572 7231 gene locus_tag LOCUS_05030 6572 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 7601 7260 gene locus_tag LOCUS_05040 7601 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 >Feature sequence0069 <1 561 gene locus_tag LOCUS_05050 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZK6:Na(+)-translocating NADH-quinone reductase subunit A 571 1947 gene locus_tag LOCUS_05060 gene nqrB 571 1947 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS4 protein_id gnl|my_center|LOCUS_05060 2016 2852 gene locus_tag LOCUS_05070 gene nqrC 2016 2852 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_05070 2855 3478 gene locus_tag LOCUS_05080 gene nqrD 2855 3478 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS2 protein_id gnl|my_center|LOCUS_05080 3482 4084 gene locus_tag LOCUS_05090 gene nqrE 3482 4084 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_05090 4137 5450 gene locus_tag LOCUS_05100 gene nqrF 4137 5450 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_05100 5562 6872 gene locus_tag LOCUS_05110 gene apbE 5562 6872 CDS product thiamine biosynthesis protein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118544.1 protein_id gnl|my_center|LOCUS_05110 >Feature sequence0070 2489 831 gene locus_tag LOCUS_05120 2489 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 4896 2395 gene locus_tag LOCUS_05130 4896 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121404.1 protein_id gnl|my_center|LOCUS_05130 6211 5282 gene locus_tag LOCUS_05140 6211 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 6385 7605 gene locus_tag LOCUS_05150 6385 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_05150 >Feature sequence0071 1856 960 gene locus_tag LOCUS_05160 1856 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 2987 1875 gene locus_tag LOCUS_05170 2987 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 3440 3865 gene locus_tag LOCUS_05180 3440 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3998 4666 gene locus_tag LOCUS_05190 3998 4666 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 protein_id gnl|my_center|LOCUS_05190 5790 4717 gene locus_tag LOCUS_05200 5790 4717 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120909.1 protein_id gnl|my_center|LOCUS_05200 6333 5959 gene locus_tag LOCUS_05210 6333 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 7793 6552 gene locus_tag LOCUS_05220 gene comM 7793 6552 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence0072 <1 542 gene locus_tag LOCUS_05230 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118912.1:oxidoreductase 1650 580 gene locus_tag LOCUS_05240 gene fbp 1650 580 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E887 protein_id gnl|my_center|LOCUS_05240 2377 1733 gene locus_tag LOCUS_05250 2377 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 3516 2374 gene locus_tag LOCUS_05260 3516 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_05260 4460 3513 gene locus_tag LOCUS_05270 4460 3513 CDS product NAD-dependent nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225382.1 protein_id gnl|my_center|LOCUS_05270 5452 4466 gene locus_tag LOCUS_05280 5452 4466 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201260.1 protein_id gnl|my_center|LOCUS_05280 6038 5493 gene locus_tag LOCUS_05290 6038 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence0073 492 73 gene locus_tag LOCUS_05300 492 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 761 2449 gene locus_tag LOCUS_05310 761 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 2508 3755 gene locus_tag LOCUS_05320 2508 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 3809 5143 gene locus_tag LOCUS_05330 3809 5143 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122010.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence0074 1403 360 gene locus_tag LOCUS_05340 1403 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 2736 1639 gene locus_tag LOCUS_05350 gene hpnA 2736 1639 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_05350 3048 3731 gene locus_tag LOCUS_05360 3048 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 3747 4469 gene locus_tag LOCUS_05370 3747 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4499 6259 gene locus_tag LOCUS_05380 4499 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 6448 6882 gene locus_tag LOCUS_05390 6448 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence0075 685 1227 gene locus_tag LOCUS_05400 685 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 1308 2570 gene locus_tag LOCUS_05410 gene lysA 1308 2570 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBH5 protein_id gnl|my_center|LOCUS_05410 3981 2665 gene locus_tag LOCUS_05420 3981 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122547.1 protein_id gnl|my_center|LOCUS_05420 4595 4032 gene locus_tag LOCUS_05430 4595 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05430 6287 4653 gene locus_tag LOCUS_05440 6287 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05440 7307 6537 gene locus_tag LOCUS_05450 7307 6537 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337436.1 protein_id gnl|my_center|LOCUS_05450 >Feature sequence0076 <1 880 gene locus_tag LOCUS_05460 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257729.1:histone deacetylase 1578 901 gene locus_tag LOCUS_05470 1578 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 3818 1629 gene locus_tag LOCUS_05480 3818 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 3982 6081 gene locus_tag LOCUS_05490 3982 6081 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460118.1 protein_id gnl|my_center|LOCUS_05490 <7564 6095 gene locus_tag LOCUS_05500 <7564 6095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546376.1:dolichyl-phosphate-mannose--protein mannosyltransferase >Feature sequence0077 1115 3115 gene locus_tag LOCUS_05510 1115 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120253.1 protein_id gnl|my_center|LOCUS_05510 3112 4494 gene locus_tag LOCUS_05520 3112 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119021.1 protein_id gnl|my_center|LOCUS_05520 >Feature sequence0078 39 4124 gene locus_tag LOCUS_05530 gene rpoC 39 4124 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URW4 protein_id gnl|my_center|LOCUS_05530 4293 4661 gene locus_tag LOCUS_05540 gene rpsL 4293 4661 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN32 protein_id gnl|my_center|LOCUS_05540 4773 5243 gene locus_tag LOCUS_05550 gene rpsG 4773 5243 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN31 protein_id gnl|my_center|LOCUS_05550 >Feature sequence0079 2037 499 gene locus_tag LOCUS_05560 2037 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3050 2844 gene locus_tag LOCUS_05570 3050 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 4443 3298 gene locus_tag LOCUS_05580 4443 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 5399 4689 gene locus_tag LOCUS_05590 5399 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 5786 7120 gene locus_tag LOCUS_05600 5786 7120 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123557.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence0080 185 2086 gene locus_tag LOCUS_05610 185 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 2806 2057 gene locus_tag LOCUS_05620 2806 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2897 5659 gene locus_tag LOCUS_05630 2897 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 6050 5691 gene locus_tag LOCUS_05640 6050 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 6897 5959 gene locus_tag LOCUS_05650 6897 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 6909 7262 gene locus_tag LOCUS_05660 6909 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 >Feature sequence0081 1467 3299 gene locus_tag LOCUS_05670 1467 3299 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121988.1 protein_id gnl|my_center|LOCUS_05670 4360 3419 gene locus_tag LOCUS_05680 4360 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 4933 4472 gene locus_tag LOCUS_05690 4933 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 5559 5008 gene locus_tag LOCUS_05700 5559 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 6873 5620 gene locus_tag LOCUS_05710 6873 5620 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119702.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence0082 2676 1408 gene locus_tag LOCUS_05720 2676 1408 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121878.1 protein_id gnl|my_center|LOCUS_05720 2578 2775 gene locus_tag LOCUS_05730 2578 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3144 2782 gene locus_tag LOCUS_05740 3144 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121877.1 protein_id gnl|my_center|LOCUS_05740 3608 3279 gene locus_tag LOCUS_05750 3608 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705191.1 protein_id gnl|my_center|LOCUS_05750 3723 4793 gene locus_tag LOCUS_05760 3723 4793 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_05760 6358 4865 gene locus_tag LOCUS_05770 6358 4865 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119535.1 protein_id gnl|my_center|LOCUS_05770 6488 6868 gene locus_tag LOCUS_05780 6488 6868 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227750.1 protein_id gnl|my_center|LOCUS_05780 >Feature sequence0083 993 1823 gene locus_tag LOCUS_05790 gene punA 993 1823 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ11 protein_id gnl|my_center|LOCUS_05790 1820 2659 gene locus_tag LOCUS_05800 gene deoD 1820 2659 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE80 protein_id gnl|my_center|LOCUS_05800 2730 3995 gene locus_tag LOCUS_05810 2730 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 4103 4288 gene locus_tag LOCUS_05820 4103 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 6234 4342 gene locus_tag LOCUS_05830 6234 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 6960 6298 gene locus_tag LOCUS_05840 6960 6298 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405389.1 protein_id gnl|my_center|LOCUS_05840 7170 6994 gene locus_tag LOCUS_05850 7170 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence0084 540 1382 gene locus_tag LOCUS_05860 540 1382 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972768.1 protein_id gnl|my_center|LOCUS_05860 1403 2758 gene locus_tag LOCUS_05870 1403 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2755 3573 gene locus_tag LOCUS_05880 2755 3573 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_05880 3570 5189 gene locus_tag LOCUS_05890 3570 5189 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_05890 5313 7088 gene locus_tag LOCUS_05900 gene ask 5313 7088 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence0085 2490 589 gene locus_tag LOCUS_05910 2490 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3830 3102 gene locus_tag LOCUS_05920 3830 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 4432 3911 gene locus_tag LOCUS_05930 4432 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 <7094 4462 gene locus_tag LOCUS_05940 <7094 4462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119956.1:cation transporter >Feature sequence0086 1117 1914 gene locus_tag LOCUS_05950 1117 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 1907 2299 gene locus_tag LOCUS_05960 1907 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3590 3411 gene locus_tag LOCUS_05970 3590 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 4052 5050 gene locus_tag LOCUS_05980 4052 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 5066 5425 gene locus_tag LOCUS_05990 gene ylxG 5066 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23455 protein_id gnl|my_center|LOCUS_05990 >Feature sequence0087 298 2943 gene locus_tag LOCUS_06000 298 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_06000 3036 4394 gene locus_tag LOCUS_06010 3036 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_06010 5128 4682 gene locus_tag LOCUS_06020 5128 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 6117 5290 gene locus_tag LOCUS_06030 6117 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence0088 763 254 gene locus_tag LOCUS_06040 gene ruvC 763 254 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US71 protein_id gnl|my_center|LOCUS_06040 1418 915 gene locus_tag LOCUS_06050 gene ispF 1418 915 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU80 protein_id gnl|my_center|LOCUS_06050 2822 1587 gene locus_tag LOCUS_06060 2822 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3150 4172 gene locus_tag LOCUS_06070 3150 4172 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120248.1 protein_id gnl|my_center|LOCUS_06070 4220 5065 gene locus_tag LOCUS_06080 4220 5065 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120864.1 protein_id gnl|my_center|LOCUS_06080 5169 5915 gene locus_tag LOCUS_06090 5169 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 5955 6266 gene locus_tag LOCUS_06100 5955 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence0089 1488 304 gene locus_tag LOCUS_06110 1488 304 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261129.1 protein_id gnl|my_center|LOCUS_06110 2180 1485 gene locus_tag LOCUS_06120 2180 1485 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669030.1 protein_id gnl|my_center|LOCUS_06120 3297 2209 gene locus_tag LOCUS_06130 3297 2209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809384.1 protein_id gnl|my_center|LOCUS_06130 4256 3294 gene locus_tag LOCUS_06140 4256 3294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_06140 4908 4288 gene locus_tag LOCUS_06150 4908 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 5061 5600 gene locus_tag LOCUS_06160 5061 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 5632 6654 gene locus_tag LOCUS_06170 gene asd 5632 6654 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT63 protein_id gnl|my_center|LOCUS_06170 >Feature sequence0090 1397 120 gene locus_tag LOCUS_06180 1397 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 5033 1716 gene locus_tag LOCUS_06190 5033 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 5545 6792 gene locus_tag LOCUS_06200 5545 6792 CDS product alkylhalidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117886.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence0091 413 1828 gene locus_tag LOCUS_06210 413 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 1988 2596 gene locus_tag LOCUS_06220 gene sodA 1988 2596 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW1 protein_id gnl|my_center|LOCUS_06220 2793 2614 gene locus_tag LOCUS_06230 2793 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2831 3625 gene locus_tag LOCUS_06240 2831 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 4155 3829 gene locus_tag LOCUS_06250 4155 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330016.1 protein_id gnl|my_center|LOCUS_06250 5156 4416 gene locus_tag LOCUS_06260 5156 4416 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015921.1 protein_id gnl|my_center|LOCUS_06260 5287 6057 gene locus_tag LOCUS_06270 gene fabG 5287 6057 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224232.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence0092 196 1467 gene locus_tag LOCUS_06280 196 1467 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258908.1 protein_id gnl|my_center|LOCUS_06280 1464 2255 gene locus_tag LOCUS_06290 gene cobB2 1464 2255 CDS product NAD-dependent protein deacylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E1 protein_id gnl|my_center|LOCUS_06290 2353 3672 gene locus_tag LOCUS_06300 2353 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207893.1 protein_id gnl|my_center|LOCUS_06300 3707 4762 gene locus_tag LOCUS_06310 gene pilT 3707 4762 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880449.1 protein_id gnl|my_center|LOCUS_06310 4874 5512 gene locus_tag LOCUS_06320 4874 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence0093 778 1482 gene locus_tag LOCUS_06330 778 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 2614 2030 gene locus_tag LOCUS_06340 2614 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 3068 2724 gene locus_tag LOCUS_06350 3068 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 4537 3371 gene locus_tag LOCUS_06360 gene purK 4537 3371 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQS2 protein_id gnl|my_center|LOCUS_06360 5037 4534 gene locus_tag LOCUS_06370 gene purE 5037 4534 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CC72 protein_id gnl|my_center|LOCUS_06370 5479 6216 gene locus_tag LOCUS_06380 5479 6216 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704110.1 protein_id gnl|my_center|LOCUS_06380 6409 6768 gene locus_tag LOCUS_06390 6409 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence0094 1100 606 gene locus_tag LOCUS_06400 1100 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 1387 4446 gene locus_tag LOCUS_06410 1387 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 5665 4511 gene locus_tag LOCUS_06420 5665 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962770.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence0095 75 1484 gene locus_tag LOCUS_06430 75 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1648 3102 gene locus_tag LOCUS_06440 1648 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118341.1 protein_id gnl|my_center|LOCUS_06440 4012 3080 gene locus_tag LOCUS_06450 4012 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4223 5479 gene locus_tag LOCUS_06460 4223 5479 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123564.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence0096 1269 2339 gene locus_tag LOCUS_06470 gene moxR 1269 2339 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_06470 2474 3400 gene locus_tag LOCUS_06480 2474 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_06480 3462 5741 gene locus_tag LOCUS_06490 3462 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117947.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence0097 2 1006 gene locus_tag LOCUS_06500 2 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 1943 1152 gene locus_tag LOCUS_06510 1943 1152 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333052.1 protein_id gnl|my_center|LOCUS_06510 2310 2624 gene locus_tag LOCUS_06520 2310 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 3843 2920 gene locus_tag LOCUS_06530 3843 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 5063 4281 gene locus_tag LOCUS_06540 5063 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_06540 6323 5073 gene locus_tag LOCUS_06550 6323 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence0098 <1 520 gene locus_tag LOCUS_06560 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389057.1:formimidoylglutamate deiminase 713 1000 gene locus_tag LOCUS_06570 gene groS 713 1000 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1B0 protein_id gnl|my_center|LOCUS_06570 1332 2498 gene locus_tag LOCUS_06580 1332 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119080.1 protein_id gnl|my_center|LOCUS_06580 2517 3248 gene locus_tag LOCUS_06590 gene cutC 2517 3248 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH5 protein_id gnl|my_center|LOCUS_06590 3368 3715 gene locus_tag LOCUS_06600 gene rplX 3368 3715 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN09 protein_id gnl|my_center|LOCUS_06600 3754 4284 gene locus_tag LOCUS_06610 3754 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 >Feature sequence0099 1836 1192 gene locus_tag LOCUS_06620 1836 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 1891 2493 gene locus_tag LOCUS_06630 gene sigW 1891 2493 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121917.1 protein_id gnl|my_center|LOCUS_06630 2486 4978 gene locus_tag LOCUS_06640 2486 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 5592 5050 gene locus_tag LOCUS_06650 5592 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 6114 5818 gene locus_tag LOCUS_06660 6114 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 6510 6208 gene locus_tag LOCUS_06670 6510 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 6699 6541 gene locus_tag LOCUS_06680 6699 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence0100 <1 1734 gene locus_tag LOCUS_06690 <1 1734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117740.1:peptidase S9 3864 1735 gene locus_tag LOCUS_06700 3864 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence0101 <1 740 gene locus_tag LOCUS_06710 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332037.1:ABC transporter ATP-binding protein 751 1986 gene locus_tag LOCUS_06720 751 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 3385 2003 gene locus_tag LOCUS_06730 gene Pph1 3385 2003 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121826.1 protein_id gnl|my_center|LOCUS_06730 3678 4112 gene locus_tag LOCUS_06740 3678 4112 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122603.1 protein_id gnl|my_center|LOCUS_06740 4215 5402 gene locus_tag LOCUS_06750 4215 5402 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324545.1 protein_id gnl|my_center|LOCUS_06750 >Feature sequence0102 3197 4417 gene locus_tag LOCUS_06760 3197 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 5936 4446 gene locus_tag LOCUS_06770 5936 4446 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_06770 6534 5953 gene locus_tag LOCUS_06780 6534 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 >Feature sequence0103 <1 974 gene locus_tag LOCUS_06790 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118607.1:cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme 1108 2577 gene locus_tag LOCUS_06800 1108 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_06800 2605 3801 gene locus_tag LOCUS_06810 2605 3801 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122159.1 protein_id gnl|my_center|LOCUS_06810 4011 5069 gene locus_tag LOCUS_06820 4011 5069 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQD2 protein_id gnl|my_center|LOCUS_06820 5132 5647 gene locus_tag LOCUS_06830 5132 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 5836 6693 gene locus_tag LOCUS_06840 5836 6693 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence0104 1264 689 gene locus_tag LOCUS_06850 1264 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 1627 1968 gene locus_tag LOCUS_06860 1627 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 3206 1965 gene locus_tag LOCUS_06870 gene glyA 3206 1965 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQN2 protein_id gnl|my_center|LOCUS_06870 5004 3394 gene locus_tag LOCUS_06880 5004 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 5095 6135 gene locus_tag LOCUS_06890 5095 6135 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence0105 1618 2778 gene locus_tag LOCUS_06900 1618 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3524 2955 gene locus_tag LOCUS_06910 3524 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 5253 3748 gene locus_tag LOCUS_06920 5253 3748 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118438.1 protein_id gnl|my_center|LOCUS_06920 <6717 5366 gene locus_tag LOCUS_06930 <6717 5366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117906.1:sulfatase >Feature sequence0106 <1 1806 gene locus_tag LOCUS_06940 <1 1806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123036.1:protein kinase 1819 2292 gene locus_tag LOCUS_06950 1819 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 2653 2327 gene locus_tag LOCUS_06960 2653 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 3268 2660 gene locus_tag LOCUS_06970 3268 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 4721 3312 gene locus_tag LOCUS_06980 4721 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence0107 1887 580 gene locus_tag LOCUS_06990 1887 580 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122564.1 protein_id gnl|my_center|LOCUS_06990 2200 1946 gene locus_tag LOCUS_07000 2200 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 3882 2473 gene locus_tag LOCUS_07010 3882 2473 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_07010 4762 3941 gene locus_tag LOCUS_07020 4762 3941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122565.1 protein_id gnl|my_center|LOCUS_07020 5402 4746 gene locus_tag LOCUS_07030 5402 4746 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329801.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence0108 494 1009 gene locus_tag LOCUS_07040 gene coaD 494 1009 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKG6 protein_id gnl|my_center|LOCUS_07040 2468 1917 gene locus_tag LOCUS_07050 2468 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 2747 3571 gene locus_tag LOCUS_07060 2747 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 3887 3693 gene locus_tag LOCUS_07070 3887 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 4434 4210 gene locus_tag LOCUS_07080 4434 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4544 6406 gene locus_tag LOCUS_07090 4544 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 >Feature sequence0109 1021 1593 gene locus_tag LOCUS_07100 1021 1593 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_07100 2515 1610 gene locus_tag LOCUS_07110 2515 1610 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_07110 2786 3994 gene locus_tag LOCUS_07120 gene tuf 2786 3994 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ0 protein_id gnl|my_center|LOCUS_07120 4297 5535 gene locus_tag LOCUS_07130 4297 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence0110 >Feature sequence0111 204 1694 gene locus_tag LOCUS_07140 gene uxaA 204 1694 CDS product altronate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919362.1 protein_id gnl|my_center|LOCUS_07140 1691 2815 gene locus_tag LOCUS_07150 gene uxaB 1691 2815 CDS product altronate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97L67 protein_id gnl|my_center|LOCUS_07150 2812 3441 gene locus_tag LOCUS_07160 2812 3441 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477517.1 protein_id gnl|my_center|LOCUS_07160 3441 4532 gene locus_tag LOCUS_07170 3441 4532 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_07170 4568 5506 gene locus_tag LOCUS_07180 4568 5506 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117796.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence0112 1939 551 gene locus_tag LOCUS_07190 1939 551 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640003.1 protein_id gnl|my_center|LOCUS_07190 1938 2138 gene locus_tag LOCUS_07200 1938 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 4866 2119 gene locus_tag LOCUS_07210 4866 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 5038 4850 gene locus_tag LOCUS_07220 5038 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 <6577 4966 gene locus_tag LOCUS_07230 <6577 4966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976195.1:sulfatase >Feature sequence0113 1766 4201 gene locus_tag LOCUS_07240 1766 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence0114 709 1719 gene locus_tag LOCUS_07250 gene fba 709 1719 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_867402.2 protein_id gnl|my_center|LOCUS_07250 1811 2929 gene locus_tag LOCUS_07260 gene dgt 1811 2929 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU12 protein_id gnl|my_center|LOCUS_07260 3140 4171 gene locus_tag LOCUS_07270 3140 4171 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330020.1 protein_id gnl|my_center|LOCUS_07270 4779 5765 gene locus_tag LOCUS_07280 4779 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 6115 5774 gene locus_tag LOCUS_07290 6115 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 >Feature sequence0115 957 3302 gene locus_tag LOCUS_07300 957 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 3360 5918 gene locus_tag LOCUS_07310 3360 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence0116 998 30 gene locus_tag LOCUS_07320 998 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 1110 1448 gene locus_tag LOCUS_07330 1110 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328582.1 protein_id gnl|my_center|LOCUS_07330 5835 1516 gene locus_tag LOCUS_07340 5835 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 6279 5866 gene locus_tag LOCUS_07350 6279 5866 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123550.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence0117 628 988 gene locus_tag LOCUS_tm00010 628 988 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2260 944 gene locus_tag LOCUS_07360 2260 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 2557 2264 gene locus_tag LOCUS_07370 2557 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 3231 3506 gene locus_tag LOCUS_07380 3231 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 3490 3879 gene locus_tag LOCUS_07390 3490 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_07390 5745 4921 gene locus_tag LOCUS_07400 5745 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115327.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence0118 1941 793 gene locus_tag LOCUS_07410 1941 793 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 protein_id gnl|my_center|LOCUS_07410 2760 2077 gene locus_tag LOCUS_07420 2760 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 5491 2816 gene locus_tag LOCUS_07430 5491 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence0119 708 935 gene locus_tag LOCUS_07440 708 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327047.1 protein_id gnl|my_center|LOCUS_07440 1146 937 gene locus_tag LOCUS_07450 1146 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2349 1177 gene locus_tag LOCUS_07460 2349 1177 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117901.1 protein_id gnl|my_center|LOCUS_07460 3617 2601 gene locus_tag LOCUS_07470 gene serA 3617 2601 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122566.1 protein_id gnl|my_center|LOCUS_07470 3931 4893 gene locus_tag LOCUS_07480 gene folE2 3931 4893 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT35 protein_id gnl|my_center|LOCUS_07480 5027 5395 gene locus_tag LOCUS_07490 5027 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence0120 2431 1046 gene locus_tag LOCUS_07500 2431 1046 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119957.1 protein_id gnl|my_center|LOCUS_07500 3098 2613 gene locus_tag LOCUS_07510 3098 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 4917 3484 gene locus_tag LOCUS_07520 4917 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 6144 5965 gene locus_tag LOCUS_07530 6144 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 >Feature sequence0121 142 909 gene locus_tag LOCUS_07540 142 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 906 1484 gene locus_tag LOCUS_07550 906 1484 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338439.1 protein_id gnl|my_center|LOCUS_07550 1564 2997 gene locus_tag LOCUS_07560 1564 2997 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_07560 3560 4375 gene locus_tag LOCUS_07570 3560 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 4366 5262 gene locus_tag LOCUS_07580 4366 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 5250 6074 gene locus_tag LOCUS_07590 5250 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946404.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence0122 <1 1824 gene locus_tag LOCUS_07600 <1 1824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URM7:ATP-dependent zinc metalloprotease FtsH 2 3754 1934 gene locus_tag LOCUS_07610 gene ctpA 3754 1934 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119232.1 protein_id gnl|my_center|LOCUS_07610 4266 4571 gene locus_tag LOCUS_07620 4266 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 5066 4671 gene locus_tag LOCUS_07630 5066 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 5281 5601 gene locus_tag LOCUS_07640 5281 5601 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056468.1 protein_id gnl|my_center|LOCUS_07640 5598 6005 gene locus_tag LOCUS_07650 5598 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence0123 633 148 gene locus_tag LOCUS_07660 633 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 1031 630 gene locus_tag LOCUS_07670 1031 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 1167 2567 gene locus_tag LOCUS_07680 1167 2567 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118059.1 protein_id gnl|my_center|LOCUS_07680 2728 3825 gene locus_tag LOCUS_07690 gene lacI 2728 3825 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227073.1 protein_id gnl|my_center|LOCUS_07690 4377 3919 gene locus_tag LOCUS_07700 4377 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706123.1 protein_id gnl|my_center|LOCUS_07700 4573 5550 gene locus_tag LOCUS_07710 4573 5550 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392149.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence0124 919 146 gene locus_tag LOCUS_07720 919 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 1147 1695 gene locus_tag LOCUS_07730 1147 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_07730 2871 1699 gene locus_tag LOCUS_07740 2871 1699 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 protein_id gnl|my_center|LOCUS_07740 3306 3845 gene locus_tag LOCUS_07750 3306 3845 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UV68 protein_id gnl|my_center|LOCUS_07750 3856 4857 gene locus_tag LOCUS_07760 3856 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence0125 556 68 gene locus_tag LOCUS_07770 556 68 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707485.1 protein_id gnl|my_center|LOCUS_07770 752 1153 gene locus_tag LOCUS_07780 752 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 3102 1189 gene locus_tag LOCUS_07790 gene dxs 3102 1189 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWB7 protein_id gnl|my_center|LOCUS_07790 4035 3103 gene locus_tag LOCUS_07800 gene ggpP 4035 3103 CDS product geranylgeranyl pyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118683.1 protein_id gnl|my_center|LOCUS_07800 4688 4359 gene locus_tag LOCUS_07810 4688 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 5952 4696 gene locus_tag LOCUS_07820 gene xseA 5952 4696 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTZ9 protein_id gnl|my_center|LOCUS_07820 >Feature sequence0126 <1 2672 gene locus_tag LOCUS_07830 <1 2672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122155.1:heme-binding protein 2703 3083 gene locus_tag LOCUS_07840 2703 3083 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_07840 5124 3097 gene locus_tag LOCUS_07850 5124 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence0127 3 200 gene locus_tag LOCUS_07860 3 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1171 230 gene locus_tag LOCUS_07870 1171 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 1776 1171 gene locus_tag LOCUS_07880 1776 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 3113 1914 gene locus_tag LOCUS_07890 3113 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 4108 3377 gene locus_tag LOCUS_07900 4108 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 4258 5088 gene locus_tag LOCUS_07910 4258 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence0128 1174 2334 gene locus_tag LOCUS_07920 1174 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 2412 4130 gene locus_tag LOCUS_07930 2412 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 4807 4142 gene locus_tag LOCUS_07940 4807 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4949 5122 gene locus_tag LOCUS_07950 4949 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence0129 128 859 gene locus_tag LOCUS_07960 128 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 2580 1012 gene locus_tag LOCUS_07970 2580 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 3311 2652 gene locus_tag LOCUS_07980 3311 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WM53 protein_id gnl|my_center|LOCUS_07980 4279 3398 gene locus_tag LOCUS_07990 4279 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 5917 4472 gene locus_tag LOCUS_08000 5917 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119562.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence0130 2500 1535 gene locus_tag LOCUS_08010 2500 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324266.1 protein_id gnl|my_center|LOCUS_08010 2848 3705 gene locus_tag LOCUS_08020 2848 3705 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_08020 3807 4850 gene locus_tag LOCUS_08030 3807 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence0131 1322 606 gene locus_tag LOCUS_08040 1322 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 1596 2264 gene locus_tag LOCUS_08050 1596 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 2445 3674 gene locus_tag LOCUS_08060 2445 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 3732 4904 gene locus_tag LOCUS_08070 3732 4904 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731537.1 protein_id gnl|my_center|LOCUS_08070 5051 5731 gene locus_tag LOCUS_08080 5051 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence0132 3182 15 gene locus_tag LOCUS_08090 3182 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_08090 3956 3408 gene locus_tag LOCUS_08100 gene fae 3956 3408 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122249.1 protein_id gnl|my_center|LOCUS_08100 5384 4005 gene locus_tag LOCUS_08110 5384 4005 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119468.1 protein_id gnl|my_center|LOCUS_08110 <6098 5491 gene locus_tag LOCUS_08120 <6098 5491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975712.1:cytochrome P450 hydroxylase >Feature sequence0133 <1 784 gene locus_tag LOCUS_08130 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122373.1:quinone oxidoreductase 1833 874 gene locus_tag LOCUS_08140 1833 874 CDS product aerotolerance regulator BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678753.1 protein_id gnl|my_center|LOCUS_08140 2744 1827 gene locus_tag LOCUS_08150 2744 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263515.1 protein_id gnl|my_center|LOCUS_08150 3592 2741 gene locus_tag LOCUS_08160 3592 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 4452 3592 gene locus_tag LOCUS_08170 4452 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318876.1 protein_id gnl|my_center|LOCUS_08170 5483 4458 gene locus_tag LOCUS_08180 gene moxR 5483 4458 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038330.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence0134 4252 902 gene locus_tag LOCUS_08190 4252 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence0135 365 1657 gene locus_tag LOCUS_08200 365 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2287 4476 gene locus_tag LOCUS_08210 2287 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 4628 5977 gene locus_tag LOCUS_08220 4628 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463782.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence0136 <1 2207 gene locus_tag LOCUS_08230 <1 2207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7US04:DNA helicase 2250 3341 gene locus_tag LOCUS_08240 2250 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 <6082 3367 gene locus_tag LOCUS_08250 <6082 3367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057122.1:two-component hybrid sensor and regulator >Feature sequence0137 895 1095 gene locus_tag LOCUS_08260 895 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1142 2539 gene locus_tag LOCUS_08270 gene argD 1142 2539 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121945.1 protein_id gnl|my_center|LOCUS_08270 2554 3651 gene locus_tag LOCUS_08280 2554 3651 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUT6 protein_id gnl|my_center|LOCUS_08280 3614 5098 gene locus_tag LOCUS_08290 gene astD 3614 5098 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50174 protein_id gnl|my_center|LOCUS_08290 5409 5780 gene locus_tag LOCUS_08300 5409 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence0138 1245 2306 gene locus_tag LOCUS_08310 gene purM 1245 2306 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI59 protein_id gnl|my_center|LOCUS_08310 2434 3498 gene locus_tag LOCUS_08320 2434 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 5945 3534 gene locus_tag LOCUS_08330 5945 3534 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122735.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence0139 581 1111 gene locus_tag LOCUS_08340 581 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1332 2057 gene locus_tag LOCUS_08350 1332 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 2118 3089 gene locus_tag LOCUS_08360 2118 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 3188 3718 gene locus_tag LOCUS_08370 gene apt 3188 3718 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR74 protein_id gnl|my_center|LOCUS_08370 4538 3900 gene locus_tag LOCUS_08380 4538 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 <6013 4636 gene locus_tag LOCUS_08390 <6013 4636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119278.1:sulfate ABC transporter ATP-binding protein >Feature sequence0140 1653 1021 gene locus_tag LOCUS_08400 1653 1021 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_08400 5068 1646 gene locus_tag LOCUS_08410 5068 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence0141 267 1577 gene locus_tag LOCUS_08420 267 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2751 1963 gene locus_tag LOCUS_08430 2751 1963 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121199.1 protein_id gnl|my_center|LOCUS_08430 4310 2751 gene locus_tag LOCUS_08440 gene hflX 4310 2751 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD7 protein_id gnl|my_center|LOCUS_08440 5317 4475 gene locus_tag LOCUS_08450 5317 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 5519 5352 gene locus_tag LOCUS_08460 5519 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence0142 1149 517 gene locus_tag LOCUS_08470 gene cnrH 1149 517 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122499.1 protein_id gnl|my_center|LOCUS_08470 2188 1154 gene locus_tag LOCUS_08480 2188 1154 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_08480 2671 4083 gene locus_tag LOCUS_08490 gene glnA 2671 4083 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74C40 protein_id gnl|my_center|LOCUS_08490 4360 4151 gene locus_tag LOCUS_08500 4360 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 5503 4778 gene locus_tag LOCUS_08510 gene pcxB 5503 4778 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121516.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence0143 1907 162 gene locus_tag LOCUS_08520 1907 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 2638 3321 gene locus_tag LOCUS_08530 2638 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 4929 3343 gene locus_tag LOCUS_08540 4929 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence0144 <1 1305 gene locus_tag LOCUS_08550 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228203.1:phytochrome sensor protein 1295 1744 gene locus_tag LOCUS_08560 gene epsG 1295 1744 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45773 protein_id gnl|my_center|LOCUS_08560 1755 2321 gene locus_tag LOCUS_08570 1755 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2302 2661 gene locus_tag LOCUS_08580 2302 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 2796 3311 gene locus_tag LOCUS_08590 2796 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 3308 4204 gene locus_tag LOCUS_08600 3308 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 4217 4705 gene locus_tag LOCUS_08610 4217 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence0145 <1 544 gene locus_tag LOCUS_08620 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880787.1:alcohol dehydrogenase 706 1614 gene locus_tag LOCUS_08630 gene cheY 706 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328012.1 protein_id gnl|my_center|LOCUS_08630 1989 3497 gene locus_tag LOCUS_08640 1989 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 3673 5334 gene locus_tag LOCUS_08650 3673 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122556.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence0146 3000 88 gene locus_tag LOCUS_08660 3000 88 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_08660 3899 2997 gene locus_tag LOCUS_08670 gene nanA 3899 2997 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92WP0 protein_id gnl|my_center|LOCUS_08670 >Feature sequence0147 <1 544 gene locus_tag LOCUS_08680 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123902.1:type IV fimbrial assembly protein PilB 689 2089 gene locus_tag LOCUS_08690 gene pilC 689 2089 CDS product type II secretion system F domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329380.1 protein_id gnl|my_center|LOCUS_08690 2123 3043 gene locus_tag LOCUS_08700 2123 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3123 3968 gene locus_tag LOCUS_08710 3123 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 3995 5116 gene locus_tag LOCUS_08720 3995 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence0148 143 73 gene locus_tag LOCUS_t00020 143 73 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 830 237 gene locus_tag LOCUS_08730 830 237 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_08730 904 1536 gene locus_tag LOCUS_08740 904 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1746 2942 gene locus_tag LOCUS_08750 1746 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120602.1 protein_id gnl|my_center|LOCUS_08750 2946 4016 gene locus_tag LOCUS_08760 2946 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_08760 4013 5086 gene locus_tag LOCUS_08770 gene ykfB 4013 5086 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121963.1 protein_id gnl|my_center|LOCUS_08770 5150 5497 gene locus_tag LOCUS_08780 5150 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence0149 986 717 gene locus_tag LOCUS_08790 986 717 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_08790 1760 999 gene locus_tag LOCUS_08800 1760 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2194 1757 gene locus_tag LOCUS_08810 2194 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 3498 2182 gene locus_tag LOCUS_08820 3498 2182 CDS product EscN/YscN/HrcN family type III secretion system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_08820 3997 3419 gene locus_tag LOCUS_08830 3997 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 5067 4039 gene locus_tag LOCUS_08840 5067 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 <5845 5070 gene locus_tag LOCUS_08850 <5845 5070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89ES3:flagellar M-ring protein >Feature sequence0150 2055 145 gene locus_tag LOCUS_08860 gene selB 2055 145 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_08860 2775 2239 gene locus_tag LOCUS_08870 2775 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2927 3751 gene locus_tag LOCUS_08880 gene proC 2927 3751 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTG7 protein_id gnl|my_center|LOCUS_08880 3776 4333 gene locus_tag LOCUS_08890 3776 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 4345 4908 gene locus_tag LOCUS_08900 4345 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 5671 4979 gene locus_tag LOCUS_08910 5671 4979 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123031.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence0151 3462 82 gene locus_tag LOCUS_08920 3462 82 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_08920 4136 3708 gene locus_tag LOCUS_08930 4136 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 5730 4231 gene locus_tag LOCUS_08940 5730 4231 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228762.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence0152 2155 1655 gene locus_tag LOCUS_08950 2155 1655 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250949.1 protein_id gnl|my_center|LOCUS_08950 4849 2321 gene locus_tag LOCUS_08960 4849 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence0153 1181 360 gene locus_tag LOCUS_08970 1181 360 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_08970 2047 1178 gene locus_tag LOCUS_08980 2047 1178 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640170.1 protein_id gnl|my_center|LOCUS_08980 2203 3363 gene locus_tag LOCUS_08990 gene htrA 2203 3363 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117839.1 protein_id gnl|my_center|LOCUS_08990 4042 3395 gene locus_tag LOCUS_09000 4042 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 4125 4352 gene locus_tag LOCUS_09010 4125 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 5766 4711 gene locus_tag LOCUS_09020 5766 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118488.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence0154 1 1143 gene locus_tag LOCUS_09030 1 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1532 2950 gene locus_tag LOCUS_09040 1532 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 3030 5531 gene locus_tag LOCUS_09050 3030 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence0155 540 932 gene locus_tag LOCUS_09060 540 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1131 1763 gene locus_tag LOCUS_09070 1131 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 2566 2970 gene locus_tag LOCUS_09080 2566 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 3596 3099 gene locus_tag LOCUS_09090 3596 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 3759 4577 gene locus_tag LOCUS_09100 3759 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 4709 5116 gene locus_tag LOCUS_09110 4709 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence0156 1780 911 gene locus_tag LOCUS_09120 1780 911 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_09120 2098 2571 gene locus_tag LOCUS_09130 2098 2571 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_09130 2716 3717 gene locus_tag LOCUS_09140 2716 3717 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118170.1 protein_id gnl|my_center|LOCUS_09140 3807 3959 gene locus_tag LOCUS_09150 3807 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence0157 <1 903 gene locus_tag LOCUS_09160 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119735.1:zinc-type alcohol dehydrogenase 2234 1038 gene locus_tag LOCUS_09170 2234 1038 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965468.1 protein_id gnl|my_center|LOCUS_09170 2521 2594 gene locus_tag LOCUS_t00030 2521 2594 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4118 2664 gene locus_tag LOCUS_09180 4118 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4454 5431 gene locus_tag LOCUS_09190 4454 5431 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S263 protein_id gnl|my_center|LOCUS_09190 >Feature sequence0158 2895 1342 gene locus_tag LOCUS_09200 2895 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 3214 3657 gene locus_tag LOCUS_09210 3214 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 3772 4890 gene locus_tag LOCUS_09220 3772 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence0159 894 79 gene locus_tag LOCUS_09230 894 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1230 973 gene locus_tag LOCUS_09240 1230 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1365 1832 gene locus_tag LOCUS_09250 1365 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 2030 2299 gene locus_tag LOCUS_09260 2030 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 2426 3217 gene locus_tag LOCUS_09270 2426 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 4202 5236 gene locus_tag LOCUS_09280 4202 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence0160 158 1054 gene locus_tag LOCUS_09290 158 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1051 1845 gene locus_tag LOCUS_09300 1051 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1849 3036 gene locus_tag LOCUS_09310 1849 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 3064 4380 gene locus_tag LOCUS_09320 gene moxR 3064 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119708.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence0161 1622 1308 gene locus_tag LOCUS_09330 1622 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2215 1778 gene locus_tag LOCUS_09340 2215 1778 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119701.1 protein_id gnl|my_center|LOCUS_09340 3028 2675 gene locus_tag LOCUS_09350 3028 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 3844 3164 gene locus_tag LOCUS_09360 3844 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 4103 4855 gene locus_tag LOCUS_09370 4103 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340410.1 protein_id gnl|my_center|LOCUS_09370 <5707 4860 gene locus_tag LOCUS_09380 <5707 4860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120569.1:ribonuclease D >Feature sequence0162 3 419 gene locus_tag LOCUS_09390 3 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2308 434 gene locus_tag LOCUS_09400 2308 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 4106 2460 gene locus_tag LOCUS_09410 gene rne 4106 2460 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328924.1 protein_id gnl|my_center|LOCUS_09410 4915 4604 gene locus_tag LOCUS_09420 gene ptsH 4915 4604 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332233.1 protein_id gnl|my_center|LOCUS_09420 5422 4949 gene locus_tag LOCUS_09430 gene fruA 5422 4949 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence0163 1391 1251 gene locus_tag LOCUS_09440 1391 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2022 1594 gene locus_tag LOCUS_09450 2022 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3324 2125 gene locus_tag LOCUS_09460 3324 2125 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_09460 4086 3640 gene locus_tag LOCUS_09470 4086 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4819 4214 gene locus_tag LOCUS_09480 4819 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 <5688 4994 gene locus_tag LOCUS_09490 <5688 4994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117733.1:alkaline phosphatase >Feature sequence0164 531 1997 gene locus_tag LOCUS_09500 531 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119155.1 protein_id gnl|my_center|LOCUS_09500 3680 2235 gene locus_tag LOCUS_09510 gene phoD 3680 2235 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_09510 <5682 4090 gene locus_tag LOCUS_09520 <5682 4090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118945.1:azurin >Feature sequence0165 1590 526 gene locus_tag LOCUS_09530 1590 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122118.1 protein_id gnl|my_center|LOCUS_09530 4796 1641 gene locus_tag LOCUS_09540 4796 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122117.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence0166 585 1847 gene locus_tag LOCUS_09550 585 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1985 3721 gene locus_tag LOCUS_09560 1985 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3812 5626 gene locus_tag LOCUS_09570 3812 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence0167 <1 1065 gene locus_tag LOCUS_09580 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228598.1:sulfite oxidase 1104 1877 gene locus_tag LOCUS_09590 1104 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2246 1821 gene locus_tag LOCUS_09600 2246 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 <5644 2239 gene locus_tag LOCUS_09610 <5644 2239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975994.1:ATPase >Feature sequence0168 <1 1860 gene locus_tag LOCUS_09620 <1 1860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118422.1:general secretion pathway protein GspD 2020 3030 gene locus_tag LOCUS_09630 2020 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 3443 4084 gene locus_tag LOCUS_09640 gene tolQ 3443 4084 CDS product MotA/TolQ/ExbB proton channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324221.1 protein_id gnl|my_center|LOCUS_09640 4136 4660 gene locus_tag LOCUS_09650 4136 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 4781 5539 gene locus_tag LOCUS_09660 4781 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence0169 1571 1008 gene locus_tag LOCUS_09670 1571 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2160 1561 gene locus_tag LOCUS_09680 2160 1561 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369400.1 protein_id gnl|my_center|LOCUS_09680 3650 2157 gene locus_tag LOCUS_09690 gene pabB 3650 2157 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121081.1 protein_id gnl|my_center|LOCUS_09690 5062 3647 gene locus_tag LOCUS_09700 5062 3647 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118487.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence0170 557 835 gene locus_tag LOCUS_09710 557 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1682 3220 gene locus_tag LOCUS_09720 gene dnaK 1682 3220 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK6 protein_id gnl|my_center|LOCUS_09720 3457 4248 gene locus_tag LOCUS_09730 3457 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 <5608 4586 gene locus_tag LOCUS_09740 <5608 4586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZQH9:N-succinylarginine dihydrolase >Feature sequence0171 987 34 gene locus_tag LOCUS_09750 987 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1165 1734 gene locus_tag LOCUS_09760 1165 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1781 3745 gene locus_tag LOCUS_09770 gene msaB 1781 3745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122293.1 protein_id gnl|my_center|LOCUS_09770 3753 4547 gene locus_tag LOCUS_09780 3753 4547 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118949.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence0172 1040 879 gene locus_tag LOCUS_09790 1040 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1183 2751 gene locus_tag LOCUS_09800 1183 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 3762 3067 gene locus_tag LOCUS_09810 3762 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 4764 3910 gene locus_tag LOCUS_09820 4764 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 5327 4761 gene locus_tag LOCUS_09830 5327 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence0173 1412 2155 gene locus_tag LOCUS_09840 1412 2155 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_09840 2303 3799 gene locus_tag LOCUS_09850 2303 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 <5567 4377 gene locus_tag LOCUS_09860 <5567 4377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJ31:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence0174 431 93 gene locus_tag LOCUS_09870 431 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 843 2231 gene locus_tag LOCUS_09880 843 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119759.1 protein_id gnl|my_center|LOCUS_09880 2785 2567 gene locus_tag LOCUS_09890 2785 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 4036 2984 gene locus_tag LOCUS_09900 4036 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121577.1 protein_id gnl|my_center|LOCUS_09900 4326 4757 gene locus_tag LOCUS_09910 gene fabZ 4326 4757 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence0175 444 1736 gene locus_tag LOCUS_09920 444 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1747 2127 gene locus_tag LOCUS_09930 1747 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 2150 3367 gene locus_tag LOCUS_09940 2150 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 3370 3810 gene locus_tag LOCUS_09950 3370 3810 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326238.1 protein_id gnl|my_center|LOCUS_09950 3814 4080 gene locus_tag LOCUS_09960 3814 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 4523 4062 gene locus_tag LOCUS_09970 4523 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 5414 4539 gene locus_tag LOCUS_09980 5414 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence0176 1058 1243 gene locus_tag LOCUS_09990 1058 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1652 2905 gene locus_tag LOCUS_10000 1652 2905 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123398.1 protein_id gnl|my_center|LOCUS_10000 3440 2952 gene locus_tag LOCUS_10010 3440 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 4869 3499 gene locus_tag LOCUS_10020 4869 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence0177 914 1201 gene locus_tag LOCUS_10030 gene rpmE2-2 914 1201 CDS product 50S ribosomal protein L31 type B 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8K6 protein_id gnl|my_center|LOCUS_10030 2690 1449 gene locus_tag LOCUS_10040 2690 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 2911 3585 gene locus_tag LOCUS_10050 2911 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 4897 3758 gene locus_tag LOCUS_10060 4897 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence0178 287 111 gene locus_tag LOCUS_10070 287 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 3464 897 gene locus_tag LOCUS_10080 3464 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 3858 4370 gene locus_tag LOCUS_10090 3858 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 4706 5092 gene locus_tag LOCUS_10100 4706 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence0179 <1 627 gene locus_tag LOCUS_10110 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923343.1:peptidase M3 4305 718 gene locus_tag LOCUS_10120 4305 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5476 4565 gene locus_tag LOCUS_10130 5476 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence0180 1577 3478 gene locus_tag LOCUS_10140 1577 3478 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119431.1 protein_id gnl|my_center|LOCUS_10140 3599 4456 gene locus_tag LOCUS_10150 3599 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 5253 4534 gene locus_tag LOCUS_10160 gene rph 5253 4534 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URE2 protein_id gnl|my_center|LOCUS_10160 >Feature sequence0181 2020 1553 gene locus_tag LOCUS_10170 2020 1553 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889423.1 protein_id gnl|my_center|LOCUS_10170 2518 2024 gene locus_tag LOCUS_10180 2518 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_10180 3936 2515 gene locus_tag LOCUS_10190 3936 2515 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123146.1 protein_id gnl|my_center|LOCUS_10190 4294 3989 gene locus_tag LOCUS_10200 4294 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 4413 5012 gene locus_tag LOCUS_10210 4413 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence0182 1535 996 gene locus_tag LOCUS_10220 1535 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119352.1 protein_id gnl|my_center|LOCUS_10220 1607 2941 gene locus_tag LOCUS_10230 gene ndh 1607 2941 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_10230 3198 4148 gene locus_tag LOCUS_10240 3198 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 4260 4889 gene locus_tag LOCUS_10250 4260 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence0183 377 1720 gene locus_tag LOCUS_10260 gene accC 377 1720 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_10260 1898 3208 gene locus_tag LOCUS_10270 gene pfkA 1898 3208 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121457.1 protein_id gnl|my_center|LOCUS_10270 3292 3420 gene locus_tag LOCUS_10280 3292 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3417 3980 gene locus_tag LOCUS_10290 3417 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence0184 870 1664 gene locus_tag LOCUS_10300 870 1664 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_10300 1667 4606 gene locus_tag LOCUS_10310 1667 4606 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118284.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence0185 1465 1821 gene locus_tag LOCUS_10320 1465 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 2091 4490 gene locus_tag LOCUS_10330 2091 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 5207 4662 gene locus_tag LOCUS_10340 5207 4662 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTP9 protein_id gnl|my_center|LOCUS_10340 >Feature sequence0186 1725 418 gene locus_tag LOCUS_10350 1725 418 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118373.1 protein_id gnl|my_center|LOCUS_10350 2869 1856 gene locus_tag LOCUS_10360 gene hemH 2869 1856 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFZ7 protein_id gnl|my_center|LOCUS_10360 3109 4539 gene locus_tag LOCUS_10370 gene hemA 3109 4539 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16618 protein_id gnl|my_center|LOCUS_10370 >Feature sequence0187 424 251 gene locus_tag LOCUS_10380 424 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 443 592 gene locus_tag LOCUS_10390 443 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1146 733 gene locus_tag LOCUS_10400 1146 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1441 1998 gene locus_tag LOCUS_10410 1441 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 3256 4110 gene locus_tag LOCUS_10420 3256 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 5095 4652 gene locus_tag LOCUS_10430 5095 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence0188 92 916 gene locus_tag LOCUS_10440 92 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 913 1872 gene locus_tag LOCUS_10450 913 1872 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118600.1 protein_id gnl|my_center|LOCUS_10450 2034 3056 gene locus_tag LOCUS_10460 gene asd 2034 3056 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UL17 protein_id gnl|my_center|LOCUS_10460 3103 3873 gene locus_tag LOCUS_10470 gene truA 3103 3873 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU07 protein_id gnl|my_center|LOCUS_10470 4050 4916 gene locus_tag LOCUS_10480 4050 4916 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121801.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence0189 4838 2232 gene locus_tag LOCUS_10490 4838 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence0190 1172 264 gene locus_tag LOCUS_10500 1172 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1398 2519 gene locus_tag LOCUS_10510 1398 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122219.1 protein_id gnl|my_center|LOCUS_10510 2568 4004 gene locus_tag LOCUS_10520 2568 4004 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122220.1 protein_id gnl|my_center|LOCUS_10520 4082 5200 gene locus_tag LOCUS_10530 4082 5200 CDS product iron alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence0191 485 2044 gene locus_tag LOCUS_10540 485 2044 CDS product spore cortex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121721.1 protein_id gnl|my_center|LOCUS_10540 2769 2062 gene locus_tag LOCUS_10550 2769 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 4693 2819 gene locus_tag LOCUS_10560 gene cstA 4693 2819 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence0192 1428 301 gene locus_tag LOCUS_10570 1428 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1606 2286 gene locus_tag LOCUS_10580 1606 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 protein_id gnl|my_center|LOCUS_10580 3480 2317 gene locus_tag LOCUS_10590 gene ykuE 3480 2317 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121947.1 protein_id gnl|my_center|LOCUS_10590 5226 3484 gene locus_tag LOCUS_10600 5226 3484 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331356.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence0193 974 741 gene locus_tag LOCUS_10610 974 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 910 1212 gene locus_tag LOCUS_10620 910 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1969 2706 gene locus_tag LOCUS_10630 1969 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 3399 4562 gene locus_tag LOCUS_10640 3399 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 5089 5004 gene locus_tag LOCUS_t00040 5089 5004 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0194 806 42 gene locus_tag LOCUS_10650 806 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1837 803 gene locus_tag LOCUS_10660 1837 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 2640 1834 gene locus_tag LOCUS_10670 gene wecG 2640 1834 CDS product UDP-N-acetyl-D-mannosaminuronic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123818.1 protein_id gnl|my_center|LOCUS_10670 3860 2691 gene locus_tag LOCUS_10680 3860 2691 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222487.1 protein_id gnl|my_center|LOCUS_10680 5185 3857 gene locus_tag LOCUS_10690 5185 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence0195 1010 2392 gene locus_tag LOCUS_10700 1010 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 2561 4687 gene locus_tag LOCUS_10710 2561 4687 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_10710 4844 5275 gene locus_tag LOCUS_10720 gene ppiB 4844 5275 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP01 protein_id gnl|my_center|LOCUS_10720 >Feature sequence0196 142 804 gene locus_tag LOCUS_10730 142 804 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263319.1 protein_id gnl|my_center|LOCUS_10730 816 1634 gene locus_tag LOCUS_10740 816 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1631 2602 gene locus_tag LOCUS_10750 1631 2602 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965485.1 protein_id gnl|my_center|LOCUS_10750 2708 3430 gene locus_tag LOCUS_10760 2708 3430 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403380.1 protein_id gnl|my_center|LOCUS_10760 4999 3452 gene locus_tag LOCUS_10770 4999 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence0197 554 342 gene locus_tag LOCUS_10780 554 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1074 766 gene locus_tag LOCUS_10790 1074 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1329 1541 gene locus_tag LOCUS_10800 1329 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 3023 1668 gene locus_tag LOCUS_10810 3023 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 <5328 3081 gene locus_tag LOCUS_10820 <5328 3081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UU96:pyruvate dehydrogenase E1 component >Feature sequence0198 1452 421 gene locus_tag LOCUS_10830 gene ruvB 1452 421 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPG4 protein_id gnl|my_center|LOCUS_10830 1556 2980 gene locus_tag LOCUS_10840 1556 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3071 2922 gene locus_tag LOCUS_10850 3071 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3213 3431 gene locus_tag LOCUS_10860 3213 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3444 4523 gene locus_tag LOCUS_10870 3444 4523 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMF2 protein_id gnl|my_center|LOCUS_10870 5065 4787 gene locus_tag LOCUS_10880 5065 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence0199 2 436 gene locus_tag LOCUS_10890 2 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 662 1444 gene locus_tag LOCUS_10900 662 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 2349 1570 gene locus_tag LOCUS_10910 2349 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4052 2346 gene locus_tag LOCUS_10920 4052 2346 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118026.1 protein_id gnl|my_center|LOCUS_10920 4372 5253 gene locus_tag LOCUS_10930 4372 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence0200 3745 3131 gene locus_tag LOCUS_10940 gene sigE 3745 3131 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123154.1 protein_id gnl|my_center|LOCUS_10940 4857 3904 gene locus_tag LOCUS_10950 4857 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118058.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence0201 <1 521 gene locus_tag LOCUS_10960 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J3V1:UPF0061 protein 1143 655 gene locus_tag LOCUS_10970 1143 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1543 1154 gene locus_tag LOCUS_10980 1543 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 2081 1566 gene locus_tag LOCUS_10990 2081 1566 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_10990 2612 2112 gene locus_tag LOCUS_11000 2612 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 3532 3056 gene locus_tag LOCUS_11010 3532 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 4714 3929 gene locus_tag LOCUS_11020 4714 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence0202 533 1828 gene locus_tag LOCUS_11030 533 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229154.1 protein_id gnl|my_center|LOCUS_11030 3953 1794 gene locus_tag LOCUS_11040 gene pepX1 3953 1794 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence0203 106 1188 gene locus_tag LOCUS_11050 106 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1262 3220 gene locus_tag LOCUS_11060 1262 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3205 4158 gene locus_tag LOCUS_11070 3205 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 4731 4165 gene locus_tag LOCUS_11080 4731 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence0204 581 1168 gene locus_tag LOCUS_11090 gene sigE 581 1168 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123154.1 protein_id gnl|my_center|LOCUS_11090 1210 3747 gene locus_tag LOCUS_11100 1210 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 <5218 3972 gene locus_tag LOCUS_11110 <5218 3972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121299.1:sialate O-acetylesterase >Feature sequence0205 2909 666 gene locus_tag LOCUS_11120 2909 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3280 3894 gene locus_tag LOCUS_11130 gene sigW 3280 3894 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121917.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence0206 1905 1324 gene locus_tag LOCUS_11140 1905 1324 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_11140 2177 2440 gene locus_tag LOCUS_11150 2177 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 2531 3964 gene locus_tag LOCUS_11160 2531 3964 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190901.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence0207 2960 1041 gene locus_tag LOCUS_11170 2960 1041 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121956.1 protein_id gnl|my_center|LOCUS_11170 3201 4436 gene locus_tag LOCUS_11180 3201 4436 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118180.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence0208 1347 835 gene locus_tag LOCUS_11190 1347 835 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942724.1 protein_id gnl|my_center|LOCUS_11190 2489 1365 gene locus_tag LOCUS_11200 gene rfbB 2489 1365 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J0 protein_id gnl|my_center|LOCUS_11200 3878 2505 gene locus_tag LOCUS_11210 3878 2505 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_11210 <5161 3962 gene locus_tag LOCUS_11220 <5161 3962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HC19:alpha-1,4 glucan phosphorylase >Feature sequence0209 1770 769 gene locus_tag LOCUS_11230 1770 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 3089 1809 gene locus_tag LOCUS_11240 3089 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 3339 4385 gene locus_tag LOCUS_11250 3339 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119364.1 protein_id gnl|my_center|LOCUS_11250 5092 4460 gene locus_tag LOCUS_11260 5092 4460 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence0210 3366 2149 gene locus_tag LOCUS_11270 3366 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 3756 5147 gene locus_tag LOCUS_11280 3756 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence0211 32 373 gene locus_tag LOCUS_11290 32 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 485 1147 gene locus_tag LOCUS_11300 485 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1172 1510 gene locus_tag LOCUS_11310 1172 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1742 4540 gene locus_tag LOCUS_11320 1742 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 4721 4509 gene locus_tag LOCUS_11330 4721 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4916 4989 gene locus_tag LOCUS_t00050 4916 4989 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5054 5137 gene locus_tag LOCUS_t00060 5054 5137 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0212 1177 1261 gene locus_tag LOCUS_t00070 1177 1261 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2669 1356 gene locus_tag LOCUS_11340 2669 1356 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_11340 2623 2865 gene locus_tag LOCUS_11350 2623 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 2890 3753 gene locus_tag LOCUS_11360 2890 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 4051 5091 gene locus_tag LOCUS_11370 4051 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121108.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence0213 406 149 gene locus_tag LOCUS_11380 406 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1115 2431 gene locus_tag LOCUS_11390 1115 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 2521 2769 gene locus_tag LOCUS_11400 gene rpmA 2521 2769 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPR5 protein_id gnl|my_center|LOCUS_11400 2985 3986 gene locus_tag LOCUS_11410 gene obg 2985 3986 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH6 protein_id gnl|my_center|LOCUS_11410 3983 4756 gene locus_tag LOCUS_11420 gene coaX 3983 4756 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIJ5 protein_id gnl|my_center|LOCUS_11420 >Feature sequence0214 406 2424 gene locus_tag LOCUS_11430 gene acs 406 2424 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806493.1 protein_id gnl|my_center|LOCUS_11430 2626 3348 gene locus_tag LOCUS_11440 2626 3348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967585.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence0215 373 834 gene locus_tag LOCUS_11450 373 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524062.1 protein_id gnl|my_center|LOCUS_11450 915 1169 gene locus_tag LOCUS_11460 915 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2571 1597 gene locus_tag LOCUS_11470 2571 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 3481 2663 gene locus_tag LOCUS_11480 gene ypuG 3481 2663 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327962.1 protein_id gnl|my_center|LOCUS_11480 4487 4681 gene locus_tag LOCUS_11490 4487 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence0216 1893 3284 gene locus_tag LOCUS_11500 1893 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11500 >Feature sequence0217 <1 1303 gene locus_tag LOCUS_11510 <1 1303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121659.1:sulfatase 1458 3197 gene locus_tag LOCUS_11520 1458 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 3400 4581 gene locus_tag LOCUS_11530 3400 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence0218 <1 758 gene locus_tag LOCUS_11540 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404019.1:aldehyde reductase 970 4212 gene locus_tag LOCUS_11550 970 4212 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_11550 >Feature sequence0219 1761 451 gene locus_tag LOCUS_11560 1761 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120645.1 protein_id gnl|my_center|LOCUS_11560 2825 1836 gene locus_tag LOCUS_11570 2825 1836 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119404.1 protein_id gnl|my_center|LOCUS_11570 3237 4058 gene locus_tag LOCUS_11580 3237 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4805 4239 gene locus_tag LOCUS_11590 4805 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 5044 4823 gene locus_tag LOCUS_11600 5044 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence0220 2156 795 gene locus_tag LOCUS_11610 2156 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 2409 3470 gene locus_tag LOCUS_11620 2409 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 3703 5025 gene locus_tag LOCUS_11630 3703 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence0221 329 979 gene locus_tag LOCUS_11640 329 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1730 1005 gene locus_tag LOCUS_11650 1730 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3148 2183 gene locus_tag LOCUS_11660 3148 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_11660 <5026 3264 gene locus_tag LOCUS_11670 <5026 3264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404296.1:peptidase M14 >Feature sequence0222 656 45 gene locus_tag LOCUS_11680 gene sigE 656 45 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123154.1 protein_id gnl|my_center|LOCUS_11680 834 4256 gene locus_tag LOCUS_11690 834 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence0223 607 236 gene locus_tag LOCUS_11700 607 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_11700 750 1667 gene locus_tag LOCUS_11710 gene pyrF 750 1667 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 protein_id gnl|my_center|LOCUS_11710 1907 2698 gene locus_tag LOCUS_11720 1907 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 3735 2734 gene locus_tag LOCUS_11730 3735 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence0224 57 1013 gene locus_tag LOCUS_11740 57 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1535 1101 gene locus_tag LOCUS_11750 1535 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 2722 1823 gene locus_tag LOCUS_11760 2722 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 3046 3792 gene locus_tag LOCUS_11770 3046 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 4376 3918 gene locus_tag LOCUS_11780 4376 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence0225 1294 125 gene locus_tag LOCUS_11790 1294 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1951 1451 gene locus_tag LOCUS_11800 1951 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 2523 1996 gene locus_tag LOCUS_11810 2523 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 3338 2697 gene locus_tag LOCUS_11820 3338 2697 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence0226 <1 635 gene locus_tag LOCUS_11830 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119982.1:phosphatidate cytidylyltransferase 841 1836 gene locus_tag LOCUS_11840 841 1836 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_11840 1953 4253 gene locus_tag LOCUS_11850 1953 4253 CDS product 7TM receptor with intracellular metal dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330940.1 protein_id gnl|my_center|LOCUS_11850 4207 4689 gene locus_tag LOCUS_11860 4207 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence0227 239 1075 gene locus_tag LOCUS_11870 239 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1020 1934 gene locus_tag LOCUS_11880 1020 1934 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_11880 2480 4618 gene locus_tag LOCUS_11890 2480 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121107.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence0228 2163 1738 gene locus_tag LOCUS_11900 2163 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 <4911 2174 gene locus_tag LOCUS_11910 <4911 2174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UUS6:DNA-directed DNA polymerase >Feature sequence0229 <1 539 gene locus_tag LOCUS_11920 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117991.1:arylsulfatase 585 992 gene locus_tag LOCUS_11930 585 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1209 2669 gene locus_tag LOCUS_11940 1209 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 3256 2732 gene locus_tag LOCUS_11950 3256 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3671 3755 gene locus_tag LOCUS_t00080 3671 3755 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4494 3946 gene locus_tag LOCUS_11960 4494 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence0230 275 1330 gene locus_tag LOCUS_11970 275 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1333 1602 gene locus_tag LOCUS_11980 1333 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1736 2344 gene locus_tag LOCUS_11990 1736 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2344 3048 gene locus_tag LOCUS_12000 2344 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3045 3980 gene locus_tag LOCUS_12010 3045 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 3937 4518 gene locus_tag LOCUS_12020 3937 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 4545 4808 gene locus_tag LOCUS_12030 4545 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence0231 374 1162 gene locus_tag LOCUS_12040 374 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1821 1174 gene locus_tag LOCUS_12050 1821 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3675 1861 gene locus_tag LOCUS_12060 3675 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122727.1 protein_id gnl|my_center|LOCUS_12060 4239 4688 gene locus_tag LOCUS_12070 4239 4688 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337214.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence0232 <1 2640 gene locus_tag LOCUS_12080 <1 2640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259048.1:formate dehydrogenase 2633 3271 gene locus_tag LOCUS_12090 2633 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3360 3974 gene locus_tag LOCUS_12100 gene sigE 3360 3974 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123154.1 protein_id gnl|my_center|LOCUS_12100 >Feature sequence0233 767 570 gene locus_tag LOCUS_12110 767 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12110 1466 804 gene locus_tag LOCUS_12120 1466 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12120 2811 1555 gene locus_tag LOCUS_12130 2811 1555 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119694.1 protein_id gnl|my_center|LOCUS_12130 3812 2886 gene locus_tag LOCUS_12140 gene fabH 3812 2886 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59814 protein_id gnl|my_center|LOCUS_12140 >Feature sequence0234 1623 2246 gene locus_tag LOCUS_12150 1623 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4245 2428 gene locus_tag LOCUS_12160 4245 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence0235 <1 1013 gene locus_tag LOCUS_12170 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UNG8:aminomethyltransferase 1179 1565 gene locus_tag LOCUS_12180 gene gcvH 1179 1565 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNG9 protein_id gnl|my_center|LOCUS_12180 1759 4656 gene locus_tag LOCUS_12190 gene gcvP 1759 4656 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F937 protein_id gnl|my_center|LOCUS_12190 >Feature sequence0236 3077 1032 gene locus_tag LOCUS_12200 gene pheT 3077 1032 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP77 protein_id gnl|my_center|LOCUS_12200 4183 3158 gene locus_tag LOCUS_12210 gene pheS 4183 3158 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP75 protein_id gnl|my_center|LOCUS_12210 4633 4277 gene locus_tag LOCUS_12220 gene rplT 4633 4277 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP74 protein_id gnl|my_center|LOCUS_12220 >Feature sequence0237 <1 616 gene locus_tag LOCUS_12230 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903919.1:cysteine protease 4018 785 gene locus_tag LOCUS_12240 4018 785 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P63 protein_id gnl|my_center|LOCUS_12240 >Feature sequence0238 1128 2240 gene locus_tag LOCUS_12250 gene apbE 1128 2240 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTS4 protein_id gnl|my_center|LOCUS_12250 2237 2677 gene locus_tag LOCUS_12260 2237 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence0239 3447 1870 gene locus_tag LOCUS_12270 gene lysS 3447 1870 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK37 protein_id gnl|my_center|LOCUS_12270 4094 3573 gene locus_tag LOCUS_12280 4094 3573 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence0240 1144 239 gene locus_tag LOCUS_12290 1144 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1633 2559 gene locus_tag LOCUS_12300 1633 2559 CDS product O-acetylserine/cysteine export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_455963.1 protein_id gnl|my_center|LOCUS_12300 2758 3549 gene locus_tag LOCUS_12310 2758 3549 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709386.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence0241 1 867 gene locus_tag LOCUS_12320 1 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1036 2790 gene locus_tag LOCUS_12330 gene cpaC 1036 2790 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120311.1 protein_id gnl|my_center|LOCUS_12330 2875 4071 gene locus_tag LOCUS_12340 gene cpaE 2875 4071 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120312.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence0242 1191 370 gene locus_tag LOCUS_12350 1191 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 3639 1528 gene locus_tag LOCUS_12360 gene thiC 3639 1528 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FE9 protein_id gnl|my_center|LOCUS_12360 >Feature sequence0243 <1 2079 gene locus_tag LOCUS_12370 <1 2079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121514.1:peptidase 2124 2768 gene locus_tag LOCUS_12380 2124 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 3289 2777 gene locus_tag LOCUS_12390 3289 2777 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707283.1 protein_id gnl|my_center|LOCUS_12390 3713 3297 gene locus_tag LOCUS_12400 3713 3297 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707284.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence0244 <1 707 gene locus_tag LOCUS_12410 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140702.1:glycosyl transferase 722 1468 gene locus_tag LOCUS_12420 722 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1852 1478 gene locus_tag LOCUS_12430 1852 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2031 2717 gene locus_tag LOCUS_12440 2031 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2831 4045 gene locus_tag LOCUS_12450 2831 4045 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122113.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence0245 1101 520 gene locus_tag LOCUS_12460 gene cpaA 1101 520 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326626.1 protein_id gnl|my_center|LOCUS_12460 1266 1403 gene locus_tag LOCUS_12470 1266 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1669 1472 gene locus_tag LOCUS_12480 1669 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 3143 2106 gene locus_tag LOCUS_12490 3143 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 4207 3263 gene locus_tag LOCUS_12500 4207 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence0246 1059 535 gene locus_tag LOCUS_12510 1059 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1112 1279 gene locus_tag LOCUS_12520 1112 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1601 2116 gene locus_tag LOCUS_12530 1601 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2774 2277 gene locus_tag LOCUS_12540 2774 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120543.1 protein_id gnl|my_center|LOCUS_12540 3967 2852 gene locus_tag LOCUS_12550 3967 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 4487 3999 gene locus_tag LOCUS_12560 4487 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence0247 3968 357 gene locus_tag LOCUS_12570 3968 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence0248 1769 903 gene locus_tag LOCUS_12580 1769 903 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119020.1 protein_id gnl|my_center|LOCUS_12580 2061 2870 gene locus_tag LOCUS_12590 2061 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2898 3545 gene locus_tag LOCUS_12600 2898 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 <4775 3749 gene locus_tag LOCUS_12610 <4775 3749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URU7:S-adenosylmethionine synthase >Feature sequence0249 57 1088 gene locus_tag LOCUS_12620 57 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_12620 1189 3666 gene locus_tag LOCUS_12630 1189 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099653.1 protein_id gnl|my_center|LOCUS_12630 3666 3980 gene locus_tag LOCUS_12640 3666 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 4652 4008 gene locus_tag LOCUS_12650 4652 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence0250 1947 133 gene locus_tag LOCUS_12660 1947 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2117 2992 gene locus_tag LOCUS_12670 2117 2992 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098706.1 protein_id gnl|my_center|LOCUS_12670 3331 3969 gene locus_tag LOCUS_12680 gene nccH 3331 3969 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121583.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence0251 1142 666 gene locus_tag LOCUS_12690 1142 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1756 1829 gene locus_tag LOCUS_t00090 1756 1829 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1927 2067 gene locus_tag LOCUS_12700 1927 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2170 3744 gene locus_tag LOCUS_12710 gene tig 2170 3744 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URG5 protein_id gnl|my_center|LOCUS_12710 >Feature sequence0252 488 2257 gene locus_tag LOCUS_12720 488 2257 CDS product protein fwdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870682.1 protein_id gnl|my_center|LOCUS_12720 2420 2899 gene locus_tag LOCUS_12730 2420 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence0253 432 1430 gene locus_tag LOCUS_12740 432 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1602 2804 gene locus_tag LOCUS_12750 1602 2804 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405472.1 protein_id gnl|my_center|LOCUS_12750 2832 3923 gene locus_tag LOCUS_12760 2832 3923 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence0254 295 223 gene locus_tag LOCUS_t00100 295 223 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 519 1988 gene locus_tag LOCUS_12770 519 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 2377 1985 gene locus_tag LOCUS_12780 2377 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 2870 2349 gene locus_tag LOCUS_12790 gene folA 2870 2349 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIC8 protein_id gnl|my_center|LOCUS_12790 3675 2881 gene locus_tag LOCUS_12800 gene thyA 3675 2881 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_12800 >Feature sequence0255 323 1372 gene locus_tag LOCUS_12810 323 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938351.1 protein_id gnl|my_center|LOCUS_12810 2148 1624 gene locus_tag LOCUS_12820 2148 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 <4707 3275 gene locus_tag LOCUS_12830 <4707 3275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942791.1:cadmium transporter >Feature sequence0256 332 2008 gene locus_tag LOCUS_12840 332 2008 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167859.1 protein_id gnl|my_center|LOCUS_12840 2005 3954 gene locus_tag LOCUS_12850 2005 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence0257 3428 1728 gene locus_tag LOCUS_12860 3428 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 4166 3477 gene locus_tag LOCUS_12870 4166 3477 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118095.1 protein_id gnl|my_center|LOCUS_12870 4256 4435 gene locus_tag LOCUS_12880 4256 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence0258 962 1576 gene locus_tag LOCUS_12890 962 1576 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_12890 1573 4497 gene locus_tag LOCUS_12900 1573 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence0259 1830 349 gene locus_tag LOCUS_12910 gene opuE 1830 349 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181816.1 protein_id gnl|my_center|LOCUS_12910 4276 2333 gene locus_tag LOCUS_12920 4276 2333 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122938.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence0260 247 1389 gene locus_tag LOCUS_12930 247 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121691.1 protein_id gnl|my_center|LOCUS_12930 1739 2956 gene locus_tag LOCUS_12940 1739 2956 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_12940 3744 3043 gene locus_tag LOCUS_12950 3744 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence0261 1272 772 gene locus_tag LOCUS_12960 1272 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1490 1260 gene locus_tag LOCUS_12970 1490 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1536 3614 gene locus_tag LOCUS_12980 1536 3614 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057589.1 protein_id gnl|my_center|LOCUS_12980 4004 4465 gene locus_tag LOCUS_12990 4004 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence0262 <1 1733 gene locus_tag LOCUS_13000 <1 1733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404763.1:acyl-peptide hydrolase 1922 2047 gene locus_tag LOCUS_13010 1922 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 2080 2715 gene locus_tag LOCUS_13020 2080 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 3375 2848 gene locus_tag LOCUS_13030 gene TPX 3375 2848 CDS product 2-Cys peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326977.1 protein_id gnl|my_center|LOCUS_13030 3807 3550 gene locus_tag LOCUS_13040 3807 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence0263 >Feature sequence0264 <1 744 gene locus_tag LOCUS_13050 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326676.1:sulfatase 845 1354 gene locus_tag LOCUS_13060 845 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1685 1410 gene locus_tag LOCUS_13070 1685 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2049 3281 gene locus_tag LOCUS_13080 2049 3281 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_13080 3393 3830 gene locus_tag LOCUS_13090 3393 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence0265 <1 696 gene locus_tag LOCUS_13100 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001079544.1:cytochrome-c peroxidase 1365 721 gene locus_tag LOCUS_13110 gene pdxH 1365 721 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S544 protein_id gnl|my_center|LOCUS_13110 1877 1386 gene locus_tag LOCUS_13120 1877 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334492.1 protein_id gnl|my_center|LOCUS_13120 2940 2044 gene locus_tag LOCUS_13130 2940 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 <4630 3166 gene locus_tag LOCUS_13140 <4630 3166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117992.1:arylsulfatase >Feature sequence0266 383 457 gene locus_tag LOCUS_t00110 383 457 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 604 759 gene locus_tag LOCUS_13150 604 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 744 1373 gene locus_tag LOCUS_13160 744 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13160 2353 1562 gene locus_tag LOCUS_13170 2353 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 <4624 2350 gene locus_tag LOCUS_13180 <4624 2350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229058.1:type IV secretion protein Rhs >Feature sequence0267 <1 720 gene locus_tag LOCUS_13190 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118555.1:multidrug ABC transporter ATP-binding protein 717 3818 gene locus_tag LOCUS_13200 717 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence0268 714 3863 gene locus_tag LOCUS_13210 714 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence0269 1185 2306 gene locus_tag LOCUS_13220 1185 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2312 2683 gene locus_tag LOCUS_13230 2312 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 2750 3352 gene locus_tag LOCUS_13240 2750 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 4357 3428 gene locus_tag LOCUS_13250 gene nadC 4357 3428 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085327.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence0270 270 2327 gene locus_tag LOCUS_13260 270 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_13260 2684 2340 gene locus_tag LOCUS_13270 2684 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 3754 2675 gene locus_tag LOCUS_13280 3754 2675 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123083.1 protein_id gnl|my_center|LOCUS_13280 3888 4310 gene locus_tag LOCUS_13290 3888 4310 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327586.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence0271 329 2125 gene locus_tag LOCUS_13300 329 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 3773 2184 gene locus_tag LOCUS_13310 3773 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 4141 3983 gene locus_tag LOCUS_13320 4141 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence0272 3497 480 gene locus_tag LOCUS_13330 3497 480 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120962.1 protein_id gnl|my_center|LOCUS_13330 <4596 3578 gene locus_tag LOCUS_13340 <4596 3578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123294.1:ergothioneine biosynthesis protein EgtB >Feature sequence0273 1815 562 gene locus_tag LOCUS_13350 gene ogt 1815 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123009.1 protein_id gnl|my_center|LOCUS_13350 2099 2602 gene locus_tag LOCUS_13360 2099 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 4075 2678 gene locus_tag LOCUS_13370 4075 2678 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229277.1 protein_id gnl|my_center|LOCUS_13370 <4581 4072 gene locus_tag LOCUS_13380 <4581 4072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121781.1:proline dehydrogenase >Feature sequence0274 511 1020 gene locus_tag LOCUS_13390 gene nrfC 511 1020 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 protein_id gnl|my_center|LOCUS_13390 1064 2554 gene locus_tag LOCUS_13400 gene nrfA 1064 2554 CDS product cytochrome c-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJN5 protein_id gnl|my_center|LOCUS_13400 3902 2571 gene locus_tag LOCUS_13410 3902 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 4580 4437 gene locus_tag LOCUS_13420 4580 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence0275 1044 742 gene locus_tag LOCUS_13430 1044 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1472 1044 gene locus_tag LOCUS_13440 1472 1044 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X185 protein_id gnl|my_center|LOCUS_13440 1901 1551 gene locus_tag LOCUS_13450 1901 1551 CDS product flagellar basal-body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_13450 2181 2960 gene locus_tag LOCUS_13460 gene pomA 2181 2960 CDS product flagellar motor protein MotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937943.1 protein_id gnl|my_center|LOCUS_13460 3006 3665 gene locus_tag LOCUS_13470 3006 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3681 4412 gene locus_tag LOCUS_13480 3681 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence0276 <1 576 gene locus_tag LOCUS_13490 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121299.1:sialate O-acetylesterase 956 1546 gene locus_tag LOCUS_13500 956 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1758 1684 gene locus_tag LOCUS_t00120 1758 1684 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2118 2270 gene locus_tag LOCUS_13510 2118 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 3752 2424 gene locus_tag LOCUS_13520 3752 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 <4573 3828 gene locus_tag LOCUS_13530 <4573 3828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNG2:bifunctional uridylyltransferase/uridylyl-removing enzyme >Feature sequence0277 841 2247 gene locus_tag LOCUS_13540 841 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 2326 3009 gene locus_tag LOCUS_13550 gene kdsB 2326 3009 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY2 protein_id gnl|my_center|LOCUS_13550 4036 3002 gene locus_tag LOCUS_13560 4036 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence0278 959 2800 gene locus_tag LOCUS_13570 959 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence0279 928 1428 gene locus_tag LOCUS_13580 928 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1432 2004 gene locus_tag LOCUS_13590 1432 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 2677 2078 gene locus_tag LOCUS_13600 gene mpg 2677 2078 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG12 protein_id gnl|my_center|LOCUS_13600 3073 2891 gene locus_tag LOCUS_13610 3073 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 3158 4543 gene locus_tag LOCUS_13620 3158 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence0280 2032 2982 gene locus_tag LOCUS_13630 2032 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 3049 4053 gene locus_tag LOCUS_13640 gene moxR 3049 4053 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121741.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence0281 <1 2037 gene locus_tag LOCUS_13650 <1 2037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119794.1:ATP-dependent helicase 3833 2091 gene locus_tag LOCUS_13660 3833 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence0282 70 153 gene locus_tag LOCUS_t00130 70 153 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 440 511 gene locus_tag LOCUS_t00140 440 511 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 585 658 gene locus_tag LOCUS_t00150 585 658 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 739 1935 gene locus_tag LOCUS_13670 gene tuf 739 1935 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMZ0 protein_id gnl|my_center|LOCUS_13670 2033 2106 gene locus_tag LOCUS_t00160 2033 2106 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2697 3161 gene locus_tag LOCUS_13680 gene secE 2697 3161 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMY9 protein_id gnl|my_center|LOCUS_13680 3154 4098 gene locus_tag LOCUS_13690 3154 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence0283 560 1111 gene locus_tag LOCUS_13700 560 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1503 2324 gene locus_tag LOCUS_13710 1503 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 2305 2562 gene locus_tag LOCUS_13720 2305 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2959 3939 gene locus_tag LOCUS_13730 gene yeaC 2959 3939 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence0284 699 217 gene locus_tag LOCUS_13740 699 217 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400653.1 protein_id gnl|my_center|LOCUS_13740 1255 701 gene locus_tag LOCUS_13750 1255 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2299 1289 gene locus_tag LOCUS_13760 2299 1289 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121362.1 protein_id gnl|my_center|LOCUS_13760 3678 2410 gene locus_tag LOCUS_13770 3678 2410 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122959.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence0285 446 1813 gene locus_tag LOCUS_13780 446 1813 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118040.1 protein_id gnl|my_center|LOCUS_13780 2514 2717 gene locus_tag LOCUS_13790 2514 2717 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_13790 3862 2843 gene locus_tag LOCUS_13800 3862 2843 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171504.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence0286 2704 2213 gene locus_tag LOCUS_13810 2704 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3425 2745 gene locus_tag LOCUS_13820 3425 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4489 3524 gene locus_tag LOCUS_13830 4489 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence0287 624 550 gene locus_tag LOCUS_t00170 624 550 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1876 1082 gene locus_tag LOCUS_13840 1876 1082 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_13840 2221 2862 gene locus_tag LOCUS_13850 2221 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence0288 <4449 3534 gene locus_tag LOCUS_13860 <4449 3534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120368.1:N-acetylgalactosamine-6-sulfatase >Feature sequence0289 <1 1295 gene locus_tag LOCUS_13870 <1 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UNE3:ribonuclease Y 1311 2159 gene locus_tag LOCUS_13880 1311 2159 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118627.1 protein_id gnl|my_center|LOCUS_13880 2392 2895 gene locus_tag LOCUS_13890 2392 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2938 3594 gene locus_tag LOCUS_13900 2938 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335207.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence0290 <1 1342 gene locus_tag LOCUS_13910 <1 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UUW9:catalase-peroxidase 1481 2878 gene locus_tag LOCUS_13920 gene arsA 1481 2878 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 protein_id gnl|my_center|LOCUS_13920 4103 2889 gene locus_tag LOCUS_13930 4103 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence0291 <1 2718 gene locus_tag LOCUS_13940 <1 2718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120731.1:serine/threonine protein kinase 2965 3429 gene locus_tag LOCUS_13950 2965 3429 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_13950 3922 3575 gene locus_tag LOCUS_13960 3922 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence0292 2884 1049 gene locus_tag LOCUS_13970 2884 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121419.1 protein_id gnl|my_center|LOCUS_13970 3744 2881 gene locus_tag LOCUS_13980 3744 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 <4434 3771 gene locus_tag LOCUS_13990 <4434 3771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582647.1:ATPase >Feature sequence0293 <1 1270 gene locus_tag LOCUS_14000 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UHE1:asparagine--tRNA ligase 1606 1995 gene locus_tag LOCUS_14010 gene crcB 1606 1995 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEF5 protein_id gnl|my_center|LOCUS_14010 2106 2756 gene locus_tag LOCUS_14020 2106 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3460 3128 gene locus_tag LOCUS_14030 gene hup 3460 3128 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329747.1 protein_id gnl|my_center|LOCUS_14030 3860 4375 gene locus_tag LOCUS_14040 gene rpoE 3860 4375 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence0294 1 186 gene locus_tag LOCUS_14050 1 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1131 565 gene locus_tag LOCUS_14060 1131 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1368 3650 gene locus_tag LOCUS_14070 1368 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence0295 893 228 gene locus_tag LOCUS_14080 893 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1056 1406 gene locus_tag LOCUS_14090 1056 1406 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986769.1 protein_id gnl|my_center|LOCUS_14090 1381 2100 gene locus_tag LOCUS_14100 1381 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2097 2786 gene locus_tag LOCUS_14110 2097 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 3766 2783 gene locus_tag LOCUS_14120 3766 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 4407 3865 gene locus_tag LOCUS_14130 4407 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence0296 142 297 gene locus_tag LOCUS_14140 142 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 493 1767 gene locus_tag LOCUS_14150 gene pbrT 493 1767 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122077.1 protein_id gnl|my_center|LOCUS_14150 1781 2614 gene locus_tag LOCUS_14160 1781 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2611 4344 gene locus_tag LOCUS_14170 gene ctaD 2611 4344 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIM0 protein_id gnl|my_center|LOCUS_14170 >Feature sequence0297 342 1295 gene locus_tag LOCUS_14180 gene mdh 342 1295 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNC6 protein_id gnl|my_center|LOCUS_14180 1764 2498 gene locus_tag LOCUS_14190 1764 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2756 3487 gene locus_tag LOCUS_14200 2756 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence0298 257 1552 gene locus_tag LOCUS_14210 257 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1573 3282 gene locus_tag LOCUS_14220 gene degP 1573 3282 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121355.1 protein_id gnl|my_center|LOCUS_14220 3279 4328 gene locus_tag LOCUS_14230 gene degP 3279 4328 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121356.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence0299 1177 2709 gene locus_tag LOCUS_14240 1177 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 <4387 2726 gene locus_tag LOCUS_14250 <4387 2726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UG20:ATP-dependent RNA helicase DeaD >Feature sequence0300 1667 507 gene locus_tag LOCUS_14260 1667 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 2747 1752 gene locus_tag LOCUS_14270 2747 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 2994 4256 gene locus_tag LOCUS_14280 2994 4256 CDS product ceramide glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122407.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence0301 188 985 gene locus_tag LOCUS_14290 188 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1063 2130 gene locus_tag LOCUS_14300 1063 2130 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 protein_id gnl|my_center|LOCUS_14300 <4367 2191 gene locus_tag LOCUS_14310 <4367 2191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119225.1:membrane protein >Feature sequence0302 613 89 gene locus_tag LOCUS_14320 613 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1555 2553 gene locus_tag LOCUS_14330 1555 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388014.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence0303 266 30 gene locus_tag LOCUS_14340 266 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1867 296 gene locus_tag LOCUS_14350 1867 296 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121184.1 protein_id gnl|my_center|LOCUS_14350 2144 3631 gene locus_tag LOCUS_14360 2144 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118687.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence0304 185 1726 gene locus_tag LOCUS_14370 185 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1754 3250 gene locus_tag LOCUS_14380 1754 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3272 3976 gene locus_tag LOCUS_14390 3272 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence0305 1133 105 gene locus_tag LOCUS_14400 1133 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333498.1 protein_id gnl|my_center|LOCUS_14400 1839 1171 gene locus_tag LOCUS_14410 1839 1171 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123703.1 protein_id gnl|my_center|LOCUS_14410 2104 3795 gene locus_tag LOCUS_14420 2104 3795 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123862.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence0306 <1 964 gene locus_tag LOCUS_14430 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117762.1:hemolysin D 906 3191 gene locus_tag LOCUS_14440 906 3191 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117761.1 protein_id gnl|my_center|LOCUS_14440 <4290 3188 gene locus_tag LOCUS_14450 <4290 3188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120592.1:flavoprotein >Feature sequence0307 673 3429 gene locus_tag LOCUS_14460 gene ppc 673 3429 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHN1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence0308 813 178 gene locus_tag LOCUS_14470 813 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 959 3187 gene locus_tag LOCUS_14480 959 3187 CDS product surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence0309 1920 262 gene locus_tag LOCUS_14490 1920 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2085 2840 gene locus_tag LOCUS_14500 2085 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 4069 2915 gene locus_tag LOCUS_14510 4069 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence0310 <4276 2113 gene locus_tag LOCUS_14520 <4276 2113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203328.1:9-O-acetylesterase >Feature sequence0311 1806 439 gene locus_tag LOCUS_14530 1806 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14530 2214 1927 gene locus_tag LOCUS_14540 2214 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 3201 3422 gene locus_tag LOCUS_14550 3201 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 3438 3905 gene locus_tag LOCUS_14560 3438 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence0312 1551 292 gene locus_tag LOCUS_14570 1551 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 4261 1658 gene locus_tag LOCUS_14580 4261 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence0313 3127 1859 gene locus_tag LOCUS_14590 3127 1859 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878430.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence0314 446 1366 gene locus_tag LOCUS_14600 446 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2436 1378 gene locus_tag LOCUS_14610 gene fabH 2436 1378 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG76 protein_id gnl|my_center|LOCUS_14610 <4241 2665 gene locus_tag LOCUS_14620 <4241 2665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000615086.1:cholesterol oxidase >Feature sequence0315 3055 2459 gene locus_tag LOCUS_14630 3055 2459 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528254.1 protein_id gnl|my_center|LOCUS_14630 4221 3547 gene locus_tag LOCUS_14640 4221 3547 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123490.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence0316 1662 2312 gene locus_tag LOCUS_14650 gene rpoE 1662 2312 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6U5 protein_id gnl|my_center|LOCUS_14650 >Feature sequence0317 993 148 gene locus_tag LOCUS_14660 993 148 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_14660 1284 1039 gene locus_tag LOCUS_14670 1284 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 <4228 1504 gene locus_tag LOCUS_14680 <4228 1504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119380.1:general secretion pathway protein >Feature sequence0318 802 1992 gene locus_tag LOCUS_14690 802 1992 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence0319 499 1098 gene locus_tag LOCUS_14700 499 1098 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946014.1 protein_id gnl|my_center|LOCUS_14700 1609 1160 gene locus_tag LOCUS_14710 1609 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2659 1610 gene locus_tag LOCUS_14720 2659 1610 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124007.1 protein_id gnl|my_center|LOCUS_14720 <4217 2884 gene locus_tag LOCUS_14730 <4217 2884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963149.1:peptidase M1 >Feature sequence0320 1525 734 gene locus_tag LOCUS_14740 1525 734 CDS product N,N-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122726.1 protein_id gnl|my_center|LOCUS_14740 3129 1600 gene locus_tag LOCUS_14750 3129 1600 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119613.1 protein_id gnl|my_center|LOCUS_14750 3723 3436 gene locus_tag LOCUS_14760 3723 3436 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329447.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence0321 1181 555 gene locus_tag LOCUS_14770 gene atpH 1181 555 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB8 protein_id gnl|my_center|LOCUS_14770 1762 1208 gene locus_tag LOCUS_14780 gene atpF 1762 1208 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2J0 protein_id gnl|my_center|LOCUS_14780 2149 1799 gene locus_tag LOCUS_14790 2149 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3530 2214 gene locus_tag LOCUS_14800 3530 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 4097 3612 gene locus_tag LOCUS_14810 4097 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence0322 640 1353 gene locus_tag LOCUS_14820 640 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119826.1 protein_id gnl|my_center|LOCUS_14820 1763 3493 gene locus_tag LOCUS_14830 1763 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence0323 879 3098 gene locus_tag LOCUS_14840 879 3098 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_14840 3121 3831 gene locus_tag LOCUS_14850 3121 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653722.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence0324 1498 1022 gene locus_tag LOCUS_14860 1498 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1774 3243 gene locus_tag LOCUS_14870 1774 3243 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121182.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence0325 <1 1409 gene locus_tag LOCUS_14880 <1 1409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118057.1:iduronate-2-sulfatase 2482 1454 gene locus_tag LOCUS_14890 2482 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2646 3500 gene locus_tag LOCUS_14900 2646 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence0326 1005 1997 gene locus_tag LOCUS_14910 1005 1997 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_14910 2029 2823 gene locus_tag LOCUS_14920 gene mhpD 2029 2823 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8Q7 protein_id gnl|my_center|LOCUS_14920 2816 3748 gene locus_tag LOCUS_14930 2816 3748 CDS product acetaldehyde dehydrogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJT8 protein_id gnl|my_center|LOCUS_14930 >Feature sequence0327 379 1581 gene locus_tag LOCUS_14940 379 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1764 2738 gene locus_tag LOCUS_14950 1764 2738 CDS product UDP-glucose 4-epimerase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119533.1 protein_id gnl|my_center|LOCUS_14950 3481 2681 gene locus_tag LOCUS_14960 3481 2681 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence0328 <1 778 gene locus_tag LOCUS_14970 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000546313.1:serine/threonine exchanger SteT 2521 800 gene locus_tag LOCUS_14980 2521 800 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_14980 4118 2592 gene locus_tag LOCUS_14990 4118 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence0329 <1 628 gene locus_tag LOCUS_15000 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UUP0:pseudouridine synthase 1039 848 gene locus_tag LOCUS_15010 1039 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2426 1335 gene locus_tag LOCUS_15020 2426 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123327.1 protein_id gnl|my_center|LOCUS_15020 3150 2914 gene locus_tag LOCUS_15030 3150 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122042.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence0330 1335 424 gene locus_tag LOCUS_15040 1335 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118465.1 protein_id gnl|my_center|LOCUS_15040 2884 1541 gene locus_tag LOCUS_15050 gene sigA 2884 1541 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKM1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence0331 >Feature sequence0332 <1 1126 gene locus_tag LOCUS_15060 <1 1126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UM14:tyrosine--tRNA ligase >Feature sequence0333 1937 2101 gene locus_tag LOCUS_15070 1937 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2724 3737 gene locus_tag LOCUS_15080 2724 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence0334 <1 1197 gene locus_tag LOCUS_15090 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UPN2:glutamate-ammonia-ligase adenylyltransferase 1532 3496 gene locus_tag LOCUS_15100 1532 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence0335 <1 607 gene locus_tag LOCUS_15110 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330748.1:glucosamine-6-phosphate deaminase 1989 646 gene locus_tag LOCUS_15120 1989 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_15120 3538 1982 gene locus_tag LOCUS_15130 3538 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence0336 1117 398 gene locus_tag LOCUS_15140 1117 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1389 1856 gene locus_tag LOCUS_15150 1389 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence0337 118 1512 gene locus_tag LOCUS_15160 118 1512 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_15160 1611 2048 gene locus_tag LOCUS_15170 1611 2048 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_15170 2178 3362 gene locus_tag LOCUS_15180 2178 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 3433 3927 gene locus_tag LOCUS_15190 3433 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence0338 2258 795 gene locus_tag LOCUS_15200 gene glgA 2258 795 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH55 protein_id gnl|my_center|LOCUS_15200 2492 3724 gene locus_tag LOCUS_15210 2492 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101032.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence0339 618 244 gene locus_tag LOCUS_15220 618 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 860 1249 gene locus_tag LOCUS_15230 860 1249 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118054.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence0340 947 1771 gene locus_tag LOCUS_15240 947 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 3035 1836 gene locus_tag LOCUS_15250 gene moeA1 3035 1836 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_15250 3717 3118 gene locus_tag LOCUS_15260 gene trpG 3717 3118 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120844.1 protein_id gnl|my_center|LOCUS_15260 3987 3745 gene locus_tag LOCUS_15270 3987 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence0341 607 1413 gene locus_tag LOCUS_15280 gene kdsB 607 1413 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI86 protein_id gnl|my_center|LOCUS_15280 2152 1460 gene locus_tag LOCUS_15290 2152 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 2644 2174 gene locus_tag LOCUS_15300 2644 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 2845 3666 gene locus_tag LOCUS_15310 gene sdhC 2845 3666 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122817.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence0342 583 1347 gene locus_tag LOCUS_15320 583 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 <4021 1517 gene locus_tag LOCUS_15330 <4021 1517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118605.1:glucose dehydrogenase >Feature sequence0343 520 1902 gene locus_tag LOCUS_15340 520 1902 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119007.1 protein_id gnl|my_center|LOCUS_15340 3877 2207 gene locus_tag LOCUS_15350 gene fhs 3877 2207 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EB3 protein_id gnl|my_center|LOCUS_15350 >Feature sequence0344 <1 600 gene locus_tag LOCUS_15360 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967586.1:permease 605 1837 gene locus_tag LOCUS_15370 605 1837 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_15370 1849 2238 gene locus_tag LOCUS_15380 1849 2238 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861394.1 protein_id gnl|my_center|LOCUS_15380 2411 3007 gene locus_tag LOCUS_15390 gene lexA 2411 3007 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFB0 protein_id gnl|my_center|LOCUS_15390 <4020 3012 gene locus_tag LOCUS_15400 <4020 3012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085105.1:formate dehydrogenase subunit alpha >Feature sequence0345 2726 1932 gene locus_tag LOCUS_15410 gene tagA 2726 1932 CDS product acetyl-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 protein_id gnl|my_center|LOCUS_15410 3011 3934 gene locus_tag LOCUS_15420 3011 3934 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336262.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence0346 1240 443 gene locus_tag LOCUS_15430 1240 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 2140 1460 gene locus_tag LOCUS_15440 2140 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2481 2768 gene locus_tag LOCUS_15450 2481 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2947 3798 gene locus_tag LOCUS_15460 2947 3798 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence0347 <1 583 gene locus_tag LOCUS_15470 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UVJ7:phosphate propanoyltransferase 619 894 gene locus_tag LOCUS_15480 gene eutM 619 894 CDS product ethanolamine utilization protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_15480 927 1196 gene locus_tag LOCUS_15490 927 1196 CDS product microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324357.1 protein_id gnl|my_center|LOCUS_15490 1211 2410 gene locus_tag LOCUS_15500 gene ackA 1211 2410 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVK1 protein_id gnl|my_center|LOCUS_15500 2414 2725 gene locus_tag LOCUS_15510 2414 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence0348 <1 1422 gene locus_tag LOCUS_15520 <1 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122026.1:amino acid ABC transporter permease 1505 2671 gene locus_tag LOCUS_15530 1505 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329769.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence0349 <3977 1560 gene locus_tag LOCUS_15540 <3977 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000897132.1:ATP-dependent Clp protease ATP-binding subunit ClpC >Feature sequence0350 1523 2587 gene locus_tag LOCUS_15550 1523 2587 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728221.1 protein_id gnl|my_center|LOCUS_15550 2644 3294 gene locus_tag LOCUS_15560 gene cysC 2644 3294 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQW3 protein_id gnl|my_center|LOCUS_15560 >Feature sequence0351 1589 570 gene locus_tag LOCUS_15570 gene moxR 1589 570 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120739.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence0352 1934 627 gene locus_tag LOCUS_15580 1934 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence0353 483 2531 gene locus_tag LOCUS_15590 483 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121319.1 protein_id gnl|my_center|LOCUS_15590 3122 2553 gene locus_tag LOCUS_15600 3122 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence0354 <1 1489 gene locus_tag LOCUS_15610 <1 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UJ86:CTP synthase 1552 1986 gene locus_tag LOCUS_15620 1552 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123553.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence0355 <1 1952 gene locus_tag LOCUS_15630 <1 1952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726922.1:polyketide synthase 1949 3589 gene locus_tag LOCUS_15640 1949 3589 CDS product halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039072.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence0356 1939 1622 gene locus_tag LOCUS_15650 1939 1622 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_15650 2049 2423 gene locus_tag LOCUS_15660 gene nasE 2049 2423 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_15660 3422 2469 gene locus_tag LOCUS_15670 3422 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence0357 691 1623 gene locus_tag LOCUS_15680 691 1623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_15680 2112 1756 gene locus_tag LOCUS_15690 2112 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3600 2302 gene locus_tag LOCUS_15700 3600 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121818.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence0358 <3930 360 gene locus_tag LOCUS_15710 <3930 360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URW6:DNA-directed RNA polymerase subunit beta >Feature sequence0359 2070 838 gene locus_tag LOCUS_15720 gene hutI 2070 838 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKJ7 protein_id gnl|my_center|LOCUS_15720 2879 2073 gene locus_tag LOCUS_15730 2879 2073 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389055.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence0360 1641 535 gene locus_tag LOCUS_15740 1641 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1838 1710 gene locus_tag LOCUS_15750 1838 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2854 1835 gene locus_tag LOCUS_15760 2854 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 2926 3609 gene locus_tag LOCUS_15770 gene trpF 2926 3609 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56320 protein_id gnl|my_center|LOCUS_15770 >Feature sequence0361 1323 2420 gene locus_tag LOCUS_15780 1323 2420 CDS product moaA/nifB/pqqE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919207.1 protein_id gnl|my_center|LOCUS_15780 2425 2544 gene locus_tag LOCUS_15790 2425 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence0362 718 410 gene locus_tag LOCUS_15800 718 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 717 1658 gene locus_tag LOCUS_15810 717 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence0363 1771 239 gene locus_tag LOCUS_15820 1771 239 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767667.1 protein_id gnl|my_center|LOCUS_15820 2333 1809 gene locus_tag LOCUS_15830 2333 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3206 2361 gene locus_tag LOCUS_15840 3206 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 <3907 3299 gene locus_tag LOCUS_15850 <3907 3299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122176.1:thiol-disulfide isomerase >Feature sequence0364 976 2451 gene locus_tag LOCUS_15860 976 2451 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AR3 protein_id gnl|my_center|LOCUS_15860 2448 3140 gene locus_tag LOCUS_15870 2448 3140 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_15870 3137 3745 gene locus_tag LOCUS_15880 3137 3745 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence0365 >Feature sequence0366 861 1283 gene locus_tag LOCUS_15890 861 1283 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123244.1 protein_id gnl|my_center|LOCUS_15890 1280 2566 gene locus_tag LOCUS_15900 1280 2566 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460050.1 protein_id gnl|my_center|LOCUS_15900 2563 3390 gene locus_tag LOCUS_15910 2563 3390 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15910 >Feature sequence0367 1349 126 gene locus_tag LOCUS_15920 1349 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1965 1420 gene locus_tag LOCUS_15930 1965 1420 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121758.1 protein_id gnl|my_center|LOCUS_15930 3513 2008 gene locus_tag LOCUS_15940 gene proS 3513 2008 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ7 protein_id gnl|my_center|LOCUS_15940 >Feature sequence0368 <1 516 gene locus_tag LOCUS_15950 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268934.1:ferredoxin--NADP(+) reductase 673 1551 gene locus_tag LOCUS_15960 gene murB 673 1551 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVF9 protein_id gnl|my_center|LOCUS_15960 1673 2635 gene locus_tag LOCUS_15970 1673 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 3248 2787 gene locus_tag LOCUS_15980 3248 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence0369 <1 713 gene locus_tag LOCUS_15990 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328585.1:protein disulfide-isomerase 749 1717 gene locus_tag LOCUS_16000 749 1717 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119081.1 protein_id gnl|my_center|LOCUS_16000 1825 1682 gene locus_tag LOCUS_16010 1825 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 2155 2772 gene locus_tag LOCUS_16020 2155 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_16020 2877 3116 gene locus_tag LOCUS_16030 2877 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence0370 1059 1835 gene locus_tag LOCUS_16040 1059 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_16040 2416 1958 gene locus_tag LOCUS_16050 2416 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence0371 <1 3712 gene locus_tag LOCUS_16060 <1 3712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119677.1:large multi-functional protein >Feature sequence0372 1402 494 gene locus_tag LOCUS_16070 1402 494 CDS product putative 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CQU6 protein_id gnl|my_center|LOCUS_16070 2504 1422 gene locus_tag LOCUS_16080 2504 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 3120 2779 gene locus_tag LOCUS_16090 3120 2779 CDS product anti-anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123775.1 protein_id gnl|my_center|LOCUS_16090 3777 3244 gene locus_tag LOCUS_16100 3777 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence0373 1175 84 gene locus_tag LOCUS_16110 1175 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 2650 1175 gene locus_tag LOCUS_16120 2650 1175 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767667.1 protein_id gnl|my_center|LOCUS_16120 <3827 2702 gene locus_tag LOCUS_16130 <3827 2702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121616.1:N-acetylgalactosamine-6-sulfatase >Feature sequence0374 2119 638 gene locus_tag LOCUS_16140 2119 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 3455 2235 gene locus_tag LOCUS_16150 3455 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKS7 protein_id gnl|my_center|LOCUS_16150 >Feature sequence0375 630 1238 gene locus_tag LOCUS_16160 630 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1304 1690 gene locus_tag LOCUS_16170 gene acpP 1304 1690 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP48 protein_id gnl|my_center|LOCUS_16170 1828 2376 gene locus_tag LOCUS_16180 gene fabZ 1828 2376 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121272.1 protein_id gnl|my_center|LOCUS_16180 2515 3792 gene locus_tag LOCUS_16190 gene fabF 2515 3792 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTZ1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence0376 2263 2 gene locus_tag LOCUS_16200 gene dsbB 2263 2 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123470.1 protein_id gnl|my_center|LOCUS_16200 2912 2310 gene locus_tag LOCUS_16210 2912 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3707 2913 gene locus_tag LOCUS_16220 3707 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123469.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence0377 822 271 gene locus_tag LOCUS_16230 822 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2218 1160 gene locus_tag LOCUS_16240 gene hofF 2218 1160 CDS product general secretion pathway protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123458.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence0378 >Feature sequence0379 <1 655 gene locus_tag LOCUS_16250 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109162.1:peptidase S9 2010 670 gene locus_tag LOCUS_16260 2010 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2126 3277 gene locus_tag LOCUS_16270 2126 3277 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048416.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence0380 220 882 gene locus_tag LOCUS_16280 220 882 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_16280 2600 1752 gene locus_tag LOCUS_16290 2600 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence0381 2 568 gene locus_tag LOCUS_16300 2 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 754 2310 gene locus_tag LOCUS_16310 754 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2294 3385 gene locus_tag LOCUS_16320 2294 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813493.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence0382 843 277 gene locus_tag LOCUS_16330 843 277 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123524.1 protein_id gnl|my_center|LOCUS_16330 1086 1889 gene locus_tag LOCUS_16340 1086 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2131 2496 gene locus_tag LOCUS_16350 2131 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2672 3619 gene locus_tag LOCUS_16360 2672 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence0383 1254 592 gene locus_tag LOCUS_16370 1254 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1504 2514 gene locus_tag LOCUS_16380 gene rluD 1504 2514 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHX8 protein_id gnl|my_center|LOCUS_16380 2684 3523 gene locus_tag LOCUS_16390 2684 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence0384 520 221 gene locus_tag LOCUS_16400 520 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 538 1869 gene locus_tag LOCUS_16410 538 1869 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_16410 3081 2416 gene locus_tag LOCUS_16420 gene rsmG 3081 2416 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMW0 protein_id gnl|my_center|LOCUS_16420 <3769 3087 gene locus_tag LOCUS_16430 <3769 3087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328412.1:phosphatidate cytidylyltransferase >Feature sequence0385 215 2998 gene locus_tag LOCUS_16440 215 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence0386 <1 831 gene locus_tag LOCUS_16450 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326676.1:sulfatase 2409 919 gene locus_tag LOCUS_16460 2409 919 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118668.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence0387 >Feature sequence0388 3342 958 gene locus_tag LOCUS_16470 3342 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence0389 <1 1297 gene locus_tag LOCUS_16480 <1 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121420.1:chloride channel protein <3748 1317 gene locus_tag LOCUS_16490 <3748 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123036.1:protein kinase >Feature sequence0390 139 1692 gene locus_tag LOCUS_16500 139 1692 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120586.1 protein_id gnl|my_center|LOCUS_16500 1717 2352 gene locus_tag LOCUS_16510 1717 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2336 3316 gene locus_tag LOCUS_16520 2336 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence0391 1294 1434 gene locus_tag LOCUS_16530 1294 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 2224 1424 gene locus_tag LOCUS_16540 2224 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 2814 3578 gene locus_tag LOCUS_16550 2814 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence0392 2103 1567 gene locus_tag LOCUS_16560 2103 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335171.1 protein_id gnl|my_center|LOCUS_16560 3048 2242 gene locus_tag LOCUS_16570 gene trpA 3048 2242 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URN0 protein_id gnl|my_center|LOCUS_16570 <3725 3050 gene locus_tag LOCUS_16580 <3725 3050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UKG9:tryptophan synthase beta chain >Feature sequence0393 419 273 gene locus_tag LOCUS_16590 419 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence0394 319 1044 gene locus_tag LOCUS_16600 319 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1184 2197 gene locus_tag LOCUS_16610 gene rfbG 1184 2197 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205408.1 protein_id gnl|my_center|LOCUS_16610 2210 3052 gene locus_tag LOCUS_16620 2210 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence0395 2674 1952 gene locus_tag LOCUS_16630 2674 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 3239 2829 gene locus_tag LOCUS_16640 3239 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence0396 3347 1293 gene locus_tag LOCUS_16650 3347 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118363.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence0397 1353 202 gene locus_tag LOCUS_16660 1353 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence0398 796 1335 gene locus_tag LOCUS_16670 796 1335 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257373.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence0399 1078 287 gene locus_tag LOCUS_16680 1078 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1329 1955 gene locus_tag LOCUS_16690 1329 1955 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRE6 protein_id gnl|my_center|LOCUS_16690 3369 1969 gene locus_tag LOCUS_16700 gene uvrC 3369 1969 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPD6 protein_id gnl|my_center|LOCUS_16700 >Feature sequence0400 2068 956 gene locus_tag LOCUS_16710 2068 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 2811 2236 gene locus_tag LOCUS_16720 2811 2236 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_16720 2929 3588 gene locus_tag LOCUS_16730 2929 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence0401 1003 2595 gene locus_tag LOCUS_16740 1003 2595 CDS product ketoglutarate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122083.1 protein_id gnl|my_center|LOCUS_16740 3384 2695 gene locus_tag LOCUS_16750 3384 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence0402 <1 1335 gene locus_tag LOCUS_16760 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123986.1:oxidoreductase 1337 2167 gene locus_tag LOCUS_16770 1337 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence0403 1715 1212 gene locus_tag LOCUS_16780 1715 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 2126 1737 gene locus_tag LOCUS_16790 2126 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2898 2305 gene locus_tag LOCUS_16800 2898 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence0404 174 90 gene locus_tag LOCUS_t00180 174 90 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 255 184 gene locus_tag LOCUS_t00190 255 184 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 641 567 gene locus_tag LOCUS_t00200 641 567 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 682 1287 gene locus_tag LOCUS_16810 682 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1584 1508 gene locus_tag LOCUS_t00210 1584 1508 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1679 1608 gene locus_tag LOCUS_t00220 1679 1608 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1860 2477 gene locus_tag LOCUS_16820 1860 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 2573 2501 gene locus_tag LOCUS_t00230 2573 2501 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2763 2691 gene locus_tag LOCUS_t00240 2763 2691 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2848 2775 gene locus_tag LOCUS_t00250 2848 2775 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2930 2858 gene locus_tag LOCUS_t00260 2930 2858 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3060 2987 gene locus_tag LOCUS_t00270 3060 2987 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3157 3084 gene locus_tag LOCUS_t00280 3157 3084 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3234 3159 gene locus_tag LOCUS_t00290 3234 3159 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3373 3301 gene locus_tag LOCUS_t00300 3373 3301 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3453 3382 gene locus_tag LOCUS_t00310 3453 3382 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3619 3547 gene locus_tag LOCUS_t00320 3619 3547 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0405 1283 306 gene locus_tag LOCUS_16830 gene hpnA 1283 306 CDS product HpnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121915.1 protein_id gnl|my_center|LOCUS_16830 2056 1397 gene locus_tag LOCUS_16840 2056 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2877 2257 gene locus_tag LOCUS_16850 2877 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 <3659 2963 gene locus_tag LOCUS_16860 <3659 2963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120879.1:DUF4339 domain-containing protein >Feature sequence0406 85 1248 gene locus_tag LOCUS_16870 85 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2796 1270 gene locus_tag LOCUS_16880 2796 1270 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121014.1 protein_id gnl|my_center|LOCUS_16880 <3658 3035 gene locus_tag LOCUS_16890 <3658 3035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119953.1:3-oxoacyl-ACP synthase >Feature sequence0407 >Feature sequence0408 <1 2394 gene locus_tag LOCUS_16900 <1 2394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UR95:polyribonucleotide nucleotidyltransferase 2566 3270 gene locus_tag LOCUS_16910 2566 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence0409 583 858 gene locus_tag LOCUS_16920 583 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence0410 1169 993 gene locus_tag LOCUS_16930 1169 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1234 1359 gene locus_tag LOCUS_16940 1234 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1755 2210 gene locus_tag LOCUS_16950 1755 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 3128 2247 gene locus_tag LOCUS_16960 3128 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence0411 536 33 gene locus_tag LOCUS_16970 536 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 2062 551 gene locus_tag LOCUS_16980 2062 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 3164 2202 gene locus_tag LOCUS_16990 3164 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence0412 1714 1355 gene locus_tag LOCUS_17000 1714 1355 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USG1 protein_id gnl|my_center|LOCUS_17000 2368 1778 gene locus_tag LOCUS_17010 2368 1778 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_17010 <3620 2393 gene locus_tag LOCUS_17020 <3620 2393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120896.1:PKR inhibitor (translation regulation) >Feature sequence0413 3035 231 gene locus_tag LOCUS_17030 3035 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence0414 <1 2337 gene locus_tag LOCUS_17040 <1 2337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729293.1:membrane dipeptidase >Feature sequence0415 1099 368 gene locus_tag LOCUS_17050 1099 368 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974283.1 protein_id gnl|my_center|LOCUS_17050 2447 1101 gene locus_tag LOCUS_17060 2447 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 3172 2444 gene locus_tag LOCUS_17070 3172 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 3511 3176 gene locus_tag LOCUS_17080 3511 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence0416 43 1905 gene locus_tag LOCUS_17090 gene korA 43 1905 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_17090 1915 2952 gene locus_tag LOCUS_17100 gene korB 1915 2952 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121170.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence0417 2178 706 gene locus_tag LOCUS_17110 2178 706 CDS product UDP-N-acetylhexosamine pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_17110 3186 2212 gene locus_tag LOCUS_17120 gene rfbA 3186 2212 CDS product glucose-1-phosphate thymidylyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37779 protein_id gnl|my_center|LOCUS_17120 >Feature sequence0418 439 3537 gene locus_tag LOCUS_17130 gene cti 439 3537 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121858.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence0419 2845 1151 gene locus_tag LOCUS_17140 2845 1151 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330716.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence0420 1002 1628 gene locus_tag LOCUS_17150 1002 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 >Feature sequence0421 268 849 gene locus_tag LOCUS_17160 268 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 997 1644 gene locus_tag LOCUS_17170 997 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2182 2063 gene locus_tag LOCUS_17180 2182 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 3071 2484 gene locus_tag LOCUS_17190 3071 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence0422 <1 802 gene locus_tag LOCUS_17200 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108979.1:sulfatase 929 1357 gene locus_tag LOCUS_17210 929 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 3226 1391 gene locus_tag LOCUS_17220 3226 1391 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143441.1 protein_id gnl|my_center|LOCUS_17220 3195 3428 gene locus_tag LOCUS_17230 3195 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence0423 529 1347 gene locus_tag LOCUS_17240 529 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1415 3466 gene locus_tag LOCUS_17250 gene glgB 1415 3466 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence0424 1150 503 gene locus_tag LOCUS_17260 1150 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1262 2713 gene locus_tag LOCUS_17270 gene pyk 1262 2713 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747D6 protein_id gnl|my_center|LOCUS_17270 >Feature sequence0425 409 825 gene locus_tag LOCUS_17280 409 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 2661 841 gene locus_tag LOCUS_17290 2661 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence0426 879 166 gene locus_tag LOCUS_17300 879 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1163 2527 gene locus_tag LOCUS_17310 1163 2527 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118049.1 protein_id gnl|my_center|LOCUS_17310 2624 2875 gene locus_tag LOCUS_17320 2624 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence0427 339 749 gene locus_tag LOCUS_17330 339 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1036 1677 gene locus_tag LOCUS_17340 1036 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 2084 2605 gene locus_tag LOCUS_17350 2084 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence0428 <1 986 gene locus_tag LOCUS_17360 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118163.1:acetylglucosamine-6-sulfatase 1030 2271 gene locus_tag LOCUS_17370 1030 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence0429 2388 3092 gene locus_tag LOCUS_17380 2388 3092 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140007.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence0430 <1 679 gene locus_tag LOCUS_17390 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010951299.1:septum formation inhibitor Maf >Feature sequence0431 788 1078 gene locus_tag LOCUS_17400 788 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence0432 2256 802 gene locus_tag LOCUS_17410 2256 802 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence0433 672 1415 gene locus_tag LOCUS_17420 672 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123337.1 protein_id gnl|my_center|LOCUS_17420 2002 2817 gene locus_tag LOCUS_17430 2002 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence0434 2002 1010 gene locus_tag LOCUS_17440 2002 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124130.1 protein_id gnl|my_center|LOCUS_17440 2670 2254 gene locus_tag LOCUS_17450 2670 2254 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939197.1 protein_id gnl|my_center|LOCUS_17450 3350 2970 gene locus_tag LOCUS_17460 3350 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence0435 <1 2044 gene locus_tag LOCUS_17470 <1 2044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121496.1:sodium extrusion protein NatB 2232 3359 gene locus_tag LOCUS_17480 gene trzA 2232 3359 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence0436 1963 335 gene locus_tag LOCUS_17490 1963 335 CDS product putative Na(+)/H(+) antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57007 protein_id gnl|my_center|LOCUS_17490 3156 1996 gene locus_tag LOCUS_17500 3156 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123740.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence0437 165 1700 gene locus_tag LOCUS_17510 165 1700 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_17510 2478 1708 gene locus_tag LOCUS_17520 2478 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2727 3224 gene locus_tag LOCUS_17530 2727 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence0438 <3516 259 gene locus_tag LOCUS_17540 <3516 259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UXK9:error-prone DNA polymerase >Feature sequence0439 720 1289 gene locus_tag LOCUS_17550 gene efp 720 1289 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXN7 protein_id gnl|my_center|LOCUS_17550 1337 2764 gene locus_tag LOCUS_17560 1337 2764 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence0440 1472 204 gene locus_tag LOCUS_17570 1472 204 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202736.1 protein_id gnl|my_center|LOCUS_17570 2733 1465 gene locus_tag LOCUS_17580 2733 1465 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966040.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence0441 2194 128 gene locus_tag LOCUS_17590 2194 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence0442 <1 1049 gene locus_tag LOCUS_17600 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202061.1:arylsulfatase <3483 1124 gene locus_tag LOCUS_17610 <3483 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118002.1:protein kinase >Feature sequence0443 3201 1723 gene locus_tag LOCUS_17620 3201 1723 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence0444 >Feature sequence0445 233 526 gene locus_tag LOCUS_17630 233 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 835 596 gene locus_tag LOCUS_17640 835 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1099 1881 gene locus_tag LOCUS_17650 gene hydH 1099 1881 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121413.1 protein_id gnl|my_center|LOCUS_17650 <3464 1889 gene locus_tag LOCUS_17660 <3464 1889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118187.1:ATP-dependent DNA helicase RecG >Feature sequence0446 <1 952 gene locus_tag LOCUS_17670 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UIA9:glutamine--fructose-6-phosphate aminotransferase [isomerizing] 1450 1142 gene locus_tag LOCUS_17680 1450 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 2201 1986 gene locus_tag LOCUS_17690 2201 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 3126 2368 gene locus_tag LOCUS_17700 3126 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120568.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence0447 973 65 gene locus_tag LOCUS_17710 973 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2197 1292 gene locus_tag LOCUS_17720 2197 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence0448 1035 1517 gene locus_tag LOCUS_17730 1035 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1933 2592 gene locus_tag LOCUS_17740 1933 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence0449 2616 1093 gene locus_tag LOCUS_17750 2616 1093 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence0450 492 133 gene locus_tag LOCUS_17760 492 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 944 567 gene locus_tag LOCUS_17770 944 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2298 1051 gene locus_tag LOCUS_17780 2298 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 3008 2301 gene locus_tag LOCUS_17790 3008 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence0451 33 1988 gene locus_tag LOCUS_17800 33 1988 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118237.1 protein_id gnl|my_center|LOCUS_17800 2321 3127 gene locus_tag LOCUS_17810 2321 3127 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327800.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence0452 1 1119 gene locus_tag LOCUS_17820 1 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence0453 <3409 2163 gene locus_tag LOCUS_17830 <3409 2163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123802.1:NADH-dependent dehydrogenase >Feature sequence0454 <1 3296 gene locus_tag LOCUS_17840 <1 3296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120738.1:cytochrome c >Feature sequence0455 900 3035 gene locus_tag LOCUS_17850 900 3035 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence0456 850 302 gene locus_tag LOCUS_17860 850 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2255 1296 gene locus_tag LOCUS_17870 2255 1296 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_17870 >Feature sequence0457 910 1698 gene locus_tag LOCUS_17880 gene dltE 910 1698 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123022.1 protein_id gnl|my_center|LOCUS_17880 <3393 1710 gene locus_tag LOCUS_17890 <3393 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123155.1:serine/threonine protein kinase >Feature sequence0458 1636 104 gene locus_tag LOCUS_17900 1636 104 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051390.1 protein_id gnl|my_center|LOCUS_17900 3069 1816 gene locus_tag LOCUS_17910 3069 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence0459 999 1865 gene locus_tag LOCUS_17920 999 1865 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_17920 1868 3202 gene locus_tag LOCUS_17930 1868 3202 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence0460 1856 1014 gene locus_tag LOCUS_17940 1856 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2860 2039 gene locus_tag LOCUS_17950 2860 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence0461 2096 849 gene locus_tag LOCUS_17960 2096 849 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122283.1 protein_id gnl|my_center|LOCUS_17960 3330 2071 gene locus_tag LOCUS_17970 3330 2071 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence0462 >Feature sequence0463 1611 703 gene locus_tag LOCUS_17980 1611 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 3033 1717 gene locus_tag LOCUS_17990 3033 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence0464 2262 409 gene locus_tag LOCUS_18000 2262 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 <3370 2355 gene locus_tag LOCUS_18010 <3370 2355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921166.1:peptidase M20 >Feature sequence0465 2114 2824 gene locus_tag LOCUS_18020 gene pcaI 2114 2824 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973949.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence0466 1955 468 gene locus_tag LOCUS_18030 1955 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence0467 2952 835 gene locus_tag LOCUS_18040 2952 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence0468 1330 659 gene locus_tag LOCUS_18050 1330 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3031 2567 gene locus_tag LOCUS_18060 3031 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence0469 <1 902 gene locus_tag LOCUS_18070 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122269.1:xylose isomerase 2530 941 gene locus_tag LOCUS_18080 2530 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2993 2679 gene locus_tag LOCUS_18090 2993 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 3266 3012 gene locus_tag LOCUS_18100 3266 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence0470 822 685 gene locus_tag LOCUS_18110 822 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2146 1658 gene locus_tag LOCUS_18120 2146 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2733 3326 gene locus_tag LOCUS_18130 2733 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 >Feature sequence0471 <1 1069 gene locus_tag LOCUS_18140 <1 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9WYT3:pseudouridine synthase 2660 1251 gene locus_tag LOCUS_18150 2660 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1263 1336 gene locus_tag LOCUS_t00330 1263 1336 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0472 787 266 gene locus_tag LOCUS_18160 787 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 2098 965 gene locus_tag LOCUS_18170 2098 965 CDS product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118418.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence0473 <1 1419 gene locus_tag LOCUS_18180 <1 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118102.1:biopolymer transporter 1504 3048 gene locus_tag LOCUS_18190 1504 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence0474 947 291 gene locus_tag LOCUS_18200 947 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1466 1068 gene locus_tag LOCUS_18210 1466 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1884 2513 gene locus_tag LOCUS_18220 1884 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 3183 2593 gene locus_tag LOCUS_18230 3183 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence0475 <1 2422 gene locus_tag LOCUS_18240 <1 2422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118530.1:peptidase >Feature sequence0476 >Feature sequence0477 565 266 gene locus_tag LOCUS_18250 565 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1383 712 gene locus_tag LOCUS_18260 1383 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1684 2208 gene locus_tag LOCUS_18270 1684 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2205 3008 gene locus_tag LOCUS_18280 2205 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence0478 <1 634 gene locus_tag LOCUS_18290 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117991.1:arylsulfatase 1468 650 gene locus_tag LOCUS_18300 1468 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1852 3048 gene locus_tag LOCUS_18310 1852 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence0479 1944 1663 gene locus_tag LOCUS_18320 1944 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2402 2253 gene locus_tag LOCUS_18330 2402 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence0480 2125 878 gene locus_tag LOCUS_18340 2125 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 <3294 2274 gene locus_tag LOCUS_18350 <3294 2274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123060.1:prepilin-type N-terminal cleavage/methylation domain-containing protein >Feature sequence0481 1150 239 gene locus_tag LOCUS_18360 gene iunH 1150 239 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324951.1 protein_id gnl|my_center|LOCUS_18360 1386 2393 gene locus_tag LOCUS_18370 gene trpD 1386 2393 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYS5 protein_id gnl|my_center|LOCUS_18370 >Feature sequence0482 570 2084 gene locus_tag LOCUS_18380 570 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2175 3032 gene locus_tag LOCUS_18390 2175 3032 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932352.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence0483 1389 187 gene locus_tag LOCUS_18400 gene hemN 1389 187 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122512.1 protein_id gnl|my_center|LOCUS_18400 2238 1399 gene locus_tag LOCUS_18410 2238 1399 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122511.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence0484 1296 181 gene locus_tag LOCUS_18420 gene thiE 1296 181 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQH1 protein_id gnl|my_center|LOCUS_18420 1642 2325 gene locus_tag LOCUS_18430 1642 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence0485 1053 766 gene locus_tag LOCUS_18440 1053 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1916 1104 gene locus_tag LOCUS_18450 1916 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 2039 1920 gene locus_tag LOCUS_18460 2039 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 2584 2072 gene locus_tag LOCUS_18470 2584 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 3246 2587 gene locus_tag LOCUS_18480 3246 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence0486 299 1234 gene locus_tag LOCUS_18490 299 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1444 2028 gene locus_tag LOCUS_18500 1444 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2481 2071 gene locus_tag LOCUS_18510 2481 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence0487 520 1218 gene locus_tag LOCUS_18520 520 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1240 2196 gene locus_tag LOCUS_18530 1240 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence0488 >Feature sequence0489 1092 421 gene locus_tag LOCUS_18540 gene lspA 1092 421 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF32 protein_id gnl|my_center|LOCUS_18540 1483 1124 gene locus_tag LOCUS_18550 1483 1124 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943824.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence0490 1121 213 gene locus_tag LOCUS_18560 1121 213 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022257.1 protein_id gnl|my_center|LOCUS_18560 1663 1175 gene locus_tag LOCUS_18570 1663 1175 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122323.1 protein_id gnl|my_center|LOCUS_18570 2001 2765 gene locus_tag LOCUS_18580 2001 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence0491 <1 714 gene locus_tag LOCUS_18590 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405311.1:methyl-accepting chemotaxis protein >Feature sequence0492 484 1488 gene locus_tag LOCUS_18600 484 1488 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence0493 <1 1330 gene locus_tag LOCUS_18610 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941826.1:phosphoenolpyruvate--protein phosphotransferase 2501 1377 gene locus_tag LOCUS_18620 2501 1377 CDS product cysteine proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117742.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence0494 1579 3066 gene locus_tag LOCUS_18630 1579 3066 CDS product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence0495 722 243 gene locus_tag LOCUS_18640 722 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1295 876 gene locus_tag LOCUS_18650 1295 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1625 1431 gene locus_tag LOCUS_18660 1625 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 2502 2014 gene locus_tag LOCUS_18670 2502 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2971 2693 gene locus_tag LOCUS_18680 2971 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence0496 2355 1891 gene locus_tag LOCUS_18690 2355 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 <3244 2502 gene locus_tag LOCUS_18700 <3244 2502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UWK9:queuine tRNA-ribosyltransferase >Feature sequence0497 1314 1895 gene locus_tag LOCUS_18710 1314 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence0498 1352 75 gene locus_tag LOCUS_18720 1352 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2595 1756 gene locus_tag LOCUS_18730 gene mutM 2595 1756 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121456.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence0499 2 334 gene locus_tag LOCUS_18740 2 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1515 481 gene locus_tag LOCUS_18750 1515 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200269.1 protein_id gnl|my_center|LOCUS_18750 1888 2883 gene locus_tag LOCUS_18760 1888 2883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119554.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence0500 987 277 gene locus_tag LOCUS_18770 gene tupB 987 277 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943339.1 protein_id gnl|my_center|LOCUS_18770 1856 984 gene locus_tag LOCUS_18780 gene tupA 1856 984 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986485.1 protein_id gnl|my_center|LOCUS_18780 2038 2823 gene locus_tag LOCUS_18790 2038 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105094.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence0501 >Feature sequence0502 1282 152 gene locus_tag LOCUS_18800 gene dnaJ 1282 152 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM96 protein_id gnl|my_center|LOCUS_18800 3073 1454 gene locus_tag LOCUS_18810 gene groL2 3073 1454 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM97 protein_id gnl|my_center|LOCUS_18810 >Feature sequence0503 350 2038 gene locus_tag LOCUS_18820 350 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence0504 <1 1321 gene locus_tag LOCUS_18830 <1 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256937.1:ABC transporter 1735 1403 gene locus_tag LOCUS_18840 1735 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2054 3127 gene locus_tag LOCUS_18850 2054 3127 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119727.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence0505 828 244 gene locus_tag LOCUS_18860 828 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1387 950 gene locus_tag LOCUS_18870 1387 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1849 1568 gene locus_tag LOCUS_18880 1849 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2380 1958 gene locus_tag LOCUS_18890 2380 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2904 2383 gene locus_tag LOCUS_18900 2904 2383 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942217.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence0506 546 935 gene locus_tag LOCUS_18910 546 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2237 960 gene locus_tag LOCUS_18920 gene serS 2237 960 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXX6 protein_id gnl|my_center|LOCUS_18920 >Feature sequence0507 1599 838 gene locus_tag LOCUS_18930 gene hisF 1599 838 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0H4 protein_id gnl|my_center|LOCUS_18930 2060 1593 gene locus_tag LOCUS_18940 2060 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18940 2222 2100 gene locus_tag LOCUS_18950 2222 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 <3193 2222 gene locus_tag LOCUS_18960 <3193 2222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EFB3:histidine biosynthesis bifunctional protein HisB >Feature sequence0508 2642 294 gene locus_tag LOCUS_18970 2642 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence0509 >Feature sequence0510 <1 1147 gene locus_tag LOCUS_18980 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122935.1:glycerate kinase >Feature sequence0511 64 693 gene locus_tag LOCUS_18990 64 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 714 1373 gene locus_tag LOCUS_19000 714 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 1363 1878 gene locus_tag LOCUS_19010 1363 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3146 2628 gene locus_tag LOCUS_19020 3146 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence0512 2999 1779 gene locus_tag LOCUS_19030 2999 1779 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258650.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence0513 847 1032 gene locus_tag LOCUS_19040 847 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1378 1040 gene locus_tag LOCUS_19050 1378 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence0514 2100 535 gene locus_tag LOCUS_19060 2100 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 <3165 2103 gene locus_tag LOCUS_19070 <3165 2103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117995.1:quinohemoprotein ethanol dehydrogenase >Feature sequence0515 576 1265 gene locus_tag LOCUS_19080 576 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2478 1393 gene locus_tag LOCUS_19090 2478 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence0516 237 584 gene locus_tag LOCUS_19100 237 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_19100 706 1425 gene locus_tag LOCUS_19110 706 1425 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_19110 2519 1968 gene locus_tag LOCUS_19120 2519 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence0517 >Feature sequence0518 510 1052 gene locus_tag LOCUS_19130 510 1052 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946639.1 protein_id gnl|my_center|LOCUS_19130 2360 1074 gene locus_tag LOCUS_19140 gene cinA 2360 1074 CDS product damage-inducible protein CinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117966.1 protein_id gnl|my_center|LOCUS_19140 <3146 2351 gene locus_tag LOCUS_19150 <3146 2351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122003.1:L-fucose isomerase >Feature sequence0519 1335 94 gene locus_tag LOCUS_19160 1335 94 CDS product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104605.1 protein_id gnl|my_center|LOCUS_19160 2664 1378 gene locus_tag LOCUS_19170 2664 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence0520 1091 219 gene locus_tag LOCUS_19180 1091 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 1512 2168 gene locus_tag LOCUS_19190 gene cnrH 1512 2168 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122499.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence0521 2092 704 gene locus_tag LOCUS_19200 gene dldH 2092 704 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVC8 protein_id gnl|my_center|LOCUS_19200 <3139 2206 gene locus_tag LOCUS_19210 <3139 2206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405383.1:ABC transporter ATP-binding protein >Feature sequence0522 >Feature sequence0523 173 1051 gene locus_tag LOCUS_19220 173 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2206 1073 gene locus_tag LOCUS_19230 2206 1073 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120946.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence0524 1670 2341 gene locus_tag LOCUS_19240 1670 2341 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence0525 1541 318 gene locus_tag LOCUS_19250 1541 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_19250 2934 1585 gene locus_tag LOCUS_19260 2934 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 3128 2979 gene locus_tag LOCUS_19270 3128 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence0526 451 1302 gene locus_tag LOCUS_19280 451 1302 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918236.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence0527 801 2252 gene locus_tag LOCUS_19290 801 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 >Feature sequence0528 1462 767 gene locus_tag LOCUS_19300 1462 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2100 1552 gene locus_tag LOCUS_19310 2100 1552 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256305.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence0529 572 1636 gene locus_tag LOCUS_19320 572 1636 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121627.1 protein_id gnl|my_center|LOCUS_19320 1656 2867 gene locus_tag LOCUS_19330 1656 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence0530 1606 491 gene locus_tag LOCUS_19340 1606 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 1895 2947 gene locus_tag LOCUS_19350 gene tdh 1895 2947 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFH1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence0531 1100 693 gene locus_tag LOCUS_19360 1100 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_19360 1300 2346 gene locus_tag LOCUS_19370 1300 2346 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120584.1 protein_id gnl|my_center|LOCUS_19370 2449 2862 gene locus_tag LOCUS_19380 2449 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence0532 2646 1420 gene locus_tag LOCUS_19390 gene metB 2646 1420 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence0533 1007 723 gene locus_tag LOCUS_19400 1007 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 1462 2916 gene locus_tag LOCUS_19410 gene GALNS 1462 2916 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121931.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence0534 1401 2261 gene locus_tag LOCUS_19420 1401 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122886.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence0535 >Feature sequence0536 2 1558 gene locus_tag LOCUS_19430 2 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2899 1619 gene locus_tag LOCUS_19440 2899 1619 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086613.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence0537 1733 126 gene locus_tag LOCUS_19450 1733 126 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328290.1 protein_id gnl|my_center|LOCUS_19450 2411 1905 gene locus_tag LOCUS_19460 gene trmL 2411 1905 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DW8 protein_id gnl|my_center|LOCUS_19460 <3107 2430 gene locus_tag LOCUS_19470 <3107 2430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UZ20:histidine--tRNA ligase >Feature sequence0538 352 1539 gene locus_tag LOCUS_19480 352 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 <3103 1788 gene locus_tag LOCUS_19490 <3103 1788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039072.1:halogenase >Feature sequence0539 743 96 gene locus_tag LOCUS_19500 743 96 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121675.1 protein_id gnl|my_center|LOCUS_19500 1434 931 gene locus_tag LOCUS_19510 1434 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119100.1 protein_id gnl|my_center|LOCUS_19510 1474 1650 gene locus_tag LOCUS_19520 1474 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1806 2348 gene locus_tag LOCUS_19530 1806 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2678 2472 gene locus_tag LOCUS_19540 2678 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence0540 97 1086 gene locus_tag LOCUS_19550 gene galE 97 1086 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120830.1 protein_id gnl|my_center|LOCUS_19550 1981 1151 gene locus_tag LOCUS_19560 1981 1151 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence0541 <1 1159 gene locus_tag LOCUS_19570 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118315.1:phytoene dehydrogenase 1173 1652 gene locus_tag LOCUS_19580 gene fabZ 1173 1652 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121723.1 protein_id gnl|my_center|LOCUS_19580 1645 2454 gene locus_tag LOCUS_19590 gene fabI 1645 2454 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG49 protein_id gnl|my_center|LOCUS_19590 >Feature sequence0542 2544 730 gene locus_tag LOCUS_19600 2544 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence0543 2243 156 gene locus_tag LOCUS_19610 gene thrS 2243 156 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56881 protein_id gnl|my_center|LOCUS_19610 2658 2733 gene locus_tag LOCUS_t00340 2658 2733 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0544 >Feature sequence0545 323 1075 gene locus_tag LOCUS_19620 gene lolD2 323 1075 CDS product lipoprotein-releasing system ATP-binding protein LolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPK3 protein_id gnl|my_center|LOCUS_19620 1266 2411 gene locus_tag LOCUS_19630 1266 2411 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_19630 2596 2997 gene locus_tag LOCUS_19640 2596 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence0546 185 258 gene locus_tag LOCUS_t00350 185 258 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 468 2357 gene locus_tag LOCUS_19650 468 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 <3055 2390 gene locus_tag LOCUS_19660 <3055 2390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DH57:LL-diaminopimelate aminotransferase >Feature sequence0547 <1 702 gene locus_tag LOCUS_19670 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118392.1:DNA polymerase/3'-5' exonuclease PolX 756 977 gene locus_tag LOCUS_19680 756 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 <3049 1051 gene locus_tag LOCUS_19690 <3049 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405424.1:acylaminoacyl-peptidase >Feature sequence0548 116 1213 gene locus_tag LOCUS_19700 116 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence0549 639 211 gene locus_tag LOCUS_19710 639 211 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_19710 1009 812 gene locus_tag LOCUS_19720 1009 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1354 1199 gene locus_tag LOCUS_19730 1354 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2250 1375 gene locus_tag LOCUS_19740 2250 1375 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122612.1 protein_id gnl|my_center|LOCUS_19740 3025 2318 gene locus_tag LOCUS_19750 3025 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence0550 745 1413 gene locus_tag LOCUS_19760 745 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence0551 1478 1999 gene locus_tag LOCUS_19770 gene rpoE 1478 1999 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222027.1 protein_id gnl|my_center|LOCUS_19770 2067 2657 gene locus_tag LOCUS_19780 2067 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence0552 >Feature sequence0553 >Feature sequence0554 <1 2105 gene locus_tag LOCUS_19790 <1 2105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259048.1:formate dehydrogenase >Feature sequence0555 2197 1130 gene locus_tag LOCUS_19800 gene nrdB 2197 1130 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6S4 protein_id gnl|my_center|LOCUS_19800 <3037 2298 gene locus_tag LOCUS_19810 <3037 2298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3MCP2:ribonucleoside-diphosphate reductase >Feature sequence0556 <1 625 gene locus_tag LOCUS_19820 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120542.1:uracil-DNA glycosylase 922 2451 gene locus_tag LOCUS_19830 922 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119040.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence0557 >Feature sequence0558 >Feature sequence0559 1221 1784 gene locus_tag LOCUS_19840 1221 1784 CDS product antitermination factor NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327462.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence0560 <1 558 gene locus_tag LOCUS_19850 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121269.1:sulfotransferase family protein 1311 580 gene locus_tag LOCUS_19860 1311 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2137 1304 gene locus_tag LOCUS_19870 gene fliR 2137 1304 CDS product flagellar biosynthesis protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332783.1 protein_id gnl|my_center|LOCUS_19870 2415 2134 gene locus_tag LOCUS_19880 gene fliQ 2415 2134 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329633.1 protein_id gnl|my_center|LOCUS_19880 3013 2465 gene locus_tag LOCUS_19890 3013 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence0561 93 1010 gene locus_tag LOCUS_19900 93 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 1040 2050 gene locus_tag LOCUS_19910 gene gmd 1040 2050 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ72 protein_id gnl|my_center|LOCUS_19910 >Feature sequence0562 1879 1331 gene locus_tag LOCUS_19920 1879 1331 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 protein_id gnl|my_center|LOCUS_19920 2029 2907 gene locus_tag LOCUS_19930 2029 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence0563 646 227 gene locus_tag LOCUS_19940 646 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2946 1354 gene locus_tag LOCUS_19950 gene murG 2946 1354 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120938.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence0564 <1 585 gene locus_tag LOCUS_19960 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118387.1:arylsulfatase 629 1426 gene locus_tag LOCUS_19970 gene panB 629 1426 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM39 protein_id gnl|my_center|LOCUS_19970 <3000 2346 gene locus_tag LOCUS_19980 <3000 2346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122500.1:protein kinase >Feature sequence0565 1277 477 gene locus_tag LOCUS_19990 1277 477 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119176.1 protein_id gnl|my_center|LOCUS_19990 1309 2199 gene locus_tag LOCUS_20000 gene ffsA 1309 2199 CDS product formylmethanofuran--tetrahydromethanopterin formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKZ8 protein_id gnl|my_center|LOCUS_20000 >Feature sequence0566 <1 1128 gene locus_tag LOCUS_20010 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121488.1:Fe-S oxidoreductase 2576 1242 gene locus_tag LOCUS_20020 2576 1242 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122552.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence0567 <1 1039 gene locus_tag LOCUS_20030 <1 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120492.1:prepilin-type N-terminal cleavage/methylation domain-containing protein 1036 2604 gene locus_tag LOCUS_20040 gene gspK 1036 2604 CDS product general secretion pathway protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120491.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence0568 2694 1297 gene locus_tag LOCUS_20050 gene aslA 2694 1297 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence0569 1396 899 gene locus_tag LOCUS_20060 1396 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2294 1398 gene locus_tag LOCUS_20070 2294 1398 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence0570 644 66 gene locus_tag LOCUS_20080 644 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 1082 663 gene locus_tag LOCUS_20090 1082 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 1503 1099 gene locus_tag LOCUS_20100 1503 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 1937 1566 gene locus_tag LOCUS_20110 1937 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence0571 <1 695 gene locus_tag LOCUS_20120 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123119.1:MerR family transcriptional regulator 822 1742 gene locus_tag LOCUS_20130 822 1742 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence0572 1327 785 gene locus_tag LOCUS_20140 1327 785 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122012.1 protein_id gnl|my_center|LOCUS_20140 2217 1360 gene locus_tag LOCUS_20150 2217 1360 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876382.1 protein_id gnl|my_center|LOCUS_20150 2981 2214 gene locus_tag LOCUS_20160 gene dhlA 2981 2214 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122685.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence0573 2644 2261 gene locus_tag LOCUS_20170 gene atpC 2644 2261 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB4 protein_id gnl|my_center|LOCUS_20170 >Feature sequence0574 1602 319 gene locus_tag LOCUS_20180 1602 319 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123528.1 protein_id gnl|my_center|LOCUS_20180 1846 1773 gene locus_tag LOCUS_t00360 1846 1773 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2002 2844 gene locus_tag LOCUS_20190 2002 2844 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence0575 <1 1368 gene locus_tag LOCUS_20200 <1 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121702.1:arylsulfatase 1798 1466 gene locus_tag LOCUS_20210 1798 1466 CDS product nuclear scaffold-like protein p76 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333113.1 protein_id gnl|my_center|LOCUS_20210 <2973 1964 gene locus_tag LOCUS_20220 <2973 1964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118609.1:pyruvate, phosphate dikinase >Feature sequence0576 179 895 gene locus_tag LOCUS_20230 179 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 910 1950 gene locus_tag LOCUS_20240 910 1950 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920677.1 protein_id gnl|my_center|LOCUS_20240 1919 2587 gene locus_tag LOCUS_20250 1919 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence0577 1274 84 gene locus_tag LOCUS_20260 1274 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 1383 1934 gene locus_tag LOCUS_20270 gene pyrE 1383 1934 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYX5 protein_id gnl|my_center|LOCUS_20270 2305 2162 gene locus_tag LOCUS_20280 2305 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 >Feature sequence0578 781 1323 gene locus_tag LOCUS_20290 781 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence0579 598 1044 gene locus_tag LOCUS_20300 598 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119621.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence0580 1195 158 gene locus_tag LOCUS_20310 1195 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 1419 1586 gene locus_tag LOCUS_20320 1419 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1614 2012 gene locus_tag LOCUS_20330 1614 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence0581 >Feature sequence0582 767 1504 gene locus_tag LOCUS_20340 767 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2747 1608 gene locus_tag LOCUS_20350 2747 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence0583 572 153 gene locus_tag LOCUS_20360 572 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 2067 847 gene locus_tag LOCUS_20370 2067 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 <2958 2254 gene locus_tag LOCUS_20380 <2958 2254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122609.1:2-keto-4-pentenoate hydratase >Feature sequence0584 <2957 530 gene locus_tag LOCUS_20390 <2957 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022279.1:5-oxoprolinase >Feature sequence0585 757 1914 gene locus_tag LOCUS_20400 757 1914 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_20400 2001 2666 gene locus_tag LOCUS_20410 2001 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328057.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence0586 270 2027 gene locus_tag LOCUS_20420 gene recJ 270 2027 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338790.1 protein_id gnl|my_center|LOCUS_20420 2032 2742 gene locus_tag LOCUS_20430 gene ung 2032 2742 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39615 protein_id gnl|my_center|LOCUS_20430 >Feature sequence0587 2731 722 gene locus_tag LOCUS_20440 2731 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence0588 129 1502 gene locus_tag LOCUS_20450 gene hslU 129 1502 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYZ2 protein_id gnl|my_center|LOCUS_20450 >Feature sequence0589 <1 981 gene locus_tag LOCUS_20460 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258074.1:sodium:calcium antiporter 1051 1305 gene locus_tag LOCUS_20470 1051 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence0590 382 1068 gene locus_tag LOCUS_20480 382 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 1202 1912 gene locus_tag LOCUS_20490 1202 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence0591 >Feature sequence0592 709 2877 gene locus_tag LOCUS_20500 gene ftsH1 709 2877 CDS product ATP-dependent zinc metalloprotease FtsH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUZ7 protein_id gnl|my_center|LOCUS_20500 >Feature sequence0593 866 165 gene locus_tag LOCUS_20510 866 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1984 1028 gene locus_tag LOCUS_20520 gene tadC 1984 1028 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335393.1 protein_id gnl|my_center|LOCUS_20520 <2932 2033 gene locus_tag LOCUS_20530 <2932 2033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120690.1:secretion protein >Feature sequence0594 280 1746 gene locus_tag LOCUS_20540 280 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2802 1786 gene locus_tag LOCUS_20550 2802 1786 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870058.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence0595 91 1704 gene locus_tag LOCUS_20560 gene speE1 91 1704 CDS product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 protein_id gnl|my_center|LOCUS_20560 1983 1729 gene locus_tag LOCUS_20570 1983 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence0596 298 606 gene locus_tag LOCUS_20580 298 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2241 607 gene locus_tag LOCUS_20590 2241 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2587 2258 gene locus_tag LOCUS_20600 2587 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence0597 2068 1619 gene locus_tag LOCUS_20610 2068 1619 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119076.1 protein_id gnl|my_center|LOCUS_20610 2490 2065 gene locus_tag LOCUS_20620 2490 2065 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119077.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence0598 <1 973 gene locus_tag LOCUS_20630 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120685.1:squalene--hopene cyclase >Feature sequence0599 1820 135 gene locus_tag LOCUS_20640 1820 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence0600 1112 525 gene locus_tag LOCUS_20650 1112 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence0601 202 654 gene locus_tag LOCUS_20660 gene moaC 202 654 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXJ9 protein_id gnl|my_center|LOCUS_20660 658 1674 gene locus_tag LOCUS_20670 658 1674 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121274.1 protein_id gnl|my_center|LOCUS_20670 1865 2332 gene locus_tag LOCUS_20680 gene nrdR 1865 2332 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG92 protein_id gnl|my_center|LOCUS_20680 2805 2458 gene locus_tag LOCUS_20690 2805 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence0602 3 158 gene locus_tag LOCUS_20700 3 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 1118 177 gene locus_tag LOCUS_20710 gene xerC 1118 177 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQK2 protein_id gnl|my_center|LOCUS_20710 1761 1246 gene locus_tag LOCUS_20720 1761 1246 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119636.1 protein_id gnl|my_center|LOCUS_20720 2274 1822 gene locus_tag LOCUS_20730 2274 1822 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327446.1 protein_id gnl|my_center|LOCUS_20730 <2907 2295 gene locus_tag LOCUS_20740 <2907 2295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119635.1:tolQ protein >Feature sequence0603 1926 1270 gene locus_tag LOCUS_20750 1926 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141352.1 protein_id gnl|my_center|LOCUS_20750 2602 2027 gene locus_tag LOCUS_20760 gene adk 2602 2027 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHP1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence0604 >Feature sequence0605 3 971 gene locus_tag LOCUS_20770 3 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 2148 943 gene locus_tag LOCUS_20780 2148 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947432.1 protein_id gnl|my_center|LOCUS_20780 <2901 2205 gene locus_tag LOCUS_20790 <2901 2205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122801.1:DNA polymerase III >Feature sequence0606 1777 2502 gene locus_tag LOCUS_20800 1777 2502 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence0607 <1 523 gene locus_tag LOCUS_20810 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976195.1:sulfatase 516 1886 gene locus_tag LOCUS_20820 gene GALNS 516 1886 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence0608 719 369 gene locus_tag LOCUS_20830 719 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2603 759 gene locus_tag LOCUS_20840 2603 759 CDS product putative Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59825 protein_id gnl|my_center|LOCUS_20840 >Feature sequence0609 1139 126 gene locus_tag LOCUS_20850 1139 126 CDS product cytochrome c554 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119032.1 protein_id gnl|my_center|LOCUS_20850 2281 1148 gene locus_tag LOCUS_20860 2281 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence0610 501 944 gene locus_tag LOCUS_20870 501 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 1385 1035 gene locus_tag LOCUS_20880 1385 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 <2881 1427 gene locus_tag LOCUS_20890 <2881 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036716.1:sulfate transporter >Feature sequence0611 153 719 gene locus_tag LOCUS_20900 153 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 834 1559 gene locus_tag LOCUS_20910 834 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 1765 2073 gene locus_tag LOCUS_20920 1765 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence0612 885 73 gene locus_tag LOCUS_20930 885 73 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270512.1 protein_id gnl|my_center|LOCUS_20930 1043 1579 gene locus_tag LOCUS_20940 1043 1579 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence0613 263 994 gene locus_tag LOCUS_20950 263 994 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ43 protein_id gnl|my_center|LOCUS_20950 >Feature sequence0614 <1 1865 gene locus_tag LOCUS_20960 <1 1865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120395.1:nuclease 1871 2791 gene locus_tag LOCUS_20970 1871 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20970 >Feature sequence0615 1497 2093 gene locus_tag LOCUS_20980 1497 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 <2871 2162 gene locus_tag LOCUS_20990 <2871 2162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_085984871.1:alpha/beta hydrolase >Feature sequence0616 >Feature sequence0617 2042 252 gene locus_tag LOCUS_21000 2042 252 CDS product putative serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIQ9 protein_id gnl|my_center|LOCUS_21000 >Feature sequence0618 <1 605 gene locus_tag LOCUS_21010 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7D462:flagellin 685 2673 gene locus_tag LOCUS_21020 685 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence0619 214 552 gene locus_tag LOCUS_21030 214 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 679 1554 gene locus_tag LOCUS_21040 gene thiG 679 1554 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7US84 protein_id gnl|my_center|LOCUS_21040 >Feature sequence0620 2300 1173 gene locus_tag LOCUS_21050 gene pilT 2300 1173 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence0621 <1 2476 gene locus_tag LOCUS_21060 <1 2476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119647.1:cytochrome oxidase >Feature sequence0622 453 1193 gene locus_tag LOCUS_21070 gene ispD 453 1193 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM15 protein_id gnl|my_center|LOCUS_21070 >Feature sequence0623 597 2279 gene locus_tag LOCUS_21080 597 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121283.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence0624 239 1615 gene locus_tag LOCUS_21090 239 1615 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123565.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence0625 1654 2484 gene locus_tag LOCUS_21100 gene map 1654 2484 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU68 protein_id gnl|my_center|LOCUS_21100 >Feature sequence0626 <1 1056 gene locus_tag LOCUS_21110 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119758.1:sigma-54-dependent Fis family transcriptional regulator 1444 2346 gene locus_tag LOCUS_21120 1444 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence0627 <2824 782 gene locus_tag LOCUS_21130 <2824 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117769.1:hybrid sensor histidine kinase/response regulator >Feature sequence0628 >Feature sequence0629 >Feature sequence0630 244 1182 gene locus_tag LOCUS_21140 244 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 1203 2039 gene locus_tag LOCUS_21150 1203 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121285.1 protein_id gnl|my_center|LOCUS_21150 <2822 2134 gene locus_tag LOCUS_21160 <2822 2134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098369.1:XRE family transcriptional regulator >Feature sequence0631 <1 1386 gene locus_tag LOCUS_21170 <1 1386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S008:phosphoenolpyruvate carboxykinase [ATP] 2 >Feature sequence0632 984 1190 gene locus_tag LOCUS_21180 984 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 1264 1190 gene locus_tag LOCUS_t00370 1264 1190 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1481 1570 gene locus_tag LOCUS_t00380 1481 1570 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0633 853 1065 gene locus_tag LOCUS_21190 853 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2542 1796 gene locus_tag LOCUS_21200 2542 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence0634 1296 454 gene locus_tag LOCUS_21210 1296 454 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072122.1 protein_id gnl|my_center|LOCUS_21210 >Feature sequence0635 1158 1877 gene locus_tag LOCUS_21220 1158 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 <2813 1927 gene locus_tag LOCUS_21230 <2813 1927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFY6:aspartate--tRNA(Asp/Asn) ligase >Feature sequence0636 67 333 gene locus_tag LOCUS_21240 67 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1631 426 gene locus_tag LOCUS_21250 1631 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 <2813 1870 gene locus_tag LOCUS_21260 <2813 1870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118444.1:isocitrate dehydrogenase >Feature sequence0637 >Feature sequence0638 1172 144 gene locus_tag LOCUS_21270 1172 144 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_21270 >Feature sequence0639 99 236 gene locus_tag LOCUS_21280 99 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 783 370 gene locus_tag LOCUS_21290 783 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 1565 813 gene locus_tag LOCUS_21300 1565 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2016 2222 gene locus_tag LOCUS_21310 2016 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2316 2435 gene locus_tag LOCUS_21320 2316 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence0640 887 444 gene locus_tag LOCUS_21330 887 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 933 1322 gene locus_tag LOCUS_21340 933 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 2502 1363 gene locus_tag LOCUS_21350 gene lpxD 2502 1363 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEV1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence0641 1874 555 gene locus_tag LOCUS_21360 1874 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 <2787 1987 gene locus_tag LOCUS_21370 <2787 1987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974987.1:ABC transporter ATP-binding protein >Feature sequence0642 1870 1094 gene locus_tag LOCUS_21380 gene comB 1870 1094 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 protein_id gnl|my_center|LOCUS_21380 >Feature sequence0643 1032 2696 gene locus_tag LOCUS_21390 1032 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence0644 1826 1089 gene locus_tag LOCUS_21400 1826 1089 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122939.1 protein_id gnl|my_center|LOCUS_21400 2674 1862 gene locus_tag LOCUS_21410 gene fabG 2674 1862 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120816.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence0645 690 789 gene locus_tag LOCUS_t00390 690 789 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1687 1869 gene locus_tag LOCUS_21420 1687 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence0646 1295 132 gene locus_tag LOCUS_21430 1295 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence0647 1014 253 gene locus_tag LOCUS_21440 gene uppS 1014 253 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF53 protein_id gnl|my_center|LOCUS_21440 2435 1134 gene locus_tag LOCUS_21450 gene purA 2435 1134 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHW3 protein_id gnl|my_center|LOCUS_21450 >Feature sequence0648 1298 1029 gene locus_tag LOCUS_21460 1298 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 1613 1368 gene locus_tag LOCUS_21470 1613 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence0649 <1 2037 gene locus_tag LOCUS_21480 <1 2037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119060.1:pilus assembly protein PilM >Feature sequence0650 661 539 gene locus_tag LOCUS_21490 661 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 689 2545 gene locus_tag LOCUS_21500 689 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence0651 1597 2634 gene locus_tag LOCUS_21510 1597 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence0652 >Feature sequence0653 527 1372 gene locus_tag LOCUS_21520 gene tolQ 527 1372 CDS product TolQ-type transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120828.1 protein_id gnl|my_center|LOCUS_21520 1388 1807 gene locus_tag LOCUS_21530 1388 1807 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119077.1 protein_id gnl|my_center|LOCUS_21530 1807 2244 gene locus_tag LOCUS_21540 1807 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence0654 1138 653 gene locus_tag LOCUS_21550 1138 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 1278 2675 gene locus_tag LOCUS_21560 gene aslA 1278 2675 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence0655 599 1840 gene locus_tag LOCUS_21570 599 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence0656 >Feature sequence0657 <1 1394 gene locus_tag LOCUS_21580 <1 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123669.1:serine/threonine protein kinase 1753 1622 gene locus_tag LOCUS_21590 1753 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 2628 1750 gene locus_tag LOCUS_21600 2628 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence0658 1210 2277 gene locus_tag LOCUS_21610 1210 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence0659 >Feature sequence0660 1508 2293 gene locus_tag LOCUS_21620 1508 2293 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_21620 2356 2497 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cactcgcttgcgcttcgtgcttg >Feature sequence0661 <1 822 gene locus_tag LOCUS_21630 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UMZ3:DNA mismatch repair protein MutL 1085 2602 gene locus_tag LOCUS_21640 1085 2602 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ72 protein_id gnl|my_center|LOCUS_21640 >Feature sequence0662 185 1018 gene locus_tag LOCUS_21650 185 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 1015 1149 gene locus_tag LOCUS_21660 1015 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2641 1349 gene locus_tag LOCUS_21670 2641 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence0663 1238 1984 gene locus_tag LOCUS_21680 1238 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 protein_id gnl|my_center|LOCUS_21680 <2720 2187 gene locus_tag LOCUS_21690 <2720 2187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082491.1:phospholipase >Feature sequence0664 2607 1183 gene locus_tag LOCUS_21700 2607 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence0665 1039 1200 gene locus_tag LOCUS_21710 1039 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2656 1193 gene locus_tag LOCUS_21720 2656 1193 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122652.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence0666 2551 11 gene locus_tag LOCUS_21730 2551 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence0667 859 131 gene locus_tag LOCUS_21740 859 131 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141006.1 protein_id gnl|my_center|LOCUS_21740 2199 1018 gene locus_tag LOCUS_21750 2199 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2614 2294 gene locus_tag LOCUS_21760 gene glnB 2614 2294 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327966.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence0668 1068 1859 gene locus_tag LOCUS_21770 1068 1859 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930516.1 protein_id gnl|my_center|LOCUS_21770 1910 2662 gene locus_tag LOCUS_21780 gene fabG 1910 2662 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51831 protein_id gnl|my_center|LOCUS_21780 >Feature sequence0669 1155 1865 gene locus_tag LOCUS_21790 1155 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence0670 632 2602 gene locus_tag LOCUS_21800 632 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence0671 594 106 gene locus_tag LOCUS_21810 594 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 851 1999 gene locus_tag LOCUS_21820 851 1999 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392916.1 protein_id gnl|my_center|LOCUS_21820 <2689 2010 gene locus_tag LOCUS_21830 <2689 2010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122994.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB >Feature sequence0672 1219 2142 gene locus_tag LOCUS_21840 1219 2142 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704691.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence0673 <1 677 gene locus_tag LOCUS_21850 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122074.1:acyltransferase 695 1801 gene locus_tag LOCUS_21860 695 1801 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533209.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence0674 <1 1543 gene locus_tag LOCUS_21870 <1 1543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090647.1:guanylate cyclase 1959 1630 gene locus_tag LOCUS_21880 1959 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 <2678 1962 gene locus_tag LOCUS_21890 <2678 1962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257673.1:cysteine desulfurase-like protein >Feature sequence0675 2352 292 gene locus_tag LOCUS_21900 gene uvrB 2352 292 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR2 protein_id gnl|my_center|LOCUS_21900 >Feature sequence0676 <2675 1212 gene locus_tag LOCUS_21910 <2675 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123096.1:N-acetylgalactosamine-6-sulfatase >Feature sequence0677 1513 308 gene locus_tag LOCUS_21920 1513 308 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388449.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence0678 583 239 gene locus_tag LOCUS_21930 583 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 847 638 gene locus_tag LOCUS_21940 847 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2637 967 gene locus_tag LOCUS_21950 2637 967 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122320.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence0679 158 1078 gene locus_tag LOCUS_21960 158 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876151.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence0680 1464 1643 gene locus_tag LOCUS_21970 1464 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence0681 406 2454 gene locus_tag LOCUS_21980 gene tkt 406 2454 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123963.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence0682 941 759 gene locus_tag LOCUS_21990 941 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 1233 2153 gene locus_tag LOCUS_22000 1233 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence0683 <1 689 gene locus_tag LOCUS_22010 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122499.1:DNA-directed RNA polymerase sigma-70 factor >Feature sequence0684 2652 154 gene locus_tag LOCUS_22020 2652 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence0685 1770 520 gene locus_tag LOCUS_22030 1770 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2091 1783 gene locus_tag LOCUS_22040 2091 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2355 2612 gene locus_tag LOCUS_22050 2355 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence0686 1834 1184 gene locus_tag LOCUS_22060 1834 1184 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 transl_except (pos:complement(1583..1585),aa:Sec) note codon on position 84 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_22060 >Feature sequence0687 994 1959 gene locus_tag LOCUS_22070 994 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence0688 2 337 gene locus_tag LOCUS_22080 2 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 2017 449 gene locus_tag LOCUS_22090 2017 449 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551866.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence0689 411 1940 gene locus_tag LOCUS_22100 gene merA 411 1940 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_22100 <2632 1937 gene locus_tag LOCUS_22110 <2632 1937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34331:putative rRNA methyltransferase YlbH >Feature sequence0690 2 274 gene locus_tag LOCUS_22120 2 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 314 763 gene locus_tag LOCUS_22130 gene rbfA 314 763 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URR1 protein_id gnl|my_center|LOCUS_22130 816 1781 gene locus_tag LOCUS_22140 816 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 1827 2579 gene locus_tag LOCUS_22150 1827 2579 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URR4 protein_id gnl|my_center|LOCUS_22150 >Feature sequence0691 <1 576 gene locus_tag LOCUS_22160 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140025.1:ABC transporter 573 2006 gene locus_tag LOCUS_22170 573 2006 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328443.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence0692 250 1875 gene locus_tag LOCUS_22180 250 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence0693 541 74 gene locus_tag LOCUS_22190 541 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_22190 1895 582 gene locus_tag LOCUS_22200 1895 582 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122010.1 protein_id gnl|my_center|LOCUS_22200 <2627 1989 gene locus_tag LOCUS_22210 <2627 1989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324646.1:iron permease >Feature sequence0694 >Feature sequence0695 148 1518 gene locus_tag LOCUS_22220 148 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1524 2132 gene locus_tag LOCUS_22230 1524 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence0696 1162 371 gene locus_tag LOCUS_22240 1162 371 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121590.1 protein_id gnl|my_center|LOCUS_22240 2254 1256 gene locus_tag LOCUS_22250 2254 1256 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence0697 <1 1381 gene locus_tag LOCUS_22260 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120179.1:aminopeptidase >Feature sequence0698 1737 388 gene locus_tag LOCUS_22270 1737 388 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_22270 <2613 1777 gene locus_tag LOCUS_22280 <2613 1777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060909.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) >Feature sequence0699 47 1105 gene locus_tag LOCUS_22290 gene sphX 47 1105 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121294.1 protein_id gnl|my_center|LOCUS_22290 1118 2170 gene locus_tag LOCUS_22300 gene pstC 1118 2170 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP19 protein_id gnl|my_center|LOCUS_22300 >Feature sequence0700 <1 1189 gene locus_tag LOCUS_22310 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UPH7:glutamate dehydrogenase >Feature sequence0701 139 2604 gene locus_tag LOCUS_22320 139 2604 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_22320 >Feature sequence0702 224 1897 gene locus_tag LOCUS_22330 224 1897 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_22330 2497 1931 gene locus_tag LOCUS_22340 2497 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence0703 2580 703 gene locus_tag LOCUS_22350 2580 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence0704 291 845 gene locus_tag LOCUS_22360 291 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 885 1247 gene locus_tag LOCUS_22370 885 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 1263 1556 gene locus_tag LOCUS_22380 1263 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1586 2056 gene locus_tag LOCUS_22390 1586 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence0705 905 105 gene locus_tag LOCUS_22400 905 105 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143495.1 protein_id gnl|my_center|LOCUS_22400 1861 992 gene locus_tag LOCUS_22410 1861 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence0706 <2602 1031 gene locus_tag LOCUS_22420 <2602 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120518.1:metalloprotease >Feature sequence0707 1413 667 gene locus_tag LOCUS_22430 1413 667 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529020.1 protein_id gnl|my_center|LOCUS_22430 1784 1569 gene locus_tag LOCUS_22440 1784 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2373 1972 gene locus_tag LOCUS_22450 2373 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence0708 1522 746 gene locus_tag LOCUS_22460 1522 746 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_22460 <2601 1681 gene locus_tag LOCUS_22470 <2601 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119004.1:lipid-A-disaccharide synthase >Feature sequence0709 889 11 gene locus_tag LOCUS_22480 889 11 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119082.1 protein_id gnl|my_center|LOCUS_22480 2568 886 gene locus_tag LOCUS_22490 2568 886 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118270.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence0710 2305 743 gene locus_tag LOCUS_22500 2305 743 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_22500 2410 2595 gene locus_tag LOCUS_22510 2410 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence0711 >Feature sequence0712 450 331 gene locus_tag LOCUS_22520 450 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 765 2477 gene locus_tag LOCUS_22530 765 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence0713 837 97 gene locus_tag LOCUS_22540 837 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2309 999 gene locus_tag LOCUS_22550 2309 999 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence0714 1244 321 gene locus_tag LOCUS_22560 1244 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_22560 1865 1380 gene locus_tag LOCUS_22570 1865 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324288.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence0715 >Feature sequence0716 1727 1143 gene locus_tag LOCUS_22580 1727 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119745.1 protein_id gnl|my_center|LOCUS_22580 2508 1735 gene locus_tag LOCUS_22590 gene ubiE 2508 1735 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117867.1 protein_id gnl|my_center|LOCUS_22590 >Feature sequence0717 <2585 1040 gene locus_tag LOCUS_22600 <2585 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121514.1:peptidase >Feature sequence0718 1471 488 gene locus_tag LOCUS_22610 1471 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1702 1490 gene locus_tag LOCUS_22620 1702 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 2432 1668 gene locus_tag LOCUS_22630 gene fliA 2432 1668 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQD4 protein_id gnl|my_center|LOCUS_22630 >Feature sequence0719 88 1713 gene locus_tag LOCUS_22640 88 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2503 1715 gene locus_tag LOCUS_22650 2503 1715 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2I9 protein_id gnl|my_center|LOCUS_22650 >Feature sequence0720 >Feature sequence0721 343 426 gene locus_tag LOCUS_t00400 343 426 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1801 1622 gene locus_tag LOCUS_22660 1801 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence0722 >Feature sequence0723 >Feature sequence0724 879 1613 gene locus_tag LOCUS_22670 879 1613 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_22670 <2575 1663 gene locus_tag LOCUS_22680 <2575 1663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122624.1:protein kinase >Feature sequence0725 528 139 gene locus_tag LOCUS_22690 528 139 CDS product glyoxalase/bleomycin resistance protein/dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527755.1 protein_id gnl|my_center|LOCUS_22690 1925 528 gene locus_tag LOCUS_22700 gene ntrC 1925 528 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123058.1 protein_id gnl|my_center|LOCUS_22700 <2573 1935 gene locus_tag LOCUS_22710 <2573 1935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943129.1:histidine kinase >Feature sequence0726 2277 628 gene locus_tag LOCUS_22720 2277 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence0727 323 898 gene locus_tag LOCUS_22730 323 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence0728 517 1734 gene locus_tag LOCUS_22740 517 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence0729 150 461 gene locus_tag LOCUS_22750 150 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 658 1230 gene locus_tag LOCUS_22760 658 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence0730 >Feature sequence0731 311 72 gene locus_tag LOCUS_22770 311 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 1872 493 gene locus_tag LOCUS_22780 1872 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2456 1944 gene locus_tag LOCUS_22790 2456 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761769.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence0732 967 278 gene locus_tag LOCUS_22800 gene rpsH 967 278 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UW29 protein_id gnl|my_center|LOCUS_22800 2238 1180 gene locus_tag LOCUS_22810 gene rlmN 2238 1180 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHU7 protein_id gnl|my_center|LOCUS_22810 >Feature sequence0733 <1 919 gene locus_tag LOCUS_22820 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118508.1:transglutaminase 1713 1051 gene locus_tag LOCUS_22830 1713 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence0734 >Feature sequence0735 807 1214 gene locus_tag LOCUS_22840 807 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 <2537 1300 gene locus_tag LOCUS_22850 <2537 1300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010977998.1:selenium-binding protein >Feature sequence0736 1384 206 gene locus_tag LOCUS_22860 1384 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 <2536 1725 gene locus_tag LOCUS_22870 <2536 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UJL3:inosine-5'-monophosphate dehydrogenase >Feature sequence0737 <1 1154 gene locus_tag LOCUS_22880 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UJI3:tRNA modification GTPase MnmE >Feature sequence0738 1464 2234 gene locus_tag LOCUS_22890 1464 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121361.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence0739 2207 288 gene locus_tag LOCUS_22900 2207 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence0740 1210 137 gene locus_tag LOCUS_22910 1210 137 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_22910 2278 1220 gene locus_tag LOCUS_22920 gene glpG 2278 1220 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074262.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence0741 853 620 gene locus_tag LOCUS_22930 853 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 878 2242 gene locus_tag LOCUS_22940 878 2242 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120681.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence0742 1938 334 gene locus_tag LOCUS_22950 1938 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 >Feature sequence0743 <1 1247 gene locus_tag LOCUS_22960 <1 1247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CPY9:UvrABC system protein A 1351 2301 gene locus_tag LOCUS_22970 gene moeB 1351 2301 CDS product thiamine/molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158137.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence0744 <1 801 gene locus_tag LOCUS_22980 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940902.1:DNA methyltransferase >Feature sequence0745 <1 680 gene locus_tag LOCUS_22990 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887443.1:glutamate-1-semialdehyde 2,1-aminomutase 693 1565 gene locus_tag LOCUS_23000 693 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1679 2218 gene locus_tag LOCUS_23010 1679 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence0746 1497 700 gene locus_tag LOCUS_23020 gene pfaS 1497 700 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121938.1 protein_id gnl|my_center|LOCUS_23020 <2510 1511 gene locus_tag LOCUS_23030 <2510 1511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URX8:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence0747 >Feature sequence0748 544 323 gene locus_tag LOCUS_23040 544 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1330 677 gene locus_tag LOCUS_23050 1330 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 <2509 1531 gene locus_tag LOCUS_23060 <2509 1531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PC31:phospho-2-dehydro-3-deoxyheptonate aldolase >Feature sequence0749 >Feature sequence0750 <1 1734 gene locus_tag LOCUS_23070 <1 1734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122294.1:lipoprotein 2218 1787 gene locus_tag LOCUS_23080 2218 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence0751 2012 153 gene locus_tag LOCUS_23090 2012 153 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123340.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence0752 98 1132 gene locus_tag LOCUS_23100 gene glcK 98 1132 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118462.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence0753 155 1513 gene locus_tag LOCUS_23110 155 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence0754 162 899 gene locus_tag LOCUS_23120 162 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 951 1532 gene locus_tag LOCUS_23130 951 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2189 1659 gene locus_tag LOCUS_23140 2189 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143456.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence0755 251 179 gene locus_tag LOCUS_t00410 251 179 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 334 261 gene locus_tag LOCUS_t00420 334 261 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 449 375 gene locus_tag LOCUS_t00430 449 375 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 610 538 gene locus_tag LOCUS_t00440 610 538 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 687 614 gene locus_tag LOCUS_t00450 687 614 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 823 751 gene locus_tag LOCUS_t00460 823 751 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 958 886 gene locus_tag LOCUS_t00470 958 886 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1299 1087 gene locus_tag LOCUS_23150 1299 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence0756 332 892 gene locus_tag LOCUS_23160 gene haaO 332 892 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_23160 901 1980 gene locus_tag LOCUS_23170 901 1980 CDS product 2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731314.1 protein_id gnl|my_center|LOCUS_23170 >Feature sequence0757 1056 10 gene locus_tag LOCUS_23180 1056 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 1970 1107 gene locus_tag LOCUS_23190 1970 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence0758 1186 83 gene locus_tag LOCUS_23200 gene serC 1186 83 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQL3 protein_id gnl|my_center|LOCUS_23200 2421 1492 gene locus_tag LOCUS_23210 2421 1492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330018.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence0759 115 1251 gene locus_tag LOCUS_23220 gene solA 115 1251 CDS product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence0760 1592 330 gene locus_tag LOCUS_23230 gene sucB 1592 330 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX6 protein_id gnl|my_center|LOCUS_23230 <2486 1608 gene locus_tag LOCUS_23240 <2486 1608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326049.1:2-oxoglutarate dehydrogenase E1 component >Feature sequence0761 >Feature sequence0762 449 522 gene locus_tag LOCUS_t00480 449 522 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 753 1952 gene locus_tag LOCUS_23250 753 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence0763 1253 279 gene locus_tag LOCUS_23260 1253 279 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118295.1 protein_id gnl|my_center|LOCUS_23260 1493 2461 gene locus_tag LOCUS_23270 1493 2461 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence0764 1628 612 gene locus_tag LOCUS_23280 gene atoC 1628 612 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123506.1 protein_id gnl|my_center|LOCUS_23280 2470 1805 gene locus_tag LOCUS_23290 2470 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence0765 70 1860 gene locus_tag LOCUS_23300 70 1860 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117744.1 protein_id gnl|my_center|LOCUS_23300 1943 2218 gene locus_tag LOCUS_23310 1943 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118582.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence0766 1421 597 gene locus_tag LOCUS_23320 1421 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 2033 1533 gene locus_tag LOCUS_23330 gene ilvH 2033 1533 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327088.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence0767 1728 2105 gene locus_tag LOCUS_23340 1728 2105 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088312.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence0768 30 554 gene locus_tag LOCUS_23350 30 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123400.1 protein_id gnl|my_center|LOCUS_23350 579 2279 gene locus_tag LOCUS_23360 579 2279 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123401.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence0769 2054 852 gene locus_tag LOCUS_23370 gene aspC 2054 852 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMN1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence0770 616 1713 gene locus_tag LOCUS_23380 616 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123327.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence0771 >Feature sequence0772 393 1913 gene locus_tag LOCUS_23390 393 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence0773 283 1740 gene locus_tag LOCUS_23400 283 1740 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_23400 1748 2212 gene locus_tag LOCUS_23410 1748 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence0774 1420 476 gene locus_tag LOCUS_23420 1420 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119361.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence0775 <1 860 gene locus_tag LOCUS_23430 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122268.1:transporter 1185 2261 gene locus_tag LOCUS_23440 gene prfA 1185 2261 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT3 protein_id gnl|my_center|LOCUS_23440 >Feature sequence0776 <1 1006 gene locus_tag LOCUS_23450 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117844.1:magnesium protoporphyrin chelatase >Feature sequence0777 231 890 gene locus_tag LOCUS_23460 231 890 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777093.1 protein_id gnl|my_center|LOCUS_23460 1869 1018 gene locus_tag LOCUS_23470 1869 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124104.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence0778 >Feature sequence0779 126 836 gene locus_tag LOCUS_23480 126 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 1476 1096 gene locus_tag LOCUS_23490 1476 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 1606 1734 gene locus_tag LOCUS_23500 1606 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence0780 509 1318 gene locus_tag LOCUS_23510 509 1318 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23510 >Feature sequence0781 >Feature sequence0782 1722 346 gene locus_tag LOCUS_23520 1722 346 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence0783 454 131 gene locus_tag LOCUS_23530 454 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326213.1 protein_id gnl|my_center|LOCUS_23530 811 497 gene locus_tag LOCUS_23540 gene nirD 811 497 CDS product benzene 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_23540 944 1366 gene locus_tag LOCUS_23550 944 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 1853 1386 gene locus_tag LOCUS_23560 1853 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23560 2267 1926 gene locus_tag LOCUS_23570 2267 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23570 >Feature sequence0784 523 1035 gene locus_tag LOCUS_23580 523 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 1093 1761 gene locus_tag LOCUS_23590 1093 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 <2421 1866 gene locus_tag LOCUS_23600 <2421 1866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249195.1:arginase >Feature sequence0785 2417 102 gene locus_tag LOCUS_23610 2417 102 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124011.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence0786 953 246 gene locus_tag LOCUS_23620 953 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 1551 958 gene locus_tag LOCUS_23630 1551 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 2057 1683 gene locus_tag LOCUS_23640 2057 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119559.1 protein_id gnl|my_center|LOCUS_23640 2238 2101 gene locus_tag LOCUS_23650 2238 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence0787 1185 217 gene locus_tag LOCUS_23660 1185 217 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_23660 1290 2042 gene locus_tag LOCUS_23670 1290 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence0788 394 185 gene locus_tag LOCUS_23680 394 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 429 1403 gene locus_tag LOCUS_23690 429 1403 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329841.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence0789 >Feature sequence0790 760 2016 gene locus_tag LOCUS_23700 760 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence0791 868 284 gene locus_tag LOCUS_23710 868 284 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403206.1 protein_id gnl|my_center|LOCUS_23710 1115 1843 gene locus_tag LOCUS_23720 gene pepE 1115 1843 CDS product dipeptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_23720 1972 2301 gene locus_tag LOCUS_23730 1972 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence0792 >Feature sequence0793 >Feature sequence0794 >Feature sequence0795 >Feature sequence0796 2002 1142 gene locus_tag LOCUS_23740 2002 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence0797 <2385 539 gene locus_tag LOCUS_23750 <2385 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870144.1:ATP-dependent Clp protease ATP-binding subunit ClpC >Feature sequence0798 <2383 946 gene locus_tag LOCUS_23760 <2383 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403159.1:carboxypeptidase >Feature sequence0799 316 23 gene locus_tag LOCUS_23770 316 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 967 536 gene locus_tag LOCUS_23780 967 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence0800 1023 1166 gene locus_tag LOCUS_23790 1023 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 1619 1302 gene locus_tag LOCUS_23800 1619 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence0801 >Feature sequence0802 220 1527 gene locus_tag LOCUS_23810 220 1527 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119140.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence0803 1546 1337 gene locus_tag LOCUS_23820 1546 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2078 1608 gene locus_tag LOCUS_23830 2078 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence0804 >Feature sequence0805 927 52 gene locus_tag LOCUS_23840 927 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 1832 969 gene locus_tag LOCUS_23850 gene rfbA 1832 969 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C714 protein_id gnl|my_center|LOCUS_23850 <2373 1829 gene locus_tag LOCUS_23860 <2373 1829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FYI2:dTDP-glucose 4,6-dehydratase >Feature sequence0806 >Feature sequence0807 693 1046 gene locus_tag LOCUS_23870 693 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 1067 2107 gene locus_tag LOCUS_23880 1067 2107 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731536.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence0808 557 420 gene locus_tag LOCUS_23890 557 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 872 1486 gene locus_tag LOCUS_23900 872 1486 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120394.1 protein_id gnl|my_center|LOCUS_23900 >Feature sequence0809 688 338 gene locus_tag LOCUS_23910 gene rplS 688 338 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI13 protein_id gnl|my_center|LOCUS_23910 1040 2245 gene locus_tag LOCUS_23920 1040 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence0810 1023 64 gene locus_tag LOCUS_23930 1023 64 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227675.1 protein_id gnl|my_center|LOCUS_23930 1163 1090 gene locus_tag LOCUS_t00490 1163 1090 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1618 1424 gene locus_tag LOCUS_23940 gene csrA 1618 1424 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG38 protein_id gnl|my_center|LOCUS_23940 >Feature sequence0811 >Feature sequence0812 2076 1240 gene locus_tag LOCUS_23950 gene rsmH 2076 1240 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFX8 protein_id gnl|my_center|LOCUS_23950 >Feature sequence0813 192 695 gene locus_tag LOCUS_23960 gene tadA 192 695 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIP0 protein_id gnl|my_center|LOCUS_23960 825 1214 gene locus_tag LOCUS_23970 gene speH 825 1214 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66615 protein_id gnl|my_center|LOCUS_23970 >Feature sequence0814 <2348 1422 gene locus_tag LOCUS_23980 <2348 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120391.1:lipolytic enzyme >Feature sequence0815 1663 737 gene locus_tag LOCUS_23990 1663 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 <2347 1712 gene locus_tag LOCUS_24000 <2347 1712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RD00:hercynine oxygenase >Feature sequence0816 <1 539 gene locus_tag LOCUS_24010 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118691.1:alpha-amylase 511 2064 gene locus_tag LOCUS_24020 511 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence0817 126 941 gene locus_tag LOCUS_24030 126 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 protein_id gnl|my_center|LOCUS_24030 1469 957 gene locus_tag LOCUS_24040 1469 957 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328411.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence0818 544 1608 gene locus_tag LOCUS_24050 544 1608 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_24050 1631 2050 gene locus_tag LOCUS_24060 1631 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence0819 >Feature sequence0820 >Feature sequence0821 2330 1269 gene locus_tag LOCUS_24070 2330 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence0822 >Feature sequence0823 1042 1761 gene locus_tag LOCUS_24080 1042 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532419.1 protein_id gnl|my_center|LOCUS_24080 >Feature sequence0824 61 1383 gene locus_tag LOCUS_24090 61 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence0825 368 1441 gene locus_tag LOCUS_24100 368 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 >Feature sequence0826 <2325 47 gene locus_tag LOCUS_24110 <2325 47 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UMV5:DNA topoisomerase 1 >Feature sequence0827 492 1004 gene locus_tag LOCUS_24120 492 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 <2325 1074 gene locus_tag LOCUS_24130 <2325 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UWI5:protein translocase subunit SecA 2 >Feature sequence0828 692 1627 gene locus_tag LOCUS_24140 gene ispH 692 1627 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULU1 protein_id gnl|my_center|LOCUS_24140 <2324 1660 gene locus_tag LOCUS_24150 <2324 1660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121268.1:glycosyl hydrolase >Feature sequence0829 455 1420 gene locus_tag LOCUS_24160 gene mntA 455 1420 CDS product manganese-binding lipoprotein MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34385 protein_id gnl|my_center|LOCUS_24160 1441 2211 gene locus_tag LOCUS_24170 gene troB 1441 2211 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_24170 >Feature sequence0830 983 297 gene locus_tag LOCUS_24180 983 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 1336 1154 gene locus_tag LOCUS_24190 1336 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 1731 1396 gene locus_tag LOCUS_24200 1731 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence0831 <1 1059 gene locus_tag LOCUS_24210 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120681.1:sulfatase <2322 1179 gene locus_tag LOCUS_24220 <2322 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UJ58:carbamoyl-phosphate synthase large chain >Feature sequence0832 >Feature sequence0833 962 1381 gene locus_tag LOCUS_24230 962 1381 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731162.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence0834 >Feature sequence0835 >Feature sequence0836 436 128 gene locus_tag LOCUS_24240 436 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 1223 639 gene locus_tag LOCUS_24250 1223 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 2230 1259 gene locus_tag LOCUS_24260 2230 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence0837 1953 1249 gene locus_tag LOCUS_24270 1953 1249 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120144.1 protein_id gnl|my_center|LOCUS_24270 >Feature sequence0838 1071 661 gene locus_tag LOCUS_24280 1071 661 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089880.1 protein_id gnl|my_center|LOCUS_24280 <2295 1091 gene locus_tag LOCUS_24290 <2295 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122941.1:membrane protein >Feature sequence0839 1362 625 gene locus_tag LOCUS_24300 1362 625 CDS product dolichyl-phosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_24300 2286 1498 gene locus_tag LOCUS_24310 2286 1498 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UDY5 protein_id gnl|my_center|LOCUS_24310 >Feature sequence0840 <1 1286 gene locus_tag LOCUS_24320 <1 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121650.1:anthranilate synthase component I <2288 1283 gene locus_tag LOCUS_24330 <2288 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124073.1:lipase >Feature sequence0841 2019 1408 gene locus_tag LOCUS_24340 2019 1408 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119026.1 protein_id gnl|my_center|LOCUS_24340 >Feature sequence0842 1688 834 gene locus_tag LOCUS_24350 1688 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence0843 <1 1030 gene locus_tag LOCUS_24360 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537635.1:terminase 1075 1416 gene locus_tag LOCUS_24370 1075 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 1428 1760 gene locus_tag LOCUS_24380 1428 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 1760 2125 gene locus_tag LOCUS_24390 1760 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence0844 809 1954 gene locus_tag LOCUS_24400 809 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence0845 >Feature sequence0846 <2273 958 gene locus_tag LOCUS_24410 <2273 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405453.1:glutaminyl-tRNA synthetase >Feature sequence0847 <1 1572 gene locus_tag LOCUS_24420 <1 1572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120234.1:protein kinase >Feature sequence0848 156 902 gene locus_tag LOCUS_24430 gene paaG 156 902 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_24430 1007 1912 gene locus_tag LOCUS_24440 1007 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence0849 164 901 gene locus_tag LOCUS_24450 164 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 915 1463 gene locus_tag LOCUS_24460 915 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 1777 1562 gene locus_tag LOCUS_24470 1777 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2063 1734 gene locus_tag LOCUS_24480 gene atl1 2063 1734 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207466.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence0850 <1 597 gene locus_tag LOCUS_24490 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0E0Y6H7:4-hydroxy-2-oxovalerate aldolase 581 1345 gene locus_tag LOCUS_24500 581 1345 CDS product 4-oxalocrotonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230345.1 protein_id gnl|my_center|LOCUS_24500 1829 1587 gene locus_tag LOCUS_24510 1829 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 1897 2211 gene locus_tag LOCUS_24520 1897 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence0851 <2259 1581 gene locus_tag LOCUS_24530 <2259 1581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121670.1:sodium/hydrogen exchanger >Feature sequence0852 >Feature sequence0853 <1 569 gene locus_tag LOCUS_24540 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UEU9:glycine--tRNA ligase >Feature sequence0854 >Feature sequence0855 209 739 gene locus_tag LOCUS_24550 209 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 947 1426 gene locus_tag LOCUS_24560 947 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence0856 <1 644 gene locus_tag LOCUS_24570 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121414.1:L-proline 4-hydroxylase 748 1272 gene locus_tag LOCUS_24580 gene kdsC 748 1272 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence0857 362 1525 gene locus_tag LOCUS_24590 362 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence0858 >Feature sequence0859 1384 1094 gene locus_tag LOCUS_24600 1384 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 >Feature sequence0860 >Feature sequence0861 54 551 gene locus_tag LOCUS_24610 54 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24610 601 957 gene locus_tag LOCUS_24620 601 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 1043 1600 gene locus_tag LOCUS_24630 gene yfiT 1043 1600 CDS product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 protein_id gnl|my_center|LOCUS_24630 <2228 1605 gene locus_tag LOCUS_24640 <2228 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121082.1:peptide synthase >Feature sequence0862 >Feature sequence0863 560 832 gene locus_tag LOCUS_24650 560 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 869 1312 gene locus_tag LOCUS_24660 869 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2193 2053 gene locus_tag LOCUS_24670 2193 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence0864 <1 1575 gene locus_tag LOCUS_24680 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UNF9:glutamate--tRNA ligase >Feature sequence0865 525 1280 gene locus_tag LOCUS_24690 525 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 1370 1804 gene locus_tag LOCUS_24700 1370 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence0866 781 107 gene locus_tag LOCUS_24710 781 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 894 1037 gene locus_tag LOCUS_24720 894 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence0867 1401 1760 gene locus_tag LOCUS_24730 1401 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence0868 <1 593 gene locus_tag LOCUS_24740 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072704.1:asparagine synthase B 1585 623 gene locus_tag LOCUS_24750 1585 623 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence0869 >Feature sequence0870 >Feature sequence0871 90 596 gene locus_tag LOCUS_24760 90 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1819 656 gene locus_tag LOCUS_24770 1819 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124068.1 protein_id gnl|my_center|LOCUS_24770 >Feature sequence0872 <1 1564 gene locus_tag LOCUS_24780 <1 1564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106682.1:type II secretion system protein GspD >Feature sequence0873 1710 619 gene locus_tag LOCUS_24790 1710 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence0874 >Feature sequence0875 62 955 gene locus_tag LOCUS_24800 gene atpG 62 955 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFB6 protein_id gnl|my_center|LOCUS_24800 >Feature sequence0876 1901 942 gene locus_tag LOCUS_24810 gene fcl 1901 942 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVN0 protein_id gnl|my_center|LOCUS_24810 >Feature sequence0877 532 891 gene locus_tag LOCUS_24820 532 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence0878 >Feature sequence0879 >Feature sequence0880 >Feature sequence0881 2197 1682 gene locus_tag LOCUS_24830 2197 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 >Feature sequence0882 886 266 gene locus_tag LOCUS_24840 886 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 1544 942 gene locus_tag LOCUS_24850 1544 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119419.1 protein_id gnl|my_center|LOCUS_24850 1771 1544 gene locus_tag LOCUS_24860 1771 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence0883 511 1308 gene locus_tag LOCUS_24870 gene recO 511 1308 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USC2 protein_id gnl|my_center|LOCUS_24870 >Feature sequence0884 1098 1445 gene locus_tag LOCUS_24880 1098 1445 CDS product ATP-dependent Clp protease ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329331.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence0885 1769 903 gene locus_tag LOCUS_24890 gene lpxA 1769 903 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGZ1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence0886 1433 1858 gene locus_tag LOCUS_24900 1433 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence0887 1613 324 gene locus_tag LOCUS_24910 gene pgi 1613 324 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYT0 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24910 1814 1635 gene locus_tag LOCUS_24920 1814 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence0888 654 409 gene locus_tag LOCUS_24930 654 409 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 protein_id gnl|my_center|LOCUS_24930 1997 651 gene locus_tag LOCUS_24940 1997 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence0889 523 1866 gene locus_tag LOCUS_24950 523 1866 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119058.1 protein_id gnl|my_center|LOCUS_24950 >Feature sequence0890 <1 851 gene locus_tag LOCUS_24960 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038230.1:conjugal transfer protein TraG >Feature sequence0891 558 884 gene locus_tag LOCUS_24970 558 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 1397 1041 gene locus_tag LOCUS_24980 1397 1041 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119294.1 protein_id gnl|my_center|LOCUS_24980 1567 2097 gene locus_tag LOCUS_24990 1567 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence0892 <1 1382 gene locus_tag LOCUS_25000 <1 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:RNA-binding protein 1706 1828 gene locus_tag LOCUS_25010 1706 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence0893 <2165 1065 gene locus_tag LOCUS_25020 <2165 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7ULT9:glycogen operon protein GlgX homolog >Feature sequence0894 >Feature sequence0895 217 939 gene locus_tag LOCUS_25030 217 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 1123 1689 gene locus_tag LOCUS_25040 1123 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 1670 2062 gene locus_tag LOCUS_25050 1670 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence0896 870 352 gene locus_tag LOCUS_25060 gene smpB 870 352 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH38 protein_id gnl|my_center|LOCUS_25060 1180 2034 gene locus_tag LOCUS_25070 gene lipA 1180 2034 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH37 protein_id gnl|my_center|LOCUS_25070 >Feature sequence0897 1348 551 gene locus_tag LOCUS_25080 1348 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 1570 1806 gene locus_tag LOCUS_25090 1570 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence0898 >Feature sequence0899 >Feature sequence0900 1256 444 gene locus_tag LOCUS_25100 gene accD 1256 444 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UHX0 protein_id gnl|my_center|LOCUS_25100 2120 1422 gene locus_tag LOCUS_25110 gene rpe 2120 1422 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX51 protein_id gnl|my_center|LOCUS_25110 >Feature sequence0901 590 1234 gene locus_tag LOCUS_25120 gene trmB 590 1234 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN36 protein_id gnl|my_center|LOCUS_25120 1661 1269 gene locus_tag LOCUS_25130 1661 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence0902 <1 864 gene locus_tag LOCUS_25140 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117793.1:acetylglucosamine-6-sulfatase >Feature sequence0903 559 254 gene locus_tag LOCUS_25150 559 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1071 1748 gene locus_tag LOCUS_25160 1071 1748 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence0904 1311 1793 gene locus_tag LOCUS_25170 1311 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence0905 <1 992 gene locus_tag LOCUS_25180 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122950.1:ring finger protein HAC1 1105 2088 gene locus_tag LOCUS_25190 1105 2088 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329644.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence0906 <2141 539 gene locus_tag LOCUS_25200 <2141 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URV2:elongation factor G >Feature sequence0907 <1 612 gene locus_tag LOCUS_25210 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065118.1:low-specificity L-threonine aldolase 1098 625 gene locus_tag LOCUS_25220 1098 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 1877 1353 gene locus_tag LOCUS_25230 1877 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence0908 <1 902 gene locus_tag LOCUS_25240 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861639.1:sporulation protein 1261 977 gene locus_tag LOCUS_25250 1261 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence0909 815 1633 gene locus_tag LOCUS_25260 gene parA 815 1633 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_25260 1840 1658 gene locus_tag LOCUS_25270 1840 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 >Feature sequence0910 1 123 gene locus_tag LOCUS_25280 1 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 1035 166 gene locus_tag LOCUS_25290 gene rmlD 1035 166 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_25290 <2124 1049 gene locus_tag LOCUS_25300 <2124 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024331.1:glycosyl transferase family A >Feature sequence0911 <2122 1384 gene locus_tag LOCUS_25310 <2122 1384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YHM2:histidinol dehydrogenase >Feature sequence0912 364 1737 gene locus_tag LOCUS_25320 364 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545401.1 protein_id gnl|my_center|LOCUS_25320 >Feature sequence0913 606 1790 gene locus_tag LOCUS_25330 606 1790 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence0914 1277 114 gene locus_tag LOCUS_25340 1277 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 <2118 1277 gene locus_tag LOCUS_25350 <2118 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546506.1:mannosyltransferase >Feature sequence0915 613 1428 gene locus_tag LOCUS_25360 613 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 <2117 1435 gene locus_tag LOCUS_25370 <2117 1435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18CS8:aspartate carbamoyltransferase >Feature sequence0916 955 200 gene locus_tag LOCUS_25380 955 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 1912 1985 gene locus_tag LOCUS_t00500 1912 1985 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0917 1079 666 gene locus_tag LOCUS_25390 gene rplL 1079 666 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UI01 protein_id gnl|my_center|LOCUS_25390 1744 1223 gene locus_tag LOCUS_25400 gene rplJ 1744 1223 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324458.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence0918 307 933 gene locus_tag LOCUS_25410 gene sigY 307 933 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence0919 886 302 gene locus_tag LOCUS_25420 886 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120998.1 protein_id gnl|my_center|LOCUS_25420 >Feature sequence0920 <1 638 gene locus_tag LOCUS_25430 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121613.1:lysophospholipase 2035 779 gene locus_tag LOCUS_25440 gene dadA 2035 779 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120365.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence0921 1524 907 gene locus_tag LOCUS_25450 gene rpoE 1524 907 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339513.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence0922 <1 1097 gene locus_tag LOCUS_25460 <1 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122408.1:N-acetylgalactosamine-6-sulfatase 1140 1565 gene locus_tag LOCUS_25470 1140 1565 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057535.1 protein_id gnl|my_center|LOCUS_25470 1587 2042 gene locus_tag LOCUS_25480 1587 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108259.1 protein_id gnl|my_center|LOCUS_25480 >Feature sequence0923 >Feature sequence0924 <2105 394 gene locus_tag LOCUS_25490 <2105 394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868080.1:aldehyde ferredoxin oxidoreductase >Feature sequence0925 1829 873 gene locus_tag LOCUS_25500 1829 873 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120303.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence0926 1939 1649 gene locus_tag LOCUS_25510 1939 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence0927 991 218 gene locus_tag LOCUS_25520 gene natA 991 218 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence0928 1 1578 gene locus_tag LOCUS_25530 1 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 2052 1681 gene locus_tag LOCUS_25540 2052 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence0929 1944 304 gene locus_tag LOCUS_25550 gene fadD4 1944 304 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068817.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence0930 >Feature sequence0931 >Feature sequence0932 >Feature sequence0933 490 53 gene locus_tag LOCUS_25560 490 53 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 protein_id gnl|my_center|LOCUS_25560 1304 591 gene locus_tag LOCUS_25570 1304 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 >Feature sequence0934 617 303 gene locus_tag LOCUS_25580 617 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 1371 985 gene locus_tag LOCUS_25590 1371 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 1516 1385 gene locus_tag LOCUS_25600 1516 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 >Feature sequence0935 >Feature sequence0936 439 726 gene locus_tag LOCUS_25610 439 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence0937 1008 610 gene locus_tag LOCUS_25620 1008 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 <2087 1043 gene locus_tag LOCUS_25630 <2087 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UIK1:GTP cyclohydrolase-2 >Feature sequence0938 651 1148 gene locus_tag LOCUS_25640 651 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence0939 63 1277 gene locus_tag LOCUS_25650 63 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 >Feature sequence0940 1021 311 gene locus_tag LOCUS_25660 1021 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 <2078 1380 gene locus_tag LOCUS_25670 <2078 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121464.1:lipoate--protein ligase >Feature sequence0941 >Feature sequence0942 <1 1365 gene locus_tag LOCUS_25680 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121109.1:9-O-acetylesterase >Feature sequence0943 126 1841 gene locus_tag LOCUS_25690 126 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence0944 1435 1013 gene locus_tag LOCUS_25700 1435 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329468.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence0945 928 1890 gene locus_tag LOCUS_25710 928 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence0946 1699 1941 gene locus_tag LOCUS_25720 1699 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence0947 1991 1197 gene locus_tag LOCUS_25730 1991 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 >Feature sequence0948 2057 1062 gene locus_tag LOCUS_25740 2057 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence0949 <2058 172 gene locus_tag LOCUS_25750 <2058 172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007339018.1:acyl-[ACP]--phospholipid O-acyltransferase >Feature sequence0950 1961 960 gene locus_tag LOCUS_25760 gene degP 1961 960 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121356.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence0951 1875 259 gene locus_tag LOCUS_25770 1875 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence0952 >Feature sequence0953 702 1880 gene locus_tag LOCUS_25780 gene hppD 702 1880 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810913.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence0954 949 1584 gene locus_tag LOCUS_25790 949 1584 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121754.1 protein_id gnl|my_center|LOCUS_25790 1615 1782 gene locus_tag LOCUS_25800 1615 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence0955 1040 1393 gene locus_tag LOCUS_25810 1040 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence0956 >Feature sequence0957 1600 1223 gene locus_tag LOCUS_25820 1600 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence0958 >Feature sequence0959 >Feature sequence0960 >Feature sequence0961 <1 907 gene locus_tag LOCUS_25830 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WDI1:dihydroorotate dehydrogenase (quinone) >Feature sequence0962 276 1226 gene locus_tag LOCUS_25840 gene pta 276 1226 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887455.1 protein_id gnl|my_center|LOCUS_25840 2035 1223 gene locus_tag LOCUS_25850 2035 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence0963 >Feature sequence0964 807 1997 gene locus_tag LOCUS_25860 807 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence0965 >Feature sequence0966 1666 359 gene locus_tag LOCUS_25870 gene hemN 1666 359 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120944.1 protein_id gnl|my_center|LOCUS_25870 >Feature sequence0967 1359 289 gene locus_tag LOCUS_25880 1359 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence0968 >Feature sequence0969 717 328 gene locus_tag LOCUS_25890 717 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 1915 1250 gene locus_tag LOCUS_25900 1915 1250 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118951.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence0970 648 1421 gene locus_tag LOCUS_25910 648 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 <2018 1424 gene locus_tag LOCUS_25920 <2018 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121087.1:sulfatase >Feature sequence0971 <1 961 gene locus_tag LOCUS_25930 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803778.1:dehydrogenase 970 1608 gene locus_tag LOCUS_25940 970 1608 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868278.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence0972 812 468 gene locus_tag LOCUS_25950 812 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 1691 816 gene locus_tag LOCUS_25960 1691 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 1942 1691 gene locus_tag LOCUS_25970 1942 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence0973 1808 486 gene locus_tag LOCUS_25980 gene rho 1808 486 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMK2 protein_id gnl|my_center|LOCUS_25980 >Feature sequence0974 >Feature sequence0975 1037 234 gene locus_tag LOCUS_25990 1037 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 1747 1674 gene locus_tag LOCUS_t00510 1747 1674 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0976 >Feature sequence0977 656 216 gene locus_tag LOCUS_26000 656 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 1257 742 gene locus_tag LOCUS_26010 1257 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 >Feature sequence0978 >Feature sequence0979 574 1272 gene locus_tag LOCUS_26020 574 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1358 1597 gene locus_tag LOCUS_26030 1358 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence0980 <1 1013 gene locus_tag LOCUS_26040 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118478.1:diguanylate cyclase >Feature sequence0981 416 84 gene locus_tag LOCUS_26050 416 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence0982 426 1037 gene locus_tag LOCUS_26060 gene ydeI 426 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 protein_id gnl|my_center|LOCUS_26060 1146 1715 gene locus_tag LOCUS_26070 1146 1715 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_26070 1995 1843 gene locus_tag LOCUS_26080 1995 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence0983 <1 970 gene locus_tag LOCUS_26090 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9L232:2-amino-3-ketobutyrate coenzyme A ligase >Feature sequence0984 425 778 gene locus_tag LOCUS_26100 425 778 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948308.1 protein_id gnl|my_center|LOCUS_26100 967 1206 gene locus_tag LOCUS_26110 967 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 1977 1297 gene locus_tag LOCUS_26120 1977 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence0985 1624 680 gene locus_tag LOCUS_26130 1624 680 CDS product protein BmrU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120987.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence0986 <1 776 gene locus_tag LOCUS_26140 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122153.1:acetylornithine deacetylase 878 1312 gene locus_tag LOCUS_26150 gene argA 878 1312 CDS product N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121908.1 protein_id gnl|my_center|LOCUS_26150 <1991 1338 gene locus_tag LOCUS_26160 <1991 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120004.1:aminotransferase >Feature sequence0987 >Feature sequence0988 >Feature sequence0989 712 371 gene locus_tag LOCUS_26170 712 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence0990 >Feature sequence0991 627 1172 gene locus_tag LOCUS_26180 627 1172 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119848.1 protein_id gnl|my_center|LOCUS_26180 1169 1714 gene locus_tag LOCUS_26190 1169 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence0992 225 464 gene locus_tag LOCUS_26200 225 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 457 1905 gene locus_tag LOCUS_26210 457 1905 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118987.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence0993 1609 470 gene locus_tag LOCUS_26220 gene rsgA 1609 470 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUZ6 protein_id gnl|my_center|LOCUS_26220 >Feature sequence0994 <1 789 gene locus_tag LOCUS_26230 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121858.1:peptidyl-prolyl cis-trans isomerase 789 1943 gene locus_tag LOCUS_26240 789 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence0995 215 9 gene locus_tag LOCUS_26250 gene rpmI 215 9 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP72 protein_id gnl|my_center|LOCUS_26250 751 389 gene locus_tag LOCUS_26260 751 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 1323 1487 gene locus_tag LOCUS_26270 1323 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence0996 482 1717 gene locus_tag LOCUS_26280 482 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 >Feature sequence0997 1311 1601 gene locus_tag LOCUS_26290 1311 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 >Feature sequence0998 826 1857 gene locus_tag LOCUS_26300 826 1857 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123060.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence0999 1209 1796 gene locus_tag LOCUS_26310 1209 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence1000 1142 567 gene locus_tag LOCUS_26320 1142 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26320 1787 1311 gene locus_tag LOCUS_26330 1787 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 >Feature sequence1001 136 618 gene locus_tag LOCUS_26340 136 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 615 947 gene locus_tag LOCUS_26350 615 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120341.1 protein_id gnl|my_center|LOCUS_26350 <1969 961 gene locus_tag LOCUS_26360 <1969 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120406.1:oxidoreductase >Feature sequence1002 >Feature sequence1003 >Feature sequence1004 >Feature sequence1005 973 521 gene locus_tag LOCUS_26370 973 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 1377 1859 gene locus_tag LOCUS_26380 gene rsfS 1377 1859 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URC6 protein_id gnl|my_center|LOCUS_26380 >Feature sequence1006 260 871 gene locus_tag LOCUS_26390 260 871 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGM3 protein_id gnl|my_center|LOCUS_26390 910 1512 gene locus_tag LOCUS_26400 gene tmk 910 1512 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMF8 protein_id gnl|my_center|LOCUS_26400 >Feature sequence1007 1010 135 gene locus_tag LOCUS_26410 1010 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence1008 >Feature sequence1009 281 709 gene locus_tag LOCUS_26420 281 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence1010 >Feature sequence1011 >Feature sequence1012 315 749 gene locus_tag LOCUS_26430 315 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 902 1426 gene locus_tag LOCUS_26440 902 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 1538 1882 gene locus_tag LOCUS_26450 1538 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216461.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence1013 724 909 gene locus_tag LOCUS_26460 724 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1797 937 gene locus_tag LOCUS_26470 1797 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence1014 909 625 gene locus_tag LOCUS_26480 909 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 1388 1014 gene locus_tag LOCUS_26490 1388 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118130.1 protein_id gnl|my_center|LOCUS_26490 1890 1558 gene locus_tag LOCUS_26500 1890 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 >Feature sequence1015 877 11 gene locus_tag LOCUS_26510 877 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 1693 1034 gene locus_tag LOCUS_26520 1693 1034 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403562.1 protein_id gnl|my_center|LOCUS_26520 >Feature sequence1016 >Feature sequence1017 >Feature sequence1018 1193 411 gene locus_tag LOCUS_26530 gene mqnA 1193 411 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT25 protein_id gnl|my_center|LOCUS_26530 >Feature sequence1019 >Feature sequence1020 975 361 gene locus_tag LOCUS_26540 975 361 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490721.1 protein_id gnl|my_center|LOCUS_26540 1113 1628 gene locus_tag LOCUS_26550 1113 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence1021 >Feature sequence1022 >Feature sequence1023 74 358 gene locus_tag LOCUS_26560 74 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 491 1153 gene locus_tag LOCUS_26570 491 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 1808 1227 gene locus_tag LOCUS_26580 1808 1227 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence1024 1813 794 gene locus_tag LOCUS_26590 1813 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence1025 1737 592 gene locus_tag LOCUS_26600 1737 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence1026 >Feature sequence1027 <1 1910 gene locus_tag LOCUS_26610 <1 1910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975932.1:4-aminobutyrate aminotransferase >Feature sequence1028 89 1756 gene locus_tag LOCUS_26620 89 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence1029 250 101 gene locus_tag LOCUS_26630 250 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 1855 854 gene locus_tag LOCUS_26640 gene dinB 1855 854 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USY7 protein_id gnl|my_center|LOCUS_26640 >Feature sequence1030 >Feature sequence1031 <1 619 gene locus_tag LOCUS_26650 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UNN9:bifunctional protein FolD 840 1742 gene locus_tag LOCUS_26660 gene est 840 1742 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32232 protein_id gnl|my_center|LOCUS_26660 >Feature sequence1032 1796 231 gene locus_tag LOCUS_26670 1796 231 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228459.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence1033 785 426 gene locus_tag LOCUS_26680 785 426 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_26680 >Feature sequence1034 >Feature sequence1035 >Feature sequence1036 717 391 gene locus_tag LOCUS_26690 717 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 1049 732 gene locus_tag LOCUS_26700 1049 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence1037 955 1275 gene locus_tag LOCUS_26710 955 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 1342 1701 gene locus_tag LOCUS_26720 gene groS 1342 1701 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TU13 protein_id gnl|my_center|LOCUS_26720 >Feature sequence1038 >Feature sequence1039 >Feature sequence1040 1611 730 gene locus_tag LOCUS_26730 gene argB 1611 730 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQZ8 protein_id gnl|my_center|LOCUS_26730 >Feature sequence1041 1885 881 gene locus_tag LOCUS_26740 1885 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence1042 406 696 gene locus_tag LOCUS_26750 406 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 706 1800 gene locus_tag LOCUS_26760 706 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 >Feature sequence1043 >Feature sequence1044 173 1171 gene locus_tag LOCUS_26770 173 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118488.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence1045 <1 897 gene locus_tag LOCUS_26780 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948559.1:L-asparaginase 1 >Feature sequence1046 >Feature sequence1047 512 712 gene locus_tag LOCUS_26790 512 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence1048 >Feature sequence1049 >Feature sequence1050 <1 1379 gene locus_tag LOCUS_26800 <1 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:cytochrome c >Feature sequence1051 >Feature sequence1052 486 710 gene locus_tag LOCUS_26810 486 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 >Feature sequence1053 179 913 gene locus_tag LOCUS_26820 179 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144072.1 protein_id gnl|my_center|LOCUS_26820 1302 928 gene locus_tag LOCUS_26830 1302 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence1054 964 560 gene locus_tag LOCUS_26840 gene rpsF 964 560 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKV1 protein_id gnl|my_center|LOCUS_26840 <1858 1142 gene locus_tag LOCUS_26850 <1858 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UKV0:peptidyl-tRNA hydrolase >Feature sequence1055 >Feature sequence1056 <1 877 gene locus_tag LOCUS_26860 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UNW7:tetraacyldisaccharide 4'-kinase 1844 918 gene locus_tag LOCUS_26870 1844 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence1057 762 1259 gene locus_tag LOCUS_26880 gene fae 762 1259 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122706.1 protein_id gnl|my_center|LOCUS_26880 >Feature sequence1058 >Feature sequence1059 570 1841 gene locus_tag LOCUS_26890 gene clpX 570 1841 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKU7 protein_id gnl|my_center|LOCUS_26890 >Feature sequence1060 1219 56 gene locus_tag LOCUS_26900 1219 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence1061 628 1119 gene locus_tag LOCUS_26910 628 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 >Feature sequence1062 >Feature sequence1063 796 362 gene locus_tag LOCUS_26920 796 362 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071322.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence1064 1382 525 gene locus_tag LOCUS_26930 1382 525 CDS product protein-S-isoprenylcysteine O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123158.1 protein_id gnl|my_center|LOCUS_26930 >Feature sequence1065 >Feature sequence1066 >Feature sequence1067 >Feature sequence1068 420 908 gene locus_tag LOCUS_26940 420 908 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_26940 1425 1730 gene locus_tag LOCUS_26950 1425 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 >Feature sequence1069 1204 575 gene locus_tag LOCUS_26960 1204 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030243.1 protein_id gnl|my_center|LOCUS_26960 1384 1593 gene locus_tag LOCUS_26970 1384 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence1070 360 1151 gene locus_tag LOCUS_26980 gene whiG 360 1151 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFV6 protein_id gnl|my_center|LOCUS_26980 >Feature sequence1071 >Feature sequence1072 >Feature sequence1073 1155 1228 gene locus_tag LOCUS_t00520 1155 1228 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1074 1828 440 gene locus_tag LOCUS_26990 1828 440 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence1075 1220 375 gene locus_tag LOCUS_27000 1220 375 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142182.1 protein_id gnl|my_center|LOCUS_27000 <1835 1217 gene locus_tag LOCUS_27010 <1835 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974172.1:SAM-dependent methyltransferase >Feature sequence1076 >Feature sequence1077 1832 717 gene locus_tag LOCUS_27020 1832 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence1078 572 45 gene locus_tag LOCUS_27030 572 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_27030 <1832 654 gene locus_tag LOCUS_27040 <1832 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URP3:methionine--tRNA ligase >Feature sequence1079 774 211 gene locus_tag LOCUS_27050 gene dcd 774 211 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 protein_id gnl|my_center|LOCUS_27050 >Feature sequence1080 1483 914 gene locus_tag LOCUS_27060 1483 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence1081 <1829 1132 gene locus_tag LOCUS_27070 <1829 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P33642:putative D-amino acid oxidase >Feature sequence1082 >Feature sequence1083 439 903 gene locus_tag LOCUS_27080 439 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence1084 1825 1634 gene locus_tag LOCUS_27090 1825 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence1085 <1 1063 gene locus_tag LOCUS_27100 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007337392.1:serine/threonine protein kinase 1060 1770 gene locus_tag LOCUS_27110 gene deoC 1060 1770 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPT7 protein_id gnl|my_center|LOCUS_27110 >Feature sequence1086 >Feature sequence1087 <1 716 gene locus_tag LOCUS_27120 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P59883:tRNA pseudouridine synthase B >Feature sequence1088 1011 151 gene locus_tag LOCUS_27130 1011 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 1526 1173 gene locus_tag LOCUS_27140 1526 1173 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 protein_id gnl|my_center|LOCUS_27140 >Feature sequence1089 >Feature sequence1090 <1 678 gene locus_tag LOCUS_27150 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121265.1:glycosyl transferase family 1 779 1402 gene locus_tag LOCUS_27160 779 1402 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332043.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence1091 >Feature sequence1092 >Feature sequence1093 277 1785 gene locus_tag LOCUS_27170 277 1785 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_27170 >Feature sequence1094 1090 341 gene locus_tag LOCUS_27180 gene guaA 1090 341 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 protein_id gnl|my_center|LOCUS_27180 >Feature sequence1095 1268 468 gene locus_tag LOCUS_27190 1268 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence1096 1658 141 gene locus_tag LOCUS_27200 gene cysS 1658 141 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3T5 protein_id gnl|my_center|LOCUS_27200 >Feature sequence1097 >Feature sequence1098 >Feature sequence1099 302 1090 gene locus_tag LOCUS_27210 302 1090 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence1100 <1801 1233 gene locus_tag LOCUS_27220 <1801 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UK85:enoyl-[acyl-carrier-protein] reductase [NADH] >Feature sequence1101 248 541 gene locus_tag LOCUS_27230 248 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328915.1 protein_id gnl|my_center|LOCUS_27230 1125 757 gene locus_tag LOCUS_27240 1125 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 1650 1201 gene locus_tag LOCUS_27250 1650 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence1102 694 497 gene locus_tag LOCUS_27260 694 497 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_27260 <1799 1003 gene locus_tag LOCUS_27270 <1799 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962811.1:peptidase M28 >Feature sequence1103 45 242 gene locus_tag LOCUS_27280 45 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 846 430 gene locus_tag LOCUS_27290 846 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 987 1619 gene locus_tag LOCUS_27300 987 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence1104 711 1631 gene locus_tag LOCUS_27310 711 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660854.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence1105 1161 616 gene locus_tag LOCUS_27320 1161 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 1756 1205 gene locus_tag LOCUS_27330 1756 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence1106 >Feature sequence1107 <1 845 gene locus_tag LOCUS_27340 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118642.1:serine protease >Feature sequence1108 >Feature sequence1109 <1 805 gene locus_tag LOCUS_27350 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108070.1:hemolysin D >Feature sequence1110 >Feature sequence1111 <1 740 gene locus_tag LOCUS_27360 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402848.1:alpha/beta hydrolase >Feature sequence1112 362 706 gene locus_tag LOCUS_27370 362 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence1113 >Feature sequence1114 459 1598 gene locus_tag LOCUS_27380 459 1598 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546845.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence1115 1361 615 gene locus_tag LOCUS_27390 1361 615 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122635.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence1116 <1 529 gene locus_tag LOCUS_27400 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122587.1:bacillithiol biosynthesis deacetylase BshB1 1592 567 gene locus_tag LOCUS_27410 1592 567 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FH3 protein_id gnl|my_center|LOCUS_27410 >Feature sequence1117 1294 68 gene locus_tag LOCUS_27420 1294 68 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_27420 >Feature sequence1118 885 40 gene locus_tag LOCUS_27430 885 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1200 940 gene locus_tag LOCUS_27440 1200 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 >Feature sequence1119 974 1729 gene locus_tag LOCUS_27450 974 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118676.1 protein_id gnl|my_center|LOCUS_27450 >Feature sequence1120 <1 778 gene locus_tag LOCUS_27460 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122858.1:beta-hydroxylase 896 1588 gene locus_tag LOCUS_27470 gene lolD1 896 1588 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX73 protein_id gnl|my_center|LOCUS_27470 >Feature sequence1121 1123 485 gene locus_tag LOCUS_27480 1123 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 1317 1189 gene locus_tag LOCUS_27490 1317 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence1122 1479 52 gene locus_tag LOCUS_27500 gene lpd 1479 52 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXM8 protein_id gnl|my_center|LOCUS_27500 >Feature sequence1123 <1 566 gene locus_tag LOCUS_27510 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256370.1:hybrid sensor histidine kinase/response regulator 757 1695 gene locus_tag LOCUS_27520 757 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence1124 >Feature sequence1125 50 469 gene locus_tag LOCUS_27530 50 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 497 925 gene locus_tag LOCUS_27540 497 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence1126 <1750 554 gene locus_tag LOCUS_27550 <1750 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120005.1:protein-export membrane protein SecD >Feature sequence1127 605 1312 gene locus_tag LOCUS_27560 605 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence1128 >Feature sequence1129 419 1123 gene locus_tag LOCUS_27570 gene sigE 419 1123 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123154.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence1130 >Feature sequence1131 51 533 gene locus_tag LOCUS_27580 51 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 619 1617 gene locus_tag LOCUS_27590 619 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence1132 1478 30 gene locus_tag LOCUS_27600 1478 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence1133 >Feature sequence1134 451 819 gene locus_tag LOCUS_27610 451 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 >Feature sequence1135 265 465 gene locus_tag LOCUS_27620 265 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 1373 489 gene locus_tag LOCUS_27630 1373 489 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106196.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence1136 <1 875 gene locus_tag LOCUS_27640 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RLU9:UvrABC system protein A >Feature sequence1137 >Feature sequence1138 308 1723 gene locus_tag LOCUS_27650 308 1723 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118427.1 protein_id gnl|my_center|LOCUS_27650 >Feature sequence1139 >Feature sequence1140 >Feature sequence1141 >Feature sequence1142 540 1286 gene locus_tag LOCUS_27660 gene glmU 540 1286 CDS product UDP-N-acetylglucosamine pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121125.1 protein_id gnl|my_center|LOCUS_27660 >Feature sequence1143 1681 23 gene locus_tag LOCUS_27670 1681 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence1144 <1 784 gene locus_tag LOCUS_27680 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123721.1:MFS transporter 803 1090 gene locus_tag LOCUS_27690 803 1090 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence1145 >Feature sequence1146 <1 518 gene locus_tag LOCUS_27700 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458883.1:zinc ABC transporter permease 524 1444 gene locus_tag LOCUS_27710 524 1444 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458884.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence1147 552 878 gene locus_tag LOCUS_27720 gene trx 552 878 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ76 protein_id gnl|my_center|LOCUS_27720 <1717 1176 gene locus_tag LOCUS_27730 <1717 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123406.1:isomerase >Feature sequence1148 1170 256 gene locus_tag LOCUS_27740 1170 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 >Feature sequence1149 >Feature sequence1150 <1 1500 gene locus_tag LOCUS_27750 <1 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941762.1:PAS domain-containing sensor histidine kinase 1615 1487 gene locus_tag LOCUS_27760 1615 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence1151 971 12 gene locus_tag LOCUS_27770 971 12 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_27770 <1711 968 gene locus_tag LOCUS_27780 <1711 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460069.1:membrane protein >Feature sequence1152 >Feature sequence1153 >Feature sequence1154 <1 1103 gene locus_tag LOCUS_27790 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9XAD5:putative cysteine desulfurase >Feature sequence1155 >Feature sequence1156 48 1133 gene locus_tag LOCUS_27800 48 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 >Feature sequence1157 1337 1609 gene locus_tag LOCUS_27810 gene rpoA 1337 1609 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326741.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence1158 667 182 gene locus_tag LOCUS_27820 667 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence1159 1219 1551 gene locus_tag LOCUS_27830 1219 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence1160 553 1593 gene locus_tag LOCUS_27840 553 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 >Feature sequence1161 <1 1063 gene locus_tag LOCUS_27850 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122202.1:peptidase <1702 1074 gene locus_tag LOCUS_27860 <1702 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FPZ4:elongation factor P--(R)-beta-lysine ligase >Feature sequence1162 367 77 gene locus_tag LOCUS_27870 367 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence1163 1462 944 gene locus_tag LOCUS_27880 1462 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 protein_id gnl|my_center|LOCUS_27880 >Feature sequence1164 518 880 gene locus_tag LOCUS_27890 518 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 >Feature sequence1165 844 458 gene locus_tag LOCUS_27900 844 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 >Feature sequence1166 >Feature sequence1167 >Feature sequence1168 1066 77 gene locus_tag LOCUS_27910 1066 77 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_27910 <1676 1079 gene locus_tag LOCUS_27920 <1676 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFW8:riboflavin biosynthesis protein >Feature sequence1169 <1 699 gene locus_tag LOCUS_27930 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117792.1:N-acetylgalactosamine-6-sulfatase 1575 730 gene locus_tag LOCUS_27940 1575 730 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223735.1 protein_id gnl|my_center|LOCUS_27940 >Feature sequence1170 >Feature sequence1171 >Feature sequence1172 >Feature sequence1173 1467 952 gene locus_tag LOCUS_27950 1467 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 >Feature sequence1174 <1668 699 gene locus_tag LOCUS_27960 <1668 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7URM5:1-deoxy-D-xylulose 5-phosphate reductoisomerase >Feature sequence1175 <1 1170 gene locus_tag LOCUS_27970 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815367.1:thiol:disulfide interchange protein >Feature sequence1176 <1666 671 gene locus_tag LOCUS_27980 <1666 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UGJ8:apolipoprotein N-acyltransferase >Feature sequence1177 1352 138 gene locus_tag LOCUS_27990 gene degT 1352 138 CDS product pleiotropic regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118241.1 protein_id gnl|my_center|LOCUS_27990 >Feature sequence1178 96 998 gene locus_tag LOCUS_28000 96 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 <1664 1104 gene locus_tag LOCUS_28010 <1664 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007337813.1:two-component system response regulator >Feature sequence1179 291 1037 gene locus_tag LOCUS_28020 gene pyrH 291 1037 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTH1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence1180 >Feature sequence1181 1397 633 gene locus_tag LOCUS_28030 1397 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence1182 <1 823 gene locus_tag LOCUS_28040 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122223.1:deoxyribodipyrimidine photo-lyase 1183 857 gene locus_tag LOCUS_28050 1183 857 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141520.1 protein_id gnl|my_center|LOCUS_28050 >Feature sequence1183 400 257 gene locus_tag LOCUS_28060 400 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 >Feature sequence1184 693 379 gene locus_tag LOCUS_28070 693 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 1422 958 gene locus_tag LOCUS_28080 1422 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 >Feature sequence1185 >Feature sequence1186 <1 717 gene locus_tag LOCUS_28090 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122962.1:alpha/beta hydrolase 1322 690 gene locus_tag LOCUS_28100 1322 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 >Feature sequence1187 93 728 gene locus_tag LOCUS_28110 93 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence1188 455 1030 gene locus_tag LOCUS_28120 gene regR 455 1030 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083726.1 protein_id gnl|my_center|LOCUS_28120 >Feature sequence1189 >Feature sequence1190 >Feature sequence1191 >Feature sequence1192 >Feature sequence1193 >Feature sequence1194 <1646 723 gene locus_tag LOCUS_28130 <1646 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B5L8:chaperone protein ClpB >Feature sequence1195 962 462 gene locus_tag LOCUS_28140 962 462 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085853.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence1196 >Feature sequence1197 <1 666 gene locus_tag LOCUS_28150 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122274.1:serine protease 1107 700 gene locus_tag LOCUS_28160 gene nusB 1107 700 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USA9 protein_id gnl|my_center|LOCUS_28160 <1642 1120 gene locus_tag LOCUS_28170 <1642 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S3N1:6,7-dimethyl-8-ribityllumazine synthase >Feature sequence1198 >Feature sequence1199 876 1259 gene locus_tag LOCUS_28180 876 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence1200 <1 1492 gene locus_tag LOCUS_28190 <1 1492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121337.1:helicase >Feature sequence1201 <1634 444 gene locus_tag LOCUS_28200 <1634 444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918863.1:peptidyl-prolyl cis-trans isomerase >Feature sequence1202 819 658 gene locus_tag LOCUS_28210 819 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence1203 766 134 gene locus_tag LOCUS_28220 766 134 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186100.1 protein_id gnl|my_center|LOCUS_28220 1584 793 gene locus_tag LOCUS_28230 1584 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 >Feature sequence1204 1276 731 gene locus_tag LOCUS_28240 1276 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 1631 1311 gene locus_tag LOCUS_28250 1631 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 >Feature sequence1205 >Feature sequence1206 900 718 gene locus_tag LOCUS_28260 900 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence1207 >Feature sequence1208 >Feature sequence1209 <1 989 gene locus_tag LOCUS_28270 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q727A5:glutamine--tRNA ligase >Feature sequence1210 >Feature sequence1211 >Feature sequence1212 221 1264 gene locus_tag LOCUS_28280 221 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence1213 >Feature sequence1214 >Feature sequence1215 >Feature sequence1216 >Feature sequence1217 >Feature sequence1218 >Feature sequence1219 671 363 gene locus_tag LOCUS_28290 671 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 >Feature sequence1220 >Feature sequence1221 1281 829 gene locus_tag LOCUS_28300 gene infC 1281 829 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ17 protein_id gnl|my_center|LOCUS_28300 >Feature sequence1222 >Feature sequence1223 >Feature sequence1224 <1 703 gene locus_tag LOCUS_28310 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000805086.1:gamma-glutamyltransferase >Feature sequence1225 >Feature sequence1226 >Feature sequence1227 <1 855 gene locus_tag LOCUS_28320 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103434.1:cyclopropane-fatty-acyl-phospholipid synthase >Feature sequence1228 >Feature sequence1229 >Feature sequence1230 >Feature sequence1231 >Feature sequence1232 >Feature sequence1233 >Feature sequence1234 881 591 gene locus_tag LOCUS_28330 881 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1211 1564 gene locus_tag LOCUS_28340 1211 1564 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120691.1 protein_id gnl|my_center|LOCUS_28340 >Feature sequence1235 >Feature sequence1236 308 565 gene locus_tag LOCUS_28350 308 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 <1576 584 gene locus_tag LOCUS_28360 <1576 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_868623.2:cofactor-independent phosphoglycerate mutase >Feature sequence1237 >Feature sequence1238 >Feature sequence1239 <1 1393 gene locus_tag LOCUS_28370 <1 1393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329503.1:energy-dependent translational throttle protein EttA >Feature sequence1240 >Feature sequence1241 >Feature sequence1242 >Feature sequence1243 >Feature sequence1244 1323 949 gene locus_tag LOCUS_28380 1323 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 >Feature sequence1245 >Feature sequence1246 >Feature sequence1247 1091 543 gene locus_tag LOCUS_28390 1091 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence1248 2 559 gene locus_tag LOCUS_28400 2 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 >Feature sequence1249 <1 690 gene locus_tag LOCUS_28410 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120896.1:PKR inhibitor (translation regulation) 1400 702 gene locus_tag LOCUS_28420 gene map 1400 702 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPN6 protein_id gnl|my_center|LOCUS_28420 >Feature sequence1250 728 135 gene locus_tag LOCUS_28430 728 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence1251 <1558 322 gene locus_tag LOCUS_28440 <1558 322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UXN8:magnesium transporter MgtE >Feature sequence1252 <1 634 gene locus_tag LOCUS_28450 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887159.1:aspartate aminotransferase family protein >Feature sequence1253 457 1107 gene locus_tag LOCUS_28460 457 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence1254 >Feature sequence1255 102 371 gene locus_tag LOCUS_28470 gene acyP 102 371 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ81 protein_id gnl|my_center|LOCUS_28470 >Feature sequence1256 760 188 gene locus_tag LOCUS_28480 760 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 <1550 771 gene locus_tag LOCUS_28490 <1550 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120406.1:oxidoreductase >Feature sequence1257 1087 278 gene locus_tag LOCUS_28500 gene phnP 1087 278 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_28500 >Feature sequence1258 >Feature sequence1259 560 1225 gene locus_tag LOCUS_28510 560 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence1260 <1 1334 gene locus_tag LOCUS_28520 <1 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121745.1:membrane protein >Feature sequence1261 <1 1474 gene locus_tag LOCUS_28530 <1 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120084.1:ABC transporter >Feature sequence1262 >Feature sequence1263 <1 580 gene locus_tag LOCUS_28540 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326673.1:thioredoxin reductase >Feature sequence1264 927 1079 gene locus_tag LOCUS_28550 927 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence1265 551 1543 gene locus_tag LOCUS_28560 551 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 >Feature sequence1266 324 28 gene locus_tag LOCUS_28570 324 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence1267 <1 810 gene locus_tag LOCUS_28580 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UK39:ribosomal protein S12 methylthiotransferase RimO 856 1431 gene locus_tag LOCUS_28590 856 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence1268 722 1216 gene locus_tag LOCUS_28600 722 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence1269 1518 772 gene locus_tag LOCUS_28610 gene pdxJ 1518 772 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGR4 protein_id gnl|my_center|LOCUS_28610 >Feature sequence1270 >Feature sequence1271 >Feature sequence1272 1529 558 gene locus_tag LOCUS_28620 1529 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 >Feature sequence1273 522 217 gene locus_tag LOCUS_28630 522 217 CDS product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118932.1 protein_id gnl|my_center|LOCUS_28630 1187 525 gene locus_tag LOCUS_28640 1187 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 1446 1192 gene locus_tag LOCUS_28650 1446 1192 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118934.1 protein_id gnl|my_center|LOCUS_28650 >Feature sequence1274 <1 732 gene locus_tag LOCUS_28660 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122474.1:DNA repair protein >Feature sequence1275 <1526 173 gene locus_tag LOCUS_28670 <1526 173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UM31:chaperone protein DnaK >Feature sequence1276 >Feature sequence1277 >Feature sequence1278 >Feature sequence1279 1348 191 gene locus_tag LOCUS_28680 1348 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 >Feature sequence1280 129 284 gene locus_tag LOCUS_28690 129 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 866 312 gene locus_tag LOCUS_28700 866 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 >Feature sequence1281 213 1253 gene locus_tag LOCUS_28710 213 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence1282 >Feature sequence1283 1129 1356 gene locus_tag LOCUS_28720 1129 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence1284 >Feature sequence1285 >Feature sequence1286 >Feature sequence1287 >Feature sequence1288 1 636 gene locus_tag LOCUS_28730 1 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 >Feature sequence1289 620 1171 gene locus_tag LOCUS_28740 620 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 1499 1185 gene locus_tag LOCUS_28750 1499 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 >Feature sequence1290 >Feature sequence1291 <1498 540 gene locus_tag LOCUS_28760 <1498 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272631.1:O-acetylhomoserine aminocarboxypropyltransferase >Feature sequence1292 >Feature sequence1293 845 1171 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq catacaagcacgaagcgcaagcgagtg >Feature sequence1294 1 1017 gene locus_tag LOCUS_28770 1 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence1295 >Feature sequence1296 >Feature sequence1297 702 1358 gene locus_tag LOCUS_28780 702 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 >Feature sequence1298 520 317 gene locus_tag LOCUS_28790 520 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence1299 >Feature sequence1300 993 316 gene locus_tag LOCUS_28800 993 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 <1479 962 gene locus_tag LOCUS_28810 <1479 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118528.1:DNA-directed RNA polymerase sigma-70 factor >Feature sequence1301 >Feature sequence1302 277 1086 gene locus_tag LOCUS_28820 277 1086 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333044.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence1303 1123 686 gene locus_tag LOCUS_28830 1123 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 >Feature sequence1304 <1 848 gene locus_tag LOCUS_28840 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B7NS47:tRNA U34 carboxymethyltransferase <1476 898 gene locus_tag LOCUS_28850 <1476 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005308483.1:type II secretion system protein GspG >Feature sequence1305 <1474 419 gene locus_tag LOCUS_28860 <1474 419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFI8:Sec-independent protein translocase protein TatC >Feature sequence1306 >Feature sequence1307 396 1181 gene locus_tag LOCUS_28870 396 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975431.1 protein_id gnl|my_center|LOCUS_28870 >Feature sequence1308 >Feature sequence1309 1006 350 gene locus_tag LOCUS_28880 1006 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 >Feature sequence1310 >Feature sequence1311 468 1370 gene locus_tag LOCUS_28890 468 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 >Feature sequence1312 >Feature sequence1313 1042 320 gene locus_tag LOCUS_28900 1042 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence1314 >Feature sequence1315 661 780 gene locus_tag LOCUS_28910 661 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence1316 >Feature sequence1317 606 364 gene locus_tag LOCUS_28920 606 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 <1458 603 gene locus_tag LOCUS_28930 <1458 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UKY0:ketol-acid reductoisomerase (NADP(+)) >Feature sequence1318 914 1432 gene locus_tag LOCUS_28940 914 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence1319 646 116 gene locus_tag LOCUS_28950 646 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142243.1 protein_id gnl|my_center|LOCUS_28950 >Feature sequence1320 608 994 gene locus_tag LOCUS_28960 608 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 >Feature sequence1321 <1 1236 gene locus_tag LOCUS_28970 <1 1236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UK64:argininosuccinate lyase >Feature sequence1322 498 980 gene locus_tag LOCUS_28980 498 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 >Feature sequence1323 >Feature sequence1324 1118 327 gene locus_tag LOCUS_28990 1118 327 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence1325 >Feature sequence1326 1199 690 gene locus_tag LOCUS_29000 1199 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 >Feature sequence1327 >Feature sequence1328 >Feature sequence1329 1303 56 gene locus_tag LOCUS_29010 1303 56 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124034.1 protein_id gnl|my_center|LOCUS_29010 >Feature sequence1330 >Feature sequence1331 >Feature sequence1332 1110 265 gene locus_tag LOCUS_29020 1110 265 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403407.1 protein_id gnl|my_center|LOCUS_29020 >Feature sequence1333 >Feature sequence1334 44 646 gene locus_tag LOCUS_29030 44 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 >Feature sequence1335 >Feature sequence1336 >Feature sequence1337 1201 827 gene locus_tag LOCUS_29040 1201 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 >Feature sequence1338 <1421 608 gene locus_tag LOCUS_29050 <1421 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118925.1:phosphatase >Feature sequence1339 379 218 gene locus_tag LOCUS_29060 379 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence1340 >Feature sequence1341 602 147 gene locus_tag LOCUS_29070 gene rplM 602 147 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEY3 protein_id gnl|my_center|LOCUS_29070 >Feature sequence1342 446 931 gene locus_tag LOCUS_29080 446 931 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121509.1 protein_id gnl|my_center|LOCUS_29080 1283 1149 gene locus_tag LOCUS_29090 1283 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 >Feature sequence1343 >Feature sequence1344 <1413 351 gene locus_tag LOCUS_29100 <1413 351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023186.1:alanine dehydrogenase >Feature sequence1345 >Feature sequence1346 240 1196 gene locus_tag LOCUS_29110 240 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 >Feature sequence1347 >Feature sequence1348 <1410 894 gene locus_tag LOCUS_29120 <1410 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058287.1:potassium channel protein >Feature sequence1349 <1409 795 gene locus_tag LOCUS_29130 <1409 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202541.1:sialate O-acetylesterase >Feature sequence1350 <1408 379 gene locus_tag LOCUS_29140 <1408 379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937590.1:undecaprenyl-phosphate galactose phosphotransferase WbaP >Feature sequence1351 33 926 gene locus_tag LOCUS_29150 33 926 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120714.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence1352 >Feature sequence1353 829 614 gene locus_tag LOCUS_29160 829 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 >Feature sequence1354 1383 607 gene locus_tag LOCUS_29170 1383 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence1355 >Feature sequence1356 361 1050 gene locus_tag LOCUS_29180 361 1050 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122734.1 protein_id gnl|my_center|LOCUS_29180 >Feature sequence1357 <1 913 gene locus_tag LOCUS_29190 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P61154:tungsten-containing formylmethanofuran dehydrogenase 2 subunit B >Feature sequence1358 <1 683 gene locus_tag LOCUS_29200 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UKT6:5'-nucleotidase SurE 708 1247 gene locus_tag LOCUS_29210 gene mogA 708 1247 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422732.1 protein_id gnl|my_center|LOCUS_29210 >Feature sequence1359 >Feature sequence1360 403 1290 gene locus_tag LOCUS_29220 gene sqdC 403 1290 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120934.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence1361 1018 212 gene locus_tag LOCUS_29230 1018 212 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_29230 >Feature sequence1362 >Feature sequence1363 <1 771 gene locus_tag LOCUS_29240 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121858.1:peptidyl-prolyl cis-trans isomerase >Feature sequence1364 >Feature sequence1365 >Feature sequence1366 >Feature sequence1367 794 1063 gene locus_tag LOCUS_29250 gene rpsO 794 1063 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR97 protein_id gnl|my_center|LOCUS_29250 >Feature sequence1368 >Feature sequence1369 >Feature sequence1370 >Feature sequence1371 265 996 gene locus_tag LOCUS_29260 265 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 >Feature sequence1372 >Feature sequence1373 376 1026 gene locus_tag LOCUS_29270 376 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 >Feature sequence1374 >Feature sequence1375 >Feature sequence1376 >Feature sequence1377 >Feature sequence1378 <1 1033 gene locus_tag LOCUS_29280 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8XAR8:UDP-N-acetylglucosamine 2-epimerase >Feature sequence1379 869 306 gene locus_tag LOCUS_29290 869 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405308.1 protein_id gnl|my_center|LOCUS_29290 >Feature sequence1380 1361 69 gene locus_tag LOCUS_29300 1361 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 >Feature sequence1381 347 1120 gene locus_tag LOCUS_29310 347 1120 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545472.1 protein_id gnl|my_center|LOCUS_29310 >Feature sequence1382 >Feature sequence1383 1029 760 gene locus_tag LOCUS_29320 1029 760 CDS product protein translocase TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328854.1 protein_id gnl|my_center|LOCUS_29320 1282 1082 gene locus_tag LOCUS_29330 1282 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 >Feature sequence1384 <1357 458 gene locus_tag LOCUS_29340 <1357 458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UWB8:NAD kinase >Feature sequence1385 601 74 gene locus_tag LOCUS_29350 601 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 <1357 612 gene locus_tag LOCUS_29360 <1357 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726931.1:fumarate reductase iron-sulfur subunit >Feature sequence1386 >Feature sequence1387 >Feature sequence1388 >Feature sequence1389 1348 989 gene locus_tag LOCUS_29370 1348 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 >Feature sequence1390 953 591 gene locus_tag LOCUS_29380 gene panD 953 591 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM59 protein_id gnl|my_center|LOCUS_29380 >Feature sequence1391 >Feature sequence1392 346 155 gene locus_tag LOCUS_29390 346 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence1393 1035 634 gene locus_tag LOCUS_29400 gene dksA 1035 634 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324538.1 protein_id gnl|my_center|LOCUS_29400 >Feature sequence1394 >Feature sequence1395 <1 667 gene locus_tag LOCUS_29410 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007336577.1:magnesium chelatase >Feature sequence1396 >Feature sequence1397 >Feature sequence1398 115 930 gene locus_tag LOCUS_29420 115 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence1399 474 809 gene locus_tag LOCUS_29430 474 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence1400 <1340 785 gene locus_tag LOCUS_29440 <1340 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122818.1:succinate dehydrogenase flavoprotein subunit >Feature sequence1401 >Feature sequence1402 >Feature sequence1403 <1 945 gene locus_tag LOCUS_29450 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122560.1:mannose-6-phosphate isomerase 1015 1314 gene locus_tag LOCUS_29460 1015 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence1404 1090 104 gene locus_tag LOCUS_29470 1090 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence1405 312 1226 gene locus_tag LOCUS_29480 312 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 >Feature sequence1406 1256 129 gene locus_tag LOCUS_29490 1256 129 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089740.1 protein_id gnl|my_center|LOCUS_29490 >Feature sequence1407 <1332 402 gene locus_tag LOCUS_29500 <1332 402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123543.1:FAD-binding protein >Feature sequence1408 434 1072 gene locus_tag LOCUS_29510 434 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 >Feature sequence1409 646 113 gene locus_tag LOCUS_29520 646 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 <1331 745 gene locus_tag LOCUS_29530 <1331 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122885.1:alanine glycine permease >Feature sequence1410 >Feature sequence1411 >Feature sequence1412 1047 481 gene locus_tag LOCUS_29540 1047 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121374.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence1413 530 84 gene locus_tag LOCUS_29550 530 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 >Feature sequence1414 >Feature sequence1415 893 129 gene locus_tag LOCUS_29560 893 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence1416 >Feature sequence1417 >Feature sequence1418 >Feature sequence1419 >Feature sequence1420 39 857 gene locus_tag LOCUS_29570 39 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 866 1030 gene locus_tag LOCUS_29580 866 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 >Feature sequence1421 >Feature sequence1422 >Feature sequence1423 >Feature sequence1424 <1314 612 gene locus_tag LOCUS_29590 <1314 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122317.1:methyltransferase >Feature sequence1425 >Feature sequence1426 >Feature sequence1427 1307 1053 gene locus_tag LOCUS_29600 1307 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 >Feature sequence1428 <1309 580 gene locus_tag LOCUS_29610 <1309 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963026.1:oligopeptidase B >Feature sequence1429 828 460 gene locus_tag LOCUS_29620 828 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 1288 959 gene locus_tag LOCUS_29630 gene rsbV 1288 959 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D91 protein_id gnl|my_center|LOCUS_29630 >Feature sequence1430 1218 289 gene locus_tag LOCUS_29640 1218 289 CDS product hyalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119128.1 protein_id gnl|my_center|LOCUS_29640 >Feature sequence1431 >Feature sequence1432 <1 699 gene locus_tag LOCUS_29650 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120140.1:ABC transporter ATP-binding protein >Feature sequence1433 >Feature sequence1434 >Feature sequence1435 >Feature sequence1436 >Feature sequence1437 <1304 156 gene locus_tag LOCUS_29660 <1304 156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UIR9:DNA helicase >Feature sequence1438 444 818 gene locus_tag LOCUS_29670 444 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 1000 815 gene locus_tag LOCUS_29680 1000 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 >Feature sequence1439 <1 1052 gene locus_tag LOCUS_29690 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124033.1:monooxygenase >Feature sequence1440 >Feature sequence1441 16 1104 gene locus_tag LOCUS_29700 16 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence1442 >Feature sequence1443 >Feature sequence1444 <1 753 gene locus_tag LOCUS_29710 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UJJ0:protein RecA >Feature sequence1445 1069 1284 gene locus_tag LOCUS_29720 1069 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 >Feature sequence1446 >Feature sequence1447 >Feature sequence1448 >Feature sequence1449 >Feature sequence1450 >Feature sequence1451 >Feature sequence1452 172 768 gene locus_tag LOCUS_29730 gene clpP2 172 768 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK66 protein_id gnl|my_center|LOCUS_29730 >Feature sequence1453 <1289 731 gene locus_tag LOCUS_29740 <1289 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UKD1:DNA ligase >Feature sequence1454 >Feature sequence1455 >Feature sequence1456 1222 767 gene locus_tag LOCUS_29750 1222 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence1457 67 1047 gene locus_tag LOCUS_29760 67 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 >Feature sequence1458 >Feature sequence1459 664 182 gene locus_tag LOCUS_29770 664 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 >Feature sequence1460 <1 711 gene locus_tag LOCUS_29780 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007334279.1:molecular chaperone DnaJ 786 1175 gene locus_tag LOCUS_29790 gene rnpA 786 1175 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNR1 protein_id gnl|my_center|LOCUS_29790 >Feature sequence1461 342 431 gene locus_tag LOCUS_t00530 342 431 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1279 638 gene locus_tag LOCUS_29800 1279 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 >Feature sequence1462 >Feature sequence1463 375 1238 gene locus_tag LOCUS_29810 375 1238 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080741.1 protein_id gnl|my_center|LOCUS_29810 >Feature sequence1464 >Feature sequence1465 <1 600 gene locus_tag LOCUS_29820 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002656852.1:serine protease >Feature sequence1466 110 1060 gene locus_tag LOCUS_29830 110 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 >Feature sequence1467 530 1138 gene locus_tag LOCUS_29840 530 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 >Feature sequence1468 703 287 gene locus_tag LOCUS_29850 703 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29850 <1267 755 gene locus_tag LOCUS_29860 <1267 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122606.1:ABC transporter ATP-binding protein note possible pseudo, internal stop codon >Feature sequence1469 >Feature sequence1470 447 223 gene locus_tag LOCUS_29870 447 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 <1266 456 gene locus_tag LOCUS_29880 <1266 456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UT69:GTP 3',8-cyclase >Feature sequence1471 600 52 gene locus_tag LOCUS_29890 600 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29890 929 1138 gene locus_tag LOCUS_29900 929 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 >Feature sequence1472 518 877 gene locus_tag LOCUS_29910 518 877 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 protein_id gnl|my_center|LOCUS_29910 >Feature sequence1473 >Feature sequence1474 1064 150 gene locus_tag LOCUS_29920 1064 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 1257 1102 gene locus_tag LOCUS_29930 1257 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence1475 >Feature sequence1476 <1253 488 gene locus_tag LOCUS_29940 <1253 488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121033.1:flotillin family protein >Feature sequence1477 >Feature sequence1478 656 1093 gene locus_tag LOCUS_29950 656 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 >Feature sequence1479 462 1139 gene locus_tag LOCUS_29960 462 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 >Feature sequence1480 283 411 gene locus_tag LOCUS_29970 283 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 769 434 gene locus_tag LOCUS_29980 769 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 >Feature sequence1481 >Feature sequence1482 >Feature sequence1483 >Feature sequence1484 >Feature sequence1485 >Feature sequence1486 >Feature sequence1487 373 840 gene locus_tag LOCUS_29990 373 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 1238 906 gene locus_tag LOCUS_30000 1238 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 >Feature sequence1488 <1239 571 gene locus_tag LOCUS_30010 <1239 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403352.1:tungsten formylmethanofuran dehydrogenase subunit E >Feature sequence1489 >Feature sequence1490 >Feature sequence1491 >Feature sequence1492 >Feature sequence1493 <1 511 gene locus_tag LOCUS_30020 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122517.1:endo-inulinase >Feature sequence1494 >Feature sequence1495 >Feature sequence1496 >Feature sequence1497 >Feature sequence1498 >Feature sequence1499 >Feature sequence1500 <1228 74 gene locus_tag LOCUS_30030 <1228 74 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UPR6:DNA helicase >Feature sequence1501 >Feature sequence1502 739 179 gene locus_tag LOCUS_30040 739 179 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_30040 >Feature sequence1503 <1 649 gene locus_tag LOCUS_30050 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104022.1:hydrolase <1226 681 gene locus_tag LOCUS_30060 <1226 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003705.1:sodium:sulfate symporter >Feature sequence1504 456 1154 gene locus_tag LOCUS_30070 456 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 >Feature sequence1505 <1226 659 gene locus_tag LOCUS_30080 <1226 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7TTY8:tRNA (guanine-N(1)-)-methyltransferase >Feature sequence1506 >Feature sequence1507 >Feature sequence1508 >Feature sequence1509 >Feature sequence1510 569 6 gene locus_tag LOCUS_30090 569 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 >Feature sequence1511 >Feature sequence1512 <1217 574 gene locus_tag LOCUS_30100 <1217 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122947.1:ATPase AAA >Feature sequence1513 <1 532 gene locus_tag LOCUS_30110 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073326.1:MexH family multidrug efflux RND transporter periplasmic adaptor subunit >Feature sequence1514 >Feature sequence1515 1132 167 gene locus_tag LOCUS_30120 1132 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119258.1 protein_id gnl|my_center|LOCUS_30120 >Feature sequence1516 1120 206 gene locus_tag LOCUS_30130 1120 206 CDS product manganese ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143301.1 protein_id gnl|my_center|LOCUS_30130 >Feature sequence1517 >Feature sequence1518 >Feature sequence1519 >Feature sequence1520 797 1018 gene locus_tag LOCUS_30140 gene csrA2 797 1018 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CQ8 protein_id gnl|my_center|LOCUS_30140 >Feature sequence1521 179 991 gene locus_tag LOCUS_30150 179 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 >Feature sequence1522 >Feature sequence1523 1178 180 gene locus_tag LOCUS_30160 1178 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence1524 707 93 gene locus_tag LOCUS_30170 707 93 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120874.1 protein_id gnl|my_center|LOCUS_30170 >Feature sequence1525 >Feature sequence1526 652 954 gene locus_tag LOCUS_30180 652 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 >Feature sequence1527 >Feature sequence1528 >Feature sequence1529 >Feature sequence1530 >Feature sequence1531 >Feature sequence1532 <1 533 gene locus_tag LOCUS_30190 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A407:adenosylhomocysteinase >Feature sequence1533 >Feature sequence1534 361 86 gene locus_tag LOCUS_30200 361 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 >Feature sequence1535 >Feature sequence1536 >Feature sequence1537 >Feature sequence1538 <1 876 gene locus_tag LOCUS_30210 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123917.1:3-oxoacyl-ACP synthase III >Feature sequence1539 >Feature sequence1540 >Feature sequence1541 >Feature sequence1542 >Feature sequence1543 >Feature sequence1544 >Feature sequence1545 >Feature sequence1546 >Feature sequence1547 <1186 175 gene locus_tag LOCUS_30220 <1186 175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327631.1:peptide ABC transporter permease >Feature sequence1548 >Feature sequence1549 >Feature sequence1550 >Feature sequence1551 >Feature sequence1552 336 746 gene locus_tag LOCUS_30230 gene acpS 336 746 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQA5 protein_id gnl|my_center|LOCUS_30230 >Feature sequence1553 >Feature sequence1554 >Feature sequence1555 1176 436 gene locus_tag LOCUS_30240 1176 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 >Feature sequence1556 >Feature sequence1557 3 965 gene locus_tag LOCUS_30250 3 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence1558 >Feature sequence1559 3 140 gene locus_tag LOCUS_30260 3 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 300 1151 gene locus_tag LOCUS_30270 300 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 >Feature sequence1560 499 954 gene locus_tag LOCUS_30280 499 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence1561 >Feature sequence1562 <1 1084 gene locus_tag LOCUS_30290 <1 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UFW4:argininosuccinate synthase >Feature sequence1563 >Feature sequence1564 >Feature sequence1565 >Feature sequence1566 >Feature sequence1567 <1164 86 gene locus_tag LOCUS_30300 <1164 86 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121743.1:inter-alpha-trypsin inhibitor heavy chain H2 [precursor] >Feature sequence1568 431 751 gene locus_tag LOCUS_30310 gene rpsJ 431 751 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UN22 protein_id gnl|my_center|LOCUS_30310 >Feature sequence1569 >Feature sequence1570 >Feature sequence1571 1042 263 gene locus_tag LOCUS_30320 1042 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 >Feature sequence1572 >Feature sequence1573 >Feature sequence1574 930 448 gene locus_tag LOCUS_30330 930 448 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120292.1 protein_id gnl|my_center|LOCUS_30330 >Feature sequence1575 <1159 503 gene locus_tag LOCUS_30340 <1159 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074000.1:serine--pyruvate aminotransferase >Feature sequence1576 >Feature sequence1577 >Feature sequence1578 >Feature sequence1579 890 273 gene locus_tag LOCUS_30350 gene tdk 890 273 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C8 protein_id gnl|my_center|LOCUS_30350 1157 915 gene locus_tag LOCUS_30360 1157 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 >Feature sequence1580 >Feature sequence1581 >Feature sequence1582 >Feature sequence1583 >Feature sequence1584 >Feature sequence1585 250 774 gene locus_tag LOCUS_30370 250 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 >Feature sequence1586 >Feature sequence1587 >Feature sequence1588 >Feature sequence1589 <1149 524 gene locus_tag LOCUS_30380 <1149 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118760.1:chromosome partitioning protein ParA >Feature sequence1590 <1 522 gene locus_tag LOCUS_30390 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972845.1:methyltransferase >Feature sequence1591 >Feature sequence1592 537 1019 gene locus_tag LOCUS_30400 537 1019 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332253.1 protein_id gnl|my_center|LOCUS_30400 >Feature sequence1593 >Feature sequence1594 >Feature sequence1595 >Feature sequence1596 >Feature sequence1597 >Feature sequence1598 >Feature sequence1599 >Feature sequence1600 1132 218 gene locus_tag LOCUS_30410 1132 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 >Feature sequence1601 >Feature sequence1602 >Feature sequence1603 >Feature sequence1604 >Feature sequence1605 >Feature sequence1606 53 490 gene locus_tag LOCUS_30420 53 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 >Feature sequence1607 >Feature sequence1608 504 115 gene locus_tag LOCUS_30430 504 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330460.1 protein_id gnl|my_center|LOCUS_30430 >Feature sequence1609 >Feature sequence1610 734 549 gene locus_tag LOCUS_30440 734 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence1611 >Feature sequence1612 >Feature sequence1613 135 788 gene locus_tag LOCUS_30450 gene rrp4 135 788 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101433.1 protein_id gnl|my_center|LOCUS_30450 >Feature sequence1614 >Feature sequence1615 >Feature sequence1616 >Feature sequence1617 2 847 gene locus_tag LOCUS_30460 2 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 >Feature sequence1618 >Feature sequence1619 >Feature sequence1620 <1 766 gene locus_tag LOCUS_30470 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UI51:2-isopropylmalate synthase >Feature sequence1621 422 850 gene locus_tag LOCUS_30480 422 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 1107 847 gene locus_tag LOCUS_30490 1107 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 >Feature sequence1622 >Feature sequence1623 >Feature sequence1624 376 1038 gene locus_tag LOCUS_30500 376 1038 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_30500 >Feature sequence1625 >Feature sequence1626 >Feature sequence1627 221 496 gene locus_tag LOCUS_30510 221 496 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHW4 protein_id gnl|my_center|LOCUS_30510 >Feature sequence1628 499 891 gene locus_tag LOCUS_30520 499 891 CDS product nucleoid-associated protein, YbaB/EbfC family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_30520 >Feature sequence1629 199 867 gene locus_tag LOCUS_30530 199 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30530 >Feature sequence1630 >Feature sequence1631 310 1098 gene locus_tag LOCUS_30540 310 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence1632 >Feature sequence1633 >Feature sequence1634 >Feature sequence1635 >Feature sequence1636 979 140 gene locus_tag LOCUS_30550 979 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 >Feature sequence1637 1090 755 gene locus_tag LOCUS_30560 1090 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 >Feature sequence1638 >Feature sequence1639 >Feature sequence1640 415 38 gene locus_tag LOCUS_30570 415 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 <1089 576 gene locus_tag LOCUS_30580 <1089 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329167.1:UvrB/UvrC protein >Feature sequence1641 <1 1007 gene locus_tag LOCUS_30590 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122596.1:sulfatase >Feature sequence1642 678 97 gene locus_tag LOCUS_30600 678 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 >Feature sequence1643 >Feature sequence1644 >Feature sequence1645 >Feature sequence1646 >Feature sequence1647 203 54 gene locus_tag LOCUS_30610 203 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 >Feature sequence1648 <1082 261 gene locus_tag LOCUS_30620 <1082 261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123343.1:integrase >Feature sequence1649 <1 855 gene locus_tag LOCUS_30630 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119404.1:alkaline phosphatase >Feature sequence1650 >Feature sequence1651 2 214 gene locus_tag LOCUS_30640 2 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 <1079 286 gene locus_tag LOCUS_30650 <1079 286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708577.1:muconate-lactonizing protein >Feature sequence1652 >Feature sequence1653 >Feature sequence1654 >Feature sequence1655 >Feature sequence1656 >Feature sequence1657 >Feature sequence1658 >Feature sequence1659 >Feature sequence1660 696 770 gene locus_tag LOCUS_t00540 696 770 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1661 >Feature sequence1662 >Feature sequence1663 >Feature sequence1664 >Feature sequence1665 >Feature sequence1666 <1057 533 gene locus_tag LOCUS_30660 <1057 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7TTZ4:tRNA-specific 2-thiouridylase MnmA >Feature sequence1667 >Feature sequence1668 >Feature sequence1669 >Feature sequence1670 565 735 gene locus_tag LOCUS_30670 565 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 >Feature sequence1671 >Feature sequence1672 <1 999 gene locus_tag LOCUS_30680 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327172.1:Rho termination factor domain protein >Feature sequence1673 >Feature sequence1674 1046 561 gene locus_tag LOCUS_30690 1046 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 >Feature sequence1675 >Feature sequence1676 716 294 gene locus_tag LOCUS_30700 716 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 >Feature sequence1677 >Feature sequence1678 >Feature sequence1679 >Feature sequence1680 >Feature sequence1681 842 723 gene locus_tag LOCUS_30710 842 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 >Feature sequence1682 >Feature sequence1683 >Feature sequence1684 250 11 gene locus_tag LOCUS_30720 250 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 >Feature sequence1685 347 955 gene locus_tag LOCUS_30730 347 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence1686 >Feature sequence1687 <1037 288 gene locus_tag LOCUS_30740 <1037 288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764544.1:MFS transporter >Feature sequence1688 >Feature sequence1689 >Feature sequence1690 786 544 gene locus_tag LOCUS_30750 786 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 >Feature sequence1691 440 255 gene locus_tag LOCUS_30760 440 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence1692 >Feature sequence1693 817 1032 gene locus_tag LOCUS_30770 817 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 >Feature sequence1694 482 793 gene locus_tag LOCUS_30780 482 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence1695 668 252 gene locus_tag LOCUS_30790 668 252 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918065.1 protein_id gnl|my_center|LOCUS_30790 >Feature sequence1696 >Feature sequence1697 851 177 gene locus_tag LOCUS_30800 gene surE 851 177 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_30800 >Feature sequence1698 >Feature sequence1699 >Feature sequence1700 >Feature sequence1701 <1024 370 gene locus_tag LOCUS_30810 <1024 370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227985.1:2-hydroxy-acid oxidase >Feature sequence1702 >Feature sequence1703 <1023 11 gene locus_tag LOCUS_30820 <1023 11 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S0E1:tricorn protease >Feature sequence1704 >Feature sequence1705 >Feature sequence1706 1017 346 gene locus_tag LOCUS_30830 1017 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence1707 >Feature sequence1708 <1018 458 gene locus_tag LOCUS_30840 <1018 458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123577.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence1709 >Feature sequence1710 >Feature sequence1711 >Feature sequence1712 >Feature sequence1713 >Feature sequence1714 >Feature sequence1715 17 298 gene locus_tag LOCUS_30850 17 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 <1008 299 gene locus_tag LOCUS_30860 <1008 299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122155.1:heme-binding protein >Feature sequence1716 >Feature sequence1717 >Feature sequence1718 >Feature sequence1719 <1 909 gene locus_tag LOCUS_30870 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117765.1:outer membrane channel protein